Использующие нуклеиновые кислоты (C12Q1/68)

Отслеживание патентов класса C12Q1/68
C12Q     Способы измерения или испытания, использующие ферменты или микроорганизмы (иммунологический анализ G01N33/53); составы или индикаторная бумага для них; способы получения подобных составов; контроль за условиями в микробиологических или ферментативных процессах (2824)
C12Q1/68                     Использующие нуклеиновые кислоты(1057)

Способ обнаружения микроделеций в области хромосомы с днк-маркирующим участком // 2610691
Изобретение касается способа обнаружения микроделеций в области хромосомы с ДНК-маркирующим участком. Способ включает выбор области хромосомы с ДНК-маркирующим участком; получение зонда захвата, соответствующего последовательности ДНК в указанной области; гибридизацию зонда захвата со смешанной библиотекой для связывания с последовательностью из множества образцов ДНК из области с ДНК-маркирующим участком; секвенирование захваченной последовательности ДНК из области с ДНК-маркирующим участком для получения данных секвенирования и анализ результатов секвенирования с использованием метода математической статистики с получением результата, показывающего наличие или отсутствие микроделеции в области хромосомы с ДНК-маркирующим участком в каждом из множества образцов ДНК.
Набор олигонуклеотидов для диагностики частых мутаций в гене capn3, ответственном за поясно-конечностную мышечную дистрофию 2а типа // 2610689
Изобретение относится к области биохимии. Предложен набор олигонуклеотидов для детекции мутаций c.598_612del и c.550delA гена CAPN3.

Устройство и способ для автоматического анализа биологических образцов // 2610687
Группа изобретений относится к биотехнологии, в частности к устройству и способу для автоматического анализа биологических образцов, обеспечивающих выполнение всех необходимых операций для анализа биологических образцов в режиме реального времени.
Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых днк-зондов для идентификации рнк энтеровирусов, ротовирусов, вирусов гепатита а и е, аденовирусов, норовирусов и астровирусов из водной среды методом мультиплексной пцр // 2610434
Изобретение относится к наборам олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченых ДНК-зондов для идентификации генетического материала методом мультиплексной ПЦР.

Дифференцировка человеческих эмбриональных стволовых клеток // 2610176
Изобретение относится к биохимии. Описана популяция панкреатических эндокринных клеток, которые соэкспрессируют NKX6.1 и инсулин, и где менее 10% клеток в популяции экспрессируют глюкагон, где популяцию панкреатических эндокринных клеток получают дифференцировкой плюрипотентных стволовых клеток человека, полученных из устойчивых линий эмбриональных стволовых клеток человека, где указанная дифференцировка включает первую стадию культивирования плюрипотентных стволовых клеток в среде, содержащей агонист рецептора TGF-β, выбранный из группы, состоящей из активина А, активина В, TGFβ-I, TGFβ-II, GDF-8 и GDF-11, в концентрации от около 2 нг/мл до 100 нг/мл, и дополнительную стадию культивирования клеток панкреатической эндодермы в среде, содержащей от 20 нМ до 500 нМ (2S,5S)-(Е,Е)-8-(5-(4-(трифторметил)фенил)-2,4-пентадиеноиламино)бензолактам.

Модифицированный вариант гена lacz из e. coli, кодирующий стабилизированный вариант белка, для использования в качестве транскрипционного репортера в yarrowia lipolytica // 2609646
Настоящее изобретение относится к биохимии, в частности к способу модификации гена LacZ из Escherichia coli. Для осуществления способа фрагмент ДНК, содержащий кодирующую область гена LacZ, нарабатывают с помощью полимеразной цепной реакции с использованием олигонуклеотидного праймера, позволяющего ввести дополнительный кодон GGA, кодирующий глицин, непосредственно после инициаторного кодона ATG.

Геномный отбор и секвенирование с помощью кодированных микроносителей // 2609630
Изобретение относится к области биохимии, а именно к способу определения последовательности молекулы нуклеиновой молекулы-мишени.
Способ определения вероятности рецидивирования рака молочной железы // 2609199
Изобретение относится к области медицины. Предложен способ определения вероятности рецидивирования рака молочной железы у субъекта - млекопитающего, включающий измерение уровня экспрессии РНК-транскриптов KI67, CCND1, PTEN, NDRG1, TERT в биологическом образце, содержащем опухолевые клетки и определение показателя рецидивирования для указанного субъекта с учетом измеренных уровней экспрессии генов как точки на графике с двумя координатами X и Y.

Пакетированное событие 8264.44.06.1 с устойчивостью к гербицидам, связанные трансгенные линии сои и их детектирование // 2608650
Изобретение относится к области биохимии, в частности к трансгенной растительной клетке сои, семени и растению сои, которые предназначены для получения растения, имеющего устойчивость к гербициду, выбранному из группы, состоящей из 2,4-D, глифосата, глюфосината и их комбинаций.
Способ прогнозирования возникновения рецидива рака вульвы i и ii стадии // 2608508
Изобретение относится к медицине и касается способа прогнозирования возникновения рецидива вульвы I и II стадии.
Набор 5'-фосфорилированных олигонуклеотидных праймеров для амплификации методом полимеразной цепной реакции полной кодирующей последовательности гена мембранного протеина ttss hrcv burkholderia pseudomallei // 2608506
Изобретение относится к области молекулярной биологии и биотехнологии. Изобретение представляет собой набор 5'-фосфорилированных олигонуклеотидных праймеров для амплификации методом полимеразной цепной реакции (ПЦР) полной кодирующей последовательности гена мембранного протеина системы секреции III типа (TTSS) HrcV возбудителя мелиоидоза.
Набор 5'-фосфорилированных олигонуклеотидных праймеров для амплификации методом полимеразной цепной реакции полной кодирующей последовательности гена омра/мотв burkholderia pseudomallei // 2608505
Изобретение относится к области молекулярной биологии и биотехнологии. Изобретение представляет собой набор 5'-фосфорилированных олигонуклеотидных праймеров для амплификации методом полимеразной цепной реакции гена ompA/motB, кодирующего поверхностный протеин OmpA/MotB возбудителя мелиоидоза.

Детекция нуклеиновокислотной последовательности-мишени в анализе с гибридизацией сигнального олигонуклеотида, зависящей от расщепления и удлинения зондирующего и метящего олигонуклеотида (варианты) // 2608501
Группа изобретений относится к области биотехнологии, в частности к детекции нуклеиновокислотной последовательности-мишени в анализе с PCE-SH (гибридизацией сигнального олигонуклеотида, зависящей от расщепления и удлинения зондирующего и метящего олигонуклеотида (РТО)).

Лечение заболеваний, связанных с nanog, путем ингибирования природного антисмыслового транскрипта nanog // 2608493
Изобретение относится к биохимии. Описаны способы повышения экспрессии полинуклеотида NANOG с помощью олигонуклеотидов длиной от 19 до 30 нуклеотидов.
Способ диагностики растительного материала на трансгенность // 2607372
Изобретение относится к области биохимии, в частности к способу диагностики растительного материала на трансгенность.
Способ оценки обсемененности пародонта патогенными бактериями с применением полимеразной цепной реакции в реальном времени // 2607046
Изобретение относится к области биохимии, клинико-лабораторной диагностики, в частности к определению степени обсемененности пародонта патогенными бактериями с помощью ПЦР в реальном времени.
Способ определения степени гноетечения на пародонте по уровню мрнк гена интерлейкина-8 (il-8) человека // 2607041
Изобретение относится к области медицины, стоматологии, молекулярной биологии и клинико-лабораторной диагностики.
Способ выявления кандидатных генов для проведения популяционных исследований генетического полиморфизма у детей, проживающих в условиях стронциевой геохимической провинции // 2607031
Изобретение относится к области биохимии и медицины, в частности к способу выявления кандидатных генов для проведения популяционных исследований генетического полиморфизма у детей, проживающих в условиях стронциевой геохимической провинции.

Синтетические олигонуклеотидные праймеры и способ выявления рнк атипичного пестивируса крупного рогатого скота // 2607025
Изобретения относятся к ветеринарной вирусологии и биотехнологии, а именно к генетической инженерии. Предложены синтетические олигонуклеотидные праймеры для выявления РНК атипичного пестивируса крупного рогатого скота и способ их применения.

Маркеры тромбоэмболической болезни // 2606758
Настоящее изобретение относится к области генетики. Предложен способ оценки риска возникновения у индивида тромбоэмболического эпизода или диагностики возникновения или наличия такой болезни или эпизода на основании присутствия серпина А10 (ингибитор протеина Z) Arg67Stop (rs2232698), серпина С1 (антитромбин) Ala384Ser (Cambridge II), фактора XII С46Т (rs1801020), фактора XIII Val34Leu (rs5985), фактора II (протромбин) G20210A (rs1799963), фактора V Leiden Arg506Gln (rs6025), фактора V Cambridge Arg306Thr, фактора V Hong Kong Arg306Gly, группы крови ABO rs8176719, группы крови ABO rs7853989, rs8176743 и rs8176750.
Олигонуклеотидные праймеры и флюоресцентный зонд с внутренним гасителем, комплементарные участку гена р30 (cp204l) вируса африканской чумы свиней, для использования в полимеразной цепной реакции в режиме реального времени // 2606253
Изобретение относится к области биотехнологии, а именно к синтетическим олигонуклеотидным зондам и праймерам для выявления ДНК вируса африканской чумы свиней.

Наборы олигонуклеотидных зондов и способы профилирования микробиоты желудочно-кишечного тракта // 2605913
Группа изобретений относится к области биотехнологии и представлена набором олигонуклеотидных зондов для профилирования микробиоты желудочно-кишечного тракта (ЖКТ), где указанный набор включает в частности (a) олигонуклеотид, состоящий из (ai) нуклеотидной последовательности, выбранной из ACGCTTGCACCCT (SEQ ID NO: 1) необязательно с не более тремя замещенными основаниями или AGGGTGCAAGCGT (SEQ ID NO: 27) необязательно с не более тремя замещенными основаниями, и (aii) 0-5 нуклеотидов в дополнение к (ai), где олигонуклеотид согласно (а) способен гибридизоваться с SEQ ID NO: 27 или SEQ ID NO: 1, соответственно, в строгих условиях гибридизации.

Способ диагностики папиллярной почечноклеточной карциномы и набор для его осуществления // 2605829
Изобретение относится к области медицины, в частности к онкологии, и молекулярной биологии. Предложен способ диагностики папиллярной почечноклеточной карциномы (ППК), включающий стадии получения исходной пары образцов ткани от пациента, выделение и очистку препаратов РНК, синтез кДНК на матрице РНК с использованием олигонуклеотидных праймеров, проведение количественной реакции амплификации фрагмента гена CALL и сравнение количества амплифицированного фрагмента CALL для образца, полученного из предположительно пораженной раком ткани, с количеством амплифицированного фрагмента ДНК для образца, полученного из нормальной ткани.
Способ оценки риска прогрессирования хронической болезни почек у детей // 2605575
Изобретение относится к области медицины и предназначено для оценки риска прогрессирования хронической болезни почек (ХБП) у детей.

Способы определения зиготности в объемной пробе // 2605324
Группа изобретений относится к области биотехнологии. Способы определения наличия или отсутствия вставленной нуклеотидной последовательности в определенном сайте вставки в нуклеиновой кислоте включают: выделение нуклеиновой кислоты из одного образца или порций; приведение нуклеиновой кислоты в контакт с прямым праймером, способным связываться с нуклеиновой кислотой выше сайта вставки; первым обратным праймером, специфичным для вставленной нуклеотидной последовательности, и вторым обратным праймером, способным связываться с нуклеиновой кислотой ниже сайта вставки.

Способ прогнозирования рецидивов рака тела матки на основании уровня экспрессии генов pten и cyp1b1 // 2605302
Изобретение относится к молекулярной биологии. Способ включает: экстракцию препаратов суммарной РНК, получение комплементарной ДНК с помощью реакции обратной транскрипции на РНК-матрице и последующую амплификацию в режиме реального времени с использованием высокоспецифичных праймеров для генов PTEN, CYP1B1 и АСТВ (референтный локус), а также расчет коэффициента относительной экспрессии генов PTEN и CYP1B1 (КPTEN и КCYP1B1) методом RT-PCR.

Функциональные растворимые гетеродимеры мнс ii класса со стабилизирующей дисульфидной связью // 2604813
Изобретение относится к области биотехнологии, конкретно к получению рекомбинантных молекул МНС II класса, и может быть использовано в медицине.

Растение, обладающее повышенной устойчивостью или чувствительностью к ингибитору 4-hppd // 2604793
Изобретение относится к области биохимии, в частности к агенту для придания растению устойчивости к ингибитору 4-HPPD, включающему ДНК, кодирующую белок, обладающий активностью, придающей растению устойчивость к ингибитору 4-HPPD.

Способ получения гетерогенного набора одноцепочечных фрагментов днк для мультиплексного генетического анализа // 2604198
Изобретение относится к биохимии. Описан способ получения гетерогенного набора одноцепочечных фрагментов ДНК для мультиплексного генетического анализа.

Система и способ для распространения информации с использованием модифицированных нуклеиновых кислот // 2603746
Настоящее изобретение относится к области биоинформатики. Предложен способ для приготовления улучшенной вычислительной системы, основанной на нуклеиновых кислотах, включающий синтезирование в водном растворе варианта системы молекулярных вычислений, отличающегося включением химической модификации, изменяющей энергию гибридизации молекул нуклеиновых кислот в системе.

Способ скрининга веществ, имеющих регулирующее вес действие // 2603745
Изобретение относится к области генной инженерии, конкретно к скринингу веществ, оказывающих регулирующее вес действие, и может быть использовано в медицине.

Высокопроизводительный анализ трансгенных границ // 2603265
Настоящее изобретение относится к биохимии, в частности к способу определения и секвенирования неизвестных последовательностей ДНК, которые фланкируют известные последовательности в выделенной ДНК.

Набор синтетических олигодезоксирибонуклеотидов для детекции гена msp1α риккетсии anaplasma marginale методом полимеразной цепной реакции в режиме "реального времени" // 2603254
Изобретение относится к области биохимии. Представлен набор синтетических олигодезоксирибонуклеотидов для детекции гена msp1α риккетсии Anaplasma marginale методом полимеразной цепной реакции в режиме «реального времени».

Способ амплификации нуклеиновых кислот // 2603253
Изобретение относится к области биотехнологии. Описан способ амплификации нуклеиновых кислот, в котором наночастицы в объеме реакционной смеси переносят тепло в окружающую их среду посредством возбуждения.

Способ выделения циркулирующих днк из плазмы или сыворотки крови // 2603098
Изобретение относится к области молекулярной биологии и диагностической медицины. Предложен способ выделения циркулирующих ДНК из плазмы или сыворотки крови.

Способы секвенирования трехмерной структуры исследуемой области генома // 2603082
Группа изобретений относится к области биотехнологии и представляет собой варианты способов создания совокупности смежных фрагментов исследуемой области генома.

Способ и продукт для локализованной или пространственной детекции нуклеиновой кислоты в образце ткани // 2603074
Настоящее изобретение относится к способам и продуктам для локализованной или пространственной детекции нуклеиновой кислоты в образце ткани и, в частности, к способу локализованной детекции нуклеиновой кислоты в образце ткани, включающему: (а) предоставление чипа, содержащего подложку, на которой непосредственно или опосредованно иммобилизованы многочисленные разновидности захватывающих зондов, так что каждая разновидность занимает определенное положение на чипе и ориентирована таким образом, что имеет свободный 3′-конец, позволяющий указанному зонду действовать в качестве праймера в реакции удлинения или лигирования праймера, где каждая разновидность указанного захватывающего зонда содержит молекулу нуклеиновой кислоты, имеющую в направлении от 5′ к 3′: (1) позиционную область, которая соответствует положению захватывающего зонда на чипе, и (2) захватывающую область; (б) приведение указанного чипа в контакт с образцом ткани таким образом, что положение захватывающего зонда на чипе может быть сопоставлено с положением в образце ткани, и предоставление возможности нуклеиновой кислоте образца ткани гибридизоваться с захватывающей областью в указанных захватывающих зондах; (в) синтез молекул ДНК на основе захваченных молекул нуклеиновой кислоты с использованием указанных захватывающих зондов в качестве праймеров удлинения или лигирования, где указанные удлиненные или лигированные молекулы ДНК являются мечеными благодаря позиционной области; (г) возможно синтез комплементарной нити указанной меченой ДНК и/или возможно амплификацию указанной меченой ДНК; (д) высвобождение по меньшей мере части меченых молекул ДНК и/или их комплементов или ампликонов с поверхности чипа, где указанная часть включает позиционную область или ее комплемент; и (е) прямой или опосредованный анализ последовательности высвобожденных молекул ДНК.

Модифицированный биосенсор для детекции внутриклеточной рн // 2603060
Группа изобретений относится к области биотехнологии. В группу изобретений входят нуклеиновая кислота, которая кодирует флуоресцентный биосенсор для регистрации изменения рН, аминокислотная последовательность которого показана в SEQ ID No: 4, а также кассета экспрессии и эукариотическая клетка, продуцирующая биосенсор.

Ген-восстановитель rf4 для цитоплазматической мужской стерильности (cms) c-типа кукурузы, молекулярные маркеры и их применение // 2603005
Изобретение относится к области биохимии, в частности к способу идентификации растения, способного восстанавливать фертильность при цитоплазматической мужской стерильности С-типа, содержащего функциональный ген-восстановитель для цитоплазматической мужской стерильности С-типа кукурузы, включающему выделение молекул нуклеиновой кислоты из растения и скрининг выделенных молекул нуклеиновых кислот с использованием ПЦР в отношении молекулы нуклеиновой кислоты, содержащей нуклеотидную последовательность, выбранную из группы, состоящей из SEQ ID NO: 1-197 и маркеров, обозначаемых как полиморфизмы ID №№1-106 в таблице 3.

Способ идентификации рнк вирусов гриппа а и в с одновременным определением вариантов гемагглютинина и нейраминидазы вируса гриппа а, идентификацией генетических маркеров патогенности и устойчивости к противогриппозным препаратам на биологических микрочипах, биочип, набор олигонуклеотидных зондов, используемые в способе // 2603000
Изобретение относится к области молекулярной биологии, вирусологии, ветеринарии и медицине и касается способа идентификации РНК вирусов гриппа А и В с одновременным определением вариантов гемагглютинина и нейраминидазы вируса гриппа А, а также генетических маркеров патогенности и устойчивости к противогриппозным препаратам, на биологических микрочипах.

Способ прогнозирования эффективности терапии пероральным сахароснижающим препаратом метформином у больных сахарным диабетом 2 типа // 2602663
Изобретение относится к области медицины, и касается способа прогнозирования эффективности монотерапии пероральным сахароснижающим препаратом метформином у больных сахарным диабетом 2 типа.

Способ получения днк-праймеров и зондов для малоинвазивной пренатальной пцр-диагностики трисомии 21-й хромосомы у плода по крови беременной женщины и диагностический набор для ее осуществления // 2602366
Предложенная группа изобретений относится к области медицины. Предложен способ получения ДНК-праймеров и зондов для малоинвазивной пренатальной ПЦР-диагностики трисомии 21-й хромосомы у плода по крови беременной женщины, характеризующийся тем, что выбирают сайт дифференциального метилирования фетальной ДНК 21-й хромосомы и ДНК 21-й хромосомы взрослого человека, чувствительный к эндонуклеазам, синтезируют прямой и обратный праймер, соответствующие ампликону длиной от 60 до 300 п.н., а также зонд, соответствующий этому ампликону, проводят ПЦР в реальном времени смеси образцов после их обработки эндонуклеазой рестрикции, отбирают пары праймеров и зонды, обеспечивающие эффективность реакции ПЦР в реальном времени выше 90% и линейность при изменении относительной концентрации образцов выше 90%.
Способ прогнозирования эффективности профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза // 2601902
Изобретение относится к медицине, а именно к хирургии, и касается способа прогнозирования эффективности профилактики альбендазолом послеоперационного рецидива цистного эхинококкоза.

Способ одновременной генодиагностики двух мутантных аллелей, вызывающих cvm и blad у крупного рогатого скота, и тест-система для его осуществления // 2601151
Группа изобретений относится к области биотехнологии. Способ одновременной генодиагностики двух мутантных аллелей, вызывающих CVM и BLAD у крупного рогатого скота, включает выделение ДНК из биологического материала, постановку полимеразной цепной реакции в режиме реального времени с использованием реакционной смеси (тест-системы) с CVM/BLAD, содержащей 50 мМKСl, 50 mMTRIS-HCl, 250 нMdNTP, 2,5 мMMgCl2, праймеры - в концентрации 200 нМ, аллель-специфические зонды - в концентрации 100 Нм, имеющие следующие последовательности: CVM_up - gattctcaagagcttaattctaagga, CVM_low - aagtaaaccccagcaaagccac, CVM_Wt - (FAM) aggtctcatggcagttct-(BHQ1), CVM_m - (R6G) catggcatttctcacagcat-(BHQ2), BLAD_up - ttaggcagttgcgttc, BLAD_low - acgttgacgaggtcatccacca, BLAD_Wt - (ROX) accccatcgacctgtacta-(BHQ1), BLAD_m (Cy5) ccatcggcctgtactacct-(BHQ2), разбавитель, 2,5 ед.

Вращающаяся платформа для проведения секвенирования нуклеиновых кислот // 2601139
Изобретение относится к биохимии. Описан способ для проведения пиросеквенирования нуклеиновых кислот.
Набор синтетических олигонуклеотидов для диагностики болезни крона и неспецифического язвенного колита путем выявления маркерных участков бактериальной днк методом полимеразной цепной реакции // 2601132
Изобретение относится к биохимии. Описан набор синтетических олигонуклеотидов для выявления маркерных участков генов бактерий кишечника человека, ассоциированных с развитием воспалительных заболеваний кишечника (болезни Крона и неспецифического язвенного колита) методом полимеразной цепной реакции в режиме реального времени.

Композиции и способы для количественного определения последовательности нуклеиновой кислоты в образце // 2601129
Изобретение относится к биохимии. Описаны способы количественного определения специфического продукта в реакции амплификации с внесением одноцепочечных разрывов и достройкой и способ контроля в режиме реального времени реакции амплификации с внесением одноцепочечных разрывов и достройкой.

Набор олигонуклеотидных праймеров и зондов для генотипирования полиморфных локусов днк, ассоциированных с риском развития спорадической формы болезни альцгеймера в российских популяциях // 2600874
Изобретения относятся к области генетики, молекулярной биологии и медицины и касаются способа для анализа генетического полиморфизма в локусах ДНК ApoE, ApoJ и GAB2 и набора олигонуклеотидных праймеров и зондов.

Способ идентификации нативных пар фрагментов днк или рнк, присутствующих в одних и тех же живых клетках // 2600873
Изобретение относится к области биотехнологии. В изобретении описан способ идентификации пар фрагментов ДНК или РНК, исходно присутствующих в одних и тех же живых или фиксированных клетках, в частности, способ идентификации нативных пар генов легких и тяжелых цепей антител, а также нативных пар генов альфа- и бета-цепей Т-клеточных рецепторов (ТКР).
Способ прогнозирования предрасположенности к развитию посттравматического остеоартроза коленного сустава // 2600860
Изобретение относится к области медицины и предназначено для диагностики предрасположенности к посттравматическому остеоартрозу коленного сустава.
 
2548320.
Наверх