Способ получения двухнулевых линий-восстановителей фертильности brassica napus, имеющих хорошее агрономическое качество

Получают двухнулевую линию-восстановитель фертильности Brassica napus для мужской цитоплазматической стерильности (ЦМС) Ogura, представляющую собой интрогрессию редьки, несущую ген-восстановитель фертильности Rfo, вырезанную из аллели Pgi-2 редьки и рекомбинированную с геном Pgi-2 из Brassica oleracea, характеризующейся женской фертильностью, хорошим уровнем переноса Rfo и высокой вегетационной мощностью. Для характеризации полученной линии-восстановителя фертильности используют комбинацию маркеров PGIol, PGIUNT, PGIint, BolJon и СР418. Линия отличается хорошим агрономическим качеством. 2 н. и 5 з.п. ф-лы, 24 ил.

 

Изобретение относится к способу получения двухнулевых линий-восстановителей фертильности рапса Brassica napus с цитоплазматической мужской стерильностью (ЦМС) Ogura, представляющего собой интрогрессию редьки, несущую ген-восстановитель фертильности Rfo, вырезанный из аллели Pgi-2 редьки и рекомбинированный с геном Pgi-2 Brassica oleracea, имеющих хорошее агрономическое качество, отличающееся женской фертильностью, хорошим уровнем переноса Rfo и высокой вегетационной мощностью. Изобретение также относится к способу получения гибридных семян Brassica napus и их потомства, а также использования маркеров для селекции.

Линии-восстановители фертильности для размножения системы мужской цитоплазматической стерильности (ЦМС) Ogu-INRA рапса (Brassica napus L.) были основой целью исследований в течение последних нескольких лет. Широкое обратное скрещивание и селекция были необходимы для улучшения их женской фертильности и получения двухнулевых линий-восстановителей фертильности. Так называемые «double low-двухнулевые» разновидности - это те, которые содержат низкий уровень эруковой кислоты, а также низкий уровень глюкозинолатов в шроте после экстракции масла. Однако в размножении этих линий все еще могут встречаться трудности (перестройки интрогрессии, возможная связь с негативными особенностями) вследствие большой величины интрогрессии редьки.

Поэтому авторы изобретения поставили себе цель получить новую улучшенную двухнулевую линию-восстановитель фертильности с хорошим агрономическим качеством.

Эта цель была достигнута новым способом получения рекомбинантной двухнулевой линии-восстановителя фертильности для ЦМС Ogu-INRA рапса. Первая задача данного изобретения относится к способу получения двухнулевых линий-восстановителей фертильности Brassica napus для мужской цитоплазматической стерильности (ЦМС) Ogura, представляющего собой интрогрессию редьки, несущую ген-восстановитель фертильности Rfo, лишенный аллели Pgi-2 редьки и рекомбинированный с геном Pgi-2 из Brassica oleracea; которые имеют хорошее агрономическое качество, отличающееся женской фертильностью, хорошим уровнем переноса Rfo и высокой вегетационной мощностью, упомянутый способ включает в себя следующие стадии:

а) скрещивание двухнулевых линий ЦМС ярового рапса Brassica napus с вырезанной вставкой генома редьки с двухнулевой линией ярового рапса сорта Drakkar для формирования гетерозиготного растения Brassica napus с восстановленной фертильностью,

b) облучение перед мейозом гетерозиготных растений с восстановленной фертильностью, полученных на стадии а), гамма-лучами,

с) перекрестное опыление цветков, полученных на стадии b), с двухнулевой яровой линией ЦМС Wesroona,

d) тестирование потомства на мощность, женскую фертильность и уровень переноса гена ЦМС,

e) селекция линий потомства.

В данном изобретении термин «линия(и)» означает растение, которое в основном гомозиготно и воспроизводится самоопылением.

Способ по п.1, в котором доза облучения на стадии b) составляет 65 Грэй в течение 6 минут.

В соответствии с одной из предпочтительных форм реализации способа по данному изобретению двухнулевая линия ЦМС ярового Brassica napus на стадии а) является линией R211.

R211 представляет собой яровую линию-восстановитель фертильности INRA. Drakkar - это зарегистрированная яровая французская разновидность. Wesroona - это зарегистрированная яровая австралийская разновидность.

В соответствии с одной из предпочтительных форм реализации способа по данному изобретению тестирование выполняется с комбинацией из пяти маркеров, избранных из PGIol, PGIUNT, PGIint, BolJon и СР418.

Другая задача данного изобретения относится к двухнулевым линиям-восстановителям фертильности Brassica napus для ЦМС Ogura, представляющим собой делецию вставки Rfo в аллели Pgi-2 редьки, рекомбинированной с геном Pgi-2 Brassica oleracea и имеющим хорошие агрономические качества, отличающееся женской фертильностыо, хорошим уровнем переноса Rfo и высокой вегетационной мощностью.

В соответствии с одной из предпочтительных форм реализации двухнулевые линии-восстановители фертильности представляют собой уникальную комбинацию пяти маркеров, избранных из PGIol, PGIUNT, PGIint, BolJon и СР418.

Другая задача данного изобретения относится к способу формирования гибридных растений Brassica napus и их потомства, полученных следующими стадиями:

а) получение линий-восстановителей фертильности, продуцированных по пункту 1, и скрещивание их для получения гомозигот,

b) использование упомянутой линии-восстановителя фертильности на делянке для получения гибрида как опылителя,

с) использование ЦМС стерильных растений для получения гибридов на делянке в качестве растений, продуцирующих гибридные семена и

d) сбор гибридных семян с мужских стерильных растений.

Другая задача данного изобретения относится к семенам растений Brassica, полученных способом по данному изобретению.

Еще одна задача изобретения относится к семенам Brassica napus, депонированным в NCIMB Limited (Национальные Коллекции индустриальных пищевых и морских бактерий), 23 St Machar Drive, Aberdeen, Scotland, AB24 3RY, UK, 4 июля , 2003 под номером NCIMB41183.

Другая задача данного изобретения относится к использованию по меньшей мере четырех маркеров PGIol, PGIint, BolJon и CP418 или какой-либо их части, образующей по меньшей мере один полиморфный сайт, для характеризации рекомбинированных линий-восстановителей фертильности Brassica napus для ЦМС Ogura, имеющих делецию вставки Rfo в аллели Pgi-2 редьки и рекомбинированных с геном Pgi-2 Brassica oleracea и обладающих хорошим агрономическим качеством, отличающимся женской фертильностью, хорошим уровнем переноса Rfo и высокой вегетационной мощностью.

В предпочтительном варианте реализации комбинация образована пятью маркерами PGIol, PGIUNT, PGIint, BolJon и CP418.

В данном изобретении выражение "какая-либо часть их, образующая по меньшей мере один полиморфный сайт" означает какую-либо часть последовательности, демонстрирующую по меньшей мере отличие между последовательностью типа B.oleracea и последовательностью типа B.rapa.

Такие маркеры представлены в нижеследующих чертежах и списках последовательностей линии R2000.

В соответствии с одной из предпочтительных форм реализации данное изобретение относится к:

- маркеру PGIol, который амплифицирован с использованием праймеров PGIol U и PGIol L

(PGIol U: 5TCATTTGATTGTTGCGCCTG3',

PGIol L: 5TGTACATCAGACCCGGTAGAAAA3');

- маркеру PGIint, который амплифицирован с использованием праймеров PGIint U и PGIint L

(PGIint U: 5'CAGCACTAATCTTGCGGTATG3',

PGIint L: 5'CAATAACCCTAAAAGCACCTG3');

- маркеру PGIUNT, который амплифицирован с использованием праймеров PGIol U и PGIint L

(PGIol U: 5'TCATTTGATTGTTGCGCCTG3',

PGIint L: 5'CAATAACCCTAAAAGCACCTG3');

- маркеру BolJon, который амплифицирован с использованием праймеров BolJon U и BolJon L

(BolJon U: 5'GATCCGATTCTTCTCCTGTTG3',

BolJon L: 5'GCCTACTCCTCAAATCACTCT3');

- маркеру CP418, который амплифицирован с использованием праймеров SG129 U и pCP418 L

(SG129 U: cf Giancola et al., 2003. Theor Appl. Genet (in press);

pCP418 L: 5'AATTTCTCCATCACAAGGACC3').

Другая задача данного изобретения относится к маркерам PGIol, PGIUNT, PGIint, BolJon и CP418 со следующими последовательностями:

маркер PGIol R2000:

Маркер PGIUNT R2000:

Маркер PGIint R2000:

Маркер BolJon R2000:

Маркер CP418L R2000:

В прилагающихся нижеследующих чертежах использованы следующие сокращения:

Dra Drakkar
Rel-15-1,E38,R15 R2000
Hete, Hel, R211 .Drakkar гетерозиготный R211 *Drakkar,
Darm Darmor
Bol Brassica oleracea
Bra,B.rap Brassica rapa
GCP A18-A19, Wes, Aust Wesroona
Sam, SamlPGIolSunt5 Samourai
RRH1, ba2c RRH1
rav, N.WR гибрид Brassica napus*дикая редька

Фиг.1 иллюстрирует облучение гамма-лучами и продукцию F2.

Фиг.2 иллюстрирует результаты посадки семян "R211" и "R2000".

Фиг.3 иллюстрирует число семян на стручок в различных линиях.

Фиг.4 иллюстрирует локализацию праймера PGIol в сегменте последовательности PGI из базы данных. На этой фигуре:

PGIol: - праймер PGIolU (именуемый в SGAP (Society for Growing Australian Plants - Общество австралийских растений): BnPGIch 1 U);

- праймер PGIol L (именуемый в SGAP: Bn PGIch 1 L);

PGIint: - праймер PGIint U;

- праймер PGIint L (за пределами приведенной последовательности).

Фиг.5 иллюстрирует гель-электрофорез гена PGI-2 (PGIol), маркера ПЦР (полимеразная цепная реакция) и SG34, маркера ПЦР, близкого к Rfo.

Фиг.6 иллюстрирует сегмент ДНК Pgi-2, амплифицированный с помощью ПЦР с праймерами PGIol.

Фиг.7 иллюстрирует переваривание продукта ПЦР PGIol с помощью Msel. На этой фигуре:

Sam и Darm представлены полосой 75 bp (пар оснований).

Drak, R21 l.Dk и R2000 представлены полосой 70 bр (Акриламид 15%).

8 - сходно с Samourai (75 bp); смесь с Drakkar (70 bр) позволяет визуализацию двух полос.

Фиг.8 иллюстрирует электрофорез маркера PGIUNT в агарозном геле.

На этой фигуре:

полоса PGIUNT (около 980 bp) представлена в B.oleracea, B.rapa cv Asko, поддерживающей и восстанавливающей фертильность в линиях за исключением "R211".

Амплификация в редьке и Arabidopsis отсутствует.

В различных генотипах Brassica амплифицировалась только одна полоса. Размер полосы сходен, но последовательности различны.

Фиг.9 иллюстрирует гель-электрофорез маркера ПЦР PGIint.

На этой фигуре PGIint линии 7 редьки имеет около 950 bp. Это такая же полоса, как в восстановленных RRH1 и R113. Она не обнаружена в R211. Ее также нет в R2000. Однако полоса PGIint имеет сходный размер около 870 bp в различных видах рода Brassica, но последовательности отличаются.

Фиг.10 иллюстрирует электрофорез маркера ПЦР BolJon в агарозном геле.

Фиг.11 иллюстрирует электрофорез маркера CP418 в агарозном геле.

На этой фигуре полоса CP418 (около 670 bp) специфична для генома B.oleracea. Она представлена у B.ol*, B.napus (Samourai, Drakkar, Pactol и гетерозиготного R2111*Dk). Она отсутствует у рапса с восстановленной фертильностью (RRH, R113 и R211). Она присутствует у гомозиготной R2000.

Фиг.12 иллюстрирует суммарную таблицу маркеров.

Фиг.13 (13(a), 13(b)) иллюстрируют сравнительный анализ первичной структуры маркера PGIol с Arabidopsis, редькой, B.rapa, B.oleracea и R2000.

Фиг.14 (14(a), 14(b), 14(c), 14(d)) иллюстрируют сравнительный анализ первичной структуры маркера PGlint-UNT с Arabidopsis, редькой, B.rapa, B.oleracea и R2000.

Фиг.15 (15(a), 15(b), 15(c)) иллюстрируют сравнительный анализ первичной структуры маркера CP418L с Arabidopsis, редькой, B. rapa, B.oleracea и R2000.

Фиг.16 (16 и 16bis) иллюстрирует маркеры BolJon у Arabidopsis, редьки и B.rapa. Их первичная структура сравнивается с последовательностями DB Arabidopsis (AC007190 концевой участок - AC011000 начальный участок), концевым участком EMBH959102 и начальным участком EMBH448336 B.oleracea и репрезентативной консенсусной последовательностью полос 1 и 2 маркеров SG129 в B.napus (в линиях Drakkar и Samourai соответственно).

Начиная с 836-й bp, последовательности ACG7190 - AC11000 и GCPATpBOJ не проявляют близкой гомологии с последовательностями Brassica.

Последовательности редьки и B.rapa (GCPconsen RsRf BOJ и BR) все еще близко гомологичны таковым B.napus с 858-й bp до 900-й bp и 981-й bp соответственно.

Кроме того, в редьке обнаружена только частичная гомология с последовательностью Brassica.

У вида B.rapa cv Asko остаток последовательности BolJon может быть после делеции 78 bp снова сравнен по структуре с таковыми B.oleracea и B.rapa в B.napus, начиная с 1057 bp до праймера BolJon L.

Фиг.17 (17 и 17bis) иллюстрируют локализацию праймеров Pgi-2 в последовательности th MJB21.12 Arabidopsis.

Фиг.18 иллюстрирует локализацию праймеров BolJon в гене mipsAtl62850 и перекрывающиеся участки клонов th AC007190 и AC011000 Arabidopsis. Представлено сравнение его первичной структуры с продуктом ПЦР BolJon в Arabidopsis (740 bp). Следует понимать, однако, что примеры приводятся как способ иллюстрации задачи изобретения, но никоим образом не образуют ограничений изобретения.

Пример I: Способ получения двухнулевой линии-восстановителя фертильности Brassica napus с цитоплазматической мужской стерильностью (ЦМС) Ogura, представляющего собой интрогрессию редьки, несущую ген-восстановитель фертильности Rfo, вырезанный из аллели Pgi-2 редьки, рекомбинированный с геном Pgi-2 Brassica oleracea, имеющих хорошее агрономическое качество, отличающееся женской фертильностью, хорошим уровнем переноса Rfo и высокой вегетационной мощностью.

Материалы и методы:

Генотипы: линию «R211» с вырезанной вставкой редьки скрещивали с яровым низкоглюкозинолятным (GLS) рапсом «Drakkar» для получения потомства Fl ('R211*Dk'). Яровая низкоглюкозинолятная ЦМС линия «Wesroona» (австралийского происхождения) использовалась для последующих скрещиваний. В качестве контроля в молекулярном анализе использовались: озимая линия с восстановленной фертильностью, происходящая от линии «Samourai» и несущая полную («RRHl») или неполную («R113») интрогрессию, а также европейская линия 7 редьки, азиатская редька с восстановленной фертильностью D81, гибрид Brassica napus*дикая редька, Brassica oleracea и B.rapa cv Asko, Arabidopsis thaliana.

Гамма-облучение: цветущие растения целиком были обработаны гамма-лучами от источника 60Cо на контролируемой делянке. Сублетальная доза в 65 Грэй давалась перед мейозами.

Скрещивания и получение [поколения] F2: облученные растения переносили в защищенную от насекомых оранжерею после удаления цветочных почек, размер которых превышает 2 мм. Облученное потомство Fl использовали для опыления линии ЦМС «Wesroona» вручную. Восстановленным растениям F1 позволяли дать урожай семей растений F2, который собирали индивидуально и тщательно высевали на полевые испытания параллельно с необлученным контролем (Фиг.1).

Фенотипическая селекция: при полевых испытаниях оценивали три визуальных критерия (по шкале от 1 до 5) в течение 2 лет на 1200 растениях потомства F2 плюс 44 контрольных (82 330 оцененных растений):

1 - вегетационная мощность,

2 - нормальность соотношения фертильных/стерильных растений в расщеплении F2 и

3 - женская фертильность (развитие стручка и высев семян).

Последующие самоопыленные поколения избранных семей получали как на делянке, так и в оранжерее и продуцировали гомозиготные линии (F4) для дальнейшего анализа. Изозимный анализ выполняли, как описано в Delourme R. and Eber F. 1992. Theor Appl Genet 85: 222-228, развитие маркера (Fourmann M et al. 2002. Theor Appl Genet 105:1196-1206.): ПЦР-продукты оценены по секвенированию. Проверка первичной структуры выполнена с использованием программы Blast NCBI (Национальный Центр Биотехнологической информации США) и Uk Crop Net Brassica DB, а также программного обеспечения Multialin INRA Toulouse.

Способ:

Была выбрана одна низкоглюкозинолятная яровая гомозиготная линия с восстановленной фертильностью «R211», для которой уже показаны делеции в интрогрессии (Delourme R. and Eber F. 1992. Tlieor Appl Genet 85: 222-228. Delourme R et al. 1998. Theor Appl Genet 97: 129-134. Delourme R. et al. 1999.10 Int. Rapeseed Congress, Canberra.). Несколько молекулярных маркеров утрачены на обеих сторонах Rfo, такие как spATCHIA (Fourmann M et al. 2002. Theor Appl. Genet 105:1196-1206), spSG91 (Giancola S et al. 2003. Theor Appl Genet (in press)). "R211" утратила изозимную экспрессию аллели Pgi-2 гена редьки, но также и одну из аллелей Pgi-2 генома B.oleracea (1,2). Далее, гомозиготная "R211" демонстрирует сцепленные негативные черты, такие как низкая вегетационная мощность и очень малое количество семян. Было предположено, что эти растения утратили хромосомный сегмент рапса. Соотношение фертильности в поколении F2, полученном из этого материала, ниже ожидаемого (64% вместо 75%). Была начата программа, в которой попытались добиться рекомбинации между Rfo, несущим интрогрессию из этой вырезанной линии, и гомологичной хромосомой из двухнулевой линии B.napus.

Известно, что ионизирующая радиация индуцирует хромосомные перестройки в результате двухнитевых разрывов и последующих аберрантных соединений концов. Облучение гамма-лучами использовалось на гетерозиготных растениях F1, полученных от линии "R211", для индуцирования разрывов хромосом непосредственно перед мейозом, с целью добиться рекомбинации вырезанной интрогрессии редьки в геноме рапса.

Результаты:

Очень малое количество семей из 1200 тестированных семей F2 имели лучшие оценки по трем критериям.

Только одна, «R2000», оказалась способной продуцировать нормальное соотношение фертильных растений у самоопыленного потомства со стабильным восстановлением хороших агрономических характеристик, таких как хорошая женская фертильность при нормальном числе семян по сравнению с линией «R211» (Фиг.2 и 3). Эта семья была получена в результате 6-минутной обработки облучением при дозе 65 Грэй в час.

Анализ глюкозинолятов подтвердил их низкое содержание.

На Фиг.2 (растения «R211» и «R2000») R2000 демонстрирует нормальное цветение с нормальной внешней архитектурой.

На Фиг.3 (число семян на стручок) мы видим:

- показатели лучших семей F4 «R2000» при самоопылении и при тестовых скрещиваниях;

- показатели ЦМС-линии "Pactol" рапса и контрольных "R211".

Пример II: селекция маркеров в гене Pgi-2

Изозимный анализ PGI: потомство от «R2000» экспрессирует аллель Pgi-2 рапса из генома B.oleracea, исходно утраченного в «R211».

Были определены три ПЦР-маркера для того, чтобы охарактеризовать семейство R2000 по сравнению с известными восстановителями фертильности рапса RRH1 и R113.

1) Маркер PGIol получен из последовательностей BrassicaDB, специфичных для генома Brassica. Амплификация отсутствует как в редьке, так и в Arabidopsis th., но присутствует в Brassica в виде одной полосы 248 bp.

2) Маркер PGIint амплифицировал более длинную часть гена Pgi-2, позволяя четкое различение между различными испытанными видами Brassica, Raphanus и Arabidopsis. Виды B.rapa и B.oleracea различались не по размеру полосы в агарозном геле, а по последовательности их полосы PGINT.

3) Маркер PGIUnt представляет собой комбинацию праймеров PGI ol U и PGI int L. Этот маркер обладал специфичностью маркера PGIol, но амплифицировал более длинный участок, чем маркер PGIint.

II.1 Маркер PGIol

С праймерами PGIol родительская линия «R211» демонстрирует отсутствие амплификации, тогда как в протестированных озимых линиях присутствует полоса 248 bp. Ее последовательность ДНК гомологична последовательности PGI-2 из Crop Net UK DB для вида Brassica и последовательности из предыдущей работы авторов (наименованной последовательностями SGAP) (Локализация праймеров SGPGI chou, Фиг.4).

Это ортолог клона MJB21-12 на хромосоме V (34543 bp) у Arabidopsis (NCBI DB).

PGIol плюс SG34 для проведения теста на гомозиготность:

комбинированное использование двух наборов праймеров в смешанной ПЦР: PGIol, маркирующего ген Pgi-2, отсутствующего в гомозиготном растении с восстановленной фертильностью, и SG34 (из S. Giancola et al., Giancola S et al. 2003. Theor Appl. Genet. (in press)) - маркера, очень близкого к гену Rfo, было направлено на различение гомозиготных и гетерозиготных растений среди фертильных растений в расщеплении потомства F2, полученного из "R211". Вместо использования SG34 возможно использование какого-либо другого маркера, близкого к гену Rfo или входящего в его состав.

Только одно семейство "R2000" продемонстрировало отсутствие различий между гомозиготным и гетерозиготным потомством:

ген Pgi-2 присутствует в гомозиготе "R2000" при том, что он отсутствует в родительской гомозиготной R211.

На Фиг.5 (маркеры ПЦР PGIol и SG34):

гомозиготное семейство "R2000" восстанавливает полосу PGIol.

Последовательность ДНК полосы подтверждает гомологию с известными последовательностями Pgi-2 в Arabidopsis и Brassica. Контрольные генотипы (Drakkar, Pactol, и Samourai, Darmor) имеют такой же паттерн на геле. Последовательность этой общей полосы позволяет подтвердить высокую степень их гомологии, поскольку они практически сходны, за исключением замены одного основания.

У гомозиготного семейство «R2000» восстанавливается полоса PGIol типа Brassica oleracea. Это отличает ее от известного восстановителя фертильности группы Samourai.

Эта амплифицированная часть Pgi-2 очень консервативна, и трудно обнаружить какие-либо отличия между различными генотипами. Более длинная часть гена Pgi-2 была исследована.

II.2 Маркеры PGIUNT и PGIint

Паттерн электрофореза продуктов ПЦР:

маркер PGIUNT: второй обратный праймер PGIint L был сконструирован по большей части последовательности Pgi-2, чтобы амплифицировать и консервативные, и вариабельные участки гена.

При использовании праймера PGIol U амплифицируется полоса 980 bp только в геноме Brassica.

В «R211» не наблюдается каких-либо полос, а в гомозиготной «R2000» наблюдается полоса PGIUNT, как и в родительской линии Drakkar.

На Фиг.8 (маркер PGIUNT):

маркер PGIint амплифицировал сегмент PGIUNT. Верхний праймер PGIint позволяет амплификацию у всех тестируемых видов, что дает возможность провести ясное различие между Arabidopsis, редькой и Brassica. B.rapa и B.oleracea не различались по величине полосы в агарозном геле, но различались по своим последовательностям PGIint. Все протестированные генотипы с восстановленной фертильностью, за исключением линии «R211», демонстрируют полосу европейской редьки и одну полосу Brassica, гомологичную таковой B.rapa.

Гомозиготная «R2000» не демонстрирует полосу PGIint редьки, как в вырезанной родительской линии «R211», но демонстрирует полосу Brassica, гомологичную таковой B.oleracea.

Электрофорез маркера PGIint представлен на Фиг.9.

Анализ последовательности:

сравнение последовательностей PGI из баз данных.

Известен сегмент PGI величиной около 490 bp.

Последовательности сегмента величиной около 490 bp из различных генотипов (B.oleracea, B.rapa, B.napus) были изучены в лаборатории авторов, и некоторые последовательности переданы в Brassica Crop Net DB: EMAF 25875 до 25788 (M.Fouramnn) (4). Эти последовательности очень консервативны.

Сравнение последовательностей PGI B.rapa и B.oleracea (Фиг.13 и 14):

сравнение между последовательностями PGI мы получили из протестированных генотипов видов B.oleracea и B.rapa, оно показало, что эти последовательности различаются заменами 21 основания. Эти замены позволили различить последовательности PGIint из каждого из других протестированных генотипов рапса, гомологичных либо B.rapa cv Asko (RRH1 и R113) или B.oleracea (Drakkar, R211*DK, но также R2000).

Пример III: отбор маркера в области, близкой к Rfo

Окружающие ген Rfo во вставке редьки маркеры определены, чтобы облегчить клонирование гена (Desloires S. et al. 2003. EMBO reports 4, 6:588-594). Один из них, маркер ПЦР SGI 29, располагается очень близко к Rfo (Giancola S. et al. 2003. Theor Appl. Genet. (in press)): он коамплифицировал различающиеся полосы геномов B.oleracea и B.rapa у B.napus, однако полосу редьки очень трудно разглядеть на агарозном геле.

Мишенью последовательности SG129 был ортолог клона (AC011000, в локусе F16P17) у Arabidopsis thaliana. Этот клон перекрывается с соседним примыкающим (контиг) клоном Arabidopsis (AC07190).

В базе данных Brassica Crop Net DB авторы обнаружили один клон B.oleracea (EMBH448336, 764 bp), близкий по первичной структуре к начальному участку A011000, а второй клон B.oleracea (EMBH53971), который на карте генома Arabidopsis удален на приблизительно 300 bp, близкий к концевому участку AC07190.

Мы сконструировали новый ПЦР-маркер BolJon, занимающий место между двумя клонами B.oleracea. Мы удостоверились в том, что этот маркер позволяет амплифицировать специфические полосы ПЦР в различных генотипах, сравниваемых в данной заявке.

На Фиг.16 (гель-электрофорез ПЦР-продуктов BolJon):

- У Arabidopsis амплифицировалась полоса BolJon 815 bp, гомологичная перекрывающемуся сегменту примыкающих участков.

- В диплоидных видах Brassiceae маркер BolJon демонстрирует различающиеся полосы: одна - 950 bp у B.oleracea и одна - 870 bp у B.rapa. Это показывает, что два клона B.oleracea (EMBH53971 и EMBH448336) представляют собой непрерывность в геноме Brassica, как это имеет место в ортологической последовательности у Arabidopsis.

- У B.napus эти две полосы коамплифицируются в поддерживающих линиях Samourai или Drakkar.

- В линии 7 редьки амплифицировалась одна полоса BolJon длиной около 630 bp. Полоса у редьки с восстановленной фертильностью cmsRd81 была немного меньше. У всех линий с восстановленной фертильностью одна из полос BolJon была такой же величины, как у линии 7 редьки. BolJon - это маркер интрогрессии редьки.

- Гомозиготные линии рапса с восстановленной фертильностью «RRH1», «R113», а также «R211» демонстрируют только полосу B.rapa и полосу редьки 630 bp, что предполагает, что ортолог B.oleracea гена-мишени отсутствует или он был модифицирован, когда сегмент хромосомы редьки был вставлен в исходный геном рапса B.oleracea.

Гомозиготные растения «R2000» демонстрируют присутствие маркера ПЦР редьки BolJon плюс две полосы BolJon Brassica, которые снова восстанавливают полосу B.oleracea, утраченную у «R211» и в других линиях-восстановителях фертильности.

Мы сконструировали праймер pCP418L, специфический для генома B.oleracea у тестируемых видов. С праймером SG129U он амплифицирует только одну полосу ПЦР (670 bp) у вида B.oleracea species (Фиг.17).

Амплификации ни у B.rapa, ни у редьки, ни у Arabidopsis не было, но присутствовала ясная полоса CP418 у поддерживающих линий B.napus. Ее последовательность строго гомологична последовательности EMBH448336. Этот маркер представляет собой очень консервативную последовательность ДНК, не допускающую полиморфизма между генотипами, за исключением присутствия или отсутствия.

У RRH1, R113 и у R211 отсутствовала полоса CP418, что показывает, как в предыдущем случае, что ортолог гена-мишени B.oleracea отсутствует или был модифицирован вследствие вставки сегмента генома редьки.

Гомозиготные растения «R2000» демонстрируют полосу CP418, восстанавливающую таковую, специфичную для B.oleracea.

В данном изобретении новая рекомбинантная низкоглюкозинолятная линия-восстановитель фертильности селекционирована с хорошей женской фертильностью. Низкое качество линии «R211» позволяет селекцию в поле редких рекомбинантных событий и характеризации семьи «R2000».

Гомозиготная линия «R2000» представляет собой уникальную комбинацию маркеров PGIol, PGIUNT, PGIint и BolJon по сравнению с до сих пор анализированными восстановителями фертильности рапса:

маркер PGIinT демонстрирует, что у гомозиготных линий рапса с восстановленной фертильностью RRH1 и R113 присутствует полоса европейской редьки плюс одна полоса Brassica, гомологичная геному B.rapa. «R2000» демонстрирует отсутствие полосы редьки, утраченной, как и в родительской вырезанной линии R211, но демонстрирует одну полосу Brassica, гомологичную B.oleracea. Ортологическая последовательность PGIint в собственном геноме B.rapa не амплифицируется с этим маркером в генетическом окружении линий R211 и Drakkar.

Последовательности маркера PGIol и маркера PGIUNT в линиях с восстановленной фертильностью RRH1 и R113 были гомологичны таковой B.rapa cv Asko. У «R2000» последовательность PGIUNT гомологична B.oleracea. Ортологическая последовательность в ее геноме B.rapa не амплифицируется с этим маркером в генетическом окружении линий R211 и Drakkar.

Маркер BolJon показал, что гомозиготные линии рапса с восстановленной фертильностью, включая "R211", демонстрируют присутствие полосы европейской редьки плюс только полосу B.rapa. 'R2000' демонстрирует две полосы «R211» плюс восстановленную полосу BolJon B.oleracea.

Маркер CP418 показал, что у «R2000» восстановился консервативный сегмент B.oleracea.

Гипотеза авторов состоит в том, что событие рекомбинации имело место в опыленной материнской клетке, которая дала растения «R2000». Вырезанная интрогрессия редьки затем интегрировалась в нормальный гомологичный сегмент хромосомы, несущий ген Pgi-2 типа B.oleracea, а последовательность - мишень BolJon, охарактеризованная этими маркерами, вероятно, происходит из двухнулевого генома Drakkar «00», присутствующего в облученном гетерозиготном гибриде «R211*DK».

Паттерн, наблюдавшийся для BolJon, предполагает, что событие рекомбинации привело в результате к формированию в семействе «R2000» особого сдвоенного участка, одна часть которого происходит от редьки, а другая - от B.oleracea.

1. Способ получения двухнулевых линий-восстановителей фертильности Brassica napus для мужской цитоплазматической стерильности (ЦМС) Ogura, представляющий собой интрогрессию редьки, несущую ген-восстановитель фертильности Rfo, вырезанный из аллели Pgi-2 редьки и рекомбинированный с геном Pgi-2 из Brassica oleracea, характеризующейся женской фертильностью, хорошим уровнем переноса Rfo и высокой вегетационной мощностью, где упомянутый способ включает следующие стадии: a) скрещивание двухнулевых ЦМС-линий ярового Brassica napus, содержащих вырезанную вставку генома редьки, с двухнулевой линией яровой Drakkar для формирования гетерозиготных растений с восстановленной фертильностью Brassica napus, b) облучение перед мейозом гетерозиготных растений с восстановленной фертильностью, полученных на стадии а), гамма-лучами, c) перекрестное опыление пыльцой из цветков, полученных на стадии b), с двухнулевой яровой ЦМС-линией Wesroona, d) тестирование потомства на мощность, женскую фертильность и уровень переноса гена ЦМС, e) селекция линий потомства.

2. Способ по п.1, где доза облучения на стадии b) составляет 65 Гр в течение 6 мин.

3. Способ по п.1, где двухнулевой ЦМС-линией ярового Brassica napus на стадии а) является R211.

4. Способ по п.1, где тестирование на стадии d) выполнялось с комбинацией пяти маркеров, избранных из PGIol, PGIUNT, PGIint, BolJon и СР418, где указанные маркеры имеют следующие нуклеотидные последовательности:

маркер PGIol:
TCATTTGA GTTGCGC TCGCCTTG GTGTTAT GAATGAA CAGTCAT 60
TT CTG TT GAT CAG TTA 120
ACATGTG AACTTAA GGCTCCG GTTGCAA ACATGGT TGTCAGC 180
GTT CAG GCT AAC TGC ACT 240
AATCTTG TATGAAT TGATTAA TGTTTGTT TGACTCTT TTCATTGT 248
CGG TTG ATT TG TC TC
GTTTTCGT AATAAAC ATGTATA TTTTTACA CTGAATTT TACCGGG
AC CGA АТС AA TC TCT
GATGTAC
A
маркер РGIUNT:
TCATTTGA GTTGCGC TCGCCTTG GTGTTAT GAATGAA CAGTCAT 60
TT CTG TT GAT CAG TTA 120
ACATGTG AACTTAA GGCTCCG GTTGCAA ACATGGT TGTCAGC 180
GTT CAG GCT AAC TGC ACT 240
AATCTTG TATGAAT TGATTAA TGTTTGTT TGACTCTT TTCATTGT 300
CGG TTG ATT TG TC TC 360
GTTTTCGT AATAAAC ATGTATA TTTTACAA TGAATTTT ACCGGGT 420
AC CGA АТС AC CT CTG 480
ATGTACA CTAGTCTC TGTTCTTG GATCATG TATTTTCT ATGTATTC 540
ATG CA GG ATT AC AG 600
ACAGTAC AGAAAGT CAAAACT GATGTTTT TTTACAGT GTGGAGA
AGA GTT CTG AA ТА AGT
TCGGCAT TCCGAAC GCATTTG TTTGGGA GGTTGGT AGGTACA
TGA AAT CAT CTG GGA GTG
GTAAGTG GTTTATTT TTGTATA TTCTCGTC TTTCCGCT CTTAGTGT
CTT GG AAT CA TG AT
AACTGAA CTTTTGCA TTGCAGT GTTGGAG TACCATT TCTACAG
ATT GT GCT TCT GTC TAT
GGCTTCTC TGGTTGA GTACGGT TTCTACTT TCAGCCA CATAAAA
TG GAA ACC ТА TCT TGT
CTTAGGC TTCTTTCT TTTATTTC TCTTAATG TTCTTCTT TTTTATTG 660
ATA AT CC AT TT CA 720
TTCCCGTT ATTTTCAA GTTGTTAC TCTCTAA AAGAAGA CTTCTTAG 780
TT AA TG АТС AAC ТА 840

GATCCAG ATATTCA TTTTTTAA TGGACTG GTTTTTAA GGGAGCT 900
CTG GCC AT CAG AG TCA 960
AGCATTG AGCATTT GTCCACA TTTGAGA ATATACC GAGTTGC 979
ATA CCA CCG AGA CGT ATT
AGTTGTG TTATACA TTCTTGTC TTTGCTAT CCATCAA TAGAGAT
TGA GTT TT GT CAC TCG
TGAAGTT AGTGTAG ACGCATA AGAGGTG GGTGACT GGACGAT
ATT TCA GGG ATT TTT TTC
AGGTGCT GGGTTAT
TTA TG
маркер PGIint:
CAGCACT CTTGCGG GAATTTG TTAAATTT TTGTTTGT СТСТТГСТ 60
AAT TAT TGA GT GA TC 120
ATTGTTCG TTCGTAC AAACCGA TATAATCT TACAAAC ATTTTCTA 180
TT AAT ATG TT TGA CC 240
GGGTCTG TACAATG GTCTCCAT TCTTGGG CATGATTT TTTCTACA 300
ATG СТА GT GAT AT TG 360
TATTCAG GTACAGA AAGTGTT AACTCTG GTTTTAAT ACAGTTA 420
АСА AGA CAA GAT TT GTG 480
GAGAAGT GCATTGA GAACAAT TTTGCATT GGGACTG TGGTGGA 540
TCG TCC GCA TT GGT AGG 600
TACAGTG AGTGCTT TATTTGGT TATAAAT TCGTCCAT CCGCTTG 660
GTA GTT TG TTC TT CTT 720
AGTGTAT TGAAATT TTGCAGTT CAGTGCT GGAGTCT CATTGTCT 780
AAC CTT TG GTT TAC CT 840
ACAGTAT TTCTCTGT TTGAGAA CGGTACC TACTTTAT GCCATCT 866
GGC GG GTA TTC CA CATAAGA
AAAATGT AGGCATA TTTCTATT ATTTCCCT TAATGAT AACCTT
CTT TTC TT CT TTC TTTAAAG
TATTGCAT CCGTTTTA TTCAAAA GTTACTGT CTAAATC GGG
TC TT GTT CT AAG TACCCGT
CTTAGTA CCAGCTG TTCAGCCT TTTAAATT ACTGCAG GAG
GAT ATA TT GG GTT TCAACAC
AGCTTCA ATTGATA ATTTCCA CACACCG GAGAAGA TAG
AGC AGC GTC TTT ATA GACTTTTG
TTGCATTA TGTGTGA TACAGTTT TTGTCTTT GCTATGT GA
GT TTA TC TT CCA
AGATTCG AGTTATT GTAGTCA CATAGGG GGTGATT
TGA AGT ACG AGA GGT
CGATTTC TGCTTTAG TTATTG
AGG GG

маркер BolJon:
GATCCGA TTCTCCTG GAGATCA CCAAACA AACAACT ACACAAA 60
TTC TT GCT TCA TGT TAT 120
CTTTACTT TAAATGG ATGACAA ATAGAAA TTGCTCAT TATTGTAC 180
GC AAC GAG АТС AG AA 240
GGGATAA TGTAGAA AAACCGT TAAGATT TCCCTGAT TCTCACTT 300
CAG AAC CTG TTC CC AA 360
CCAGTAG TTTTTCAC TGAAGCG ATCTACTT GTATTCA AATAAAA 420
GCG AT CAT TG CTG AAA 480
GAAAGCT AACATGT GGATATA GCATTGA ACCAAGT CACAAAC 540
GGT GAA CAA TAC AGT TAC 600
ATTATAA TCAGACC GTTCACA TGGCCTC GACCACC TCTAGCA 660
AGG TTT TTC CAG GCT AAG 720
TTAAGCG CATGGTC ACGTATA ATGAAAA TTCTATCA ATCCTAT 780
TAA TGC CAA TGT AA AAA 840
ATAGAGC ATAACAT CGATACA TTTCACTA TCTGCAA CTAAACA 900
TCT TGT TAG AC GTA CAT 957
ATACAAA AACTATG ACAGATC ACTACTA AACACAG TATGACA
CAA CGA AAA CAG TTC CTG
TCGATAG CATCCTCT AAGTACC GAGATAG ATGAAAC GTAAACA
TAA GC AAA CAA TAT AAT
CAAAATT AATTTCTC TCACAAG CTACAGA GAGTTAT AACATTTT
СТА CA GAC ATA CAT CT
GTAAATA CCATCAA GACTAGA CAGAGTT ATAACAT CTGTAAA
TTT AAT GAA CTT TAT TGT
TCCAACA CCACTAC GCAGAGT TATAACA TCTGTAA TCCAATC
AAA ATA TCT TTG ATG AAA
ACCACTA AACAAAG CTATAAC GTTTATAC AGTTTCA AATCTAC
CAG CTC ATT AA СТА AAA
CTTTCCCC AAATGAG AATATCA AAAGATG CAATCAG AAGAGTA
GT CTT CCC TTT ATA CGA
CATCGTTT AGATTAG AAACTGA TTACGTA TGATTTG AGTAGGC
TG AAC AAC GAG AGG
маркер СР418:
AATTTCTC TCACAAG CTACAGA GAGTTAT AACATTTT GTAAATA 60
CA GAC ATA CAT CT TTT 120
CCATCAA GACTAGA CAGAGTT ATAACAT CTGTAAA TCCAACA 180
AAT GAA CTT TAT TGT AAA 240
CCACTAC GCAGAGT TATAACA TCTGTAA TCCAATC ACCACTA 300
ATA TCT TTG ATG AAA CAG 360
AACAAAG CTATAAC GTTTATAC AGTTTCA AATCTAC CTTTCCCC 420
CTC ATT AA СТА AAA GT 480

AAATGAG AATATCA AAAGATG CAATCAG AAGAGTA ACATCGT 540
CTT CCC TTT ATA ACG TTT 600
GAGATTA CAAACTG CTTACGT GTGATTT GAGTAGG GTTGCCA 660
GAA AAA AGA GAG CTC GCA 672
GAGCTAG TCTCCTCC CTCATGA ATCTGTTG CCTGAGA CCGTGAC
CTC GC AGC CA CAA GAA
ACTTTCCG CACCGCC AGAATTC GCCGCGC GGAAGGA GAATCGG
AT ACC GAC АТС TCC GAA
CTGAGTG CCGAGCG CCGGGAG GACGGAG TGGGAAA GAGTGGC
AAC АТС TGC CGA AGA ACG
ATTTCGA AGAGTGG AGGAGAG GGTGGAT CTCGCGT ATCAAGT
CGA AAG GGT AAA ATG TCG
TCATCGTC GATTGCC ATTTTTTT TCAGGGC CTGTGGC GAAGTTT
CT GCC TG GCT TTA CCG
atgtcaatga ac

5. Применение комбинации по меньшей мере четырех маркеров PGIol, PGIint, BolJon и СР418 или какой-либо части их, содержащей по меньшей мере один полиморфный сайт, для характеризации рекомбинированной линии-восстановителя фертильности Brassica napus для ЦМС Ogura, содержащей вставку Rfo, вырезанную из аллели Pgi-2 редьки рекомбинированную с геном Pgi-2 Brassica oleracea, характеризующееся женской фертильностью, хорошим уровнем переноса Rfo и высокой вегетационной мощностью, где указанные маркеры имеют следующие нуклеотидные последовательности:

маркер PGIol:
TCATTTGA GTTGCGC TCGCCTTG GTGTTAT GAATGAA CAGTCAT 60
ТТ CTG ТТ GAT CAG TTA 120
ACATGTG ААСТТАА GGCTCCG GTTGCAA ACATGGT TGTCAGC 180
GTT CAG GCT AAC TGC ACT 240
AATCTTG TATGAAT TGATTAA TGTTTGTT TGACTCTT TTCATTGT 248
CGG TTG АТТ TG ТС ТС
GTTTTCGT ААТАААС ATGTATA ТТТТТАСА CTGAATTT TACCGGG
АС CGA АТС АА TC ТСТ
GATGTAC
А

маркер PGIint:
CAGCACT CTTGCGG GAATTTG TTAAATTT TTGTTTGT CTCTTTCT 60
AAT TAT TGA GT GA TC 120
ATTGTTCG TTCGTAC AAACCGA TATAATCT TACAAAC ATTTTCTA 180
TT AAT ATG TT TGA CC 240
GGGTCTG TACAATG GTCTCCAT TCTTGGG CATGATTT TTTCTACA 300
ATG СТА GT GAT AT TG 360
TATTCAG GTACAGA AAGTGTT AACTCTG GTTTTAAT ACAGTTA 420
АСА AGA CAA GAT TT GTG 480
GAGAAGT GCATTGA GAACAAT TTTGCATT GGGACTG TGGTGGA 540
TCG TCC GCA TT GGT AGG 600
TACAGTG AGTGCTT TATTTGGT TATAAAT TCGTCCA7 CCGCTTG 660
GTA GTT TG TTC TT CTT 720
AGTGTAT TGAAATT TTGCAGTT CAGTGCT GGAGTCT CATTGTCT 780
AAC CTT TG GTT TAC CT 840
ACAGTAT TTCTCTGT TIGAGAAG CGGTACC TACTTTAT GCCATCT 866
GGC GG ТА TTC CA CAT
AAAATGT AGGCATA TTTCTATT ATTTCCCT TAATGAT TTCTTTTT
CTT TTC TT CT TTC TT
TATTGCAT CCGTTTTA TTCAAAA GTTACTGT CTAAATC AAGAAAC
TC TT GTT CT AAG CTT
CTTAGTA CCAGCTG TTCAGCCT TTTAAATT ACTGCAG TTTAAAG
GAT ATA TT GG GTT GGG
AGCTTCA ATTGATA ATTTCCA CACACCG GAGAAGA TACCCGT
AGC AGC GTC TTT ATA GAG
TTGCATTA TGTGTGA TACAGTTT TTGTCTTT GCTATGT TCAACAC
GT TTA TC TT CCA TAG
AGATTCG AGTIATTA GTAGTCA CATAGGG GGTGATT GACTTTTG
TGA GT ACG AGA GGT GA
CGATTTC TGCTTTAG TTATTG
AGG GG

маркер BolJon:
GATCCGA TTCTCCTG GAGATCA CCAAACA AACAACT ACACAAA 60
TTC TT GCT TCA TGT TAT 120
CTTTACTT TAAATGG ATGACAA ATAGAAA TTGCTCAT TATTGTAC 180
GC AAC GAG АТС AG AA 240
GGGATAA TGTAGAA AAACCGT TAAGATT TCCCTGAT TCTCACTT 300
CAG AAC CTG TTC CC AA 360
CCAGTAG TTTTTCAC TGAAGCG ATCTACTT GTATTCA AATAAAA 420
GCG AT CAT TG CTG AAA 480
GAAAGCT AACATGT GGATATA GCATTGA ACCAAGT CACAAAC 540
GGT GAA CAA TAC AGT TAC 600
ATTATAA TCAGACC GTTCACA TGGCCTC GACCACC TCTAGCA 660
AGG TTT TTC CAG GCT AAG 720
TTAAGCG CATGGTC ACGTATA ATGAAAA TTCTATCA ATCCTAT 780
TAA TGC CAA TGT AA AAA 840
ATAGAGC ATAACAT CGATACA TTTCACTA TCTGCAA CTAAACA 900
TCT TGT TAG AC GTA CAT 957
ATACAAA AACTATG ACAGATC ACTACTA AACACAG TATGACA
CAA CGA AAA CAG TTC CTG
TCGATAG CATCCTCT AAGTACC GAGATAG ATGAAAC GTAAACA
TAA GC AAA CAA TAT AAT
CAAAATT AATTTCTC TCACAAG CTACAGA GAGTTAT AACATTTT
СТА CA GAC ATA CAT CT
GTAAATA CCATCAA GACTAGA CAGAGTT ATAACAT CTGTAAA
TTT AAT GAA CTT TAT TGT
TCCAACA CCACTAC GCAGAGT TATAACA TCTGTAA TCCAATC
AAA ATA TCT TTG ATG AAA
ACCACTA AACAAAG CTATAAC GTTTATAC AGTTTCA AATCTAC
CAG CTC ATT AA СТА AAA
CTTTCCCC AAATGAG AATATCA AAAGATG CAATCAG AAGAGTA
GT CTT CCC TTT ATA CGA
CATCGTTT AGATTAG AAACTGA TTACGTA TGATTTG AGTAGGC
TG AAC AAC GAG AGG
маркер СР418:
AATTTCTC TCACAAG CTACAGA GAGTTAT AACATTTT GTAAATA 60
CA GAC ATA CAT CT TTT 120
CCATCAA GACTAGA CAGAGTT ATAACAT CTGTAAA TCCAACA 180
AAT GAA CTT TAT TGT AAA 240
CCACTAC GCAGAGT TATAACA TCTGTAA TCCAATC ACCACTA 300
ATA TCT TTG ATG AAA CAG 360
AACAAAG CTATAAC GTTTATAC AGTTTCA AATCTAC CTTTCCCC 420
CTC ATT AA СТА AAA GT 480

AAATGAG ААТАТСА AAAGATG CAATCAG AAGAGTA ACATCGT 540
СТТ ССС ТТТ АТА ACG ТТТ 600
GAGATTA CAAACTG CTTACGT GTGATTT GAGTAGG GTTGCCA 660
GAA ААА AGA GAG СТС GCA 672
GAGCTAG ТСТССТСС CTCATGA ATCTGTTG CCTGAGA CCGTGAC
СТС GC AGC СА САА GAA
ACTTTCCG CACCGCC AGAATTC GCCGCGC GGAAGGA GAATCGG
AT АСС GAC АТС ТСС GAA
CTGAGTG CCGAGCG CCGGGAG GACGGAG TGGGAAA GAGTGGC
ААС АТС TGC CGA AGA ACG
ATTTCGA AGAGTGG AGGAGAG GGTGGAT CTCGCGT ATCAAGT
CGA AAG GGT ААА ATG TCG
TCATCGTC GATTGCC АТТТТТТТ TCAGGGC CTGTGGC GAAGTTT
СТ GCCac TG GCT ТТА CCG
atgtcaatga

6. Применение по п.5, где комбинация указанных маркеров дополнительно включает маркер PGIUNT и состоит из пяти маркеров PGIol, PGIUNT, PGIint, BolJon и СР418, где указанный маркер PGIUNT имеет следующую нуклеотидную последовательность:

TCATTTGA GTTGCGC TCGCCTTG GTGTTAT GAATGAA CAGTCAT 60
TT CTG TT GAT CAG ТТА 120
ACATGTG AACTTAA GGCTCCG GTTGCAA ACATGGT TGTCAGC 180
GTT CAG GCT ААС TGC ACT 240
AATCTTG TATGAAT TGATTAA TGTTTGTT TGACTCTT TTCATTGT 300
CGG TTG ATT TG TC TC 360
GTTTTCGT AATAAAC ATGTATA TTTTACAA TGAATTTT ACCGGGT 420
AC CGA АТС AC СТ CTG 480
ATGTACA CTAGTCTC TGTTCTTG GATCATG TATTTTCT ATGTATTC 540
ATG СА GG ATT AC AG 600
ACAGTAC AGAAAGT CAAAACT GATGTTTT TTTACAGT GTGGAGA
AGA GTT CTG AA ТА AGT
TCGGCAT TCCGAAC GCATTTG TTTGGGA GGTTGGT AGGTACA
TGA AAT CAT CTG GGA GTG
GTAAGTG GTTTATTT TTGTATA TTCTCGTC TTTCCGCT CTTAGTGT
СТТ GG AAT СА TG AT
AACTGAA CTTTTGCA TTGCAGT GTTGGAG TACCATT TCTACAG
ATT GT GCT TCT GTC TAT
GGCTTCTC TGGTTGA GTACGGT TTCTACTT TCAGCCA CATAAAA
TG GAA АСС ТА TCT TGT

CTTAGGC TTCTTTCT TTTATTTC TCTTAATG TTCTTCTT TTTTATTG 660
ATA Al CC AT TT CA 720
TTCCCGTT ATTTTCAA GTTGTTAC TCTCTAA AAGAAGA CTTCTTAG 780
TT АД TG АТС AAC ТА 840 900
GATCCAG ATATTCA TTTTTTAA TGGACTG GTTTTTAA GGGAGCT
CTG GCC AT CAG AG TCA 960
AGCATTG AGCATTT GTCCACA TTTGAGA ATATACC GAGTTGC 979
ATA CCA CCG AGA CGT ATT
AGTTGTG TTATACA TTCTTGTC TTTGCTAT CCATCAA TAGAGAT
TGA GTT TTACGCA GT CAC TCG
TGAAGTT AGTGTAG TAGGG AGAGGTG GGTGACT GGACGAT
ATT TCA ATT TTT TTC
AGGTGCT GGGTTAT
TTA TG

7. Применение по п.5 или 6, где
маркер PGIol амплифицируется с использованием праймеров PGIol U и PGIol L, имеющих следующие последовательности:
PGIol U: 5'TCATTTGATTGTTGCGCCTG3';
PGIol L: 5'TGTACATCAGACCCGGTAGAAAA3';
маркер PGIint амплифицируется с использованием праймеров PGIint U и PGIint L, имеющих следующие последовательности:
PGImtU: 5'CAGCACTAATCTTGCGGTATG3';
PGIint L: 5'CAATAACCCTAAAAGCACCTG3';
маркер PGIUNT амплифицируется с использованием праймеров PGIol U и PGIint L, имеющих следующие последовательности:
PGIol U: 5'TCATTTGATTGTTGCGCCTG3';
PGIint L: 5'CAATAACCCTAAAAGCACCTG3';
маркер BolJon амплифицируется с использованием праймеров BolJon U и BolJon L, имеющих следующие последовательности:
BolJon U: 5'ATCCGATTCTTCTCCTGTTG5';
BolJon L: 5'GCCTACTCCTCAAATCACTCT3';
маркер СР418 амплифицируется с использованием праймера рСР418 L, имеющего следующую последовательность:
рСР418 L: 5'AATTTCTCCATCACAAGGACC3'.



 

Похожие патенты:

Изобретение относится к области биотехнологии и может быть использовано для определения целостности хроматина/ДНК в сперматозоидах животных. .

Изобретение относится к генетической инженерии, в частности к идентификации генов, участвующих в адаптации организма в среде его обитания, и может быть использовано для создания рекомбинантной бактерии с пониженной адаптацией к конкретной окружающей среде.
Изобретение относится к области медицины, а именно к эндокринологии. .

Изобретение относится к медицине, кардиологии, а именно к диагностике атеросклероза. .

Изобретение относится к медицине, конкретно к урологии и андрологии, и может быть использовано для определения локализации инфекций в мочеполовом тракте у мужчин. .

Изобретение относится к области генетической инженерии, конкретно к процессам идентификации нуклеиновых кислот (НК), и может быть использовано для регенерации устройств многоразового использования для гибридизации НК, биочипов и ДНК-чипов.

Изобретение относится к микробиологии, биотехнологии и медицине. .

Изобретение относится к генетической инженерии, в частности к идентификации генов, участвующих в адаптации организма в среде его обитания, и может быть использовано для создания рекомбинантной бактерии с пониженной адаптацией к конкретной окружающей среде.

Изобретение относится к биотехнологии и касается белка протеазы NS3/4A HCV или его биологически активного фрагмента, который содержит последовательность, в которой остаток аминокислоты, который соответствует аминокислоте 156 протеазы NS3/4A HCV дикого типа, не является остатком аланина и, необязательно, остаток аминокислоты, который соответствует аминокислоте 168 протеазы NS3/4A HCV дикого типа, не является аспарагиновой кислотой.

Изобретение относится к биотехнологии и представляет собой способ получения L-аминокислоты с использованием бактерии рода Escherichia, причем бактерия модифицирована таким образом, что активность алкогольдегидрогеназы, кодируемой геном adhE, у этой бактерии увеличена.

Изобретение относится к идентификации непептидных ингибиторов катепсина G. .

Изобретение относится к биотехнологии и представляет собой мутантную ацетолактатсинтазу бактерий (AHAS I), в которой L-аминокислота в позиции 17, 30 и/или 33 в малой субъединице природной ацетолактатсинтазы из Escherichia coli заменена на другую L-аминокислоту или несколько L-аминокислот встроены в указанную позицию или позиции, и ингибирование валином по типу обратной связи в указанной субъединице ослаблено.

Изобретение относится к области биотехнологии и молекулярной биологии и может быть использовано в медицине и ветеринарии, а также в исследованиях бактериальной обсемененности бактериями рода Yersinia эпидемиологически значимых объектов.

Изобретение относится к молекулярной биологии, биохимии и биоорганической химии и может быть использовано для анализа взаимодействия РНК с РНК-связывающимися молекулами.

Изобретение относится к способу получения двухнулевых линий-восстановителей фертильности рапса Brassica napus с цитоплазматической мужской стерильностью Ogura, представляющего собой интрогрессию редьки, несущую ген-восстановитель фертильности Rfo, вырезанный из аллели Pgi-2 редьки и рекомбинированный с геном Pgi-2 Brassica oleracea, имеющих хорошее агрономическое качество, отличающееся женской фертильностью, хорошим уровнем переноса Rfo и высокой вегетационной мощностью

Наверх