Ген mmp8opt металлопротеиназы 8

Изобретение относится к биотехнологии и представляет собой ген металлопротеиназы 8 с последовательностью нуклеотидов, приведенной на чертеже. Изобретение позволяет при включении данного гена в состав вектора экспрессии обеспечивать высокий уровень экспрессии металлопротеиназы 8 в клетках. 3 ил.

 

Изобретение относится к области биотехнологии, а именно к генно-инженерным конструкциям для экспрессии трансгенов в клетках млекопитающих с целью их применения в клеточной инженерии и в генной терапии, а именно к модификации последовательности гена для трансфекции клеток печени in vivo с целью экспрессии в них металлопротеиназы 8.

Металлопротеиназы представляют собой ферменты, расщепляющие белки, которые находят широкое применение в пищевой и легкой промышленности, в сельском хозяйстве, а также в медицине. В частности, матриксные металлопротеиназы обладают способностью расщеплять коллаген - основной компонент внеклеточного матрикса, и расщепление коллагена под действием этих ферментов приводит к уменьшению степени фиброза и к улучшению кровоснабжения клеток печени (Siller-Lopez F, et al. Gastroenterology 2004; 126: 1122-1133; IredaleJP, Gastroenterology. 2004 126(4): 1199-201). Для продуцирования ММР8 используют ДНК, содержащую природный ген металлопротеиназы 8 человека (Garcia-Bañuelos J, et al. Gene Theraphy. 2002 Jan; 9(2): 127-34).

Технической задачей, решаемой авторами настоящего изобретения, являлось создание гена металлопротеиназы 8, при включении которого в состав эукариотического вектора обеспечивался бы более высокий уровень экспрессии названного белка в клетках, трансфицированных названным вектором.

Технический результат достигался созданием гена MMP8opt путем модификации природной последовательности гена ММР 8 таким образом, чтобы триплет нуклеотидов, кодирующий каждую из аминокислот белковой последовательности ММР 8, встречался в генах человека наиболее часто.

На фиг.1. показана последовательность нуклеотидов гена MMP8opt, а также последовательность аминокислот кодируемого белкового продукта - матриксной металлопротеиназы 8 человека.

На фиг.2 показан предназначенный для клонирования участок ДНК вектора рВА, а на фиг.3 - функциональная карта плазмиды pC4W-MMP8opt

Синтез гена и плазмиды осуществляли с помощью стандартной технологии и оборудования, применяемых для решения подобных задач в генной инженерии (Watson, J.D., Gilman, M., Witkowski, J., Zoller, M. - Recombinant DNA, Scientific American Books, New York, 1992). Дизайн оптимизированной последовательности нуклеотидов, кодирующей матриксную металлопротеиназу человека ММР 8, производили, основываясь на вырожденности генетического кода. Для каждой аминокислоты белковой последовательности ММР 8 выбирали кодирующий ее триплет нуклеотидов, наиболее часто встречающийся в генах человека. При этом использовали частоты встречаемости кодонов, приведенные на вэб-сайте http://del.mediaglyphs.org/mg/bf/nucs_aa.html. Полученная таким образом последовательность нуклеотидов представлена на фиг.1.

Плазмиду pC4W-MMP8opt, несущую оптимизированный ген MMP8opt, получали методом генно-инженерного конструирования в 6 стадий.

На первой стадии изготавливали вектор для клонирования рВА. Для этого химически синтезированные пары олигонуклеотидов

VEC-89 (AAGCTTGGCATTCCGGTACTGTTGGTAAAGCCAC) и

VEC-90 (CCATGGTGGCTTTACCAACAGTACCGGAATGCCA),

VEC-91 (CATGGAGATCTCGTCTCTGGCCATCCCGGG) и

VEC-92 (CGGAACCCGGGATGGCCAGAGACGAGATCTC),

VEC-93 (TTCCGGATGTCTTCGATATCTGCAGGATCCT) и

VEC-94(CTAGAGGATCCTGCAGATATCGAAGACATC),

отжигали, смешивали и клонировали в расщепленный рестриктазами HindIII и XbaI вектор pBluescriptII-SK+. В результате вектор рВА имеет предназначенный для клонирования участок ДНК, представленный на фиг.2.

На второй стадии:

- в вектор рВА, расщепленный рестриктазами NcoI и ВаmHI, клонировали химически синтезированные пары олигонуклеотидов

ММР-101 (CATGTTCTCCCTGAAAACCCTGCCCTTCCTGC) и

MMP-102(GCAGCAGCAGGAAGGGCAGGGTTTTCAGGGAGAA),

ММР-103 (TGCTGCTGCACGTGCAGATCTCCAAGGCCTTC) и

ММР-104 (CACGGGGAAGGCCTTGGAGATCTGCACGTGCA),

ММР-105m (CCCGTGTCCTCCAAGGAGAAGAACACCAAGACCGTGCAATGTCTTCG) и

MMP-106m(GATCCGAAGACATTGCACGGTCTTGGTGTTCTTCTCCTTGGAGGA)

с получением промежуточной плазмиды pBD-MMP8-N1-D2;

- в вектор рВА, расщепленный рестриктазами BsmBI и ВаmHI, клонировали химически синтезированные пары олигонуклеотидов ММР-107 m

(GATCCGAAGACATTGCAGGACTACCTGGAGAAGTTCTACCAGCTGCCCAG) и ММР-108 m

(TGGTTGCTGGGCAGCTGGTAGAACTTCTCCAGGTAGTCCTGCAATGTCTTCG),

ММР-109 (CAACCAGTACCAGTCCACCAGGAAGAACGGCACCAAC) и

ММР-110 (GATCACGTTGGTGCCGTTCTTCCTGGTGGACTGGTAC),

ММР-111 (GTGATCGTGGAGAAGCTGAAGGAGATGCAGCGGTTCTTC) и

ММР-112 (GGCCGAAGAACCGCTGCATCTCCTTCAGCTTCTCCAC) с получением промежуточной плазмиды pBD-MMP8-D2-B3;

- в вектор рВА, расщепленный рестриктазами BsmBI и BbsI, клонировали химически синтезированные пары олигонуклеотидов

ММР-113 (GGCCTGAACGTGACCGGCAAGCCCAACGAGGAGACCCTGGACATGA) и

ММР-114 (TCTTCATCATGTCCAGGGTCTCCTCGTTGGGCTTGCCGGTCACGTTCA),

MMP-115 (TGAAGAAGCCTCGCTGCGGCGTGCCCGACAGCGGCGGCTTCATGCT) и

ММР-116 (GGGGTCAGCATGAAGCCGCCGCTGTCGGGCACGCCGCAGCGAGGCT),

MMP-117 (GACCCCAGGCAACCCCAAGTGGGAGCGCACCAACCTGACCTACAGAAT) и

ММР-118 (CCGGATTCTGTAGGTCAGGTTGGTGCGCTCCCACTTGGGGTTGCCT)

с получением промежуточной плазмиды рВА-ММР8-В3-А4;

- в вектор рВА, расщепленный рестриктазами BsmBI и BbsI, клонировали химически синтезированные пары олигонуклеотидов

ММР-119 (CCGGAACTACACCCCACAGCTGTCCGAGGCCGAGGTG) и

MMP-120(TCTCTCCACCTCGGCCTCGGACAGCTGTGGGGTGTAGTT),

ММР-121 (GAGAGAGCCATCAAGGACGCCTTCGAGCTGTGGA) и

ММР-122 (CCACGCTCCACAGCTCGAAGGCGTCCTTGATGGC),

MMP-123 (GCGTGGCCTCCCCTCTGATCTTCACCAGGATCTCCCAGGGCGA) и

ММР-124 (GGCCTCGCCCTGGGAGATCCTGGTGAAGATCAGAGGGGAGG) с получением промежуточной плазмиды рВА-ММР8-А4-В5;

- в вектор рВА, расщепленный рестриктазами BsmBI и BbsI, клонировали химически синтезированные пары олигонуклеотидов

ММР-125 (GGCCGACATCAACATCGCCTTCTACCAGAG) и

ММР-126 (TGGTCTCTCTGGTAGAAGGCGATGTTGATGTC),

ММР-127 (AGACCACGGCGACAACTCCCCCTTCGACGG) и

ММР-128 (TTGGGGCCGTCGAAGGGGGAGTTGTCGCCG),

ММР-129 (CCCCAACGGCATCCTGGCCCACGCCTTCCAGC) и

ММР-130 (CCGGGCTGGAAGGCGTGGGCCAGGATGCCG) с получением промежуточной плазмиды рВА-ММР8-В5-А6;

- в вектор рВА, расщепленный рестриктазами BsmBI и BbsI, клонировали химически синтезированные пары олигонуклеотидов

ММР-131 (CCGGCCAGGGCATCGGCGGCGACGCCCACTTCGACGCC) и

ММР-132 (CTCCTCGGCGTCGAAGTGGGCGTCGCCGCCGATGCCCTGG),

ММР-133 (GAGGAGACCTGGACCAACACCTCCGCCAACTACAACCTGT) и

ММР-134 (CCAGGAACAGGTTGTAGTTGGCGGAGGTGTTGGTCCAGGT),

MMP-135 (TCCTGGTGGCCGCCCACGAGTTCGGCCACTCCCTGGGCCT) и

MMP-136 (GGCCAGGCCCAGGGAGTGGCCGAACTCGTGGGCGGCCA)

с получением промежуточной плазмиды рВА-ММР8-А6-В7;

- в вектор рВА, расщепленный рестриктазами BsmBI и BbsI, клонировали химически синтезированную пару олигонуклеотидов

MMP-137 (GGCCCACTCCTCTGACCCTGGCGCCCTGATGTACCCCAACTACGC) и

MMP-138 (CTGAAGGCGTAGTTGGGGTACATCAGGGCGCCAGGGTCAGAGGAGTG),

MMP-139 (CTTCAGGGAGACCAGCAACTACTCCCTGCCTCAGGACGACATCGA) и

MMP-140 (ATGCCGTCGATGTCGTCCTGAGGCAGGGAGTAGTTGCTGGTCTCC),

MMP-141 (CGGCATCCAGGCCATCTACGGCCTGTCCAGCAACCCCATCCAGCCCA) и

MMP-142 (CCGGTGGGCTGGATGGGGTTGCTGGACAGGCCGTAGATGGCCTGG) с получением промежуточной плазмиды рВА-ММР8-В7-А8;

- в вектор рВА, расщепленный рестриктазами HindIII и BbsI, клонировали химически синтезированные пары олигонуклеотидов

ММР-143 (CCGGCCCCAGCACCCCCAAGCCCTGCGACCCCAGCCTG) и

MMP-144 (GAAGGTCAGGCTGGGGTCGCAGGGCTTGGGGGTGCTGGGG),

ММР-145 (ACCTTCGACGCCATCACCACCCTGCGGGGCGAGATCCTG) и

MMP-146 (GAAGAACAGGATCTCGCCCCGCAGGGTGGTGATGGCGTC),

MMP-147m (TTCTTCAAGGACAGGTACTTCTGGAGAAGGCACCCCCAGCTGCAAGAGACGA) и MMP-148m (AGCTTCGTCTCTTGCAGCTGGGGGTGCCTTCTCCAGAAGTACCTGTCCTT) с получением промежуточной плазмиды pDA-MMP8-A8-D9;

- в вектор рВА, расщепленный рестриктазами BsmBI и BamHI, клонировали химически синтезированные пары олигонуклеотидов

MMP-149m (GATCCGAAGACATTGCAGAGAGTGGAGATGAACTTCATCTCTCTGTTCTGGC) и

ММР-150 m (GGGAGGGCCAGAACAGAGAGATGAAGTTCATCTCCACTCTCTGCAATGTCTTCG),

ММР-151 (CCTCCCTGCCCACCGGCATCCAGGCCGCCTACGAGGACTTC) и

ММР-152 (TCTGTCGAAGTCCTCGTAGGCGGCCTGGATGCCGGTGGGCA),

MMP-153 (GACAGAGACCTGATCTTCCTGTTCAAGGGCAACCAGTACTG) и

ММР-154 (GGCCCAGTACTGGTTGCCCTTGAACAGGAAGATCAGGTC)

с получением промежуточной плазмиды pBD-MMP8-D9-B10;

- в вектор рВА, расщепленный рестриктазами BsmBI и BamHI, клонировали химически синтезированные пары олигонуклеотидов

ММР-155 (GGCCCTGAGCGGCTACGACATCCTGCAGGGCTACC) и

ММР-156 (CTTGGGGTAGCCCTGCAGGATGTCGTAGCCGCTCAG),

ММР-157m (CCAAGGACATCTCCAACTACGGCTTCCCCAGCAGCGTGCAATGTCTTCG) и

ММР-158m (GATCCGAAGACATTGCACGCTGCTGGGGAAGCCGTAGTTGGAGATGTC)

с получением промежуточной плазмиды pBD-MMP8-B10-Dl 1;

- в вектор рВА, расщепленный рестриктазами HindIII и BbsI, клонировали химически синтезированные пары олигонуклеотидов

ММР-159 m (AGCTTCGTCTCTTGCAGGCCATCGACGCCGCCGTGTTCTACAGAAGCAAGACCTA) и ММР-160 m

(AAGAAGTAGGTCTTGCTTCTGTAGAACACGGCGGCGTCGATGGCCTGCAAGAGAC GA),

ММР-161 (CTTCTTCGTGAACGACCAGTTCTGGAGATACGACAACCAGAGAC) и

ММР-162 (TGAACTGTCTCTGGTTGTCGTATCTCCAGAACTGGTCGTTCACG),

ММР-163 (AGTTCATGGAGCCCGGCTACCCCAAGAGCATCTCCGGCGCCTTCC) и

ММР-164 (CCGGGGAAGGCGCCGGAGATGCTCTTGGGGTAGCCGGGCTCCA)

с получением промежуточной плазмиды pDA-MMPS-D11-A12;

- в вектор рВА, расщепленный рестриктазами BsmBI и BbsI, клонировали химически синтезированные пары олигонуклеотидов

ММР-165 (CCGGCATCGAGAGCAAGGTGGACGCCGTGTTCCAGC) и

ММР-166 (GCTCCTGCTGGAACACGGCGTCCACCTTGCTCTCGATG),

ММР-167 (AGGAGCACTTCTTCCACGTGTTCAGCGGCCCCAGATAC) и

ММР-168 (GGCGTAGTATCTGGGGCCGCTGAACACGTGGAAGAAGT),

MMP-169 (TACGCCTTCGACCTGATCGCCCAGAGAGTGACCAGAGT) и

ММР-170 (GGCCACTCTGGTCACTCTCTGGGCGATCAGGTCGAA)

с получением промежуточной плазмиды рВА-ММР8-А12-В13;

- в вектор рВА, расщепленный рестриктазами BsmBI и EcoRV, клонировали химически синтезированную пару олигонуклеотидов

ММР-171 (GGCCAGAGGCAACAAGTGGCTGAACTGCAGATACGGCTGAT) и

ММР-172 (ATCAGCCGTATCTGCAGTTCAGCCACTTGTTGCCTCT) с получением промежуточной плазмиды рВА-ММР8-В13-Е14.

Встраивание соответствующих последовательностей ДНК подтверждали секвенированием.

На третьей стадии;

- Bbsl - BsmBI фрагмент плазмиды pBD-MMP8-D2-B3 и BsmBI - XbaI фрагмент плазмиды рВА-ММР8-В3-А4 клонировали в плазмиду pBD-MMP8-Nl-D2, расщепленную рестриктазами BbsI и XbaI, с получением новой промежуточной плазмиды рВА-ММР8-Н1-А4;

- BsmBI - Bbsl фрагмент плазмиды рВА-ММР8-В5-А6 и BamHI - BsmBI фрагмент плазмиды рВА-ММР8-А4-В5 клонировали в плазмиду рВА-ММР8-А6-В7, расщепленную рестриктазами BbsI и BamHI, с получением новой промежуточной плазмиды рВА-ММР8-А4-В7;

- ВаmHI - BsmBI фрагмент плазмиды pDA-MMP8-A8-D9 клонировали в плазмиду pBD-MMP8-D9-B10, расщепленную рестриктазами Bbsl и ВаnHI, с получением новой промежуточной плазмиды

рВА-ММР8-А8-В10;

- XhoI - BbsI фрагмент плазмиды pBD-MMP8-B10-D11 клонировали в плазмиду pDA-MMP8-D11-A12, расщепленную рестриктазами XhoI и BsmBI, с получением новой промежуточной плазмиды рВА-ММР8-В10-А12;

- ВаmHI - BsmBI фрагмент плазмиды рВА-ММР8-А12-В13 и BsmBI - EcoRV фрагмент плазмиды рВА-ММ81-В13-Е14 клонировали в плазмиду рВА, расщепленную рестриктазами BglII и EcoRV, с получением новой промежуточной плазмиды рВА-ММР8-А12-Е14.

Встраивание соответствующих последовательностей ДНК подтверждали рестриктным анализом полученных плазмид.

На четвертой стадии Bbsl - ВаmHI фрагмент плазмиды рВА-ММР8-А12-Е14 клонировали в плазмиду рВА-ММР8-В10-А12, расщепленную рестриктазами BbsI и ВаmHI, с получением новой промежуточной плазмиды рВА-ММР8-В10-Е14. Встраивание соответствующих последовательностей ДНК подтверждали рестриктным анализом полученной плазмиды.

На пятой стадии:

- BbsI - BglII фрагмент плазмиды рВА-ММР8-А4-В7 клонировали в плазмиду рВА-ММР8-Н1-А4, расщепленную рестриктазами BbsI и ВаmHI, с получением новой промежуточной плазмиды рВА-ММР8-Н1-В7;

- BbsI - BsmBI фрагмент плазмиды рВА-ММР8-А8-В10 и BsmBI - ВаmHI фрагмент плазмиды рВА-ММР8-В10-Е14 клонировали в плазмиду рВА-ММР8-В7-А8, расщепленную рестриктазами BbsI и ВаmHI, с получением новой промежуточной плазмиды рВА-ММР8-В7-Е14;

Встраивание соответствующих последовательностей ДНК подтверждали рестриктным анализом полученных плазмид.

На шестой стадии HindIII - BsmBI фрагмент плазмиды рВА-ММР8-Н1-В7 и BsmBI - XbaI фрагмент плазмиды рВА-ММР8-В7-Е14 клонировали в экспрессионный вектор pC4W, расщепленный рестриктазами HindIII и XbaI, с получением конечной плазмиды pC4W-MMP8opt. Встраивание соответствующих последовательностей ДНК подтверждали рестриктным анализом и секвенированием полученной плазмиды.

Функциональная карта плазмиды pC4W-MMP8opt, несущей ген MMP8opt и предназначенной для экспрессии гена матриксной металлопротеиназы 8 в клетках млекопитающих, представлена на фиг.3.

Эффективность заявляемого изобретения иллюстрируется следующим примером.

Пример. Клетки НЕК293, высеянные в лунки 24-луночной плашки (50000 клеток на лунку) в среде DMEM, содержащей 2% эмбриональной телячьей сыворотки, трансфицировали плазмидой pC4W-MMP8opt, несущей оптимизированный ген матриксной металлопротеиназы 8 человека MMP8opt. Трансфекцию проводили с использованием 1 мкг ДИК и 1 мкл реагента Липофектамин 2000 (Invitrogen) в соответствии с протоколом производителя. Через 24 ч после трансфекции культуральную среду заменяли на свежую. Анализировали накопление ММР8 в культуральной среде за следующие 48 часов. Концентрацию ММР8 в культуральной среде измеряли при помощи набора "Quantikine Human MMP-8 (total) Immunoassay" компании R&D Systems (США) в соответствии с протоколом производителя. Согласно этим измерениям концентрация ММР 8 в культуральной среде составляла 8.5 мкг/мл, что в 6 раз быше чем при использовании аналогичной ДНК, содержащей немодифицированный ген.

Оптимизированный для экспрессии в клетках млекопитающего ген металлопротеиназы 8, обладающий последовательностью нуклеотидов, приведенной на фиг.1.



 

Похожие патенты:

Изобретение относится к области биотехнологии и может быть использовано в фармакологии и медицине. .

Изобретение относится к области биотехнологии и может быть использовано в легкой промышленности. .

Изобретение относится к биологии, научно-практической фармакологии, биохимии и касается выделенного фрагмента ДНК с указанной последовательностью нуклеотидов, кодирующего белок, обладающий свойством внутримембранной эндопротеазы (IMPAS), а также способа получения указанного белка.

Изобретение относится к области энзимологии и белковой инженерии и может быть использовано в различных отраслях народного хозяйства, которые производят продукцию, содержащую добавки фермента с протеолитической активностью.

Изобретение относится к области генной и белковой инженерии и может быть использовано при создании новых моющих средств и очищающих составов. .

Изобретение относится к области медицины и биотехнологии и касается ДНК-последовательностей, кодирующих человеческие протеины Тх и Ту, родственные конвергирующему интерлейкин-1-бета ферменту.

Изобретение относится к получению биологически активной IL-1 протеазы с помощью технологии рекомбинантных ДНК и может быть использовано в медицине. .

Изобретение относится к области биотехнологии и представляет собой ген металлопротеиназы 1 с последовательностью нуклеотидов, приведенной на фиг.1

Изобретение относится к биотехнологии

Изобретение относится к области биохимии, в частности к полипептиду укороченной секретируемой аспартил-протеиназы 2, который способен эффективно вызывать опосредованные антителами и клеточные иммунные реакции на C.albicans и состоящему из аминокислотной последовательности, соответствующей SEQ ID NO:1; или функционально эквивалентному полипептиду, который имеет аминокислотную последовательность, полученную из SEQ ID NO:1 посредством одной или более консервативных замен аминокислот, причем указанный полипептид по меньшей мере на 80% идентичен аминокислотной последовательности SEQ ID NO:1 на протяжении всей длины SEQ ID NO:1. Также раскрыт полинуклеотид, кодирующий указанный полипептид, экспрессионный вектор, содержащий указанный полинуклеотид, клетка-хозяин для продукции указанного полипептида, содержащая указанный вектор. Раскрыты композиции для лечения или профилактики инфекции Candida albicans, содержащие указанный полипептид или полинуклеотид в эффективном количестве, а также способ лечения и профилактики инфекции Candida albicans с использованием указанных композиций. Также раскрыт набор для диагностирования инфекции Candida albicans, содержащий указанный полипептид и/или указанный полинуклеотид и реагент для определения комплексов, которые включают указанный полипептид. Изобретение позволяет эффективно вызывать опосредованные антителами и клеточные иммунные реакции на C.albicans и не имеет недостатков, которые присутствуют у полноразмерной аспартил-протеиназы дикого типа. 8 н. и 10 з.п. ф-лы, 7 ил., 1 табл.

Изобретение относится к области биотехнологии и касается способа мытья посуды. Охарактеризованный способ заключается в обеспечении композиции для мытья посуды и посуды, нуждающейся в очистке, приведении указанной посуды в контакт с указанной композицией для мытья посуды при условиях, эффективно обеспечивающих очистку указанной посуды, где указанная композиция для мытья посуды содержит модифицированный субтилизин, где указанный модифицированный субтилизин, по меньшей мере, на 70% гомологичен последовательности AQSVPWGISRVQAPAAHNRGLTGSGVKVAVLDTGISTHPDLNIRGGASFVPGEPSTQDGNGHGTHVAGTIAALNNSIGVLGVAPNAELYAVKVLGASGSGSVSSIAQGLEWAGNNGMHVANLSLGSPSPSATLEQAVNSATSRGVLVVAASGNSGAGSISYPARYANAMAVGATDQNNNRASFSQYGAGLDIVAPGVNVQSTYPGSTYASLNGTSMATPHVAGAAALVKQKNPSWSNVQIRNHLKNTATSLGSTNLYGSGLVNAEAATR и содержит (i) замену G116V и, по меньшей мере, одну дополнительную мутацию или (ii) замену S126R. Представленное изобретение позволяет удалять белковые загрязнения на посуде с высокой эффективностью, является безопасным для потребителей и окружающей среды. 5 з.п. ф-лы, 2 табл., 2 ил., 6 пр.

Изобретение относится в области биотехнологии. Описан фермент сериновая протеаза грибов, имеющая аминокислотную последовательность зрелого фермента, которая по меньшей мере на 86% идентична аминокислотной последовательности зрелого фермента Fe_RF6318, представленной в описании. Раскрыты: выделенная нуклеиновая кислота, кодирующая указанный фермент; рекомбинантный вектор экспрессии, содержащий указанную нуклеиновую кислоту, функционально связанную с регуляторными последовательностями; и клетка-хозяин для получения фермента сериновой протеазы по настоящему изобретению, содержащая указанный рекомбинантный экспрессионный вектор. Предложен способ получения фермента или ферментного препарата, содержащего указанный фермент сериновой протеазы, при этом способ включает этап культивирования клетки-хозяина по настоящему изобретению и либо этап восстановления протеазы из клетки, либо этап выделения клетки из культуральной среды и получения супернатанта, содержащего протеазу. Описан ферментный препарат, содержащий сериновую протеазу грибов, раскрытую в описании, полученный указанным способом. Изобретение позволяет расширить арсенал протеолитических ферментов. 9 н. и 29 з.п. ф-лы, 17 ил., 6 табл., 14 пр.

Изобретение относится к биохимии. Описан способ повышения экспрессии гена сайт-1 мембраносвязанной пептидазы транскрипционных факторов (MBTPS1) в клетках или тканях млекопитающего in vivo или in vitro, включающий: приведение указанных клеток или тканей в контакт по меньшей мере с одним антисмысловым олигонуклеотидом, составляющим в длину от 10 до 30 нуклеотидов, который специфично гибридизуется с комплементарным участком природного антисмыслового полинуклеотида, имеющего последовательность SEQ ID NO: 2, и повышает, за счет этого, экспрессию указанного гена сайт-1 мембраносвязанной пептидазы транскрипционных факторов (MBTPS1) в клетках или тканях млекопитающего in vivo или in vitro. Также представлен антисмысловой олигонуклеотид длиной приблизительно 10-30 нуклеотидов, содержащий по меньшей мере одну модификацию, где указанная по меньшей мере одна модификация выбрана из: по меньшей мере одного модифицированного фрагмента сахара; по меньшей мере одной модифицированной межнуклеотидной связи; по меньшей мере одного модифицированного нуклеотида и их комбинаций; причем указанный антисмысловой олигонуклеотид гибридизуется с природным антисмысловым полинуклеотидом гена сайт-1 мембраносвязанной пептидазы транскрипционных факторов (MBTPS1), имеющим последовательность SEQ ID NO: 2, и повышает, за счет этого, экспрессию гена сайт-1 мембраносвязанной пептидазы транскрипционных факторов (MBTPS1) in vivo или in vitro по сравнению с контролем, и при этом: указанный олигонуклеотид имеет последовательность, по меньшей мере на 80% идентичную последовательности, обратно комплементарной участку длиной 10-30 нуклеотидов из последовательности SEQ ID NO: 2, или указанный олигонуклеотид имеет последовательность, по меньшей мере на 80% идентичную участку из 10-30 нуклеотидов в последовательности SEQ ID NO: 1. Кроме того, описаны композиция, содержащая представленный антисмысловой олигонуклеотид, и способ предотвращения или лечения заболевания, связанного с геном сайт-1 мембраносвязанной пептидазы транскрипционных факторов (MBTPS1) и/или кодируемым указанным геном MBTPS1 продуктом, включающий использование представленного антисмыслового олигонуклеотида. 4 н. и 20 з.п. ф-лы, 1 ил., 2 пр.

Изобретение относится к биотехнологии и представляет собой ген металлопротеиназы 8 с последовательностью нуклеотидов, приведенной на чертеже

Наверх