Полипептиды с противомикробной активностью и кодирующие их полинуклеотиды



Полипептиды с противомикробной активностью и кодирующие их полинуклеотиды
Полипептиды с противомикробной активностью и кодирующие их полинуклеотиды
Полипептиды с противомикробной активностью и кодирующие их полинуклеотиды
Полипептиды с противомикробной активностью и кодирующие их полинуклеотиды
Полипептиды с противомикробной активностью и кодирующие их полинуклеотиды
Полипептиды с противомикробной активностью и кодирующие их полинуклеотиды
Полипептиды с противомикробной активностью и кодирующие их полинуклеотиды
Полипептиды с противомикробной активностью и кодирующие их полинуклеотиды
Полипептиды с противомикробной активностью и кодирующие их полинуклеотиды
Полипептиды с противомикробной активностью и кодирующие их полинуклеотиды

 


Владельцы патента RU 2393224:

НОВОЗИМС ЭДЕНИУМ БАЙОТЕК А/С (DK)

Полипептид, гомологичный полипептиду, экспрессируемому Eurotinium amstelodami, обладает противомикробной активностью и может быть использован для применения в качестве лечебного или профилактического средства человеку или животному, а также в корме для животных. 10 н. и 9 з.п. ф-лы, 2 табл.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к выделенным полипептидам с противомикробной активностью и к выделенным полинуклеотидам, кодирующим полипептиды. Это изобретение относится также к конструкциям нуклеиновых кислот, векторам и клеткам-хозяевам, содержащим полинуклеотиды, а также к способам получения и применения полипептидов.

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ

Целью настоящего изобретения является предоставление полипептидов с противомикробной активностью и кодирующих полипептиды полинуклеотидов.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к выделенным полипептидам с противомикробной активностью, выбранным из группы, состоящей из

(a) полипептида с аминокислотной последовательностью, которая имеет по меньшей мере 60% идентичность аминокислотам 1-42 последовательности SEQ ID NO:2;

(b) полипептида, который кодируется нуклеотидной последовательностью, которая гибридизуется в условиях по меньшей мере умеренной жесткости (i) с нуклеотидами 145-270 последовательности SEQ ID NO:1, (ii) с последовательностью кДНК, которая содержится в нуклеотидах 1-270 в последовательности SEQ ID NO:1, или (iii) с цепью, комплементарной (i) или (ii); и

(c) варианта, содержащего консервативную замену, делецию, и/или вставку одной или нескольких аминокислот в аминокислотах 1-42 в последовательности SEQ ID NO:2.

Настоящее изобретение относится также к выделенным полинуклеотидам, кодирующим полипептиды с противомикробной активностью, выбранным из группы, состоящей из

(a) полинуклеотида, кодирующего полипептид с аминокислотной последовательностью, которая имеет меньшей мере 60% идентичность аминокислотам 1-42 последовательности SEQ ID NO:2;

(b) полинуклеотида, имеющего по меньшей мере 60% идентичность нуклеотидам 145-270 последовательности SEQ ID NO:1; и

(c) полинуклеотида, который гибридизуется в условиях по меньшей мере умеренной жесткости (i) с нуклеотидами 145-270 последовательности SEQ ID NO:1, (ii) с последовательностью кДНК, которая содержится в нуклеотидах 1-270 последовательности SEQ ID NO:1, или (iii) с цепью, комплементарной (i) или (ii).

Настоящее изобретение относится также к конструкциям нуклеиновых кислот, рекомбинантным экспрессирующим векторам и рекомбинантным клеткам-хозяевам, содержащим полинуклеотиды.

Настоящее изобретение относится также к способам получения таких полипептидов с противомикробной активностью, включающим в себя (a) культивирование рекомбинантной клетки-хозяина, содержащей конструкцию нуклеиновой кислоты, содержащей полинуклеотид, кодирующий полипептид, в условиях, способствующих продукции полипептида; и (b) выделение полипептида.

Настоящее изобретение относится также к способам применения полипептидов и полинуклеотидов согласно изобретению.

ОПРЕДЕЛЕНИЯ

Противомикробная активность: В настоящем описании термин "противомикробная активность" определяют как активность, которая способна вызывать гибель или ингибировать рост микробных клеток. В контексте настоящего изобретения подразумевают, что термин "противомикробный" означает существование бактерицидного и/или бактериостатического, и/или фунгицидного и/или фунгистатического, и/или вироцидного эффекта, где термин "бактерицидный" следует понимать, как способный убивать бактериальные клетки. Термин "бактериостатический" следует понимать, как способный ингибировать рост бактерий, т.е. ингибирующий рост бактериальных клеток. Термин "фунгицидный" следует понимать, как способный убивать клетки грибов. Термин "фунгистатический" следует понимать, как способный ингибировать рост грибов, т.е. ингибирующий рост клеток грибов. Термин "вироцидный" следует понимать, как способный инактивировать вирус. Термином "микробные клетки" обозначают бактериальные клетки или клетки грибов (включая дрожжи).

В контексте настоящего изобретения подразумевают, что термин "ингибирующий рост микробных клеток" означает, что клетки находятся в нерастущем состоянии, т.е., что они не способны размножаться. Для целей настоящего изобретения противомикробную активность можно определять в соответствии со способом, описанным Lehrer et al., Journal of Immunological Methods, Vol. 137 (2) pp. 167-174 (1991). Альтернативно противомикробную активность можно определять в соответствии с руководствами NCCLS из CLSI (Институт клинических и лабораторных стандартов; ранее известный как Национальный комитет по клиническим и лабораторным стандартам).

Полипептиды с противомикробной активностью могут обладать способностью снижать количество живых клеток Escherichia coli (DSM 1576) до 1/100 через 8 часов (предпочтительно через 4 часа, более предпочтительно через 2 часа, наиболее предпочтительно через 1 час, и, особенно, через 30 минут) инкубации при 20°C в водном растворе 25% (масс./масс.); предпочтительно в водном растворе 10% (масс./масс.); более предпочтительно в водном растворе 5% (масс./масс.); более предпочтительно в водном растворе 1% (масс./масс.); наиболее предпочтительно в водном растворе 0,5% (масс./масс.); и, особенно, в водном растворе 0,1% (масс./масс.) полипептидов с противомикробной активностью.

Полипептиды с противомикробной активностью также могут обладать способностью ингибировать рост Escherichia coli (DSM 1576) в течение 24 часов при 25°C в субстрате для микробного роста при добавлении в концентрации 1000 миллионных долей; предпочтительно при добавлении в концентрации 500 миллионных долей; более предпочтительно при добавлении в концентрации 250 миллионных долей; более предпочтительно при добавлении в концентрации 100 миллионных долей; наиболее предпочтительно при добавлении в концентрации 50 миллионных долей; и, особенно, при добавлении в концентрации 25 миллионных долей.

Полипептиды с противомикробной активностью могут обладать способностью снижать количество живых клеток Bacillus subtilis (ATCC 6633) до 1/100 через 8 часов (предпочтительно через 4 часа, более предпочтительно через 2 часа, наиболее предпочтительно через 1 час, и, особенно, через 30 минут) инкубации при 20°C в водном растворе 25% (масс./масс.); предпочтительно в водном растворе 10% (масс./масс.); более предпочтительно в водном растворе 5% (масс./масс.); более предпочтительно в водном растворе 1% (масс./масс.); наиболее предпочтительно в водном растворе 0,5% (масс./масс.); и, особенно, в водном растворе 0,1% (масс./масс.) полипептидов с противомикробной активностью.

Полипептиды с противомикробной активностью также могут обладать способностью ингибировать рост Bacillus subtilis (ATCC 6633) в течение 24 часов при 25°C в субстрате для микробного роста, при добавлении в концентрации 1000 миллионных долей; предпочтительно при добавлении в концентрации 500 миллионных долей; более предпочтительно при добавлении в концентрации 250 миллионных долей; более предпочтительно при добавлении в концентрации 100 миллионных долей; наиболее предпочтительно при добавлении в концентрации 50 миллионных долей; и, особенно, при добавлении в концентрации 25 миллионных долей.

Полипептиды согласно изобретению имеют по меньшей мере 20%, предпочтительно по меньшей мере 40%, более предпочтительно по меньшей мере 50%, более предпочтительно по меньшей мере 60%, более предпочтительно по меньшей мере 70%, более предпочтительно по меньшей мере 80%, более предпочтительно по меньшей мере 90%, более предпочтительно по меньшей мере 95%, и наиболее предпочтительно по меньшей мере 100% противомикробную активность полипептида, состоящего из аминокислотной последовательности, представленной в качестве аминокислот 1-42 последовательности SEQ ID NO:2.

Дефензин: Как используют в настоящем описании, термин "дефензин" относится к полипептидам, известным специалистам в данной области, которые принадлежат к классу противомикробных пептидов дефензинов. Для того чтобы определить, является ли полипептид дефензином в соответствии с этим изобретением, аминокислотную последовательность предпочтительно сравнивают с профилями скрытых марковских моделей (профилями HMM) базы данных PFAM с использованием общедоступного программного обеспечения HMMER (см. пример 6).

Семейства дефензина PFAM включают дефензин_1 или "дефензин млекопитающих" (регистрационный no. PF00323), дефензин_2 или "дефензин членистоногих" (регистрационный no. PF01097), дефензин_бета или "бета-дефензин" (регистрационный no. PF00711), дефензин_propep или "пропептид дефензина" (регистрационный no. PF00879) и гамма-тионин или "семейство гамма-тионинов" (регистрационный no. PF00304).

Дефензины могут относиться к классу альфа-дефензина, к классу бета-дефензина, к классу тета-дефензина, к классу дефензина насекомых (членистоногих), к классу дефензина растений, к классу дефензина двустворчатых моллюсков или к другим классам дефензина, где аминокислотная последовательность содержит 6 или 8 цистеинов, и которые обладают структурным сходством с любым из упомянутых ранее классов дефензина. Дефензины также могут представлять собой синтетические дефензины, обладающие общими с любым из классов дефензина характерными свойствами.

Примеры таких дефензинов включают, но не ограничиваются ими, α-дефензин HNP-1 (пептид нейтрофилов человека) HNP-2 и HNP-3; β-дефензин-12, дрозомицин, гелиомицин, γ1-пуротионин, дефензин насекомых A и дефензины, описанные в заявках PCT WO 99/53053, WO 02/085934 и WO 03/044049.

Выделенный полипептид: Как используют в настоящем описании, термин "выделенный полипептид" относится к полипептиду, который является по меньшей мере на 20% чистым, предпочтительно по меньшей мере на 40% чистым, более предпочтительно по меньшей мере на 60% чистым, более предпочтительно по меньшей мере на 80% чистым, более предпочтительно по меньшей мере на 90% чистым, и наиболее предпочтительно по меньшей мере на 95% чистым, как определяют посредством SDS-PAGE.

По существу чистый полипептид: В настоящем описании термин "по существу чистый полипептид" означает препарат полипептида, который содержит не более 10%, предпочтительно не более 8%, более предпочтительно не более 6%, более предпочтительно не более 5%, более предпочтительно не более 4%, не более 3%, более предпочтительно не более 2%, более предпочтительно не более 1%, и наиболее предпочтительно не более 0,5% по массе других полипептидных веществ, с которыми он ассоциирован в природе. Таким образом, предпочтительно, чтобы по существу чистый полипептид являлся по меньшей мере на 92% чистым, предпочтительно по меньшей мере на 94% чистым, более предпочтительно по меньшей мере на 95% чистым, более предпочтительно по меньшей мере на 96% чистым, более предпочтительно по меньшей мере на 96% чистым, более предпочтительно по меньшей мере на 97% чистым, более предпочтительно по меньшей мере на 98% чистым, более предпочтительно по меньшей мере на 99%, более предпочтительно по меньшей мере на 99,5% чистым, и наиболее предпочтительно на 100% чистым по массе от общего полипептидного вещества, находящегося в препарате.

Полипептиды согласно изобретению предпочтительно находятся по существу в чистой форме. В частности, предпочтительно, чтобы полипептиды находились "по существу в чистой форме", т.е., чтобы препарат полипептида по существу не содержал других полипептидных веществ, с которыми он ассоциирован в природе. Этого можно достигать, например, посредством получения полипептида посредством хорошо известных рекомбинантных способов или классических способов очистки.

В настоящем описании термин "по существу чистый полипептид" является синонимом терминов "выделенный полипептид" и "полипептид в выделенной форме".

Идентичность: Сходство между двумя аминокислотными последовательностями или между двумя нуклеотидными последовательностями описывают посредством параметра "идентичность".

Для целей настоящего изобретения степень идентичности между двумя аминокислотными последовательностями можно определять с использованием программы FASTA, которая включена в версию 2.0x пакета программ FASTA (см. W. R. Pearson and D. J. Lipman (1988), "Improved Tools for Biological Sequence Analysis", PNAS 85:2444-2448; и W. R. Pearson (1990) "Rapid and Sensitive Sequence Comparison with FASTP and FASTA", Methods in Enzymology 183:63-98). Используемая оценочная матрица представляла собой BLOSUM50, штраф за делецию составлял -12, и штраф за продолжение делеции составлял -2.

Степень идентичности между двумя нуклеотидными последовательностями определяют с использованием указанного алгоритма и комплекта программного обеспечения, как описано выше. Используемая оценочная матрица представляла собой матрицу идентичности, штраф за делецию составлял -16, и штраф за продолжение делеции составлял -4.

Альтернативно выравнивание двух аминокислотных последовательностей определяют с использованием программы Needle из пакета EMBOSS (http://emboss.org) версии 2.8.0. Программа Needle выполняет алгоритм общего выравнивания, описанный в Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48, 443-453. Используемая подстановочная матрица представляет собой BLOSUM62, штраф за внесение делеции составляет 10, и штраф за продолжение делеции составляет 0,5.

Степень идентичности между аминокислотной последовательностью по настоящему изобретению ("последовательностью согласно изобретению"; например, аминокислоты 1-42 последовательности SEQ ID NO:2) и другой аминокислотной последовательностью ("чужеродной последовательностью") вычисляют как количество точных совпадений при выравнивании двух последовательностей, разделенное на длину "последовательности согласно изобретению" или на длину "чужеродной последовательности", исходя из того, какая из них короче. Результаты выражают в виде процентной идентичности.

Точное совпадение происходит, если "последовательность согласно изобретению" и "чужеродная последовательность" обладают идентичными аминокислотными остатками в одинаковых положениях перекрывающегося участка (в примере выравнивания, представленном ниже, они изображены посредством "|"). Длина последовательности представляет собой количество аминокислотных остатков в последовательности (например, длина для аминокислот 1-42 в последовательности SEQ ID NO:2 составляет 42).

В примере выравнивания, представленном ниже, перекрывающийся участок представляет собой аминокислотную последовательность "HTWGER-NL" последовательности 1; или аминокислотную последовательность "HGWGEDANL" последовательности 2. В примере делеция обозначена посредством "-".

Пример выравнивания

Фрагмент полипептида: В настоящем описании термин "фрагмент полипептида" определяют, как полипептид, обладающий одной или несколькими аминокислотами, удаленными с N-конца и/или C-конца SEQ ID NO:2 или гомологичной ей последовательности, где фрагмент обладает противомикробной активностью. Предпочтительно фрагмент полипептида согласно изобретению сохраняет все остатки цистеина и аминокислотные остатки между остатками цистеина.

Подпоследовательность: В настоящем описании термин "подпоследовательность" определяют как нуклеотидную последовательность, обладающую одним или несколькими нуклеотидами, удаленными с 5'-конца и/или 3'-конца SEQ ID NO:1 или гомологичной ей последовательности, где подпоследовательность кодирует фрагмент полипептида, обладающий противомикробной активностью.

Аллельный вариант: В настоящем описании термин "аллельный вариант" означает любые две или более альтернативные формы гена, занимающие один и тот же локус на хромосоме. Аллельное разнообразие возникает в природе вследствие мутации и может приводить к полиморфизму в популяциях. Мутации генов могут быть молчащими (нет изменений в кодируемом полипептиде) или могут кодировать полипептиды, обладающие измененными аминокислотными последовательностями. Аллельный вариант полипептида представляет собой полипептид, кодируемый аллельным вариантом гена.

По существу чистый полинуклеотид: В настоящем описании термин "по существу чистый полинуклеотид" относится к препарату полинуклеотида, не содержащему других посторонних или ненужных нуклеотидов и находящемуся в форме, пригодной для применения в системах продукции белков способами генетической инженерии. Таким образом, по существу чистый полинуклеотид содержит не более 10%, предпочтительно не более 8%, более предпочтительно не более 6%, более предпочтительно не более 5%, более предпочтительно не более 4%, более предпочтительно не более 3%, более предпочтительно не более 2%, более предпочтительно не более 1%, и наиболее предпочтительно не более 0,5% по массе других полинуклеотидных веществ, с которыми он ассоциирован в природе. По существу чистый полинуклеотид может, однако, включать природные 5'- и 3'-нетранслируемые области, такие как промоторы и терминаторы. Предпочтительно, чтобы по существу чистый полинуклеотид являлся по меньшей мере на 90% чистым, предпочтительно по меньшей мере на 92% чистым, более предпочтительно по меньшей мере на 94% чистым, более предпочтительно по меньшей мере на 95% чистым, более предпочтительно по меньшей мере на 96% чистым, более предпочтительно по меньшей мере на 97% чистым, более предпочтительно по меньшей мере на 98% чистым, более предпочтительно по меньшей мере на 99% и наиболее предпочтительно по меньшей мере на 99,5% чистым по массе. Полинуклеотиды согласно изобретению предпочтительно находятся по существу в чистой форме. В частности, предпочтительно, чтобы полинуклеотиды, описанные в настоящем описании, находились "по существу в чистой форме", т.е., чтобы препарат полинуклеотида по существу не содержал других полинуклеотидных веществ, с которыми он ассоциирован в природе. В настоящем описании термин "по существу чистый полинуклеотид" является синонимом терминов "выделенный полинуклеотид" и "полинуклеотид в выделенной форме". Полинуклеотиды могут представлять собой полинуклеотиды геномного происхождения, полинуклеотиды из кДНК, из РНК, полусинтетического, синтетического происхождения или любые их сочетания.

кДНК: В настоящем описании термин "кДНК" определяют как молекулу ДНК, которую можно получать посредством обратной транскрипции из зрелой сплайсированной молекулы мРНК, полученной из эукариотической клетки. В кДНК отсутствуют последовательности интронов, которые обычно представлены в соответствующей геномной ДНК. Исходный первичный транскрипт РНК представляет собой предшественник мРНК, который подвергается процессингу посредством ряда стадий перед образованием зрелой сплайсированной мРНК. Эти стадии включают удаление последовательностей интронов в процессе, называемом сплайсингом. Источником кДНК является мРНК, в которой, таким образом, отсутствуют какие-либо последовательности интронов.

Конструкция нуклеиновой кислоты: В настоящем описании термин "конструкция нуклеиновой кислоты" относится к молекуле нуклеиновой кислоты либо одноцепочечной, либо двухцепочечной, которая выделена из природного гена или которая модифицирована, чтобы содержать сегменты нуклеиновых кислот, способом, который в ином случае не встречается в природе. Термин конструкция нуклеиновой кислоты является синонимом термина "экспрессирующая кассета", когда конструкция нуклеиновой кислоты содержит контролирующие последовательности, необходимые для экспрессии кодирующей последовательности согласно изобретению.

Контролирующая последовательность: В настоящем описании термин "контролирующие последовательности" определяют, как включающие все компоненты, которые необходимы для экспрессии или способствуют экспрессии полинуклеотида, кодирующего полипептид согласно изобретению. Каждая контролирующая последовательность может представлять собой собственную или чужеродную нуклеотидную последовательность, кодирующую полипептид. Такие контролирующие последовательности включают, но не ограничиваются ими, лидерную последовательность, последовательность полиаденилирования, последовательность пропептида, промотор, последовательность сигнального пептида, и терминатор транскрипции. Контролирующие последовательности включают, по меньшей мере, промотор и транскрипционный и трансляционный стоп-сигналы. В целях введения конкретных участков рестрикции, облегчающих лигирование контролирующих последовательностей с кодирующей областью нуклеотидной последовательности, кодирующей полипептид, в контролирующих последовательностях могут быть предусмотрены линкеры.

Функционально связанный: В настоящем описании термин "функционально связанный" означает конфигурацию, в которой контролирующая последовательность помещена в соответствующем положении относительно кодирующей последовательности полинуклеотидной последовательности, чтобы контролирующая последовательность управляла экспрессией кодирующей последовательности полипептида.

Кодирующая последовательность: В настоящем описании термин "кодирующая последовательность" означает нуклеотидную последовательность, которая непосредственно определяет аминокислотную последовательность ее белкового продукта. Границы кодирующей последовательности, как правило, определяют по открытой рамке считывания, которая, как правило, начинается с инициирующего кодона ATG или альтернативных инициирующих кодонов, таких как GTG и TTG. Кодирующая последовательность может представлять собой ДНК, кДНК или рекомбинантную нуклеотидную последовательность.

Экспрессия: Термин "экспрессия" включает в себя любую стадию, вовлеченную в продукцию полипептида, включая, но не ограничиваясь ими, транскрипцию, посттранскрипционную модификацию, трансляцию, посттрансляционную модификацию и секрецию.

Экспрессирующий вектор: В настоящем описании термин "экспрессирующий вектор" определяют как линейную или кольцевую молекулу ДНК, которая содержит полинуклеотид, кодирующий полипептид согласно изобретению, и которая функционально связана с дополнительными нуклеотидами, которые обеспечивают экспрессию.

Клетка-хозяин: В настоящем описании термин "клетка-хозяин" включает в себя клетку любого типа, поддающуюся трансформации, трансфекции, трансдукции и т.п. конструкцией нуклеиновой кислоты, содержащей полинуклеотид согласно изобретению.

Модификация: В настоящем описании термин "модификация" означает любую химическую модификацию полипептида, состоящего из аминокислот 1-42 последовательности SEQ ID NO:2, а также генетическое воздействие на ДНК, кодирующую этот полипептид. Модификация(и) могут представлять собой замену(ы), делецию(и) и/или вставку(и) аминокислоты(аминокислот), а также перестановку(и) боковой цепи(ей) аминокислот; или использование в аминокислотной последовательности неприродных аминокислот со сходными свойствами. В частности, модификация(и) может представлять собой амидирование, такое как C-концевое амидирование.

Искусственный вариант: В настоящем описании термин "искусственный вариант" означает полипептид, обладающий противомикробной активностью, продуцируемый организмом, экспрессирующим модифицированную нуклеотидную последовательность SEQ ID NO:1. Модифицированную нуклеотидную последовательность получают путем модификации нуклеотидной последовательности, описанной в SEQ ID NO:1, посредством вмешательства человека.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Полипептиды с противомикробной активностью

В первом аспекте настоящее изобретение относится к выделенным полипептидам, обладающим аминокислотной последовательностью, которая обладает степенью идентичности с аминокислотами 1-42 последовательности SEQ ID NO:2 (т.е. со зрелым полипептидом) по меньшей мере 60%, предпочтительно по меньшей мере 65%, более предпочтительно, по меньшей мере 70%, более предпочтительно, по меньшей мере 75%, более предпочтительно, по меньшей мере 80%, более предпочтительно, по меньшей мере 85%, более предпочтительно, по меньшей мере 90%, более предпочтительно, по меньшей мере 95%, и наиболее предпочтительно, по меньшей мере 97%, которые имеют противомикробную активность (в дальнейшем "гомологичные полипептиды"). В предпочтительном аспекте гомологичные полипептиды обладают аминокислотной последовательностью, которая отличается на десять аминокислот, предпочтительно на пять аминокислот, более предпочтительно, на четыре аминокислоты, более предпочтительно, на три аминокислоты, более предпочтительно, на две аминокислоты, и наиболее предпочтительно, на одну аминокислоту от аминокислот 1-42 последовательности SEQ ID NO:2.

Полипептид согласно изобретению предпочтительно содержит аминокислотную последовательность SEQ ID NO:2 или ее аллельный вариант; или ее фрагмент, который обладает противомикробной активностью. В предпочтительном аспекте полипептид содержит аминокислотную последовательность SEQ ID NO:2. В другом предпочтительном аспекте, полипептид содержит аминокислоты 1-42 последовательности SEQ ID NO:2, или ее аллельный вариант; или ее фрагмент, который обладает противомикробной активностью. В другом предпочтительном аспекте полипептид содержит аминокислоты 1-42 последовательности SEQ ID NO:2. В другом предпочтительном аспекте полипептид состоит из аминокислотной последовательности SEQ ID NO:2 или ее аллельного варианта; или ее фрагмента, который обладает противомикробной активностью. В другом предпочтительном аспекте полипептид состоит из аминокислотной последовательности SEQ ID NO:2. В другом предпочтительном аспекте полипептид состоит из аминокислот 1-42 последовательности SEQ ID NO:2 или ее аллельного варианта; или ее фрагмента, который обладает противомикробной активностью. В другом предпочтительном аспекте полипептид состоит из аминокислот 1-42 последовательности SEQ ID NO:2.

Во втором аспекте настоящее изобретение относится к выделенным полипептидам с противомикробной активностью, которые кодируются полинуклеотидами, которые гибридизуются в условиях очень низкой жесткости, предпочтительно в условиях низкой жесткости, более предпочтительно, в условиях умеренной жесткости, более предпочтительно, в условий средневысокой жесткости, более предпочтительно, в условиях высокой жесткости, и наиболее предпочтительно, в условиях очень высокой жесткости, (i) с нуклеотидами 145-270 последовательности SEQ ID NO:1, (ii) с последовательностью кДНК, содержащейся между нуклеотидами 1-270 последовательности SEQ ID NO:1, (iii) с подпоследовательностью (i) или (ii), или (iv) комплементарной (i), (ii), или (iii) цепью (J. Sambrook, E. F. Fritsch, and T. Maniatus, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York). Подпоследовательность SEQ ID NO:1 содержит по меньшей мере 100 смежных нуклеотидов или предпочтительно по меньшей мере 200 смежных нуклеотидов. Более того, подпоследовательность может кодировать фрагмент полипептида, который обладает противомикробной активностью. Нуклеотидную последовательность SEQ ID NO:1 или ее подпоследовательность, а также аминокислотную последовательность SEQ ID NO:2 или ее фрагмент можно использовать для создания зонда нуклеиновой кислоты для выявления и клонирования ДНК, кодирующей полипептиды с противомикробной активностью, в штаммах различных родов или видов в соответствии со способами, хорошо известными в данной области. В частности, такие зонды можно использовать для гибридизации с геномной или кДНК представляющего интерес рода или вида, с последующим стандартным способом саузерн-блоттинга, в целях выявления и выделения из них соответствующего гена. Такие зонды могут быть значительно короче полной последовательности, но их длина должна составлять по меньшей мере 14, предпочтительно по меньшей мере 25, более предпочтительно по меньшей мере 35 и наиболее предпочтительно по меньшей мере 70 нуклеотидов. Однако предпочтительно, чтобы длина зонда нуклеиновой кислоты составляла по меньшей мере 100 нуклеотидов. Например, зонд нуклеиновой кислоты может составлять по меньшей мере 200 нуклеотидов, предпочтительно по меньшей мере 270 нуклеотидов. Можно использовать как ДНК, так и РНК зонды. Для выявления соответствующего гена зонды, как правило, являются мечеными (например, 32P, 3H, 35S, биотином или авидином). Такие зонды охватываются настоящим изобретением.

Для геномных библиотек ДНК или кДНК, полученных из таких других организмов, можно, таким образом, проводить скрининг на ДНК, которая гибридизуется с зондами, описанными выше, и которая кодирует полипептид с противомикробной активностью. Геномную или другую ДНК из таких других организмов можно выделять посредством гель-электрофореза в агарозном или полиакриламидном геле, или посредством других способов выделения. ДНК из библиотек или выделенную ДНК можно переносить и иммобилизовывать на нитроцеллюлозе или другом пригодном носителе. В целях выявления клона или ДНК, которая является гомологичной SEQ ID NO:1 или ее подпоследовательности, носитель используют в саузерн-блоте.

Для целей настоящего изобретения гибридизация показывает, что нуклеотидная последовательность гибридизуется с меченым зондом нуклеиновой кислоты, соответствующим нуклеотидной последовательности, представленной в SEQ ID NO:1, с комплементарной ей цепью, или с ее подпоследовательностью, в условиях очень от очень низкой до очень высокой жесткости. Молекулы, с которыми зонд нуклеиновой кислоты гибридизуется в этих условиях, можно определять с использованием рентгеновской пленки.

В предпочтительном аспекте зонд нуклеиновой кислоты представляет собой полинуклеотидную последовательность, которая кодирует полипептид SEQ ID NO:2 или его подпоследовательность. В другом предпочтительном аспекте зонд нуклеиновой кислоты представляет собой SEQ ID NO:1. В другом предпочтительном аспекте зонд нуклеиновой кислоты представляет собой участок SEQ ID NO:1, кодирующий зрелый полипептид.

Для длинных зондов длиной по меньшей мере 100 нуклеотидов, условия от очень низкой до очень высокой жесткости, определяются как предгибридизация и гибридизация при 42°C в 5X SSPE, 0,3% SDS, 200 мкг/мл расщепленной и денатурированной ДНК спермы лосося, и либо 25% формамид для очень низкой и низкой жесткости, 35% формамид для средней и средневысокой жесткости, или 50% формамид для высокой и очень высокой жесткости, с последующим процессом саузерн-блоттинга оптимально в течение от 12 до 24 часов.

Для длинных зондов длиной по меньшей мере 100 нуклеотидов, носитель в конце промывают три раза, каждый по 15 минут, с использованием 2X SSC, 0,2% SDS предпочтительно по меньшей мере при 45°C (очень низкая жесткость), более предпочтительно по меньшей мере при 50°C (низкая жесткость), более предпочтительно по меньшей мере при 55°C (средняя жесткость), более предпочтительно по меньшей мере при 60°C (средневысокая жесткость), более предпочтительно по меньшей мере при 65°C (высокая жесткость), и наиболее предпочтительно по меньшей мере при 70°C (очень высокая жесткость).

Для коротких зондов, длина которых составляет от приблизительно 15 нуклеотидов до приблизительно 70 нуклеотидов, условия жесткости определяются как предгибридизация, гибридизация, и промывание после гибридизации при температуре, которая на от приблизительно 5°C до приблизительно 10°C ниже Tm, вычисленной с использованием вычисления в соответствии Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48:1390), в 0,9 M NaCl, 0,09 M Трис-HCl pH 7,6, 6 мМ ЭДТА, 0,5% NP-40, 1X растворе Денхарда, 1 мМ пирофосфате натрия, 1 мМ одноосновном фосфате натрия, 0,1 мМ ATP, и 0,2 мг РНК дрожжей на мл в соответствии со стандартным способом саузерн-блоттинга. Для коротких зондов, длина которых составляет от приблизительно 15 нуклеотидов до приблизительно 70 нуклеотидов, носитель промывают однократно в 6X SCC плюс 0,1% SDS в течение 15 минут и дважды в течение 15 с использованием 6X SSC при температуре, ниже вычисленной Tm на от 5°C до 10°C.

В третьем аспекте настоящее изобретение относится к искусственным вариантам, содержащим консервативную замену, делецию и/или вставку одной или нескольких аминокислот SEQ ID NO:2 или ее зрелого полипептида. Предпочтительно, аминокислотные изменения по своей природе представляют собой незначительные изменения, а именно, консервативные аминокислотные замены или вставки, которые не влияют значительно на сворачивание и/или активность белка; небольшие делеции, как правило, от одной до приблизительно 30 аминокислот; небольшие N- или C-концевые удлинения, такие как N-концевой остаток метионина; небольшой линкерный пептид из вплоть до приблизительно 20-25 остатков; или небольшое удлинение, которое упрощает очистку посредством изменения суммарного заряда или другой функции, такое как полигистидиновый участок, антигенный эпитоп или связывающий домен.

Примерами консервативных замен являются замены в группе основных аминокислот (аргинин, лизин и гистидин), кислых аминокислот (глутаминовая кислота и аспарагиновая кислота), полярных аминокислот (глутамин и аспарагин), гидрофобных аминокислот (лейцин, изолейцин и валин), ароматических аминокислот (фенилаланин, триптофан и тирозин), и небольших аминокислот (глицин, аланин, серин, треонин и метионин). Аминокислотные замены, которые, как правило, не изменяют определенной активности, известны в данной области и описаны, например, H. Neurath and R.L. Hill, 1979, In, The Proteins, Academic Press, New York. Наиболее часто встречающиеся замены представляют собой Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu и Asp/Gly.

В дополнение к 20 стандартным аминокислотам, остатки дикого типа могут быть заменены нестандартными аминокислотами (такими как 4-гидроксипролин, 6-N-метиллизин, 2-аминоизомасляная кислота, изовалин и альфа-метилсерин). Аминокислотные остатки могут быть заменены ограниченным количеством неконсервативных аминокислот, аминокислот, которые не кодируются генетическим кодом, и неприродных аминокислот. "Неприродные аминокислоты" модифицируются после синтеза белка и/или обладают химической структурой в их боковой цепи(ях), которая отличается от химической структуры стандартных аминокислот. Неприродные аминокислоты можно химически синтезировать, и, предпочтительно, они являются коммерчески доступными и включают в себя пипеколиновую кислоту, карбоновую кислоту тиазолидина, дегидропролин, 3- и 4-метилпролин, и 3,3-диметилпролин.

Альтернативно аминокислотные изменения представляют собой изменения такого характера, которые изменяют физико-химические свойства полипептидов. Например, аминокислотные изменения могут повышать термическую стабильность полипептида, изменять специфичность в отношении субстрата, изменять оптимальное значение pH и т.п.

Основные аминокислоты в исходном полипептиде можно выявлять в соответствии со способами, известными в данной области, такими как сайт-направленный мутагенез или сканирующий аланином мутагенез (Cunningham and Wells, 1989, Science 244: 1081-1085). В последнем способе, для выявления аминокислотных остатков, которые являются ответственными за активность молекулы, в каждый остаток молекулы вводят единичные мутации аланином, и полученные мутантные молекулы анализируют на биологическую активность (т.е., противомикробную активность). См. также, Hilton et al., 1996, J. Biol. Chem. 271: 4699-4708. Активный участок фермента или другое биологическое взаимодействие также можно определять посредством анализа структуры, как определяют посредством таких способов, как ядерный магнитный резонанс, кристаллография, электронография или фотоаффинное мечение, совместно с мутацией предполагаемых аминокислот области контакта. См., например, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309:59-64. Принадлежность к необходимым аминокислотам также можно установить, исходя из анализа идентичности с полипептидами, которые сходны с полипептидом в соответствии с этим изобретением.

Единичные или множественные аминокислотные замены можно проводить и анализировать с использованием известных способов мутагенеза, рекомбинации и/или перетасовки, с последующим пригодным способом скрининга, таким как способы, описанные Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; или WO 95/22625. Другие способы, которые можно использовать, включают ПЦР с пониженной точностью, фаговый дисплей (например, Lowman et al., 1991, Biochem. 30:10832-10837; патент США № 5223409; WO 92/06204), и сайт-направленный мутагенез (Derbyshire et al., 1986, Gene 46:145; Ner et al., 1988, DNA 7:127).

Способы мутагенеза/перетасовки можно объединять с высокопроизводительными автоматизированными способами скрининга для выявления активности клонированных мутантных полипептидов, экспрессируемых клетками-хозяевами. Мутантные молекулы ДНК, которые кодируют активные полипептиды, можно получать из клеток-хозяев и быстро секвенировать с использованием стандартных в данной области способов. Эти способы дают возможность быстрого определения значения отдельных аминокислотных остатков в представляющем интерес полипептиде, и их можно применять в отношении полипептидов с неизвестной структурой.

Общее количество аминокислотных замен, делеций и/или вставок в аминокислотах 1-42 последовательности SEQ ID NO:2 составляет 10, предпочтительно 9, более предпочтительно 8, более предпочтительно 7, более предпочтительно не более 6, более предпочтительно не более 5, более предпочтительно 4, более предпочтительно 3, более предпочтительно 2 и наиболее предпочтительно 1.

В предпочтительном варианте осуществления полипептиды согласно изобретению представляют собой полипептиды дефензина. В другом варианте осуществления полипептиды согласно изобретению содержат три дицистеиновых связи.

N-концевое удлинение

Пригодное N-концевое удлинение полипептидов согласно изобретению может состоять из от 1 до 50 аминокислот, предпочтительно из 2-20 аминокислот, главным образом, из 3-15 аминокислот. В одном варианте осуществления N-концевое удлинение пептида не содержит Arg (R). В другом варианте осуществления N-концевое удлинение содержит участок расщепления kex2 или kex2-подобный участок расщепления, как определено ниже. В предпочтительном варианте осуществления N-концевое удлинение представляет собой пептид, содержащий по меньшей мере два аминокислотных остатка Glu (E) и/или Asp (D), такой как N-концевое удлинение, содержащее следующие последовательности: EAE, EE, DE и DD.

Участки Kex2

Участки Kex2 (см., например, Methods in Enzymology Vol 185, ed. D. Goeddel, Academic Press Inc. (1990), San Diego, CA, "Gene Expression Technology") и kex2-подобные участки представляют собой двухосновные участки распознавания (т.е. участки расщепления), находящиеся между участком, кодирующим пропептид, и зрелым участком некоторых белков. Было показано, что вставка участка kex2 или kex2-подобного участка в определенных случаях приводит к повышению безошибочного процессинга эндопептидазой в участке расщепления пропептида, что приводит к повышенному уровню секреции белка.

В контексте этого изобретения вставка участка kex2 или kex2-подобного участка приводит к возможности осуществления расщепления в определенном положении N-концевого удлинения, что приводит к тому, что противомикробный полипептид является удлиненным по сравнению со зрелым полипептидом, представленным в качестве аминокислот 1-42 последовательности SEQ ID NO:2.

Слитые полипептиды

Полипептиды согласно изобретению также включают слитые полипептиды или расщепляемые слитые полипептиды, в которых другой полипептид является слитым с N-концом или C-концом полипептида согласно изобретению или его фрагмента. Слитый полипептид получают посредством слияния нуклеотидной последовательности (или ее части), кодирующей другой полипептид, с нуклеотидной последовательностью (или ее частью) согласно изобретению. Способы получения слитых полипептидов известны в данной области и включают лигирование кодирующих последовательностей, кодирующих полипептиды, таким образом, чтобы они находились в рамке считывания и чтобы экспрессия слитого полипептида находилась под контролем указанного промотора(ов) и терминатора.

Источники полипептидов с противомикробной активностью

Полипептид согласно изобретению можно получать из микроорганизмов любого рода. Как используют в настоящем описании, для целей настоящего изобретения термин "получают из" применительно к данному источнику означает, что полипептид, кодируемый нуклеотидной последовательностью, продуцируется источником или штаммом, в который нуклеотидная последовательность из источника была встроена. В предпочтительном аспекте, полипептид, полученный из данного источника секретируется внеклеточно.

Полипептид согласно изобретению может представлять собой бактериальный полипептид. Например, полипептид может представлять собой полипептид грамположительных бактерий, например, такой как полипептид Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis или Bacillus thuringiensis; или полипептид Streptomyces, например, полипептид Streptomyces lividans или Streptomyces murinus; или полипептид грамотрицательных бактерий, например, полипептид E. coli или Pseudomonas sp.

Полипептид согласно изобретению также может представлять собой пептид грибов, и более предпочтительно полипептид дрожжей, такой как полипептид Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces или Yarrowia; или более предпочтительно полипептид мицеллярных грибов, такой как полипептид Acremonium, Aspergillus, Aureobasidium, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium или Trichoderma.

В предпочтительном аспекте полипептид представляет собой полипептид с противомикробной активностью из Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis или Saccharomyces oviformis.

В другом предпочтительном аспекте, полипептид представляет собой полипептид Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei или Trichoderma viride.

В другом предпочтительном аспекте полипептид представляет собой полипептид Eurotium amstelodami, Aspergillus amstelodami, Aspergillus montevidensis или Aspergillus vitis.

В более предпочтительном аспекте полипептид представляет собой полипептид Eurotium amstelodami, например, полипептид SEQ ID NO:2.

Понятно, что для упомянутых выше видов, это изобретение относится как к совершенной, так и к несовершенной стадии, и другим таксономическим эквивалентам, например, анаморфам, независимо от названия вида, под которым они известны. Специалисты в данной области легко определят идентичность соответствующих эквивалентов.

Штаммы этих видов легко доступны для общественного пользования в ряде коллекций культур, таких как American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS), и Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).

Более того, такие полипептиды можно выявлять и получать из других источников, включая микроорганизмы, выделенные из природного источника (например, почвы, компостов, воды, и т.д.) с использованием упомянутых выше зондов. Способы выделения микроорганизмов из естественной среды хорошо известны в данной области. Полинуклеотид затем можно получать аналогично посредством скрининга геномной или кДНК библиотеки другого микроорганизма. После выявления с помощью зонда(ов) полинуклеотидной последовательности, кодирующей полипептид, полинуклеотид можно выделять или клонировать с использованием способов, которые хорошо известны средним специалистам в данной области (см., например, Sambrook et al., 1989, выше). Полипептиды согласно изобретению также включают слитые полипептиды или расщепляемые слитые полипептиды, в которых другой полипептид является слитым с N-концом или C-концом полипептида или его фрагмента. Слитый полипептид получают посредством слияния нуклеотидной последовательности (или ее части), кодирующей другой полипептид, с нуклеотидной последовательностью (или ее частью) согласно изобретению. Способы получения слитых полипептидов известны в данной области и включают лигирование кодирующих последовательностей, кодирующих полипептиды, чтобы они находились в рамке считывания и чтобы экспрессия слитого полипептида находилась под контролем одного промотора(ов) и терминатора.

Полинуклеотиды

Настоящее изобретение относится также к выделенным полинуклеотидам с нуклеотидной последовательностью, которая кодирует полипептид согласно изобретению. В предпочтительном аспекте нуклеотидная последовательность указана в SEQ ID NO:1. В другом предпочтительном аспекте нуклеотидная последовательность представляет собой кодирующий зрелый полипептид участок SEQ ID NO:1. Настоящее изобретение относится также к нуклеотидным последовательностям, которые кодируют полипептид c аминокислотной последовательностью SEQ ID NO:2 или его зрелый полипептид, которые отличаются от SEQ ID NO:1 вследствие вырожденности генетического кода. Настоящее изобретение относится также к подпоследовательности SEQ ID NO:1, которая кодирует фрагменты SEQ ID NO:2, которые обладают противомикробной активностью.

Настоящее изобретение относится также к мутантным полинуклеотидам, содержащим по меньшей мере одну мутацию в кодирующей зрелый полипептид последовательности SEQ ID NO:1, в которых мутантная нуклеотидная последовательность кодирует полипептид, который состоит из аминокислот 1-42 последовательности SEQ ID NO:2.

Способы, используемые для выделения или клонирования полинуклеотида, кодирующего полипептид, известны в данной области и включают выделение из геномной ДНК, получение из кДНК, или их сочетание. Клонирование полинуклеотидов согласно изобретению из такой геномной ДНК можно проводить, например, с использованием хорошо известной полимеразной цепной реакции (ПЦР) или скрининга экспрессирующих библиотек посредством антител для выявления клонированных фрагментов ДНК с общими структурными элементами. См., например, Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Можно использовать другие способы амплификации нуклеиновых кислот, такие как лигазная цепная реакция (LCR), активированная лигированием транскрипция (LAT) и амплификация на основе нуклеотидной последовательности (NASBA). Полинуклеотиды можно клонировать из штамма Eurotium, или другого или родственного организма и, таким образом, например, они могут представлять собой аллельные или видовые варианты кодирующего полипептид участка нуклеотидной последовательности.

Настоящее изобретение относится также к полинуклеотидам с нуклеотидными последовательностями, которые обладают степенью идентичности с кодирующей зрелый полипептид последовательностью SEQ ID NO:1 (т.е., с нуклеотидами 145-270) по меньшей мере 60%, предпочтительно по меньшей мере 65%, более предпочтительно по меньшей мере 70%, более предпочтительно по меньшей мере 75%, более предпочтительно по меньшей мере 80%, более предпочтительно по меньшей мере 85%, более предпочтительно по меньшей мере 90%, более предпочтительно по меньшей мере 95%, и наиболее предпочтительно по меньшей мере 97% идентичности, которые кодируют активный полипептид.

Модификация нуклеотидной последовательности, кодирующей полипептид согласно изобретению, может быть необходима для синтеза полипептидов, по существу сходных с полипептидом. Термин "по существу сходный" с полипептидом относится к неприродным формам полипептида. Эти полипептиды могут отличаться некоторым предусмотренным образом от полипептида, выделенного из природного источника, например, искусственные варианты, которые отличаются специфичной активностью, термостабильностью, оптимальным значением pH, или сходными с ними. Последовательность варианта можно конструировать на основе нуклеотидной последовательности, представленной в качестве кодирующего полипептид участка SEQ ID NO:1, например, в качестве ее подпоследовательности, и/или посредством введения нуклеотидных замен, которые не приводят к другой аминокислотной последовательности полипептида, кодируемого нуклеотидной последовательностью, но которые соответствуют использованию кодонов организма хозяина, предназначенного для продукции фермента, или посредством введения нуклеотидных замен, которые могут приводить к различным аминокислотным последовательностям. Для общего описания замен нуклеотидов, см., например, Ford et al., 1991, Protein Expression and Purification 2: 95-107.

Специалистам в данной области понятно, что такие замены можно проводить за пределами участков, ответственных за функцию молекулы, и по-прежнему получать активный полипептид. Аминокислотные остатки, необходимые для активности полипептида, кодируемого выделенным полинуклеотидом согласно изобретению, и таким образом, которые предпочтительно не подвергают заменам, можно идентифицировать в соответствии со способами, известными в данной области, такими как сайт-направленный мутагенез или сканирующий аланином мутагенез (см., например, Cunningham and Wells, 1989, Science 244: 1081-1085). В последнем способе, мутации вносят в каждый положительно заряженный остаток молекулы, и полученные мутантные молекулы анализируют на противомикробную активность для выявления аминокислотных остатков, ответственных за активность молекулы. Участки взаимодействия субстрат-фермент также можно определять посредством анализа трехмерной структуры, как определяют с помощью таких способов, как анализ посредством ядерного магнитного резонанса, кристаллография или фотоаффинное мечение (см., например, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).

Настоящее изобретение относится также к выделенным полинуклеотидам, кодирующим полипептид согласно изобретению, которые гибридизуются в условиях низкой жесткости, предпочтительно в условиях умеренной жесткости, более предпочтительно в условиях средневысокой жесткости, более предпочтительно в условиях высокой жесткости, и наиболее предпочтительно в условиях очень высокой жесткости (i) с нуклеотидами 145-270 последовательности SEQ ID NO:1, (ii) с последовательностью кДНК, которая содержится в нуклеотидах 1-270 последовательности SEQ ID NO:1, или (iii) с цепью, комплементарной (i) или (ii); или их аллельным вариантам и подпоследовательностям (Sambrook et al., 1989, выше), как определено в настоящем описании.

Настоящее изобретение относится также к выделенным полинуклеотидам, полученным посредством (a) гибридизации совокупности ДНК в условиях низкой, умеренной, средневысокой, высокой или очень высокой жесткости (i) с нуклеотидами 145-270 последовательности SEQ ID NO:1, (ii) с последовательностью кДНК, которая содержится в нуклеотидах 1-270 последовательности SEQ ID NO:1, или (iii) с цепью, комплементарной (i) или (ii); и (b) выделения гибридизованного полинуклеотида, который кодирует полипептид с противомикробной активностью.

Конструкции нуклеиновых кислот

Настоящее изобретение относится также к конструкциям нуклеиновых кислот, содержащим выделенный полинуклеотид согласно изобретению, функционально связанный с одной или несколькими контролирующими последовательностями, которые регулирует экспрессию кодирующей последовательности в пригодной клетке-хозяине в условиях, совместимых с контролирующими последовательностями.

Выделенный полинуклеотид, кодирующий полипептид согласно изобретению, можно обрабатывать различными способами для обеспечения экспрессии полипептида. Обработка полинуклеотидной последовательности перед ее встраиванием в вектор может быть желательной или необходимой в зависимости от экспрессирующего вектора. Способы модификации полинуклеотидных последовательностей, в которых используются способы рекомбинантных ДНК, хорошо известны в данной области.

Контролирующая последовательность может представлять собой пригодную промоторную последовательность, нуклеотидную последовательность, которая распознается клеткой-хозяином для экспрессии полинуклеотида, кодирующего полипептид согласно изобретению. Последовательность промотора содержит последовательности контроля транскрипции, которые осуществляют экспрессию полипептида. Промотор может представлять собой любую нуклеотидную последовательность, которая проявляет транскрипционную активность в предпочтительной для выбора клетке-хозяине, включая мутантные, укороченные и гибридные промоторы, и его можно получать из генов, кодирующих внеклеточные или внутриклеточные полипептиды, либо гомологичные, либо гетерологичные клетке-хозяину.

Примерами пригодных промоторов для регуляции транскрипции конструкции нуклеиновых кислот согласно изобретению, особенно в бактериальной клетке-хозяине, являются промоторы, полученные из lac-оперона E. coli, ген агаразы (dagA) Streptomyces coelicolor, ген левансахаразы (sacB) Bacillus subtilis, ген альфа-амилазы (amyL) Bacillus licheniformis, ген мальтогенной амилазы (amyM) Bacillus stearothermophilus, ген альфа-амилазы (amyQ) Bacillus amyloliquefaciens, ген пенициллиназы (penP) Bacillus licheniformis, Bacillus subtilis гены xylA и xylB, и ген прокариотической бета-лактамазы (Villa-Kamaroff et al., 1978, Proceedings of the National Academy of Sciences USA 75: 3727-3731), а также промотор tac (DeBoer et al., 1983, Proceedings of the National Academy of Sciences USA 80: 21-25). Кроме того, промоторы описаны в "Useful proteins from recombinant bacteria" в Scientific American, 1980, 242: 74-94; и в Sambrook et al., 1989, выше.

Примеры пригодных промоторов для регуляции транскрипции конструкций нуклеиновых кислот согласно изобретению в клетках-хозяевах в виде мицеллярных грибов представляют собой промоторы, полученные из генов амилазы TAKA Aspergillus oryzae, аспарагиновой протеазы Rhizomucor miehei, нейтральной альфа-амилазы Aspergillus niger, стабильной в отношении кислот альфа-амилазы Aspergillus niger, глюкоамилазы (glaA) Aspergillus niger или Aspergillus awamori, липазы Rhizomucor miehei, щелочной протеазы Aspergillus oryzae, триозофосфатизомеразы Aspergillus oryzae, ацетамидазы Aspergillus nidulans, амилоглюкозидазы Fusarium venenatum (WO 00/56900), Daria Fusarium venenatum (WO 00/56900), Quinn Fusarium venenatum (WO 00/56900), трипсиноподобной протеазы Fusarium oxysporum (WO 96/00787), бета-глюкозидазы Trichoderma reesei, целлобиогидролазы I Trichoderma reesei, эндоглюканазы I Trichoderma reesei, эндоглюканазы II Trichoderma reesei, эндоглюканазы III Trichoderma reesei, эндоглюканазы IV Trichoderma reesei, эндоглюканазы V Trichoderma reesei, ксиланазы I Trichoderma reesei, ксиланазы II Trichoderma reesei, бета-ксилозидазы Trichoderma reesei, а также промотор NA2-tpi (гибрид промоторов из генов нейтральной альфа-амилазы Aspergillus niger и триозофосфатизомеразы Aspergillus oryzae); и их мутантные, укороченные и гибридные промоторы.

В дрожжевом хозяине пригодные промоторы получают из генов енолазы (ENO-1) Saccharomyces cerevisiae, галактокиназы (GAL1) Saccharomyces cerevisiae, алкогольдегидрогеназы/глицеральдегид-3-фосфатдегидрогеназы (ADH1, ADH2/GAP) Saccharomyces cerevisiae, триозофосфатизомеразы (TPI) Saccharomyces cerevisiae, металлотионина (CUP1) Saccharomyces cerevisiae и 3-фосфоглицераткиназы Saccharomyces cerevisiae. Другие пригодные промоторы для дрожжевых клеток-хозяев описаны Romanos et al., 1992, Yeast 8: 423-488.

Контролирующая последовательность также может представлять собой пригодную последовательность терминатора транскрипции, последовательность, распознаваемую клеткой-хозяином для завершения транскрипции. Терминирующая последовательность является функционально связанной c 3'-концом нуклеотидной последовательности, кодирующей полипептид. Любой терминатор, который является функциональным в предпочтительной для выбора клетке-хозяине можно использовать в соответствии с настоящим изобретением.

Предпочтительные терминаторы для клеток хозяев, представляющих собой мицеллярные грибы, получают из генов амилазы TAKA Aspergillus oryzae, глюкоамилазы Aspergillus niger, антранилатсинтетазы Aspergillus nidulans, альфа-глюкозидазы Aspergillus niger и трипсиноподобной протеазы Fusarium oxysporum.

Предпочтительные терминаторы для дрожжевых клеток-хозяев получают из генов енолазы Saccharomyces cerevisiae, цитохрома C (CYC1) Saccharomyces cerevisiae, и глицеральдегид-3-фосфатдегидрогеназы Saccharomyces cerevisiae. Другие пригодные терминаторы для дрожжевых клеток-хозяев описаны Romanos et al., 1992, выше.

Контролирующая последовательность также может представлять собой пригодную лидерную последовательность, нетранслируемую область мРНК, которая является важной для трансляции клетки-хозяина. Лидерная последовательность является функционально связанной с 5'-концом нуклеотидной последовательности, кодирующей полипептид. Любая лидерная последовательность, которая является функциональной в предпочтительной для выбора клетке-хозяине, можно использовать в соответствии с настоящим изобретением.

Предпочтительные лидерные последовательности для клеток-хозяев, представляющих собой мицеллярные грибы, получают из генов амилазы TAKA Aspergillus oryzae и триозофосфатизомеразы Aspergillus nidulans.

Пригодные лидерные последовательности для дрожжевых клеток-хозяев получают из генов енолазы (ENO-1) Saccharomyces cerevisiae, 3-фосфоглицераткиназы Saccharomyces cerevisiae, альфа-фактора Saccharomyces cerevisiae, и алкогольдегидрогеназы/глицеральдегид-3-фосфатдегидрогеназы (ADH2/GAP) Saccharomyces cerevisiae.

Контролирующая последовательность также может представлять собой последовательность для полиаденилирования, последовательность, функционально связанную с 3'-концом нуклеотидной последовательности, и которую при транскрипции распознает клетка-хозяин в качестве сигнала для добавления остатков полиаденозина к транскрибируемой мРНК. Любую последовательность для полиаденилирования, которая является функциональной в предпочтительной для выбора клетке-хозяине, можно использовать в соответствии с настоящим изобретением.

Предпочтительные последовательности для полиаденилирования для клеток-хозяев, представляющих собой мицеллярные грибы, получают из генов амилазы TAKA Aspergillus oryzae, глюкоамилазы Aspergillus niger, антранилатсинтетазы Aspergillus nidulans, трипсиноподобной протеазы Fusarium oxysporum, и альфа-глюкозидазы Aspergillus niger.

Пригодные последовательности для полиаденилирования для дрожжевых клеток-хозяев описаны Guo and Sherman, 1995, Molecular Cellular Biology 15: 5983-5990.

Контролирующая последовательность также может представлять собой кодирующий сигнальный пептид участок, который кодирует аминокислотную последовательность, связанную с N-концом полипептида, и направляет кодируемый полипептид по секреторному пути клетки. 5'-конец кодирующей последовательности нуклеотидной последовательности может изначально содержать кодирующий сигнальный пептид участок, естественным образом связанный в трансляционной рамке считывания с сегментом кодирующего участка, который кодирует секретируемый полипептид. Альтернативно 5'-конец кодирующей последовательности может содержать кодирующий сигнальный пептид участок, который является чужеродным для кодирующей последовательности. Чужеродный кодирующий сигнальный пептид участок может быть необходим в случае, когда кодирующая последовательность в природе не содержит кодирующего сигнальный пептид участка. Альтернативно чужеродный кодирующий сигнальный пептид участок может просто заменять природный кодирующий сигнальный пептид участок в целях повышения секреции полипептида. Однако в соответствии с настоящим изобретением можно использовать любой кодирующий сигнальный пептид участок, который направляет экспрессируемый полипептид по секреторному пути в выбранной предпочтительной хозяйской клетке.

Эффективные кодирующие сигнальный пептид участки для бактериальных клеток-хозяев представляют собой кодирующие сигнальный пептид участки, полученные из генов мальтогенной амилазы NCIB 11837, альфа-амилазы Bacillus stearothermophilus, субтилизина Bacillus licheniformis, бета-лактамазы Bacillus licheniformis, нейтральной протеазы (nprT, nprS, nprM) Bacillus stearothermophilus и prsA Bacillus subtilis. Дополнительные сигнальные пептиды описаны Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.

Эффективные кодирующие сигнальный пептид участки для клеток-хозяев, представляющих собой мицеллярные грибы, представляют собой кодирующие сигнальный пептид участки, полученные из генов амилазы TAKA Aspergillus oryzae, нейтральной амилазы Aspergillus niger, глюкоамилазы Aspergillus niger, аспарагиновой протеазы Rhizomucor miehei, целлюлазы Humicola insolens и липазы Humicola lanuginosa.

В предпочтительном аспекте кодирующий сигнальный пептид участок представляет собой нуклеотиды 1-60 последовательности SEQ ID NO:1, которые кодируют аминокислоты с -48 по -29 SEQ ID NO:2.

Пригодные сигнальные пептиды для дрожжевых клеток-хозяев получают из генов альфа-фактора Saccharomyces cerevisiae и инвертазы Saccharomyces cerevisiae. Дополнительные пригодные кодирующие сигнальные пептиды участки описаны Romanos et al., 1992, выше.

Контролирующая последовательность также может представлять собой кодирующий пропептид участок, который кодирует аминокислотную последовательность, находящуюся на N-конце полипептида. Полученный в результате полипептид известен в качестве профермента или прополипептида (или в некоторых случаях зимогена). Прополипептид, как правило, является неактивным и может превращаться в зрелый активный полипептид посредством каталитического или аутокаталитического отщепления пропептида от прополипептида. Кодирующий пропептид участок можно получать из генов щелочной протеазы (aprE) Bacillus subtilis, нейтральной протеазы (nprT) Bacillus subtilis, альфа-фактора Saccharomyces cerevisiae, аспарагиновой протеазы Rhizomucor miehei, и лакказы Myceliophthora thermophila (WO 95/33836).

В предпочтительном аспекте кодирующий пропептид участок представляет собой нуклеотиды 61-144 последовательности SEQ ID NO:1, которые кодируют аминокислоты -28 по -1 SEQ ID NO:2.

В случае, когда участки сигнального пептида и пропептида находятся на N-конце полипептида, участок пропептида располагается рядом с N-концом полипептида, и участок сигнального пептида располагается рядом с N-концом участка пропептида.

Также может быть необходимо добавление регуляторных последовательностей, которые обеспечивают регуляцию экспрессии полипептида, связанную с ростом клетки-хозяина. Примерами регуляторных систем являются системы, которые приводят к включению или выключению экспрессии гена в ответ на химический или физический стимул, включая присутствие регулирующего соединения. Регуляторные системы в прокариотических системах включают системы операторов lac, tac и trp. В дрожжах можно использовать систему ADH2 или систему GAL1. В мицеллярных грибах в качестве регуляторных последовательностей можно использовать промотор альфа-амилазы TAKA, промотор глюкоамилазы Aspergillus niger и промотор глюкоамилазы Aspergillus oryzae. Другими примерами регуляторных последовательностей являются последовательности, которые обеспечивают амплификацию гена. В эукариотических системах они включают в себя ген дигидрофолатредуктазы, который амплифицируется в присутствии метотрексата, и гены металлотеонеина, которые амплифицируются в присутствии тяжелых металлов. В этих случаях нуклеотидная последовательность, кодирующая полипептид, является функционально связанной с регуляторной последовательностью.

Экспрессирующие векторы

Настоящее изобретение относится также к рекомбинантным экспрессирующим векторам, содержащим полинуклеотид согласно изобретению, промотор и транскрипционный и трансляционный стоп сигналы. Различные нуклеиновые кислоты и контролирующие последовательности, описанные выше, можно соединять друг с другом с получением рекомбинантного экспрессирующего вектора, который может включать один или несколько пригодных участков рестрикции для возможности внесения вставок или замен в таких участках в нуклеотидную последовательность, кодирующую полипептид. Альтернативно нуклеотидную последовательность согласно изобретению можно экспрессировать посредством встраивания нуклеотидной последовательности или конструкции нуклеиновой кислоты, содержащей последовательность, в соответствующий вектор для экспрессии. При создании экспрессирующего вектора кодирующую последовательность располагают в векторе таким образом, чтобы кодирующая последовательность была функционально связана с соответствующими последовательностями для контроля экспрессии.

Рекомбинантный экспрессирующий вектор может представлять собой любой вектор (например, плазмиду или вирус), который можно удобным способом подвергать процессам, связанным с рекомбинантными ДНК, и который может приводить к экспрессии нуклеотидной последовательности. Выбор вектора, как правило, зависит от совместимости вектора с клеткой-хозяином, в которую вводят вектор. Векторы могут представлять собой линейные или замкнутые кольцевые плазмиды.

Вектор может представлять собой автономно реплицирующийся вектор, т.е. вектор, который полностью существует экстрахромосомно, репликация которого независима от репликации хромосомы, например, он может представлять собой плазмиду, экстрахромосомный элемент, минихромосому или искусственную хромосому. Вектор может содержать любые элементы для обеспечения саморепликации. Альтернативно вектор может представлять собой вектор, который при введении в клетку-хозяина встраивается в геном и реплицируется совместно с хромосомой(ами), в которую он встроился. Более того, можно использовать единый вектор или плазмиду или два или более векторов или плазмид, которые совместно содержат всю ДНК, предназначенную для введения в геном клетки-хозяина, или транспозон.

Векторы согласно изобретению предпочтительно содержат один или несколько селективных маркеров, которые обеспечивают удобную селекцию трансформированных клеток. Селективный маркер представляет собой ген, продукт которого обеспечивает устойчивость к биоцидам или вирусам, устойчивость к тяжелым металлам, прототрофию ауксотрофам и т.п.

Примерами бактериальных селективных маркеров являются гены dal из Bacillus subtilis или Bacillus licheniformis, или маркеры, которые придают устойчивость к антибиотикам, такую как устойчивость к ампициллину, канамицину, хлорамфениколу или тетрациклину. Пригодными маркерами для дрожжевых клеток-хозяев являются ADE2, HIS3, LEU2, LYS2, MET3, TRP1 и URA3. Селективные маркеры для применения в клетках-хозяевах, представляющих собой мицеллярные грибы, включают, но не ограничиваются ими, amdS (ацетамидаза), argB (орнитинкарбамоилтрансфераза), bar (фосфинотрицинацетилтрансфераза), hph (гигромицинфосфотрансфераза), niaD (нитратредуктаза), pyrG (оротидин-5'-фосфатдекарбоксилаза), sC (сульфатаденилтрансфераза) и trpC (антранилатсинтетаза), а также их эквиваленты. Предпочтительными для использования в клетке Aspergillus являются гены amdS и pyrG Aspergillus nidulans или Aspergillus oryzae и ген bar Streptomyces hygroscopicus.

Векторы согласно изобретению предпочтительно содержат элемент(ы), которые обеспечивают встраивание вектора в геном клетки-хозяина или автономную репликацию вектора в клетке независимо от генома.

Для встраивания в геном клетки-хозяина основой вектора может быть полинуклеотидная последовательность, кодирующая полипептид, или любой другой элемент вектора для встраивания в геном посредством гомологичной или негомологичной рекомбинации. Альтернативно вектор может содержать дополнительные нуклеотидные последовательности для направления интеграции посредством гомологичной рекомбинации в геном клетки-хозяина в точном положении(ях) на хромосоме(ах). Для повышения вероятности встраивания в точное положение, встраиваемые элементы предпочтительно должны содержать достаточное количество пар оснований нуклеиновых кислот, такое как от 100 до 10000 пар оснований, предпочтительно от 400 до 10000 пар оснований и наиболее предпочтительно от 800 до 10000 пар оснований, которые обладают высокой степенью идентичности с соответствующей последовательностью-мишенью для увеличения вероятности гомологичной рекомбинации. Встраиваемые элементы могут представлять собой любую последовательность, которая гомологична последовательности-мишени в геноме клетки-хозяина. Более того, встраиваемые элементы могут представлять собой некодирующие или кодирующие нуклеотидные последовательности. С другой стороны, вектор можно встраивать в геном клетки-хозяина посредством негомологичной рекомбинации.

Для автономной репликации вектор может дополнительно содержать ориджин репликации, дающий возможность вектору автономно реплицироваться в представляющей интерес клетке-хозяине. Ориджин репликации может представлять собой любой плазмидный репликатор, обеспечивающий автономную репликацию, который функционирует в клетке. В настоящем описании термин "ориджин репликации" или "плазмидный репликатор" определяют как нуклеотидную последовательность, которая дает возможность плазмиде или вектору реплицироваться in vivo.

Примерами бактериальных ориджинов репликации являются ориджины репликации плазмид pBR322, pUC19, pACYC177 и pACYC184, обеспечивающие репликацию в E. coli, и pUB110, pE194, pTA1060 и pAMβ1, обеспечивающие репликацию в Bacillus. Примерами ориджинов репликации для использования в дрожжевой клетке-хозяине являются 2-микронный ориджин репликации, ARS1, ARS4, сочетание ARS1 и CEN3 и сочетание ARS4 и CEN6.

Примерами ориджинов репликации, пригодных в клетках мицеллярных грибов, являются AMA1 и ANS1 (Gems et al., 1991, Gene 98:61-67; Cullen et al., 1987, Nucleic acids Research 15: 9163-9175; WO 00/24883). Выделение гена AMA1 и конструирование плазмид или векторов, содержащих ген, можно проводить в соответствии со способами, описанными в WO 00/24883.

Для повышения продукции продукта гена в клетку-хозяина можно вводить более одной копии полинуклеотида согласно изобретению. Повышения количества копий полинуклеотида можно достигать посредством встраивания по меньшей мере одной дополнительной копии последовательности в геном клетки-хозяина или посредством включения амплифицируемого гена селективного маркера совместно с полинуклеотидом, где клетки, содержащие амплифицированные копии гена селективного маркера, и, таким образом, дополнительные копии полинуклеотида, можно отбирать посредством культивирования клеток в присутствии соответствующего вещества для селекции.

Способы, используемые для лигирования описанных выше элементов с конструкциями рекомбинантных экспрессирующих векторов согласно изобретению, хорошо известны специалисту в данной области (см., например, Sambrook et al., 1989, выше).

Клетки-хозяева

Настоящее изобретение относится также к рекомбинантным клеткам-хозяевам, содержащим полинуклеотид согласно изобретению, которые предпочтительно используют для рекомбинантной продукции полипептидов. Вектор, содержащий полинуклеотид согласно изобретению, вводят в клетку-хозяина таким образом, чтобы вектор поддерживался в качестве интегрированного в хромосому элемента или в качестве самореплицирующегося экстрахромосомного вектора, описанного ранее. Термин "клетка-хозяин" включает любого потомка исходной клетки, который не является идентичным исходной клетке вследствие мутаций, которые происходят в процессе репликации. Выбор клетки-хозяина в большой степени зависит от гена, кодирующего полипептид, и его источника.

Клетка-хозяин может представлять собой одноклеточный микроорганизм, например, прокариотический организм, или неодноклеточный микроорганизм, например, эукариотический организм. Пригодные одноклеточные микроорганизмы представляют собой бактериальные клетки, такие как грамположительные бактерии, включая, но не ограничиваясь ими, клетку Bacillus, например, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis и Bacillus thuringiensis; или клетку Streptomyces, например, Streptomyces lividans и Streptomyces murinus, или грамотрицательные бактерии, такие как E. coli и Pseudomonas sp. В предпочтительном аспекте бактериальная клетка-хозяин представляет собой клетку Bacillus lentus, Bacillus licheniformis, Bacillus stearothermophilus или Bacillus subtilis. В другом предпочтительном аспекте, клетка Bacillus представляет собой алкалофильную клетку Bacillus.

Введение вектора в бактериальную клетку-хозяина можно, например, осуществлять посредством трансформации протопласта (см., например, Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), с использованием компетентных клеток (см., например, Young and Spizizin, 1961, Journal of Bacteriology 81: 823-829, или Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56: 209-221), электропорации (см., например, Shigekawa and Dower, 1988, Biotechniques 6: 742-751), или конъюгации (см., например, Koehler and Thorne, 1987, Journal of Bacteriology 169: 5771-5278).

Клетка-хозяин также может представлять собой эуриотическую клетку, такую как клетка млекопитающих, насекомых, растений или грибов.

В предпочтительном аспекте клетка-хозяин представляет собой клетку грибов. Как используют в настоящем описании "грибы" включают типы Ascomycota, Basidiomycota, Chytridiomycota и Zygomycota (как определено Hawksworth et al, In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK), а также Oomycota (как приведено в Hawksworth et al, 1995, выше, стр. 171) и все митоспоровые грибы (Hawksworth et al, 1995, выше).

В более предпочтительном аспекте относящаяся к грибам клетка-хозяин представляет собой дрожжевую клетку. Как используют в настоящем описании "дрожжи" включают аскоспорогенные дрожжи (Endomycetales), базидиоспорогенные дрожжи и дрожжи, принадлежащие к несовершенным грибам (Blastomycetes). Поскольку классификация дрожжей может в будущем измениться, для целей этого изобретения дрожжи следует определять, как описано в Biology and Activities of Yeast (Skinner, F.A., Passmore, S. M., and Davenport, R.R., eds, Soc. App. Bacteriol. Symposium Series No. 9, 1980).

В более предпочтительном аспекте, дрожжевая клетка-хозяин представляет собой клетку Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces или Yarrowia.

В наиболее предпочтительном аспекте дрожжевая клетка-хозяин представляет собой клетку Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces dougflasii, Saccharomyces kluyveri, Saccharomyces norbensis или Saccharomyces oviformis. В другом наиболее предпочтительном аспекте, дрожжевая клетка-хозяин представляет собой клетку Kluyveromyces lactis. В другом наиболее предпочтительном аспекте дрожжевая клетка-хозяин представляет собой клетку Yarrowia lipolytica.

В другом более предпочтительном аспекте относящаяся к грибам клетка-хозяин представляет собой клетку мицеллярных грибов. "Мицеллярные грибы" включают все мицеллярные формы подгрупп Eumycota и Oomycota (как определено Hawksworth et al, 1995, выше). Мицеллярные грибы, главным образом, характеризуются стенкой мицелия, состоящей из хитина, целлюлозы, глюкана, хитозана, маннана и других сложных полисахаридов. Вегетативный рост происходит посредством удлинения гифа, и катаболизм углерода является облигатно аэробным. Напротив, вегетативный рост дрожжей, таких как Saccharomyces cerevisiae происходит посредством почкования одноклеточного таллома, и катаболизм углерода может быть ферментативным.

В более предпочтительном аспекте клетка-хозяин, относящаяся к мицеллярным грибам, представляет собой клетку Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Coprinus, Coholus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes или Trichoderma.

В наиболее предпочтительном аспекте клетка-хозяин, относящаяся к мицеллярным грибам, представляет собой Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger или Aspergillus oryzae. В другом наиболее предпочтительном аспекте клетка-хозяин, относящаяся к мицеллярным грибам, представляет собой клетку Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides или Fusarium venenatum. В другом наиболее предпочтительном аспекте клетка-хозяин, относящаяся к мицеллярным грибам, представляет собой клетку штамма Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, или Ceriporiopsis subvermispora, Coprinus cinereus, Coriolus hirsutus, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei или Trichoderma viride.

Трансформацию клеток грибов можно проводить посредством процесса, включающего формирование протопластов, трансформацию протопластов и регенерацию клеточной стенки по существу известным способом. Пригодные способы трансформации клеток-хозяев Aspergillus и Trichoderma описаны в EP 238 023 и Yelton et al., 1984, Proceedings of the National Academy of Sciences USA 81: 1470-1474. Пригодные способы трансформации видов Fusarium описаны Malardier et al, 1989, Gene 78: 147-156, и в WO 96/00787. Дрожжи можно трансформировать с использованием способов, описанных Becker and Guarente, In Abelson, J.N. and Simon, M.I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al, 1983, Journal of Bacteriology 153: 163; и Hinnen et al., 1978, Proceedings of the National Academy of Sciences USA 75: 1920.

Способы получения

Настоящее изобретение относится также к способам получения полипептида согласно изобретению, включающим (a) культивирование клетки, которая в своей форме дикого типа способна продуцировать полипептид в условиях, способствующих продукции полипептида; и (b) выделение полипептида. Предпочтительно, клетка представляет собой клетку рода Eurotium, и более предпочтительно Eurotium amstelodami.

Настоящее изобретение относится также к способам получения полипептида согласно изобретению, включающим (a) культивирование клетки-хозяина в условиях, способствующих продукции полипептида; и (b) выделение полипептида.

Настоящее изобретение относится также к способам получения полипептида согласно изобретению, включающим (a) культивирование клетки-хозяина в условиях, способствующих продукции полипептида, где клетка-хозяин содержит мутантную нуклеотидную последовательность по меньшей мере с одной мутацией в кодирующем зрелый полипептид участке SEQ ID NO:1, где мутантная нуклеотидная последовательность кодирует полипептид, который состоит из аминокислот 1-42 последовательности SEQ ID NO:2, и (b) выделение полипептида.

В способах получения согласно изобретению клетки культивируют в питательной среде, пригодной для продукции полипептида, с использованием способов, хорошо известных в данной области. Например, клетку можно культивировать посредством культивирования во встряхиваемой колбе, и мелкомасштабного или крупномасштабного культивирования (включая постоянное, периодическое культивирование, культивирование с подпиткой или твердофазное культивирование) в лаборатории или в промышленных биореакторах, проводимого в пригодной среде и в условиях, обеспечивающих экспрессию и/или выделение пептида. Культивирование проводят в пригодной питательной среде, содержащей источники углерода и азота и неорганические соли, с использованием известных в данной области способов. Пригодные среды доступны у коммерческих поставщиков или их можно получать в соответствии с опубликованными составами (например, в каталогах American Type Culture Collection). Если полипептид секретируется в питательную среду, полипептид можно выделять непосредственно из среды. Если полипептид не секретируется, его можно выделять из клеточных лизатов.

Полипептиды можно выявлять с использованием известных в данной области способов, которые являются специфичными в отношении полипептидов. Эти способы выявления могут включать применение специфичных антител. Например, можно использовать анализ противомикробной активности для определения активности полипептида, как описано в настоящем описании.

Полученный полипептид можно выделять с использованием известных в данной области способов. Например, полипептид можно выделять из питательной среды общепринятыми способами, включая, но не ограничиваясь ими, центрифугирование, фильтрацию, экстракцию, сушку распылением, выпаривание или осаждение.

Полипептиды согласно изобретению можно очищать различными способами, известными в данной области, включая, но не ограничиваясь ими, хроматографию (например, ионообменную, аффинную, гидрофобную хроматографию, хроматофокусирование и гель-фильтрацию), электрофоретические способы (например, препаративное изоэлектрическое фокусирование), дифференциальную растворимость (например, осаждение сульфатом аммония), SDS-PAGE или экстракцию (см., например, Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

Растения

Настоящее изобретение относится также к трансгенному растению, части растения или клетке растения, которую трансформировали нуклеотидной последовательностью, кодирующей полипептид с противомикробной активностью согласно изобретению, для того чтобы экспрессировать и получать полипептид в поддающихся выделению количествах. Полипептид можно выделять из растения или части растения. Альтернативно можно использовать само по себе растение или часть растения, содержащую рекомбинантный полипептид, для улучшения качества пищи или корма, например, для улучшения пищевой ценности, вкуса и реологических свойств или для разрушения антипитательного фактора.

Трансгенное растение может быть двудольным (dicot) или однодольным (monocot). Примерами однодольных растений являются травы, такие как мятлик луговой (мятлик обыкновенный, Poa), кормовая трава, такая как Festuca, Lolium, травы умеренного климата, такие как Agrostis, и зерновые, например, такие как пшеница, овес, рожь, ячмень, рис, сорго и маис (кукуруза).

Примерами двудольных растений являются табак, бобовые, такие как люпины, картофель, сахарная свекла, горох, фасоль и соя, и крестоцветные растения (семейство Brassicaceae), такие как цветная капуста, рапс и близко родственный модельный организм Arabidopsis thaliana.

Примерами частей растений являются стебель, каллюс, листья, корень, плоды, семена и клубни, а также отдельные ткани, образующие эти части, например, эпидермис, мезофилл, паренхима, сосудистые ткани, меристемы. Конкретные отделы клетки растений, такие как хлоропласты, апопласты, митохондрии, вакуоли, пероксисомы и цитоплазма, также рассматривают как части растений. Более того, любую клетку растения независимо от ткани-источника рассматривают как часть растения. Аналогично, части растений, такие как конкретные ткани и клетки, выделенные для упрощения применения согласно изобретению, также рассматривают как части растения, например, зародыш, эндосперм, алейрон и оболочки семян.

Также в объем настоящего изобретения входит потомство таких растений, частей растений и клеток растений.

Трансгенное растение или клетку растения, экспрессирующую полипептид согласно изобретению, можно получать в соответствии с известными в данной области способами. В кратком изложении, растение или клетку растения получают посредством встраивания одной или нескольких экспрессирующих конструкций, кодирующих полипептид согласно изобретению, в геном растения-хозяина и размножения полученного модифицированного растения или клетки растения в трансгенное растение или клетку растения.

Целесообразно, чтобы экспрессирующая конструкция представляла собой конструкцию нуклеиновой кислоты, которая содержит полинуклеотид, кодирующий полипептид согласно изобретению, функционально связанный с соответствующими регуляторными последовательностями, необходимыми для экспрессии нуклеотидной последовательности в предпочтительном для выбора растении или части растения. Более того, экспрессирующая конструкция может содержать селективный маркер, пригодный для выявления клеток-хозяев, в которые встроилась экспрессирующая конструкция, и последовательности ДНК, необходимые для введения конструкции в представляющее интерес растение (последние зависят от используемого способа введения ДНК).

Выбор регуляторных последовательностей, таких как последовательности промотора и терминатора, и необязательно сигнальных или транспортных последовательностей, определяется, например, исходя из того, когда, где и каким образом необходимо экспрессировать полипептид. Например, экспрессия гена, кодирующего полипептид согласно изобретению, может быть конститутивной или индуцибельной, или может быть зависимой от развития, специфичной в отношении стадии или ткани, и продукт гена может быть направлен в конкретную ткань или часть растения, такую как семена или листья. Регуляторные последовательности описаны, например, Tague et al., 1988, Plant Physiology 86: 506.

Для конститутивной экспрессии можно использовать промотор 35S-CaMV, промотор убиквитина маиса 1 и актина риса 1 (Franck et al., 1980, Cell 21: 285-294, Christensen et al., 1992, Plant Mo. Biol. 18: 675-689; Zhang et al., 1991, Plant Cell 3: 1155-1165). Специфичные в отношении органа промоторы могут представлять собой, например, промотор из запасающих тканей, таких как семена, клубни картофеля и плоды (Edwards & Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), или из накапливающих метаболиты тканей, таких как меристемы (Ito et al., 1994, Plant Mol. Biol. 24: 863-878), специфичный в отношении семян промотор, такой как промотор для глютелина, проламина, глобулина или альбумина риса (Wu et al., 1998, Plant and Cell Physiology 39: 885-889), промотор Vicia faba из гена легумина B4 и неизвестного белка семян из Vicia faba (Conrad et al., 1998, Journal of Plant Physiology 152: 708-711), промотор из белка основы масла семян (Chen et al., 1998, Plant and Cell Physiology 39: 935-941), промотор запасного белка napA из Brassica napus, или любой другой специфичный в отношении семян промотор, известный в данной области, например, как описано в WO 91/14772. Более того, промотор может представлять собой специфичный в отношении листьев промотор, такой как промотор rbcs из риса или томатов (Kyozuka et al., 1993, Plant Physiology 102: 991-1000), промотор гена аденинметилтрансферазы вируса хлореллы (Mitra и Higgins, 1994, Plant Molecular Biology 26: 85-93), или промотор гена aldP из риса (Kagaya et al., 1995, Molecular and General Genetics 248: 668-674), или индуцируемый повреждением промотор, такой как промотор картофеля pin2 (Xu et al., 1993, Plant Molecular Biology 22: 573-588). Аналогично, промотор может быть индуцируемым посредством абиотических воздействий, таких как температура, засуха или изменение содержания солей, или он может индуцироваться применением экзогенных веществ, которые активируют промотор, например, этанола, эстрогенов, гормонов растений, таких как этилен, абсцизиновая кислота и гиббереллиновая кислота, и тяжелых металлов.

Также для достижения более высокой экспрессии полипептида согласно изобретению в растении можно использовать элемент, усиливающий промотор. Например, элемент, усиливающий промотор, может представлять собой интрон, который помещен между промотором и нуклеотидной последовательностью, кодирующей полипептид согласно изобретению. Например, в Xu et al., 1993, выше, описано применение первого интрона гена актина риса 1 для повышения экспрессии.

Ген селективного маркера и любые другие части конструкции для экспрессии можно выбирать из тех, которые доступны в данной области.

Конструкцию нуклеиновой кислоты встраивают в геном растений в соответствии с общепринятыми способами, известными в данной области, включая опосредуемую Agrobacterium трансформацию, опосредуемую вирусом трансформацию, микроинъекцию, бомбардировку частицами, биолистическую трансформацию и электропорацию (Gasser et al., 1990, Science 244: 1293; Potrykus, 1990, Bio/Technology 8: 535; Shimamoto et al., 1989, Nature 338: 274).

В настоящее время опосредуемый Agrobacterium tumefaciens перенос гена является предпочтительным для выбора способом получения трансгенных двудольных (для обзора, см. Hooykas and Schilperoort, 1992, Plant Molecular Biology 19: 15-38) и его можно использовать для трансформации однодольных, хотя для этих растений часто используют другие способы трансформации. В настоящее время предпочтительным для выбора способом получения трансгенных однодольных является бомбардировка частицами (микроскопические частицы из золота или вольфрама, покрытые ДНК для трансформации) зародышевых каллюсов или развивающихся зародышей (Christou, 1992, Plant Journal 2: 275-281; Shimamoto, 1994, Current Opinion Biotechnology 5: 158-162; Vasil et al., 1992, Bio/Technology 10: 667-674). Альтернативный способ трансформации однодольных основан на трансформации протопласта, как описано Omirulleh et al., 1993, Plant Molecular Biology 21: 415-428.

После трансформации трансформанты, обладающие встроенной конструкцией для экспрессии, отбирают и регенерируют в целые растения в соответствии с хорошо известными в данной области способами. Часто процесс трансформации разрабатывают для селективного удаления генов, по которым проводят отбор, либо в процессе регенерации, либо в последующих поколениях, с использованием, например, ко-трансформации с двумя отдельными конструкциями T-ДНК или сайт-специфичной эксцизии гена, по которому проводят отбор, с помощью специфичной рекомбиназы.

Настоящее изобретение относится также к способам получения полипептида согласно изобретению, включающим (a) культивирование трансгенного растения или клетки растения, содержащей полинуклеотид, кодирующий полипептид с противомикробной активностью согласно изобретению, в условиях, способствующих продукции полипептида; и (b) выделение полипептида.

Композиции

Настоящее изобретение относится также к композициям, таким как фармацевтические композиции, содержащие полипептид согласно изобретению. Предпочтительно, композиции обогащены таким полипептидом. Термин "обогащенный" указывает на то, что противомикробная активность композиции повышена, например, с коэффициентом обогащения 1,1.

Кроме того, композиции могут содержать другое фармацевтически активное вещество, такое как дополнительное биоцидное вещество, такое как другой противомикробный полипептид, проявляющий противомикробную активность, как определено выше. Биоцидное вещество может представлять собой известный в данной области антибиотик. Классы антибиотиков включают пенициллины, например, пенициллин G, пенициллин V, метициллин, оксициллин, карбенициллин, нафциллин, ампициллин и т.д.; пенициллины в сочетании ингибиторами бета-лактамазы, цефалоспорины, например, цефаклором, цефазолином, цефуроксимом, моксалактамом и т.д.; карбапенемы; монобактамы; аминогликозиды; тетрациклины; макролиды; линкомицины; полимиксины; сульфонамиды; хинолоны; хлорамфеникол; метронидазол; спектиномицин; триметоприм; ванкомицин; и т.д. Биоцидное вещество также может представлять собой противомикробное вещество, включая, полиены, например, амфотерицин B, нистатин; 5-флукозин; и азолы, например, миконазол, кетоконазол, итраконазол и флуконазол.

В одном варианте осуществления биоцидное средство представляет собой неферментативное химическое вещество. В другом варианте осуществления биоцидное вещество представляет собой неполипептидное химическое вещество.

Композиции могут содержать пригодный носитель. Композиции также могут содержать пригодный носитель для доставки, способный доставлять противомикробные полипептиды согласно изобретению в требуемую область, при использовании композиций в качестве лекарственного средства.

Композиции полипептида можно получать в соответствии с известными в данной области способами, и они могут находиться в форме жидкой или сухой композиции. Например, композиция полипептида может находиться в форме гранулята или микрогранулята. Полипептид, подлежащий включению в композицию, можно стабилизировать в соответствии с известными в данной области способами.

Примеры композиций полипептида согласно изобретению представлены ниже. Доза композиции полипептида согласно изобретению и другие условия применения композиции можно определять на основе известных в данной области способов.

Способы и применение

Настоящее изобретение относится также к способам применения полипептидов с противомикробной активностью. Противомикробные полипептиды, как правило, пригодны в любом очаге, подверженном заражению бактериями, грибами, дрожжами или водорослями. Как правило, очаги находятся в водных системах, таких как системы водяного охлаждения, вода для ополаскивания белья для стирки, масляные системы, такие как смазочно-охлаждающие масла, смазывающие вещества, нефтяная отрасль и т.п., где микроорганизмы необходимо уничтожать или где их рост необходимо контролировать. Однако также настоящее изобретение можно применять во всех способах применения, для которых пригодны известные противомикробные композиции, таких как защита дерева, латекса, адгезива, клея, бумаги, картона, текстиля, кожи, пластмасс, уплотнительного состава и корма.

Другие способы применения включают продукты питания, напитки, косметические средства, такие как лосьоны, кремы, гели, мази, мыла, шампуни, кондиционеры для волос, антиперспиранты, дезодоранты, жидкости для промывания рта, продукты для контактных линз или ингредиенты пищи.

Таким образом, противомикробные полипептиды согласно изобретению могут быть пригодными в качестве дезинфицирующих средств, например, для лечения инфекций глаза или полости рта, инфекций кожи; в антиперспирантах или дезодорантах; для чистки и дезинфекции контактных линз и зубов (ухода за полостью рта).

Как правило, предполагается, что противомикробные полипептиды согласно изобретению пригодны для очистки, дезинфекции или для ингибирования роста микробов на поверхности. Примерами поверхностей, с которыми предпочтительно можно осуществлять контактирование противомикробных полипептидов согласно изобретению, представляют собой поверхности используемого технологического оборудования, например, молочных заводов, химических или фармацевтических заводов, систем санитарной обработки воды, нефтеперерабатывающих заводов, заводов по производству бумаги, водоочистных сооружений и башенных охладителей. Противомикробные полипептиды согласно изобретению следует использовать в количестве, которое является эффективным для очистки, дезинфекции или ингибирования микробного роста на представляющей интерес поверхности.

Противомикробные полипептиды согласно изобретению, кроме того, можно использовать для очистки поверхностей и кухонных принадлежностей на заводах по производству пищевых продуктов и в любых помещениях, в которых изготавливают или подают пищу, таких как больницы, дома престарелых и рестораны.

Также их можно использовать в качестве консерванта или дезинфицирующего средства в красках на водной основе.

Это изобретение относится также к применению противомикробного полипептида или композиции согласно изобретению в качестве лекарственного средства. Кроме того, противомикробный полипептид или композицию согласно изобретению также можно использовать для изготовления лекарственного средства для контроля или борьбы с микроорганизмами, такими как относящиеся к грибам организмы или бактерии, предпочтительно грамположительные бактерии.

Композицию и противомикробный полипептид согласно изобретению можно использовать в качестве противомикробного ветеринарного средства или терапевтического или профилактического средства для человека. Таким образом, композицию и противомикробный полипептид согласно изобретению можно использовать для получения ветеринарных средств или лекарственных или профилактических средств для человека для лечения микробных инфекций, таких как бактериальные или грибковые инфекции, предпочтительно инфекции грамположительными бактериями. В частности микробные инфекции могут быть ассоциированы с заболеваниями легких, включая, но не ограничиваясь ими, туберкулез, пневмонию и кистозный фиброз; и заболеваниями, передающимися половым путем, включая, но не ограничиваясь ими, гонорею и хламидии.

Композиция согласно изобретению содержит эффективное количество противомикробного полипептида согласно изобретению.

Как используют в настоящем описании, подразумевают, что термин "эффективное количество" означает количество противомикробных полипептидов согласно изобретению, которое является достаточным для ингибирования роста представляющих интерес микроорганизмов.

Это изобретение относится также к композициям для заживления ран или продукции, такой как поддерживающие повязки, медицинские устройства, например, такие как катетеры, и, кроме того, к продуктам для волос против перхоти, таким как шампуни.

Составы противомикробных полипептидов согласно изобретению вводят в организм хозяина, страдающего от микробной инфекции или предрасположенному к ней. Введение может быть местным, локализованным или системным в зависимости от конкретного микроорганизма, предпочтительно оно является локализованным. Как правило, доза противомикробных полипептидов согласно изобретению является достаточной для снижения количества микробов с уничтожением по меньшей мере приблизительно на 50%, как правило, по меньшей мере на 1 порядок, и, возможно, на 2 или более порядков. Соединения согласно изобретению вводят в дозировке, которая снижает количество микробов при минимизации побочных эффектов. Предполагается, что для применения in vivo композицию получают и применяют под руководством терапевта. Противомикробные полипептиды согласно изобретению особенно пригодны для уничтожения грамотрицательных бактерий, включая Pseudomonas aeruginosa и Chlamydia trachomatis; и грамположительных бактерий, включая стрептококки, такие как Streptococcus pneumonia, S. uberis, S. hyointestinalis, S. pyogenes или agalactiae; и стафилококки, такие как Staphylococcus aureus, S. epidermidis, S. simulans, S. xylosus, S. carnosus.

Составы противомикробных полипептидов согласно изобретению можно вводить в организм хозяина, страдающего от микробной инфекции легких или предрасположенного к микробной инфекции легких, такой как пневмония; или микробной инфекции раны, такой как бактериальная инфекция раны.

Препараты противомикробных полипептидов согласно изобретению также можно вводить в организм хозяина, страдающего от инфекции кожи или предрасположенному к инфекции кожи, такой как угревая сыпь, атопический дерматит или себорейный дерматит; предпочтительно инфекция кожи представляет собой бактериальную инфекцию кожи, например, вызванную Staphylococcus epidermidis, Staphylococcus aureus, Propionibactehum acnes, Pityrosporum ovale или Malassezia furfur.

Противомикробные полипептиды согласно изобретению также пригодны для составов для уничтожения микробов in vitro, в частности, когда нежелательно применять множество общепринятых антибиотиков. Например, противомикробные полипептиды согласно изобретению можно добавлять в пищевые препараты для животных и/или человека; или их можно включать в качестве добавок в культуры клеток in vitro для предотвращения избыточного роста микробов в культуре ткани.

Чувствительность конкретного микроба к уничтожению посредством противомикробных полипептидов согласно изобретению можно определять посредством анализа in vitro, как подробно описано в экспериментальном разделе. Как правило, культуру микробов объединяют с противомикробным полипептидом в различных концентрациях на период времени, достаточный для обеспечения воздействия белка, как правило, приблизительно от одного часа до одних суток. Затем подсчитывают количество жизнеспособных микробов и определяют уровень гибели.

Представляющие интерес микробы включают, но не ограничиваются ими, грамотрицательные бактерии, например: Citrobacter sp.; Enterobacter sp.; Escherichia sp., например, E. coli; Klebsiella sp.; Morganella sp.; Proteus sp.; Providencia sp.; Salmonella sp., например S. typhi, S. typhimurium; Serratia sp.; Shigella sp.; Pseudomonas sp., например, P. aeruginosa; Yersinia sp., например, Y. pestis, Y. pseudotuberculosis, Y. enterocolitica; Franciscella sp.; Pasturella sp.; Vibrio sp., например, V. cholerae, V. parahemolyticus; Campylobacter sp., например, C. jejuni; Haemophilus sp., например, H. influenzae, H. ducreyi; Bordetella sp., например B. pertussis, B. bronchiseptica, B. parapertussis; Brucella sp., Neisseria sp., например, N. gonorrhoeae, N. meningitides, и т.д. Другие представляющие интерес бактерии включают Legionella sp., например, L. pneumophila; Listeria sp., например, L. monocytogenes; Mycoplasma sp., например M. hominis, M. pneumoniae; Mycobacterium sp., например M. tuberculosis, M. leprae; Treponema sp., например T. pallidum; Borrelia sp., например, B. burgdorferi; Leptospirae sp.; Rickettsia sp., например, R. rickettsii, R. typhi; Chlamydia sp., например, C. trachomatis, C. pneumoniae, C. psittaci; Helicobacter sp., например, H. pylori, и т.д.

Небактериальные представляющие интерес патогены включают патогены грибов и одноклеточных, например, Plasmodia sp., например, P. falciparum, Trypanosoma sp., например, T. brucei; shistosomes; Entaemoeba sp., Cryptococcus sp., Candida sp., например, C. albicans; и т.д.

Можно использовать различные способы введения. Состав полипептида можно вводить перорально или можно инъецировать внутривенно, подкожно, перитонеально, посредством аэрозоля, офтальмически, внутрь мочевого пузыря, местно и т.д. Например, способы введения посредством ингаляции хорошо известны в данной области. Дозировка терапевтического состава широко варьирует в зависимости от конкретного противомикробного полипептида, подлежащего введению, природы заболевания, частоты введения, способа введения, выведения средства из организма хозяина, и т.п. Изначальная доза может быть более большой с последующими меньшими поддерживающими дозами. Дозу можно вводить нечасто, раз в неделю или раз в две недели, или ее можно разделять на меньшие дозы и вводить один или несколько раз в сутки, два раза в неделю, и т.д. для поддержания эффективного уровня дозировки. Во многих случаях, для перорального введения требуется более высокая доза, чем для внутривенного введения. Амидные связи, а также С- и N-концы можно модифицировать для более высокой стабильности при пероральном введении. Например, C-конец можно подвергать амидированию.

Составы

Соединения согласно изобретению можно включать в различные составы для терапевтического введения. Более конкретно, соединения согласно изобретению можно составлять в фармацевтические композиции посредством объединения с соответствующими фармацевтически приемлемыми носителями или разбавителями, и их можно составлять в препараты в твердой, полутвердой, жидкой или газообразной формах, таких как таблетки, капсулы, порошки, гранулы, мази, кремы, пены, растворы, суппозитории, инъекции, средства для ингаляции, гели, микросферы, лосьоны и аэрозоли. По существу, введение соединений можно проводить различными способами, включая пероральное введение, введение на слизистую оболочку щеки, ректальное парентеральное, внутрибрюшинное, внутрикожное, чрескожное, интратрахеальное, и т.д., введение. Противомикробные полипептиды согласно изобретению после введения могут быть системными или могут быть локализованными посредством применения имплантата или другого состава, который действует, задерживая активную дозу в области имплантации.

В одном варианте осуществления состав для местного применения содержит хелатирующий агент, который снижает эффективную концентрацию двухвалентных катионов, в частности, кальция и магния. Например, можно включать в состав средства, такие как цитрат, ЭГТА или ЭДТА, где цитрат является предпочтительным. Концентрация цитрата, как правило, составляет приблизительно от 1 до 10 мМ.

Соединения согласно изобретению можно вводить отдельно, в сочетании друг с другом, или их можно применять в сочетании с другими известными соединениями (например, с перфорином, противовоспалительными средствами, антибиотиками и т.д.). В фармацевтических дозированных формах, соединения можно вводить в форме их фармацевтически приемлемых солей. Следующие способы и эксципиенты являются только иллюстративными и ни в коей мере не ограничивающими.

Для пероральных препаратов соединения можно использовать отдельно или в сочетании с соответствующими дополнительными веществами для изготовления таблеток, порошков, гранул или капсул, например, с общепринятыми дополнительными веществами, такими как лактоза, маннит, кукурузный крахмал или картофельный крахмал; со связующими веществами, такими как кристаллическая целлюлоза, производные целлюлозы, гуммиарабик, кукурузный крахмал или желатины; с дезинтегрирующими средствами, такими как кукурузный крахмал, картофельный крахмал или карбоксиметилцеллюлоза натрия; со смазывающими веществами, такими как тальк или стеарат магния; и если необходимо, с разбавителями, буферными средствами, смачивающими средствами, консервантами и вкусовыми добавками.

Соединения можно составлять в препараты для инъекций посредством растворения, суспендирования или эмульгирования их в водном или неводном растворителе, таком как растительное масло или другие сходные масла, синтетические глицериды алифатических кислот, сложные эфиры высших алифатических кислот или пропиленгликоля; и, если необходимо, с общепринятыми добавками, такими как солюбилизаторы, изотонические вещества, суспендирующие вещества, эмульгаторы, стабилизаторы и консерванты.

Соединения можно применять в составе, представляющем собой аэрозоль, подлежащем введению посредством ингаляции. Соединения согласно изобретению можно составлять в находящихся под давлением приемлемых веществах для распыления, таких как дихлордифторметан, пропан, азот и т.п.

Соединения можно использовать в качестве лосьонов, например, для предотвращения инфицирования ожогов, посредством составов с общепринятыми дополнительными веществами, такими как солюбилизаторы, изотонические вещества, суспендирующие вещества, эмульгаторы, стабилизаторы и консерванты.

Более того, соединения можно изготавливать в суппозиториях посредством смешивания с множеством основ, таких как эмульгирующие основы или растворимые в воде основы. Соединения согласно изобретению можно вводить ректально с помощью суппозитория. Суппозиторий может включать носитель, такой как масло какао, карбоваксы и полиэтиленгликоли, которые плавятся при температуре организма, но которые затвердевают при комнатной температуре.

Единичные дозированные формы для перорального или ректального введения, такие как сиропы, эликсиры и суспензии можно изготавливать, если каждая единица дозирования, например, чайная ложка, столовая ложка, таблетка или суппозиторий, содержит установленное количество композиции, содержащей одно или несколько соединений согласно изобретению. Аналогично единичные дозированные формы для инъекции или внутривенного введения могут содержать соединение согласно изобретению в композиции в качестве раствора в стерильной воде, нормальном физиологическом растворе или другом фармацевтически приемлемом носителе.

Имплантаты для непрерывного высвобождения хорошо известны в данной области. Имплантаты составляют в качестве микросфер, пластинок и т.д. с биологически деградируемыми полимерами. Например, полимеры молочной кислоты и/или гликолевой кислоты формируют поддающийся разрушению полимер, который хорошо переносится организмом хозяина. Имплантат, содержащий противомикробные полипептиды согласно изобретению, помещают рядом с областью инфекции, чтобы локальная концентрация активного вещества была повышенной относительно остальных частей организма.

Как используют в настоящем описании, термин "единичная дозированная форма" относится к физически разобщенным единицам, пригодным в качестве единичной дозы для субъекта-животного или субъекта-человека, где каждая единица содержит установленное количество соединений согласно изобретению, в вычисленном количестве, достаточном для получения требуемого эффекта, совместно с фармацевтически приемлемым разбавителем, носителем или веществом для доставки. Характеристики единичных дозированных форм согласно изобретению зависят от конкретного используемого соединения и предполагаемого эффекта, и фармакодинамики, ассоциированной с соединением, в организме хозяина. Фармацевтически приемлемые эксципиенты, такие как вещество для доставки, адъюванты, носители или разбавители, являются общедоступными. Более того, общедоступными являются фармацевтически приемлемые вспомогательные вещества, такие как изменяющие pH и буферные средства, изменяющие тоничность средства, стабилизаторы, увлажняющее вещества и т.п.

Типичные дозировки для системного введения находятся в диапазоне от 0,1 пг до 100 миллиграмм на кг массы субъекта на введение. Типичная дозировка может представлять собой одну таблетку, вводимую от двух до шести раз в сутки, или одну капсулу или таблетку с замедленным высвобождением, вводимую один раз в сутки, и обладающую пропорционально более высоким содержанием активного ингредиента. Эффекта замедленного высвобождения можно достигать с помощью компонентов капсулы, которые растворяются при различных значениях pH, с помощью капсул, из которых высвобождение происходит медленно при осмотическом давлении, или посредством любых других известных способов контролируемого высвобождения.

Специалисты в данной области поймут, что уровни доз могут варьировать в зависимости от конкретного соединения, тяжести симптомов и чувствительности субъекта к побочным эффектам. Некоторые из конкретных соединений являются более эффективными, чем другие. Предпочтительные дозировки данного соединения легко определят специалисты в данной области множеством способов. Предпочтительными способами является определение физиологической эффективности данного соединения.

Применение липосом в качестве носителя для доставки представляет собой один из представляющих интерес способов. Липосомы объединяются с клетками намеченной для воздействия области и доставляют содержимое их просвета внутриклеточно. Контакт липосом с клетками поддерживают в течение достаточного для слияния периода времени с использованием различных способов поддержания контакта, таких как локализация, связующие вещества и т.п. В одном аспекте этого изобретения липосомы разрабатывают, чтобы они находились в аэрозольном состоянии для легочного введения. Липосомы можно изготавливать с очищенными белками или пептидами, которые осуществляют слияние мембран, такими как вирус Сендай или вирус гриппа и т.д. Липиды могут представлять собой любое пригодное сочетание известных формирующих липосомы липидов, включая катионные или цвиттерионные липиды, такие как фосфатидилхолин. Остальные липиды обычно представляет собой нейтральные или кислые липиды, такие как холестерин, фосфатидилсерин, фосфатидилглицерин и т.п.

Для получения липосом можно использовать способы, описанные Kato et al. (1991) J. Biol. Chem. 266:3361. В кратком изложении липиды и композицию полости, содержащую пептиды, объединяют в соответствующей водной среде, удобнее, в солевой среде, где общее содержание твердых веществ находится в диапазоне приблизительно 1-10 процентов по массе. После интенсивного перемешивания в течение коротких периодов времени, приблизительно 5-60 с, пробирку помещают в теплую водяную баню при приблизительно 25-40°C, и этот цикл повторяют приблизительно 5-10 раз. Затем композицию обрабатывают ультразвуком в течение подходящего периода времени, как правило, приблизительно 1-10 с, и, кроме того, ее можно перемешать встряхиванием. Затем объем увеличивают добавлением водной среды, как правило, увеличивая объем приблизительно в 1-2 раза, а затем встряхивают и охлаждают. Этот способ обеспечивает встраивание в полость высокомолекулярных молекул.

Составы с другими активными средствами

Для применения в обсуждаемых способах, противомикробные полипептиды согласно изобретению можно составлять с другими фармацевтически активными средствами, в частности с другими противомикробными средствами. Другие представляющие интерес средства включают широкое множество антибиотиков, известных в данной области. Классы антибиотиков включают пенициллины, например, пенициллин G, пенициллин V, метициллин, оксициллин, карбенициллин, нафциллин, ампициллин и т.д.; пенициллины в сочетании с ингибиторами бета-лактамазы, цефалоспорины, например, цефаклор, цефазолин, цефуроксим, моксалактам, и т.д.; карбапенемы; монобактамы; аминогликозиды; тетрациклины; макролиды; линкомицины; полимиксины; сульфонамиды; хинолоны; хлорамфеникол; метронидазол; спектиномицин; триметоприм; ванкомицин; и т.д.

Также пригодны противомикробные средства, включая полиены, например, амфотерицин B, нистатин; 5-флукозин; и азолы, например, миконазол, кетоконазол, итраконазол и флуконазол. Противотуберкулезные лекарственные средства включают изониазид, этамбутол, стрептомицин и рифампин. Также в состав противомикробных полипептидов согласно изобретению можно включать цитокины, например, интерферон гамма, фактор некроза опухоли альфа, интерлейкин 12 и т.д.

Синтез in vitro

Противомикробные пептиды согласно изобретению можно получать посредством синтеза in vitro с использованием общепринятых способов, известных в данной области. Доступными являются различные коммерческие устройства для синтеза, например автоматизированные устройства для синтеза Applied Biosystems Inc., Beckman, и т.д. Посредством использования устройств для синтеза, природные аминокислоты можно заменять неприродными аминокислотами, в частности, D-изомерами (или D-формами) например, D-аланином и D-изолейцином, диастереоизомерами, боковыми цепями с различной длиной или функциональностью, и т.п. Конкретную последовательность и способ получения определяют исходя из удобства, экономических расчетов, требуемой чистоты и т.п.

Можно проводить химическое связывание в различных пептидах или белков, содержащих пригодные для образования связей функциональные группы, такие как аминогруппы для образования амида или замещенного амина, например, восстановительным аминированием, тиольные группы для образования тиоэфира или дисульфида, карбоксильные группы для образования амида, и т.п.

Если необходимо, в процессе синтеза или в процессе экспрессии в пептид можно вводить различные группы, которые обеспечивают связывание с другими молекулами или с поверхностью. Таким образом, цистеины можно использовать для получения тиоэфиров, гистидины для связывания с комплексом ионов металлов, карбоксильные группы для образования амидов или сложных эфиров, аминогруппы для образования амидов и т.п. Полипептиды также можно выделять и очищать в соответствии с общепринятыми способами рекомбинантного синтеза. Можно получать лизат экспрессирующего хозяина и лизат очищать с использованием ВЭЖХ, гель-фильтрации, гель-электрофореза, аффинной хроматографии, или других способов очистки. В основном, используемые композиции содержат по меньшей мере 20% по массе требуемого продукта, более часто, по меньшей мере приблизительно 75% по массе, предпочтительно по меньшей мере приблизительно 95% по массе, и для терапевтических целей, как правило, по меньшей мере приблизительно 99,5% по массе, по отношению к примесям, связанным со способом получения продукта и его очистки. Как правило, процентные содержания основаны на общем содержании белка.

Корм для животных

Настоящее изобретение относится также к способам применения полипептидов с противомикробной активностью в корме для животных, а также к композициям корма и кормовым добавкам, содержащим противомикробные полипептиды согласно изобретению.

Термин животное включает всех животных, в том числе человека. Примерами животных являются нежвачные животные и жвачные животные, такие как коровы, овцы и лошади. В конкретном варианте осуществления животное представляет собой нежвачное животное. Нежвачные животные включают животных с однокамерным желудком, например, кабанов или свиней (включая, но не ограничиваясь ими, поросят, поросят на доращивании и свиней); домашних птиц, таких как индюки и куры (включая, но не ограничиваясь ими, бройлерные куры, несушки); молодых телят; и рыб (включая, но не ограничиваясь ими, лосось).

Термин корм или композиция корма означает любое соединение, препарат, смесь, или композицию, пригодную или предназначенную для потребления животным.

Применение в соответствии с этим изобретением противомикробного полипептида может представлять собой скармливание животному до, после или одновременно с пищей. Последнее является предпочтительным.

В конкретном варианте осуществления противомикробный полипептид в форме, в которой его добавляют в корм, или при включении в кормовую добавку, является строго определенным. Строго определенный означает, что препарат противомикробного полипептида является по меньшей мере на 50% чистым, как определяют гель-фильтрацией (см. пример 12 в WO 01/58275). В другом конкретном варианте осуществления препарат противомикробного полипептида является по меньшей мере на 60, 70, 80, 85, 88, 90, 92, 94, или по меньшей мере на 95% чистым, как определяют этим способом.

Строго определенный препарат противомикробного полипептида является предпочтительным. Например, значительно проще в корме дозировать точно противомикробный полипептид, который по существу не содержит других мешающих или загрязняющих противомикробных полипептидов. Термин дозировать точно относится, в частности, к стремлению получать единообразные и постоянные результаты, и к способности оптимизировать дозировку, исходя из требуемого эффекта.

Для применения в корме для животных, однако, нет необходимости в том, чтобы противомикробный полипептид был настолько чистым; он может, например, включать другие ферменты, и в этом случае его можно называть препаратом противомикробного полипептида.

Препарат противомикробного полипептида можно (a) добавлять непосредственно в корм (или использовать непосредственно в процессе обработки растительных белков), или (b) его можно использовать при получении одной или нескольких промежуточных композиций, таких как кормовые добавки или предварительные смеси, которые затем добавляют в корм (или используют в процессе обработки). Описанная выше степень чистоты относится к чистоте исходного препарата противомикробного полипептида независимо от применения в соответствии с (a) или (b), упомянутыми выше.

Препараты противомикробных полипептидов со степенью чистоты этого порядка, в частности, можно получать с использованием рекомбинантных способов получения, в то время как их не так легко получать и они также повергаются более высоким изменениям от партии к парии при получении противомикробного полипептида традиционными способами культивирования.

Такой препарат противомикробного полипептида можно, безусловно, смешивать с другими ферментами.

Как используют в настоящем описании, термин растительные белки относится к любому соединению, композиции, препарату или смеси, которые включают по меньшей мере один белок, полученный из растения или источником которого является растение, включая модифицированные белки и производные белков. В конкретных вариантах осуществления содержание белка в растительных белках составляет по меньшей мере 10, 20, 30, 40, 50 или 60% (масс./масс.).

Растительные белки можно получать из растительных источников белка, таких как бобовые и зерновые, например, из материалов из растений семейств Fabaceae (Leguminosae), Cruciferaceae, Chenopodiaceae, и Poaceae, таких как соевая мука, мука из люпина и мука из семян рапса. В конкретном варианте осуществления источник растительного белка представляет собой вещество из одного или нескольких растений семейства Fabaceae, например сою, люпин, горох или фасоль.

В другом конкретном варианте осуществления источник растительного белка представляет собой материал из одного или нескольких растений семейства Chenopodiaceae, например, свеклу, сахарную свеклу, шпинат или квиноа.

Другими примерами источников растительного белка являются рапс и капуста.

Соя является предпочтительным источником растительного белка.

Другими примерами источников растительного белка являются зерновые, такие как ячмень, пшеница, рожь, овес, маис (кукуруза), рис и сорго.

Противомикробный полипептид можно добавлять в корм в любой форме либо в качестве относительно чистого противомикробного полипептида, либо в смеси с другими компонентами, предназначенными для добавления в корм для животных, т.е. в форме добавок в корм для животных, таких как так называемые предварительные смеси для корма для животных.

В дополнительном аспекте настоящее изобретение относится к композициям для применения в корме для животных, таком как корм для животных, и в добавках к корму для животных, например, в предварительных смесях.

Помимо противомикробного полипептида, согласно изобретению добавки к корму для животных согласно изобретению содержат по меньшей мере один жирорастворимый витамин, и/или по меньшей мере один растворимый в воде витамин, и/или по меньшей мере один микроэлемент, и/или по меньшей мере один макроэлемент.

Кроме того, необязательно, дополнительные ингредиенты корма представляют собой красители, ароматические соединения, стабилизаторы, и/или по меньшей мере один другой фермент, выбранный из фитаз EC 3.1.3.8 или 3.1.3.26; ксиланаз EC 3.2.1.8; галактаназ EC 3.2.1.89; и/или бета-глюканаз EC 3.2.1.4.

В конкретном варианте осуществления эти другие ферменты являются строго определенными (как определено выше для препаратов противомикробного полипептида).

Примерами других противомикробных пептидов (AMP) являются CAP18, лейкоцин A, тритрптицин, протегрин-1, танатин, дефензин, овиспирин, такой как новиспирин (Robert Lehrer, 2000), и их варианты или фрагменты, которые сохраняют противомикробную активность.

Примерами других противогрибковых полипептидов (AFP) являются пептиды Aspergillus giganteus и Aspergillus niger, а также их варианты и фрагменты, которые сохраняют противогрибковую активность, как описано в WO 94/01459 и WO 02/090384.

Как правило, жирорастворимые и растворимые в воде витамины, а также микроэлементы, формируют часть так называемой предварительной смеси, предназначенной для добавления в корм, в то время как макроэлементы, как правило, добавляют в корм отдельно. Любой из этих типов композиций, если она дополнена противомикробным полипептидом согласно изобретению, представляет собой добавку в корм для животных согласно изобретению.

В конкретном варианте осуществления добавка в корм для животных согласно изобретению предназначена для включения (или предусмотрено, что она должна быть включена) в рационы животных или в корм на уровне от 0,01 до 10,0%; более конкретно от 0,05 до 5,0%; или от 0,2 до 1,0% (% означает г добавки на 100 г корма). Это, в частности, соблюдается для предварительных смесей.

Следующие ниже компоненты представляют собой неисключительный перечень примеров этих компонентов:

Примерами жирорастворимых витаминов являются витамин A, витамин D3, витамин E и витамин K, например, витамин K3.

Примерами растворимых в воде витаминов являются витамин B12, биотин и холин, витамин B1, витамин B2, витамин B6, ниацин, фолиевая кислота и пантотенат, например, Ca-D-пантотенат.

Примерами микроэлементов являются магний, цинк, железо, медь, йод, селен и кобальт.

Примерами макроэлементов являются кальций, фосфор и натрий.

Пищевые потребности в этих компонентах (иллюстрируемые для домашней птицы и поросят/свиней) представлены в таблице A WO 01/58275. Под пищевыми потребностями подразумевают, что эти компоненты должны быть представлены в рационе в указанных концентрациях.

Альтернативно, добавка в корм для животных согласно изобретению содержит по меньшей мере один из отдельных компонентов, указанных в таблице WO 01/58275. По меньшей мере один означает любой из, один или несколько из, один, или два, или три, или четыре и так далее вплоть до всех тринадцати или вплоть до всех пятнадцати отдельных компонентов. Более конкретно, этот по меньшей мере один отдельный компонент включают в добавку согласно изобретению в таком количестве, чтобы получить концентрацию в корме, находящуюся в диапазоне, указанном в столбце четыре, или в столбце пять, или в столбце шесть таблицы A.

Настоящее изобретение относится также к композициям корма для животных. Композиции корма для животных или рационы обладают относительно высоким содержанием белка. Рационы домашней птицы или свиней можно характеризовать, как указано в таблице B WO 01/58275, столбцы 2-3. Рационы для рыб можно характеризовать, как указано в столбце 4 этой таблицы B. Более того, такие рационы для рыб, как правило, обладают содержанием неочищенных жиров 200-310 г/кг. Композиция корма для животных в соответствии с этим изобретением обладает содержанием неочищенного белка 50-800 г/кг, и, более того, содержит по меньшей мере один противомикробный полипептид, как заявлено в настоящей заявке.

Более того, или альтернативно (содержанию неочищенного белка, указанного выше), композиция корма для животных согласно изобретению обладает содержанием метаболической энергии 10-30 МДж/кг; и/или содержанием кальция 0,1-200 г/кг; и/или содержанием свободного фосфора 0,1-200 г/кг; и/или содержанием метионина 0,1-100 г/кг; и/или содержанием метионина плюс цистеин 0,1-150 г/кг; и/или содержанием лизина 0,5-50 г/кг.

В конкретных вариантах осуществления содержание метаболической энергии, неочищенного белка, кальция, фосфора, метионина, метионина плюс цистеин, и/или лизина находится в любом из диапазонов 2, 3, 4 или 5 в таблице B WO 01/58275 (R. 2-5).

Неочищенный белок вычисляют как азот (N), умноженный на коэффициент 6,25, т.е. Неочищенный белок (г/кг)=N (г/кг)×6,25. Содержание азота определяют способом Kjeldahl (A.O.A.C, 1984, Official Methods of Analysis 14th ed., Association of Official Analytical Chemists, Washington DC).

Метаболическую энергию можно вычислять, исходя из публикации NRC Nutrient requirements in swine, ninth revised edition 1988, subcommittee on swine nutrition, committee on animal nutrition, board of agriculture, national research council. National Academy Press, Washington, D. C., pp. 2-6, и the European Table of Energy Values for Poultry Feed-stuffs, Spelderholt centre for poultry research and extension, 7361 DA Beekbergen, The Netherlands. Grafisch bedrijf Ponsen & looijen bv, Wageningen. ISBN 90-71463-12-5.

Содержание в рационе кальция, свободного фосфора и аминокислот в полных рационах животных вычисляют на основе кормовых таблиц, таких как Veevoedertabel 1997, gegevens over chemische samenstelling, verteerbaarheid en voederwaarde van voedermiddelen, Central Veevoederbureau, Runderweg 6, 8219 pk Lelystad. ISBN 90-72839-13-7.

В конкретном варианте осуществления композиция корма для животного согласно изобретению содержит по меньшей мере один растительный белок или источник белка, как определено выше.

В дополнительных конкретных вариантах осуществления, композиция корма для животного согласно изобретению содержит 0-80% маиса; и/или 0-80% сорго; и/или 0-70% пшеницы; и/или 0-70% ячменя; и/или 0-30% овса; и/или 0-40% соевой муки; и/или 0-10% рыбной муки; и/или 0-20% сыворотки. Рационы для животных могут быть изготовлены в качестве мешанки (не гранулированной) или гранулированного корма. Как правило, измельченный материал корма смешивают и к нему добавляют достаточные количества необходимых витаминов и минералов в соответствии с потребностями для представляющего интерес вида. Ферменты можно добавлять в качестве твердых или жидких составов ферментов. Например, твердый состав фермента, как правило, добавляют до или в процессе стадии смешивания; и жидкий препарат фермента, как правило, добавляют после стадии гранулирования. Фермент также можно добавлять в кормовую добавку или предварительную смесь.

Конечная концентрация фермента в рационе находится в диапазоне 0,01-200 мг ферментного белка на кг рациона, например, в диапазоне 5-30 мг ферментного белка на кг рациона животного. Противомикробный полипептид можно вводить в одном или нескольких из следующих количеств (диапазонов доз): 0,01-200; или 0,01-100; или 0,05-100; или 0,05-50; или 0,10-10 - все эти диапазоны представлены в мг белка противомикробного полипептида на кг корма (в миллионных долях).

Для определения мг белка противомикробного полипептида на кг корма, противомикробный полипептид очищают из композиции корма, и специфичную активность очищенного противомикробного полипептида определяют с использованием пригодного анализа (см. в противомикробной активности, субстратах и анализах). Противомикробную активность композиции корма по существу также определяют с использованием того же анализа, и на основе этих двух определений, вычисляют дозировку в мг белка противомикробного полипептида.

Указанные принципы применяют для определения мг белка противомикробного полипептида в кормовых добавках. Безусловно, если является доступным образец противомикробного полипептида, используемого для получения кормовой добавки или корма, специфичную активность определяют в этом образце (нет необходимости очищать противомикробный полипептид из композиции корма или добавки).

Сигнальный пептид и пропептид

Настоящее изобретение относится также к конструкциям нуклеиновых кислот, содержащим ген, кодирующий белок, функционально связанный с одной или обеими из первой нуклеотидной последовательности, состоящий из нуклеотидов 1-60 последовательности SEQ ID NO:1, кодирующей сигнальный пептид, состоящий из аминокислот с -48 по -29 SEQ ID NO:2, и второй нуклеотидной последовательности, состоящей из нуклеотидов 61-144 последовательности SEQ ID NO:1, кодирующей пропептид, состоящий из аминокислот с -28 по -1 SEQ ID NO:2, где ген является чужеродным для первой и второй нуклеотидных последовательностей.

Настоящее изобретение относится также к рекомбинантным экспрессирующим векторам и рекомбинантным клеткам-хозяевам, содержащим такие конструкции нуклеиновых кислот.

Настоящее изобретение относится также к способам получения белка, включающим (a) культивирование такой рекомбинантной клетки-хозяина в условиях, пригодных для продукции белка; и (b) выделение белка.

Первая и вторая нуклеотидные последовательности могут быть функционально связанными с чужеродными генами отдельно от других контролирущих последовательностей или в сочетании с другими контролирующими последовательностями. Такие другие контролирующие последовательности описаны выше. Как описано ранее, в случае, когда участки как сигнального пептида, так и пропептида, находятся на N-конце белка, участок пропептида располагается рядом с N-концом белка, и участок сигнального пептида расположен рядом с N-концом участка пропептида.

Белок может быть собственным белком клетки-хозяина или гетерологичным ей. Термин "белок" не предназначен в настоящем описании для отнесения к конкретной длине кодируемого продукта и, таким образом, включает пептиды, олигопептиды и белки. Термин "белок" также включает два или более полипептидов, объединенных с образованием кодируемого продукта. Белки также включают гибридные полипептиды, которые содержат сочетание частей или полных полипептидных последовательностей, полученных из по меньшей мере двух различных белков, где один или несколько из них могут быть гетерологичными клетке-хозяину или ее собственными. Кроме того, белки включают природные аллельные и полученные способами инженерии варианты упомянутых выше белков и гибридных белков.

Предпочтительно, белок представляет собой гормон или его вариант, фермент, рецептор или его фрагмент, антитело или его фрагмент, или репортер. В более предпочтительном аспекте белок представляет собой оксидоредуктазу, трансферазу, гидролазу, лиазу, изомеразу или лигазу. В более предпочтительном аспекте белок представляет собой аминопептидазу, амилазу, карбогидразу, карбоксипептидазу, каталазу, целлюлазу, хитиназу, кутиназу, циклодекстрингликозилтрансферазу, дезоксирибонуклеазу, эстеразу, альфа-галактозидазу, бета-галактозидазу, глюкоамилазу, альфа-глюкозидазу, бета-глюкозидазу, инвертазу, лакказу, липазу, манноидазу, мутаназу, оксидазу, пектинолитический фермент, пероксидазу, фитазу, полифенолоксидазу, протеолитический фермент, рибонуклеазу, трансглутаминазу или ксиланазу.

Ген можно получать из любого прокариотического, эукариотического или другого источника.

Настоящее изобретение дополнительно описано посредством следующих примеров, которые не следует толковать, как ограничивающие объем этого изобретения.

ПРИМЕРЫ

Химические реактивы, используемые в качестве буферов и субстратов, представляли собой по меньшей мере химически чистые коммерческие продукты. В следующих примерах противомикробный полипептид, представленный в качестве аминокислот 1-42 последовательности SEQ ID NO:2 обозначается как "евроцин".

ПРИМЕР 1

Библиотека кДНК Eurotium amstelodami

Библиотеку кДНК получали из E. amstelodami, выращиваемых в течение 5 суток на картофельном агаре с декстрозой (PDA). РНК, содержащую поли-A, очищали, синтезировали кДНК и получали библиотеку в соответствии со стандартными способами молекулярной биологии. Подробный протокол для общего процесса можно найти в примерах международной патентной заявки WO 01/12794. Вектор, используемый для клонирования, представлял собой pMhas5, который представлен в последовательности SEQ ID NO:8 и который обладает следующими элементами:

Таблица 1
Элементы вектора pMhas5
Элемент Локализация Описание
CDS 365-1156 Устойчивость к канамицину
CDS 2232-2387 Альфа-пептид бета-галактозидазы
-10 сигнальная последовательность 2189-2192 Последовательность Шайна-Дальгарно
Промотор 2101-2189 Промотор Lac
Отличающийся элемент 626-650 Праймер KanP1 для системы BACE

ПРИМЕР 2

Конструкция экспрессирующего вектора Aspergillus для евроцина

Кодирующую евроцин нуклеотидную последовательность амплифицировали из библиотеки кДНК (см. пример 1) следующим образом: 1 микролитр кДНК (приблизительно 10 нанограмм ДНК) использовали в качестве матрицы в реакционной смеси для ПЦР с праймером A и праймером B.

Праймер A: TCTTGGATCCACCATGCACTTCACCAAGGTCTCC (SEQ ID NO:4)

Праймер B: TCTTCTCGAGTTAGAAAGAACAGGTGCAGGTAGG (SEQ ID NO:5)

10 пмоль каждого праймера использовали в объеме реакции 50 микролитров. Температура отжига составляла 55 градусов Цельсия, и удлинение происходило при 72 градусах Цельсия в течение 1 минуты. Всего проводили 35 циклов. Использовали Expand High Fidelity PCR System (Roche).

Аликвоты реакционной смеси для ПЦР разделяли в 4% агарозном геле. Отчетливая полоса была видна в области, соответствующей размеру приблизительно 300 п.о. Фрагмент ПЦР расщепляли посредством BamH1 и Xho1, которые расщепляли в выступах, внесенных посредством праймеров ПЦР. Расщепленные фрагменты выделяли и клонировали в расщепленную посредством BamH1-Xho1 pMT2786 экспрессирующую плазмиду Aspergillus на основе плазмиды pMT2188, которая основана на pCaHj527 (см. пример 7 международной патентной заявки WO 02/12472; и WO 00/70064). Подтверждали, что представляющая интерес последовательность кодирует последовательность евроцина, как определено выше. Последовательность фрагмента POR представлена в качестве SEQ ID NO:6.

Экспрессирующая плазмида Aspergillus со вставкой продукта ПЦР обозначили pMT2935 и она представлена в качестве SEQ ID NO:7.

ПРИМЕР 3

Экспрессия евроцина в Aspergillus

pMT2935 (см. SEQ ID NO:7) трансформировали в штамм BECXh2 Aspergillus oryzae (см. международную патентную заявку WO 00/39322). 30 трансформантов повторно выделяли дважды в селективных и не индуцирующих условиях на планшетах с минимальной средой Cove с сахарозой и ацетамидом. Для анализа экспрессии евроцина, трансформанты выращивали в течение 6 суток при 30 градусах Цельсия в пробирках с 10 мл YPM (2% пептон, 1% дрожжевой экстракт, 2% мальтоза). Супернатанты разделяли в 10% гелях Бис-Трис SDS NuPage (Invitrogen) по рекомендациям изготовителя с буфером для разделения MES для обеспечения разделения в низком диапазоне Mw. Трансформанты Aspergillus oryzae росли хорошо, даже после индукции экспрессии евроцина.

Отчетливая полоса с размером, ожидаемым для евроцина, была видна в большинстве трансформантов, в то время как эта полоса не была видна в нетрансформированных штаммах-хозяевах BECh2 A. oryzae.

ПРИМЕР 4

Очистка евроцина

Бульон для культивирования фильтровали через 0,22 мкм фильтр Corning 431118 и с использованием муравьиной кислоты pH доводили до 4,0. Фильтрование через 0,22 мкм фильтр повторяли для удаления дополнительного осадка после доведения pH. Измеряли проводимость и доводили до приблизительно 10 мСм см-1 добавлением воды MQ (Millipore). Затем фильтрат помещали в 12 мл колонку Source 30S (Amersham Biosciences 17-1273-01) с использованием устройства для анализа ВЭЖХ AKTA. Буфер для загрузки представлял собой 50 мМ муравьиную кислоту, pH 4 (буфер A).

Евроцин элюировали с использованием градиента буфера B 0-100% в 20 объемах колонки. Буфер B представлял собой 50 мМ муравьиную кислоту, 2 M натрий хлорид, pH 4,0. Принадлежность очищенных фракций проверяли посредством MALDI-TOF MS (Voyager DE Pro instrument, Applied Biosystems) и чистоту приближенно проверяли посредством SDS-PAGE (Invitrogen, NuPage 12% Бис-Трис/MES, окрашенный посредством Gel code Blue Stain Reagent, Pierce 24592)

Фракции, содержащие рассматриваемое соединение (исходя из MALDI-TOF MS), объединяли и концентрировали на фильтре Amicon Ultra 5000 Da MWCO (Millipore UFC900524). Центрифугирование проводили при 4000 g в течение приблизительно 30 минут. Затем раствор обессоливали посредством трехкратного промывания 0,01% кислоты с использованием того же фильтра и условий центрифугирования.

Продукт анализировали на точную последовательность и чистоту посредством анализа аминокислот и MALDI-TOF MS. Измеренная масса евроцина составляла 4339 Да. Расчетная молекулярная масса составляла 4338,8 Да, среднее значение, исходя из аминокислот 1-42 последовательности SEQ ID NO:2.

Исходный раствор хранили при -20°C.

ПРИМЕР 5

Оценка противомикробной активности

Очищенный евроцин оценивали на противомикробную активность в анализе микроразведений. Минимальные ингибирующие концентрации определяли в соответствии с руководствами NCCLS/CLSI из CLSI (Институт клинических и лабораторных стандартов).

Евроцин анализировали в следующих концентрациях: 32; 16; 8; 4; 2; 1; 0,50; 0,25; 0,13; и 0,06 мкг/мл.

Как представлено в таблице 2, евроцин проявляет строгую противомикробную активность против множества штаммов ATCC.

Таблица 2

Противомикробная активность евроцина

ПРИМЕР 6

Применение файлов HMM из базы данных PFAM для выявления дефензина

Анализ последовательности с использованием профилей скрытой марковской модели (профилей HMM) можно проводить либо интерактивно через Интернет или локально на компьютере с использованием хорошо известного находящегося в свободном доступе пакета программного обеспечения HMMER. Последняя версия представляет собой HMMER 2.3.2, октябрь 2003 года.

Профили HMM можно получать из хорошо известной базы данных PFAM. Последней версией является PFAM 16.0, ноябрь 2004. Как HMMER, так и PFAM доступны для любого стандартизованного компьютерного оборудования, например, из Washington University in St. Louis (USA), School of Medicine (http://pfam.wustl.edu и http://hmmer.wustl.edu).

Если представляющая интерес аминокислотная последовательность, или ее фрагмент, относится к следующим пяти семействам PFAM, аминокислотная последовательность представляет собой дефензин в соответствии с настоящим изобретением:

- Дефензин_бета или "Бета дефензин", регистрационный номер: PF00711;

- Дефензин_propep или "пропептид дефензина", регистрационный номер: PF00879;

- Дефензин_1 или "дефензин млекопитающих", регистрационный номер: PF00323;

- Дефензин_2 или "дефензин членистоногих", регистрационный номер: PF01097;

- Гамма-тионин или "семейство гамма-тионинов", регистрационный номер: PF00304.

Аминокислотная последовательность относится к семейству PFAM, в соответствии с настоящим изобретением, если для нее значение E составляет больше 0,1, и оценка составляет больше или равно нулю, при использовании базы данных PFAM в интерактивном режиме или при локальном использовании программы hmmpfam (из пакета программного обеспечения HMMER).

Если анализ последовательности проводят локально с использованием программы hmmpfam, необходимо получить (загрузить) профили HMM из базы данных PFAM. Для каждого семейства существует два профиля; xxxjs.hmm для общего поиска и xxx_fs.hmm для локального поиска ("xxx" представляет собой название семейства). Это приводит всего к десяти профилям для пяти упомянутых выше семейств.

Эти десять профилей можно использовать отдельно или объединять (добавлять) в единый профиль (с использованием текстового редактора - профили представляют собой файлы ASCII), который можно назвать, например, defensin.hmm. Представляющую интерес аминокислотную последовательность затем можно оценивать с использованием следующей командной строки:

hmmpfam -E 0,1 defensin.hmm sequence_file

- где "sequence_file" представляет собой файл с представляющей интерес аминокислотной последовательностью в любом формате, распознаваемом пакетом программного обеспечения HMMER.

Если оценка больше или равна нулю (0,0), и значение E больше 0,1, то представляющая интерес аминокислотная последовательность является дефензином в соответствии с настоящим изобретением.

База данных PFAM дополнительно описана в Bateman et al. (2004) "The Pfam Protein Families Database", Nucleic acids Research, Vol. 32 (Database Issue) pp. D138-D141.

1. Полипептид с противомикробной активностью, выбранный из группы, состоящей из
(a) полипептида, содержащего аминокислотную последовательность, которая имеет по меньшей мере 70%-ную идентичность аминокислотам 1-42 последовательности SEQ ID NO:2;
(b) полипептида, который кодируется полинуклеотидом, который гибридизуется в условиях высокой жесткости с нуклеотидами 145-270 последовательности SEQ ID NO:1 или с комплементарной им цепью.

2. Полипептид по п.1, содержащий аминокислотную последовательность, которая имеет по меньшей мере 80%-ную идентичность аминокислотам 1-42 последовательности SEQ ID NO:2.

3. Полипептид по п.2, содержащий аминокислотную последовательность, которая имеет по меньшей мере 90%-ную идентичность аминокислотам 1-42 последовательности SEQ ID NO:2.

4. Полипептид по п.3, содержащий аминокислотную последовательность, которая имеет по меньшей мере 95%-ную идентичность аминокислотам 1-42 последовательности SEQ ID NO:2.

5. Полипептид по п.4, содержащий аминокислотную последовательность из аминокислот 1-42 последовательности SEQ ID NO:2.

6. Полипептид по п.5, который состоит из аминокислот 1-42 последовательности SEQ ID NO:2.

7. Выделенный полинуклеотид, содержащий нуклеотидную последовательность, которая кодирует полипептид по любому из пп.1-6.

8. Выделенный полинуклеотид по п.7, имеющий по меньшей мере одну мутацию в последовательности SEQ ID NO:1, кодирующей зрелый полипептид, где мутантная нуклеотидная последовательность кодирует полипептид, состоящий из аминокислот 1-42 последовательности SEQ ID NO:2.

9. Конструкция нуклеиновой кислоты, содержащая полинуклеотид по п.7, функционально связанный с одной или несколькими контролирующими последовательностями, которые регулируют продукцию полипептида в экспрессирующей системе хозяина.

10. Рекомбинантный экспрессирующий вектор, содержащий конструкцию нуклеиновой кислоты по п.9.

11. Рекомбинантная клетка-хозяин, содержащая конструкцию нуклеиновой кислоты по п.9.

12. Способ получения полипептида по любому из пп.1-6, предусматривающий (а) культивирование клетки, которая в форме ее дикого типа способна продуцировать полипептид, в условиях, способствующих продуцированию полипептида; и (b) выделение полипептида.

13. Способ получения полипептида по любому из пп.1-6, предусматривающий (а) культивирование клетки-хозяина, содержащей конструкцию нуклеиновой кислоты, содержащей нуклеотидную последовательность, кодирующую полипептид, в условиях, способствующих продуцированию полипептида; и (b) выделение полипептида.

14. Способ получения полипептида по любому из пп.1-6, предусматривающий (а) культивирование клетки трансгенного растения или трансгенного растения, содержащей полинуклеотид, кодирующий полипептид, обладающий противомикробной активностью согласно изобретению в условиях, способствующих продупированию полипептида; и (b) выделение полипептида.

15. Трансгенное растение, часть растения или клетка растения, экспрессирующая полипептид по любому из пп.1-6, которая трансформирована полинуклеотидом, кодирующим полипептид по любому из пп.1-6.

16. Способ уничтожения или ингибирования роста микробных клеток, предусматривающий контактирование микробных клеток с противомикробным полипептидом, как он определен в любом из пп.1-6.

17. Противомикробный полипептид по любому из пп.1-6 для применения в качестве лекарственного средства, или противомикробного ветеринарного средства, или терапевтического или профилактического средства для человека.

18. Противомикробный полипептид, как он определен в любом из пп.1-6, для применения в изготовлении ветеринарного лекарственного средства или лекарственного средства для человека для лечения микробной инфекции или для профилактического применения.

19. Противомикробный полипептид, как он определен в любом из пп.1-6, для применения в корме для животных.



 

Похожие патенты:

Изобретение относится к биотехнологии. .

Изобретение относится к области фитопатологии, более конкретно к повышению устойчивости растений к патогенным микроорганизмам, более конкретно к усилению механизма индуцированной устойчивости.

Изобретение относится к области микробиологии и молекулярной генетики и может быть использовано в медицинской промышленности при производстве вакцин против Streptococcus agalactiae.

Изобретение относится к биотехнологии, в частности к генетической инженерии, и позволяет получать микробиологическим синтезом по упрощенной технологии новый гибридный полипептид GST-CFP10 со свойствами видоспецифичного белка-антигена Mycobacterium tuberculosis CFP10, который может быть использован для ранней видоспецифичной диагностики туберкулезной инфекции.

Изобретение относится к области микробиологии и молекулярной генетики и может быть использовано при производстве вакцин против Streptococcus pyogenes - стрептококков группы А (СГА) и Streptococcus agalactiae - стрептококков группы В (СГВ).

Изобретение относится к биотехнологии, конкретно к области генной инженерии, касается способа получения активного рекомбинантного белка летального фактора сибирской язвы LF, рекомбинантной плазмидной ДНК рЕТНIS-LF, кодирующей активный белок летального фактора сибирской язвы LF, и штамма бактерий Escherichia coli, продуцирующего активный белок летального фактора сибирской язвы.

Изобретение относится к белкам с установленными аминокислотными последовательностями, представленными в перечне последовательностей, полученным из бактерии, преимущественно штаммов А и В, которые проявляют свойства антигена.

Изобретение относится к биотехнологии и представляет собой полинуклеотиды, обладающие способностью ускорять биоситнез предшественника правастатина ML-236В в микроорганизмах, вырабатывающих ML-236В, при введении в эти микроорганизмы.
Наверх