Полипептиды с направленным действием

Настоящее изобретение относится к области клеточной биологии, молекулярной биологии, биологии рака и к медицине и представляет собой фармацевтическую композицию для нацеливания на клетки, несущие рецептор BLyS, содержащую эффективное количество слитого белка, состоящего из полипептида BLyS, слитого с цитотоксическим полипептидом, где цитотоксический полипептид расположен на N-конце слитого белка, а полипептид BLyS расположен на С-конце слитого белка, и фармацевтически приемлемый носитель. Изобретение обеспечивает лечение и профилактику B-клеточного пролиферативного расстройства. 4 н. и 7 з.п. ф-лы, 4 табл., 14 ил.

 

ОПИСАНИЕ

По настоящему изобретению испрашивается приоритет предварительной заявки на патент США, серийный номер 60/649478, поданной 1 февраля 2005 года, которая приведена в настоящем описании в качестве ссылки в полном объеме.

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

Настоящее изобретение относится, по меньшей мере, к области клеточной биологии, молекулярной биологии, биологии рака и к медицине. Более конкретно настоящее изобретение относится к композициям, содержащим полипептид BLyS, конъюгированный с цитотоксическим агентом, и к применению таких композиций в терапии.

ПРЕДПОСЫЛКИ СОЗДАНИЯ ИЗОБРЕТЕНИЯ

В-лимфоцитарный стимулятор является представителем суперсемейства фактора некроза опухоли (TNF), который индуцирует пролиферацию и дифференциацию В-клеток in vivo и in vitro (Moore et al., Science 285: 260-263 (1999)). BLyS отличается от других В-клеточных факторов пролиферации и дифференциации, таких как IL-2, IL-4, IL-5, IL-6, IL-7, IL-13, IL-15, CD40L или CD27L (CD70), своим геном, специфичным для моноцитов, и по характеру экспрессии белка, а также по специфическому распределению рецептора и по биологической активности в отношении В-лимфоцитов. Экспрессия BLyS не обнаружена в естественных клетках-киллерах (NK), Т-клетках или B-клетках, а ограничена клетками миеломного происхождения. Экспрессия BLyS на покоящихся моноцитах подвергается положительной регуляции интерфероном-гамма (IFN-гамма). Ген, кодирующий BLyS, был картирован на хромосоме 13q34.

BLyS человека экспрессируется в виде связанного с мембраной полипептида типа II, состоящего из 285 аминокислот, и растворимого полипептида, состоящего из 152 аминокислот (Moore et al., 1999, supra). Связанная с мембраной форма BLyS имеет трансмембранный домен между аминокислотными остатками 47 и 73. NH2-конец растворимой формы BLyS начинается от Ala134, связанной с мембраной формы BLyS. Было показано, что растворимый рекомбинантный BLyS индуцирует пролиферацию В-клеток селезенки мыши in vitro и связывается с рецептором клеточной поверхности на указанных клетках (Moore et al., 1999, supra). Было также показано, что введение растворимого BLyS мышам приводит к повышению доли CD45Rdull, Ly6Dbright (так же известного, как ThB) B-клеток и к повышению сывороточных уровней IgM и IgA (Moore et al., 1999 supra). Таким образом, BLyS демонстрирует В-клеточный тропизм как по распределению его рецептора, так и по биологической активности.

Успешная разработка терапевтических средств, направленных на опухоль, зависит частично от возможностей сайт-специфичной доставки терапевтических средств, а также от биологической активности доставляемого агента. Моноклональные антитела используют для придания селективности цитотоксическим агентам, которые в противном случае не отличаются избирательностью, таким как токсины, радионуклиды и факторы роста (Williams et al., 1990; Rowlinson-Busza et al., 1992; Wahl, 1994). Одна такая молекула представляет собой гелонин, инактивирующий рибосому растительный токсин размером 29 кДа, обладающий эффективностью и механизмом действия, аналогичными А-цепи рицина (RTA), но имеет повышенную стабильность и сниженную токсичность (Stirpe et al., 1992; Rosenblum et al., 1995). В предшествующих работах удалось идентифицировать и исследовать биологические свойства различных химических конъюгатов растительного токсина гелонина и различных антител (Boyle et al., 1995; Xu et al., 1996; Rosenblum et al., 1999). В предшествующих исследованиях антитело ZME-018 подвергали химическому связыванию с очищенным гелонином, и указанный иммуноконъюгат демонстрировал специфическую цитотоксичность в отношении антиген-позитивных клеток меланомы в культуре ткани на моделях с ксенотрансплантатом опухоли человека (Rosenblum et al., 1991; Mujoo et al., 1995).

Таким образом, существует потребность в разработке усовершенствованных терапевтических средств, обладающих специфичностью для аномально пролиферирующих В-клеток.

КРАТКОЕ ОПИСАНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к способам получения и применения молекул, которые обладают мишеневой активностью в отношении, например, раковых клеток, входящих в состав опухоли, и цитотоксической активностью. Указанная молекула может включать, например, конъюгированный полипептид. Настоящее изобретение также относится к композициям, которые получают на основе указанных конгъюгированных полипептидов. Так, например, белоксодержащиее конъюгаты по настоящему изобретению относятся к соединению, которое включает как токсин, так и полипептид BLyS. В некоторых вариантах осуществления настоящего изобретения конъюгированные полипептиды конструируют с помощью рекомбинантных методик с получением слитого белка. Конъюгированные соединения могут быть также присоединены друг к другу, например, через линкер.

В конкретных вариантах осуществления настоящего изобретения мишенивая и цитотоксическая активности придаются молекуле за счет отдельного фрагмента молекулы, хотя альтернативно один фрагмент может обладать частично или полностью как мишеневой, так и цитотоксической активностью.

Для специалистов в настоящей области понятно, что термин BlyS может использоваться взаимозаменяемо с терминами полинуклеотиды или полипептиды BAFF, BLYS, TALL1, THANK, ZTNF4, TALL-1, TNFSF20 и дельта BAFF, хотя в альтернативных вариантах они могут не быть взаимозаменяемыми. Кроме того, специалисту в настоящей области известно, как определить являются ли конкретные молекулы, которые потенциально могут быть взаимозаменяемы с BLyS, настолько подходящими, чтобы использовать их в соответствии с настоящим изобретением и/или в соответствии с доступными в настоящее время способами. Как было показано в настоящем изобретении, SEQ ID NO: 1 относится к полипептиду BlyS человека полной длины из 285 аминокислот. SEQ ID NO: 20 относится к полинуклеотидной последовательности BlyS человека. Аминокислотные остатки 134-285 в SEQ ID NO: 1 включают растворимую изоформу полипептида BLyS, который в некоторых вариантах осуществления настоящего изобретения представляет собой изоформу, используемую в конъюгированных полипептидах по настоящему изобретению. BLyS мыши (полипептид SEQ ID NO: 2; нуклеотид SEQ ID NO: 3) или другие ортологи BLyS также входят в область настоящего изобретения. Функциональные эквиваленты BLyS также могут использоваться в сочетании конъюгированными полипептидами с направленным действием по настоящему изобретению. Например, в настоящем изобретении рассматриваются полипептиды, сохраняющие BLyS активность, которые характеризуются по меньшей мере 80%-ной гомологией последовательности, по меньшей мере 85%-ной гомологией последовательности, по меньшей мере 90%-ной гомологией последовательности с любой из SEQ ID NO: 1 или SEQ ID NO: 2. В другом конкретном варианте осуществления настоящего изобретения аминокислотная последовательность BLyS включает по меньшей мере примерно 40, по меньшей мере примерно 50, по меньшей мере примерно 75, по меньшей мере примерно 100, по меньшей мере примерно 125, по меньшей мере примерно 150, по меньшей мере примерно 175, по меньшей мере примерно 200, по меньшей мере примерно 225, по меньшей мере примерно 250 или по меньшей мере примерно 275 последовательных аминокислот из SEQ ID NO: 1 или SEQ ID NO: 2. В других вариантах функциональные эквиваленты включают по меньшей мере D-Е петлю, вовлекаемую в распознавание рецептора (см. Oren et al., Nat Struct Biol. 2002 Apr; 9(4): 288-92).

В некоторых вариантах может использоваться BLyS дикого типа, а в других вариантах может использоваться мутантный BLyS. Примеры мутантов BLyS включают мутант с мутацией по Cys146 (Chen et al., 2002; 2004; 2005) и в конкретных вариантах мутация может иметь место в аланине или в валине. Мутанты BLyS, используемые в настоящем изобретении, также сохраняют способность достигать В-клетки, в частности сохраняют способность связываться по меньшей мере с одним рецептором BLyS. Мутантный BLyS может обладать повышенной любой активностью в сравнении с BLyS дикого типа, включая способность связываться с В-клеткой, такой как способность связываться с рецептором BLyS.

Полипептиды BLyS с направленным действием по настоящему изобретению направлены на клетки, которые экспрессируют рецептор BLyS, такой как TNFRSF13B/TACI (SEQ ID NO: 4), TNFRSF17/BCMA (SEQ ID NO: 5) и TNFRSF13C/BAFFR (SEQ ID NO: 6). В некоторых вариантах осуществления настоящего изобретения конъюгированные полипептиды по настоящему изобретению могут специфически связываться с клеткой, экспрессирующей функциональный эквивалент SEQ ID NO: 4, SEQ ID NO: 5 или SEQ ID NO: 6. В некоторых вариантах осуществления настоящего изобретения полагают, что клетки, экспрессирующие рецептор BLyS, могут быть связаны с аномальной пролиферацией В-клеток. Для любого специалиста в настоящей области со средним уровнем знаний понятно, что BLyS может формировать димеры или тримеры, с тем чтобы участвовать в распознавании рецептора. Также следует понимать, что белоксодержащие композиции конъюгированных полипептидов, рассматриваемые в настоящем описании, также будут способствовать образованию димеров BLyS, тримеров или любых других мультимерных белковых комплексов.

В некоторых вариантах осуществления настоящего изобретения полипептид BLyS присоединяется к молекуле. В предпочтительных вариантах присоединение является ковалентным. В дополнительных вариантах осуществления настоящего изобретения указанная молекула представляет собой, например, цитотоксический агент, лекарственное средство, химиотерапевтический агент, радиоактивный изотоп, про-апоптозный агент, антиангиогенный агент, гормон, цитокин, фактор роста, пептид, белок, антибиотик, фермент (такой, например, как Granzyme B или Granzyme A), антитело, Fab-фрагмент антитела, визуализующий агент, нуклеиновую кислоту или антиген. Указанные молекулы приведены лишь в качестве примеров. Молекулы, входящие в область настоящего изобретения, включают фактически любую молекулу, которая может быть присоединена к полипептиду BLyS и затем может быть введена в организм человека. В предпочтительных вариантах осуществления настоящего изобретения про-апоптозный агент представляет собой, например, грамицидин, магаинин, меллитин, дефензин или цекропин. В других предпочтительных вариантах осуществления настоящего изобретения антиангиогенный агент представляет собой тромбоспондин, ангиостатин, эндостатин или фактор, полученный из пигментного эпителия. В других предпочтительных вариантах осуществления настоящего изобретения указанный цитокин представляет собой, например, интерлейкин-1 (IL-1), IL-2, IL-5, IL-10, IL-11, IL-12, IL-18, интерферон-γ (IF-γ), IF-α, IF-β, фактор некроза опухоли-α (TNF-α) или ГМ-КСФ (гранулоцитарно-макрофагальный колониестимулирующий фактор). Указанные примеры приведены только для иллюстрации и никоим образом не исключают другие про-апоптозные агенты, антиангиогенный агенты или цитокины, известные в данной области.

Некоторые варианты осуществления настоящего изобретения относятся к рекомбинантному пептидному токсину гелонина (показан как SEQ ID NO: 7), который описан в патенте США No.5631348 и который включен в настоящее описание в качестве ссылки. Рекомбинантный токсин гелонин по настоящему изобретению может представлять любую часть или фрагмент SEQ ID NO: 7, который сохраняет токсиновую активность. В некоторых вариантах осуществления настоящего изобретения гелонин включает остатки 110-210 из SEQ ID NO: 7. В других конкретных вариантах аминокислотная последовательность r-гелонина включает по меньшей мере 30, по меньшей мере 40, по меньшей мере 50, по меньшей мере 75, по меньшей мере 100, по меньшей мере 125, по меньшей мере 150, по меньшей мере 175, по меньшей мере 200, по меньшей мере 225 или по меньшей мере 250 последовательных аминокислот из SEQ ID NO: 7. Другие соединения по настоящему изобретению включают рекомбинантный токсин гелонин, который сохраняет ядерный участок токсина, кроме того, что он содержит по меньшей мере 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 или более последовательных аминокислотных остатков SEQ ID NO: 7 в дополнение к указанному ядерному участку токсина. В других вариантах осуществления настоящего изобретения гелонин включает SEQ ID NO: 21 (номер доступа в GenBank No.P33186). В некоторых вариантах осуществления настоящего изобретения может использоваться rGel дикого типа, а в других вариантах может использоваться мутантный rGel. В конкретных вариантах осуществления настоящего изобретения молекулу rGel получают в соответствии с заявкой на патент США No: 10/074 596, поданной 12 февраля 2002 года, которая приведена в настоящем описании в качестве ссылки в полном объеме.

В одном из вариантов осуществления настоящего изобретения репрезентативный конъюгированный полипептид имеет последовательность SEQ ID NO: 8. Приведенный в качестве примера полинуклеотид, кодирующий указанный конъюгированный полипептид, показан как SEQ ID NO: 9. Другой вариант осуществления настоящего изобретения относится к репрезентативному конъюгированному полипептиду с последовательностью SEQ ID NO: 10. Полинуклеотид, кодирующий указанный конъюгированный полипептид, показан как SEQ ID NO: 11.

Другие варианты осуществления настоящего изобретения относится к цитотоксическому агенту, который может представлять собой, например, абрин, додекандрин, трикозантин, трикокирин, бриодин, антивирусный белок из Mirabilis, белок, инактивирующий рибосомы ячменя (BRIP), антивирусные белки из лаконоса (PAP), сапорины, люффины и/или момордины.

В некоторых аспектах настоящего изобретения полипептиды по настоящему изобретению могут быть конъюгированы. В основном указанные конъюгированные полипептиды содержат по меньшей мере пять аминокислот в длину. В некоторых вариантах осуществления настоящего изобретения конъюгированные полипептиды имеют в длину, например, от примерно 5 до примерно 10 аминокислот, от примерно 5 до примерно 50 аминокислот, от примерно 5 до примерно 100 аминокислот, от примерно 5 до примерно 150 аминокислот, от примерно 5 до примерно 500 аминокислот, от примерно 5 до примерно 1000 аминокислот или от примерно 5 до примерно 5000 аминокислот.

Конъюгация полипептидов по настоящему изобретению может быть достигнута с использованием подходящих способов, включающих, например, как химическую конъюгацию, так и «генетическую конъюгацию», в соответствии с которой рекомбинантные слитые белки, включающие полипептид BLyS, функционально связываются с цитотоксическим пептидом. Рассматриваемая конъюгация с полипептидом BLyS включает конъюгацию N-концевого участка белка (в пределах первых 100 аминокислот), внутреннего участка (между N-концевым и C-концевым участками) и/или С-концевого участка белка (в пределах последних 100 аминокислот). Далее подробно описаны методики конъюгации, рассматриваемые для использования в настоящем изобретении.

Конъюгированные полипептиды по настоящему изобретению могут быть экспрессированы в экзогенном режиме. В конкретном варианте осуществления настоящего изобретения полипептид включает слитый полипептид или химерный полипептид. Химерный полипептид содержит весь или дискретную часть двух или более полипептидов. Дискретная часть полипептида относится к аминокислотному участку, который содержит идентифицируемую функцию или активность. Слитый белок представляет собой тип химерного белка, в котором первый полипептид или часть первого полипептида связана по типу конец-с-концом со вторым полипептидом или частью второго полипептида.

Настоящее изобретение также относится к способам лечения индивидуума с В-клеточным пролиферативный расстройством, включающим введение указанному индивидууму терапевтически эффективного количества одной или нескольких молекул по настоящему изобретению, включая конъюгированные полипептиды. Термин «В-клеточное пролиферативное расстройство» обозначает злокачественные, а также незлокачественные популяции клеток, которые зачастую отличаются от окружающей ткани как морфологически, так и генотипически. Цитотоксический полипептид может быть соединен с полипептидом BLyS множеством способов, известных специалистам в данной области и описанных далее более подробно.

Примеры В-клеточных пролиферативных расстройств, лечение которых может проводиться в соответствии с настоящим изобретением, включают по меньшей мере следующие: В-клеточный хронический лимфоцитарный лейкоз/малую лимфоцитарную лимфому при пролимфоцитарном лейкозе В-клеток, иммуноцитому/лимфоплазмацитарную лимфому (+/- макроглобулинемию Валденштрома), лимфому клеток мантии, лимфому В-клеток пограничной зоны в лимфоидной ткани, связанной со слизистой (MALT типа), лимфому В-клеток пограничной зоны селезенки (+/- ворсинчатые лимфоциты), лейкемический ретикулез, диффузную лимфому крупных В-клеток, медиастинальную (вилочковую) лимфому крупных В-клеток, внутрисосудистую лимфому крупных В-клеток, лимфому Буркитта, миелому плазматических клеток (множественную миелому), моноклональную гаммопатию или гаммопатию неясного генеза (MGUS), индолентную миелому, миелому Смолдеринга, остеосклеротическую миелому (POEMS синдром), лейкоз плазматических клеток, несекретирующую миелому, плазмацитому, солитарную плазмоцитому кости, экстрамедуллярную плазмацитому, макроглобулинемию Валденштрома, болезнь, вызванную патологией тяжелой цепи (HCD), заболевание, связанное с осаждением иммуноглобулина, системную патологию легкой цепи и первичный амилоидоз.

В некоторых аспектах настоящего изобретения композиции и способы относятся к В-клеточным пролиферативным расстройствам, которые устойчивы к лечению. Указанное расстройство может быть изначально устойчивым к лечению или указанное расстройство может стать устойчивым к лечению в результате первичного или последующего лечения.

Другие варианты осуществления настоящего изобретения относятся к композициям по настоящему изобретению для профилактики и/или лечения по меньшей мере одного симптома В-клеточного пролиферативного расстройства. В конкретном варианте осуществления настоящего изобретения композицию по настоящему изобретению используют для профилактики и/или лечения аутоиммунного расстройства, такого как, например, артрит или системная красная волчанка. Что касается профилактического применения, то можно достигнуть полного предупреждения развития симптома или его появление может быть задержано. Что касается применения для лечения, то симптом может быть полностью устранен или частично уменьшен.

В других аспектах осуществления настоящего изобретения описанные способы и композиции используют применительно к индивидууму, который проходит другое лечение по поводу такого же В-клеточного пролиферативного расстройства и который будет проходить другое лечение или который уже проходит данное лечение. Может рассматриваться любая дополнительная терапия, где в конкретных вариантах осуществления настоящего изобретения дополнительная терапия включает облучение, химиотерапию, хирургическое вмешательство, генную терапию, иммунотерапию, гормональную терапию или их сочетание.

В конкретных вариантах осуществления изобретения предлагается способ лечения индивидуума с В-клеточным пролиферативным расстройством, включающий введение указанному пациенту терапевтически эффективного количества композиции, такой как конъюгированный полипептид, включающий полипептид BLyS, конъюгированный с цитотоксическим полипептидом, в конкретных вариантах указанный способ также включает введение индивидууму средства, которое повышает экспрессию рецептора BLyS.

В дополнительных вариантах осуществления изобретения рецептор BLyS может быть введен в клетку-хозяин и экспрессирован в клетке-хозяине, что позволяет BLyS воздействовать на клетки за пределами его природного тропизма. В конкретных вариантах осуществления настоящего изобретения экспрессия полинуклеотида, содержащего последовательность нуклеиновой кислоты, которая кодирует конъюгат BLyS (такой как слитый белок) по настоящему изобретению, регулируется тканеспецифичным промотором. Например, молекулу рецептора BLyS, такую как SEQ ID NO: 4 (генная последовательность SEQ ID NO: 12), вводят с помощью подходящего вектора в клетку-хозяин печени. Экспрессия рецептора BLyS контролируется промотором, специфичным для гепатомы. Таким образом, действие BLyS-конъюгированных полипептидов может быть направлено на клетки гепатомы для лечения. В других вариантах осуществления настоящего изобретения конъюгированные полипептиды могут быть связаны с визуализирующим агентом для отслеживания прогресса направленного воздействия полипептида в организме пациента.

В дополнительных вариантах осуществления настоящего изобретения предлагается способ селективного направленного воздействия на клетку, экспрессирующую рецептор BLyS, включающий контактирование указанной клетки с конъюгированным полипептидом, содержащим полипептид BLyS, конъюгированный с цитотоксическим пептидом.

В другом варианте осуществления настоящего изобретения предлагается способ мониторинга терапии В-клеточного пролиферативного расстройства, включающий введение пациенту терапевтически эффективного количества конъюгированного полипептида, содержащего полипептид BLyS, конъюгированный с цитотоксическим полипептидом и визуализирующим агентом.

Настоящее изобретение относится к мультиполипептидным композициям, в которых более чем один полипептид присутствует в виде конкретного отдельного соединения. Таким образом, белок BLyS может быть, например, присоединен к токсину гелонин, например ко второму, третьему, четвертому, пятому, шестому, седьмому или более полипептиду.

В других вариантах осуществления настоящего изобретения предлагаются наборы для лечения и/или профилактики В-клеточных пролиферативных расстройств, содержащие композицию, содержащую полипептид BLyS, конъюгированный с другой молекулой, такой как, например, цитотоксический агент или фармацевтический агент. В конкретных вариантах осуществления композиция содержит слитый белок rGel и BLyS и/или полинуклеотид, его кодирующий.

Таким образом, в вариантах осуществления настоящего изобретения предлагается композиция, содержащая полипептид BLyS, конъюгированный с дополнительной молекулой, включающей молекулу, которая не идентична полипептиду BLyS. В конкретных аспектах дополнительная молекула не является гомологом BlyS. В конкретных аспектах настоящего изобретения дополнительная молекула содержит, например, фармацевтический агент, хелат или цитотоксический агент. Компоненты композиции могут быть включены в состав слитого белка или могут быть, например, химически конъюгированы. Композиция по настоящему изобретению может содержать рекомбинантный полипептид и/или полинуклеотид, кодирующий рекомбинантный полипептид. В конкретных аспектах композиция также содержит радиоактивный агент, клеточный визуализирующий агент или оба агента. Указанная композиция может быть включена в состав фармацевтически приемлемого носителя.

В конкретных аспектах полипептида BlyS полипептид включает В-клеточный направленный домен, который содержит петлю D-E для распознавания рецептора, включает всю или только функциональную часть последовательности SEQ ID NO: 1 или SEQ ID NO: 2 и/или содержит функциональный эквивалент BLyS, где последовательность указанного функционального эквивалента обладает по меньшей мере 80% гомологией к SEQ ID NO: 1 или к SEQ ID NO: 2.

В тех вариантах осуществления настоящего изобретения, где используют цитотоксический агент, указанный цитотоксический агент может быть любого подходящего вида, тогда как в некоторых вариантах цитотоксический агент включает пептид, полипептид или, например, малую молекулу. В конкретных аспектах цитотоксический пептид включает пептид гелонина, который в вариантах осуществления, приведенных в качестве примера, находится в 5' положении по отношению к полипептиду BLyS. В конкретных вариантах осуществления настоящего изобретения пептид гелонин содержит SEQ ID NO: 7. В других конкретных вариантах осуществления изобретения пептид гелонин содержит аминокислотные остатки 110-210

последовательности SEQ ID NO: 7.

В конкретных вариантах осуществления настоящего изобретения цитотоксический агент выбран из группы, состоящей, например, из рицина А, дифтерийного токсина, абрина, додекандрина, трикозантина, трикокирина, бриодина, антивирусного агента из Mirabilis, белка, инактивирующего рибосомы ячменя (BRIP), антивирусного белка из лаконоса (PAP), сапорина, люффина, экзотоксина Pseudomonas и момордина.

В некоторых аспектах осуществления настоящего изобретения указанная композиция содержит, например, SEQ ID NO: 8 и/или SEQ ID NO: 10.

В конкретных аспектах настоящего изобретения рассматривается клетка-хозяин, содержащая композицию по настоящему изобретению. В других конкретных аспектах настоящего изобретения предлагается выделенный полинуклеотид, кодирующий по меньшей мере часть композиции по настоящему изобретению, включая всю композицию. В конкретных вариантах осуществления полинуклеотид содержит SEQ ID NO: 9 или SEQ ID NO: 11.

В дополнительных вариантах осуществления настоящего изобретения предлагается способ лечения индивидуума с В-клеточным пролиферативным расстройством, включающий введение пациенту терапевтически эффективного количества композиции, содержащей полипептид BLyS, конъюгированный с дополнительной молекулой, такой как, например, цитотоксический агент. Данный способ может также включать введение индивидууму агента, который, например, повышает экспрессию рецептора BLyS. В конкретных аспектах осуществления настоящего изобретения BLyS выбран из группы, состоящей из TNFRSF13B/TACI (SEQ ID NO: 4), TNFRSF17/BCMA (SEQ ID NO: 5) и TNFRSF13C/BAFFR (SEQ ID NO: 6).

В одном из вариантов осуществления настоящего изобретения предлагается способ селективного направленного воздействия на клетку, экспрессирующую рецептор BLyS, включающий контактирование данной клетки с композицией, содержащей полипептид BLyS, конъюгированный с цитотоксическим агентом.

В дополнительных вариантах осуществления настоящего изобретения предлагается способ мониторинга терапии индивидуума с В-клеточным пролиферативным расстройством, включающий введение указанному индивидууму терапевтически эффективного количества композиции, содержащей полипептид BLyS, конъюгированный с цитотоксическим агентом, и визуализирующий агент.

Приведенное выше в общих чертах описывает признаки и технические преимущества настоящего изобретения для большей ясности приведенного ниже подробного описания настоящего изобретения. Дополнительные признаки и преимущества настоящего изобретения описаны и формируют ниже заявляемые по настоящему изобретению объекты. Специалистам в данной области понятно, что концепция и конкретные описанные варианты осуществления могут быть использованы в качестве основы для последующего изменения или разработки других структур для достижения тех же целей, что и цели настоящего изобретения. Для специалистов в настоящей области также очевидно, что такие эквивалентные по строению конструкции не будут выходить за рамки и менять сущность настоящего изобретения, приведенного в настоящем описании. Новые признаки, которые, как полагают, будут характерны для настоящего изобретения как с точки зрения организации, так и способов осуществления, в сочетании с другими дополнительными объектами и признаками могут быть лучше поняты из приведенного ниже описания, которое наиболее полно представит изобретение в сочетании с приведенными фигурами. Указанные особенности приведены в явном виде, однако каждая из предлагаемых фигур дана с целью иллюстрации и описательной целью и их не следует рассматривать как ограничивающие область настоящего изобретения.

ОПИСАНИЕ ФИГУР

Для более полного понимания настоящего изобретения ниже приведено описание фигур для лучшего понимания описания изобретения.

На фиг.1 показана примерная ориентация BLyS и rGel.

На фиг. 2 показана репрезентативная последовательность ДНК (SEQ ID NO: 9) и последовательность белка (SEQ ID NO: 8) слитого токсина BLyS/rGel.

На фиг.3 показана репрезентативная последовательность ДНК (SEQ ID NO: 11) и последовательность белка (SEQ ID NO: 10) слитого токсина rGel/BLyS.

На фиг.4 проиллюстрирована конструкция репрезентативного слитого токсина rGel/BLyS. Получен слитый токсин rGel/BLyS, содержащий rGel на N-конце, за которым следует пептид G4S, присоединенный к молекуле BLyS с использованием ПЦР по методу перекрывающегося сплайсинг-расширения. Рекомбинантную конструкцию ДНК rGel/BLyS вводят в сайты рестрикции ферментов Kpn I и Xho I в векторе pET-32a с получением вектора экспрессии pET32rGel/BLyS.

На фиг.5 показана процедура очистки слитого токсина rGel/BLyS. По результатам окрашивания Кумасси-блю при проведении электрофореза в SDS-PAGE слитого токсина rGel/BLyS показатель M r для rGel/BLyS имеет значение 45кДа, демонстрируя молярное соотношение 1:1 BLyS и rGel (левая панель). Результаты вестерн-блоттинга с использованием антигелонинового антитела или анти-BLyS антитела показывают, что слитый токсин rGel/BLyS содержит токсин и BLyS в слитом токсине (правая панель).

На фиг.6 продемонстрирована ингибирующая активность в бесклеточной системе белкового синтеза слитого токсина rGel/BLyS. Для определения n-гликозидазной активности компонента rGel в слитом токсине rGel/BLyS этот материал добавляют к тесту для трансляции in vitro с использованием теста для оценки включения [3H]-лейцинами, изолированными ретикулоцитами кролика. Сравнивают кривые ингибирования для слитого токсина rGel/BLyS и нативного rGel.

На фиг. 7 продемонстрированы результаты сравнения rGel/BLyS и слитого токсина BLyS/rGel против клеточной линии клеток мантии JEKO. Клетки линии клеток мантии JEKO высевают (с плотностью 5·103/лунку) в лунки 96-луночных микротитрационных планшетов с плоским дном и добавляют в лунки в четырехкратном повторе rGel, rGel/BLyS или BLyS/rGel. Через 96 часов к каждой лунке добавляют по 75 мкл ХТТ-меченой смеси, после чего клетки инкубируют еще в течение 4 часов. Определяют поглощение на спектрофотометре при длине волны 450 нм с использованием счетчика для ELISA.

На фиг. 8А-8М показаны кривые зависимости доза-ответ для слитого токсина rGel/BLyS против различных опухолевых клеточных линий: Jurkat (8A), KBM-5 (8B), THP-1 (8C), HL-60 (8D), IM-9 (8E), MM1.S (8F), ММ1.R (8G), RPMI18226 (8H), 8226/LR-5 (8I), JEKO (8J), SP53 (8K), Mino (8L) и Granta (8M). Клетки тринадцати опухолевых клеточных линий высевают (с плотностью 5·103/лунку) в лунки 96-луночных микротитрационных планшетов с плоским дном и добавляют в лунки в четырехкратном повторе rGel или rGel/BLyS. Через 96 часов к каждой лунке добавляют по 75 мкл ХТТ-меченой смеси, после чего клетки инкубируют еще в течение 4 часов. Определяют поглощение на спектрофотометре при длине волны 450 нм с использованием счетчика для ELISA.

На фиг. 9 продемонстрирована специфичность слитого токсина rGel/BLyS для клеточной линии клеток мантии JEKO, экспрессирующих рецепторы BLyS. Клетки линии клеток мантии JEKO высевают (с плотностью 5·103/лунку) в лунки 96-луночных микротитрационных планшетов с плоским дном и добавляют в лунки в четырехкратном повторе BLyS, rGel, CTP/rGel и rGel/BLyS. Через 96 часов к каждой лунке добавляют по 75 мкл ХТТ-меченой смеси, после чего клетки инкубируют еще в течение 4 часов. Определяют поглощение на спектрофотометре при длине волны 450 нм с использованием счетчика для ELISA.

На фиг. 10 представлены кривые зависимости доза-ответ для слитого токсина rGel/BLyS против различных дексаметазон-чувствительных (MM1.S) и дексаметазон-резистентных (MM1.R) клеток клеточной линии множественной миеломы. Клетки клеточных линий MM1.S и MM1.R высевают (с плотностью 5·103/лунку) в лунки 96-луночных микротитрационных планшетов с плоским дном и добавляют в лунки в четырехкратном повторе rGel, Dex или rGel/BLyS. Через 96 часов к каждой лунке добавляют по 75 мкл ХТТ-меченой смеси, после чего клетки инкубируют еще в течение 4 часов. Определяют поглощение на спектрофотометре при длине волны 450 нм с использованием счетчика для ELISA.

На фиг. 11 проиллюстрирована максимальная переносимая доза (MTD) для rGel/BLyS. Для получения значения MTD для rGel/BLyS различные концентрации rGel/BLyS инъецируют мышам Balb/C в течение 5 последовательных дней внутривенно в хвостовую вену и определяют массу тела и количество выживших мышей.

На фиг. 12 продемонстрирована специфичность rGel/BLyS к клеткам, экспрессирующим рецептор BLyS (фиг. 14А). Активность по связыванию с рецептором фрагмента BLyS компонента в rGel/BLyS определяют по методу ELISA с использованием интактных клеток JeKo-1 и HL-60 (фиг. 14B). Для определения удельной активности rGel/BLyS против трех клеточных линий лимфомы клеток мантии (MCL), экспрессирующих один или несколько рецепторов BLyS, клетки клеточной линии JeKo-1 MCL высевают (с плотностью 5·103/лунку) в лунки 96-луночных микротитрационных планшетов с плоским дном и добавляют в лунки в четырехкратном повторе BLyS, rGel, CTP/rGel или rGel/BLyS. Через 96 часов к каждой лунке добавляют по 50 мкл ХТТ-меченой смеси, после чего клетки инкубируют еще в течение 4 часов или в течение ночи. Определяют поглощение на спектрофотометре при длине волны 450 нм с использованием счетчика для ELISA.

На фиг. 13A-13B проиллюстрировано конкурентное ингибирование под действием rGel/BLyS на клетках JeKo-1. Для проведения теста на конкурентное ингибирование клетки JeKo-1 высевают (с плотностью 5×103/лунку) в лунки 96-луночных микротитрационных планшетов с плоским дном (Becton Dickinson) и проводят предварительную обработку с использованием 1 нМ BLyS, 50 нМ BLyS (фиг. 15А), 10 мкг/мл BAFF-R:Fc, 10 мкг/мл TACI:Fc или 10 мкг/мл BCMA:Fc (фиг. 15В) в течение 2 часов и затем добавляют в лунки в четырехкратном повторе rGel, BLyS или rGel/BLyS. Через 96 часов к каждой лунке добавляют по 50 мкл ХТТ-меченой смеси (Roche), после чего клетки инкубируют еще в течение 4 часов или в течение ночи. На спектрофотометре определяют поглощение при длине волны 450 нм с использованием счетчика для ELISA.

На фиг. 14А-14С показаны эффекты rGel/BLyS на апоптоз (14А) и вид клеток JeKo-1 под микроскопом после обработки. Клетки JeKo-1 обрабатывают с использованием 100 пМ BLyS, 100 пМ rGel или 100 пМ rGel/BLyS. Через 96 часов оценивают наличие в клетках JeKo-1 апоптоза при проведении окрашивания по методу TUNEL (фиг. 14В). Количество апоптозных клеток подсчитывают в случайно выбранных полях (увеличение × 200) и выражают в процентах. Для выявления эффекта rGel/BLyS на апоптоз клетки JeKo-1 или Granta 519 высевают с плотностью 5×105/клеток в лунки 24-луночного планшета и затем обрабатывают с использованием 100 пМ BLyS, 100 пМ rGel или 100 пМ rGel/BLyS. После обработки клетки собирают, промывают и лизируют в 0,2 мл буфера для лизирования. Клеточные лизаты (50 мкг) фракционируют при проведении электрофореза в 8-15% SDS-PAGE и электрофоретически переносят на нитроцеллюлозные мембраны Immobilon-P. Мембраны блокируют и затем зондируют различными антителами (фиг. 14С). Используют вторичные антитела, конъюгированные с пероксидазой хрена, для визуализации иммунореактивных белков с использованием выявляющего реагента ECL. Актин используют в качестве контроля на белковую нагрузку.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

В контексте настоящего описания термин «другой» может обозначать по меньшей мере второй или еще больше. Несколько вариантов осуществления настоящего изобретения могут состоять или состоять, по существу, из одного или большего числа элементов, стадий осуществления методики и/или методик по настоящему изобретению. Считается, что любой способ или композиция, приведенные в настоящем описании, могут быть осуществлены применительно к любому другому способу или композиции, приведенных в настоящем тексте.

I. Определения

Термин «конъюгированный» в контексте настоящего описания относится к некоторым вариантам осуществления настоящего изобретения, в которых имеет место присоединение BLyS молекулы к молекуле цитотоксического агента. Указанное присоединение может осуществляться любыми подходящими методиками из числа известных в данной области, тогда как в некоторых аспектах присоединение происходит путем рекомбинации, с помощью линкера и т.п. В конкретных аспектах используется ионная ассоциация, такая как, например, с использованием авидин-биотиновой связи.

II. Настоящее изобретение

Настоящее изобретение относится к композициям, которые направленно воздействуют на аномально пролиферирующие В-клетки, которые демонстрируют пристутствие рецепторов для полипептидов BLyS. Нормально пролиферирующем B-клетки, а также другие типы клеток, не экспрессируют рецепторы BLyS. Полипептиды по настоящему изобретению включают полипептид BLyS, который служит в качестве направленного домена, и цитотоксический пептид, который снижает или устраняет пролиферацию одной или нескольких клеток-мишеней. Такие полипептиды обладают специфической цитотоксической активностью против аномально пролиферирующих В-клеток и в этой связи полезны для применения в терапии любого B-клеточного пролиферативного расстройства. Способы создания и использования таких полипептидов в терапии описаны ниже.

III. Протеиноподобные соединения BLys

Настоящее изобретение относится к конъюгированным полипептидам с направленным воздействием, в частности к таким полипептидам, которые оказывают терапевтический эффект для индивидуума. В некоторых вариантах настоящее изобретение относится к новым композициям, включающим протеиноподобные молекулы. В некоторых вариантах считается, что указанные протеиноподобные соединения могут быть модифицированы путем делеции, замещения или добавления аминокислотных остатков. В конкретных вариантах BLyS включают мутацию, которая не влияет на активность связывания с рецептором BLyS. Указанная мутация может присутствовать в полинуклеотиде, кодирующем молекулу BLyS. Репрезентативные мутанты BLyS включают мутацию Cys146 (Chen et al., 2002; 2004; 2005) и в конкретных вариантах указанные мутации затрагивают аланин или валин. Мутанты BLyS, используемые в настоящем изобретении, сохраняют способность направленно воздействовать на B-клетки, например сохраняют способность связываться по меньшей мере с одним рецептором BLyS. В мутанте BLyS может быть повышена любая активность в сравнении с BLyS дикого типа, включая способность связываться с B-клеткой, например, через рецептор BLyS.

Кроме того, протеиноподобное соединение может включать молекулу аминокислоты, включающую более одной полипептидной единицы. В контексте настоящего описания термин «протеиноподобная молекула», «протеиноподобная композиция», «протеиноподобное соединение», «протеиноподобная цепь» или «протеиноподобный материал» в основном относится без ограничения к пептиду, включающему от примерно 3 до примерно 100 аминокислот, к полипептиду, включающему более чем 100 аминокислот, и к полипептиду, включающему более чем примерно 200 аминокислот, или к эндогенной последовательности полной длины, транслируемой с гена. Все указанные выше термины, включающие слово «протеиноподобный», могут использоваться взаимозаменяемо. Кроме того, указанные термины равным образом могут использоваться применительно к конъюгированным полипептидам или белковым конъюгатам.

В некоторых вариантах размер по меньшей мере одной протеиноподобной молекулы может составлять без ограничения примерно или по меньшей мере 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1750, 2000, 2250, 2500 или более остатков в молекуле аминокислоты и включать любой диапазон, который может быть получен на основе указанных значений.

Соответственно термин «протеиноподобная композиция» относится к последовательностям аминокислотных молекул, включающим по меньшей мере одну из 20 обычных аминокислот природных белков или по меньшей мере одну модифицированную или необычную аминокислоту, включая без ограничения аминокислоты, приведенные ниже в таблице 1.

ТАБЛИЦА 1
Модифицированные и необычные аминокислоты
Сокращение Аминокислота Сокращение Аминокислота
Aad 2-аминоадипиновая кислота EtAsn N-этиласпарагин
Baad 3-аминоадапиновая кислота Hyl Гидроксилизин
Bala β-аланин, β-аминопропионовая кислота AHyl Аллогидроксилизин
Abu 2-аминомасляная кислота 3Hyp 3-гидроксипролин
4Abu 4-аминомасляная кислота, пиперидиновая кислота 4Hyp 4-гидроксипролин
Acp 6-аминокапроновая кислота Ide Изодесмозин
Ahe 2-аминогептановая кислота Alle Аллоизолейцин
Aib 2-аминоизомасляная кислота MeGly N-метилглицин, саркозин
Baib 3-аминоизомасляная кислота Melle N-метилизолейцин
Apm 2-аминопимелиновая кислота MeLys 6-N-метиллизин
Dbu 2,4-диаминомасляная кислота MeVal N-метилвалин
Des Десмозин Nva Норвалин
Dpm 2,2'-диаминопимелиновая кислота Nle Норлейцин
Dpr 2,3-диаминопропионовая кислота Orn Орнитин
EtGly N-этилглицин

В контексте настоящего описания термин «молекула аминокислоты» относится к любой аминокислоте, производному аминокислоты или миметику аминокислоты, что очевидно любому специалисту в данной области. В некоторых вариантах остатки протеиноподобной молекулы являются последовательными и не включают какой-либо молекулы, отличной от аминокислоты, которая нарушала бы последовательность остатков в молекуле аминокислоты. В других вариантах последовательность может включать один или несколько фрагментов молекул, отличных от аминокислоты. В конкретных вариантах последовательность остатков в протеиноподобной молекуле может прерываться одним или несколькими фрагментами молекул, отличными от аминокислоты.

Направленные конъюгированные полипептиды по настоящему изобретению могут содержать делеции и/или замещения аминокислот; таким образом, белки с делецией, белки с замещением и белки с делецией и замещением представляют собой направленные конъюгированные полипептиды. В некоторых вариантах осуществления настоящего изобретения указанные направленные конъюгированные полипептиды могут также включать вставки или добавленные аминокислоты, такие как, например, линкеры. Термин «направленный слитый делетированный белок» характеризуется потерей одного или нескольких остатков из нативного белка, но обладает специфичностью и/или активностью нативного белка.

Варианты по замещению или замене в типичном случае включают замену одной аминокислоты другой в одном или нескольких сайтах в белке и могут быть созданы таким образом, чтобы модулировать одно или несколько свойств полипептида, в частности повышать его эффективность или специфичность. Замещения такого рода являются предпочтительно консервативными, то есть одну аминокислоту заменяют другой аминокислотой сходного размера и заряда. Консервативные замещения известны в настоящей области и включают, например, замену аланина на серин; аргинина на лизин; аспарагина на глютамин или гистидин; аспартата на глютамат; цистеина на серин; глютамина на аспарагин; глютамата на аспартат; глицина на пролин; гистидина на аспарагин или глютамин; изолейцина на лейцин или валин; лейцина на валин или изолейцин; лизина на аргинин; метионина на лейцин или изолейцин; фенилаланина на тирозин, лейцин или метионин; серина на треонин; треонина на серин; триптофана на тирозин; тирозина на триптофан или фенилаланин; и валина на изолейцин или лейцин.

Кроме делеции или замещения направленный слитый белок может содержать вставки из остатков, которые в типичном случае представляют собой добавление по меньшей мере одного остатка к полипептиду. Такая добавка может включать вставку направленного пептида или полипептида, или просто одного остатка. Терминальные вставки, называемые слитыми белками, описаны ниже.

Термин «биологически функциональный эквивалент» известен в настоящей области и далее будет определен более подробно. Соответственно последовательности, которые характеризуются наличием примерно 70% и примерно 80% или примерно от 81% до примерно 90%, а также в диапазоне от примерно 91% до примерно 99% аминокислот, которые идентичны или функционально эквивалентны аминокислотам в нативном полипептиде, включаются в настоящее изобретении при условии, что в них сохраняется биологическая активность белка. Направленный слитый белок может представлять биологически функциональный эквивалент своему природному партнеру. Например, он может представлять собой функциональный эквивалент с точки зрения способности связываться с рецептором. В других вариантах конъюгированные полипептиды по настоящему изобретению могут обладать большей аффинностью к своим рецепторам, чем их нативные партнеры.

Термин «функционально эквивалентный кодон» в контексте настоящего описания относится к кодонам, которые кодируют одну и ту же аминокислоту, например, как в случае шести кодонов для аргинина или серина, а также относится к кодонам, которые кодируют биологически эквивалентные аминокислоты (см. таблицу 2, ниже).

ТАБЛИЦА 2
ТАБЛИЦА КОДОНОВ
АМИНОКИСЛОТЫ КОДОНЫ
Аланин Ala A GCA GCC GCG GCU
Цистеин Cys C UGC UGU
Аспарагиновая кислота Asp D GAC GAU
Глютаминовая кислота Glu E GAA GAG
Фенилаланин Phe F UUC UUU
Глицин Gly G GGA GGC GGG GGU
Гистидин His H CAC CAU
Изолейцин Ile I AUA AUC AUU
Лизин Lys K AAA AAG
Лейцин Leu L UUA UUG CUA CUC CUG CUU
Метионин Met M AUG
Аспарагин Asn N AAC AAU
Пролин Pro P CCA CCC CCG CCU
Глютамин Gln Q CCA CAG
Аргинин Arg R AGA AGG CGA CGC CGG CGU
Серин Ser S AGC AGU UCA UCC UCG UCU
Треонин Thr T ACA ACC ACG ACU
Валин Val V GUA GUC GUG GUU
Триптофан Trp W UGG
Тирозин Tyr Y UAC UAU

Следует также понимать, что аминокислотные последовательности и последовательности нуклеиновой кислоты могут включать дополнительные остатки, такие как дополнительные N- или С-концевые аминокислоты или 5'- или 3'-последовательности, и, по существу, представлять последовательности, приведенные в указанном перечне, при условии, что данная последовательность удовлетворяет указанным выше критериям для сохранения биологической активности белка, в том случае, когда рассматривается экспрессия белка. Добавление терминальных последовательностей в особенности применимо к последовательностям нуклеиновых кислот, которые могут включать, например, различные некодирующие последовательности, фланкирующие одну из 3'- или 5'-частей кодирующего участка, или могут включать различные внутренние последовательности, например интроны, которые, как известно, находятся внутри генов.

Ниже приводится описание различных аспектов замены аминокислот в белке с созданием эквивалентной или даже улучшенной молекулы второго поколения. Например, некоторые аминокислоты могут быть замещены другими аминокислотами в структуре белка без существенной потери способности к интерактивному связыванию с такими структурами, как, например, сайты связывания с молекулами субстрата. Поскольку именно интерактивная способность и природа белка определяют биологическую и функциональную активность белка, некоторые аминокислотные замещения могут быть осуществлены в последовательности белка и в соответствующей кодирующей последовательности ДНК, и тем не менее может быть получен белок с похожими свойствами. Таким образом, авторы изобретения полагают, что могут быть внесены различные изменения в последовательности ДНК генов без существенной потери их биологической применимости или активности, как это описывается ниже. В таблице 2 показаны кодоны, которые кодируют конкретные аминокислоты.

При введении таких изменений следует учитывать гидропатический индекс аминокислот. Важность гидропатического индекса аминокислот в характеристике интерактивной биологической функции белка хорошо известна в данной области (Kyte & Doolittle, 1982). Считается, что относительный гидропатический характер аминокислоты носит вклад во вторичную структуру получаемого белка, которая, в свою очередь, определяет характер взаимодействия белка с другими молекулами, например с ферментами, субстратами, рецепторами, ДНК, антителами, антигенами и т.п.

В настоящей области также известно, что замещение в пределах подобных аминокислот может быть эффективно осуществлено на основе гидрофильности. В патенте США No. 4 554 101, приведенном в настоящем описании в качестве ссылки, указывается, что наивысшая локальная средняя гидрофильность белка, определяемая гидрофильностью соседних аминокислот, коррелирует с соответствующим биологическим свойством белка. Как подробно описано в патенте США No. 4 554 101, аминокислотным остаткам присвоены следующие показатели гидрофильности: аргинин (+3,0); лизин (+3,0); аспартат (+3,0±1); глютамат (+3,0 ±1); серин (+3,0); аспарагин (+0,2); глютамин (+0,2); глицин (0); треонин (-0,4); пролин (-0,5±1); аланин (-0,5); гистидин (-0,5); цистеин (-1,0); метионин (-1,3); валин (-1,5); лейцин (-1,8); изолейцин (-1,8); тирозин (-2,3); фенилаланин (-2,5); триптофан (-3,4).

Следует понимать, что аминокислота может быть замещена другой аминокислотой, имеющей аналогичный показатель гидрофильности, и при этом будет создан биологически эквивалентный и иммунологически эквивалентный белок. При проведении таких замен предпочтительно замещение аминокислот, для которых гидрофильные показатели находятся в пределах ±2, причем особенно предпочтителен указанный показатель, находящийся в пределах ± 1, а если указанные показатели находятся в пределах ±0,5, они являются еще более предпочтительными.

Как указывалось выше, аминокислотные замены, как правило, основаны на относительном сходстве заместителей в боковой цепи аминокислоты, например от их гидрофобности, гидрофильности, заряда, размера и т.п. Репрезентативные замещения, которые учитывают различные указанные выше характеристики, известны специалистам в данной области и включают: аргинин и лизин; глютамат и аспартат; серин и треонин; глютамин и аспарагин; а также валин, лейцин и изолейцин.

IV. Конъюгированные полипептиды

Настоящее изобретение также относится к конъюгированным полипептидам, таким как транслированные белки, полипептиды и пептиды, в основном моноклонального типа, которые связываются по меньшей мере с одним агентом с образованием конъюгата. Конъюгированные полипептиды по настоящему изобретению включают химическую конъюгацию и «генетическую конъюгацию», такую, как в случае рекомбинантных слитых белков. Следует также понимать, что полипептиды по настоящему изобретению могут быть синтезированы de novo с использованием методик, известных специалистам в данной области.

А. Пептидный синтез

Конъюгированные полипептиды по настоящему изобретению могут быть синтезированы. Методики пептидного синтеза известны специалистам в данной области (Bodanczky et al., 1976; Peptide Synthesis, 1985; Solid Phase Peptide Synthelia, 1984; The Proteins, 1976). Описание соответствующих защитных групп, подходящих для использования в таких методах синтеза, можно найти в приведенных выше работах, а также в руководстве по защитным группам (Protective Groups in Organic Chemistry, 1973). Указанные методы синтеза включают последовательное добавление одного или нескольких аминокислотных остатков или подходящим образом замещенных аминокислотных остатков к растущей пептидной цепи. Обычно амино- или карбоксильные группы первого аминокислотного остатка подвергают защите с использованием подходящей селективно удаляемой защитной группы. Используют другую селективно удаляемую защитную группу для аминокислот, содержащих реакционноспособную боковую группу, таких как лизин.

При использовании в качестве примера метода твердофазного синтеза защищенную или дериватизированную аминокислоту присоединяют к инертной твердой подложке через ее незащищенную карбоксильную или аминогруппу. Защитную группу для аминогруппы или карбоксильной группы затем селективно удаляют и следующую аминокислоту в последовательности, которая имеет комплементарную (амино или карбоксильную) группу, защищенную соответствующим образом, добавляют и подвергают реакции с остатком, уже присоединенным к твердой подложке. Защитную группу для аминогруппы или карбоксильной группы затем удаляют от указанного вновь добавленного аминокислотного остатка и вносят соответствующим образом защищенную следующую аминокислоту (и так далее). После того, как все желательные аминокислоты будут связаны в соответствующей последовательности, удаляют любые оставшиеся терминальные и боковые защитные группы (а также твердую подложку), последовательно или одновременно, с получением конечного пептида. Пептиды по настоящему изобретению предпочтительно не содержат бензилированных или метилбензилированных аминокислот. Такие фрагменты защитной группы могут использоваться в ходе синтеза, но их удаляют перед использованием пептидов. Могут быть необходимы также дополнительные реакции, описанные в различных руководствах, для образования внутримолекулярных связей, с целью поддержания нужной конформации.

B. Линкеры/связующие агенты

Множество пептидов или полипептидов могут быть соединены с помощью биологически высвобождаемой связи, такой как селективно-расщепляемый линкер или аминокислотная последовательность. Например, рассматриваются пептидные линкеры, которые включают расщепляемый ферментом сайт, предпочтительно локализованный или активный в опухолевом окружении. Репрезентативные формы таких пептидных линкеров включают формы, расщепляемые урокиназой, плазмином, тромбином, фактором IXa, фактором Xa или металлопротеиназой, такой как коллагеназа, желатиназа или стромелизин. Альтернативно пептиды или полипептиды могут быть соединены с адъювантом.

Аминокислоты, такие как селективно-расщепляемые линкеры, синтетические линкеры или другие аминокислотные последовательности, могут быть использованы для отделения протеиноподобных фрагментов. Дополнительно, в свете того известного факта, что множество типов линкеров, содержащих дисульфидную связь, могут с успехом использоваться для конъюгирования токсинового фрагмента с напрвленным агентом, некоторые линкеры могут быть предпочтительны в сравнении с другими линкерами на основе различных фармакологических характеристик и способностей. Например, линкеры, содержащие дисульфидную связь, которая является пространственно «спрятанной», является предпочтительной, в связи с их большей стабильностью in vivo, которая препятствует высвобождению токсинового фрагмента до связывания с сайтом действия. Кроме того, некоторые преимущества настоящего изобретения могут быть выявлены при использовании любого из множества токсиновых фрагментов, включающих гелонин и дегликозилированную цепь А рицина.

Следует иметь в виду в качестве основного руководства, что любой биохимический поперечно-сшивающий линкер, подходящий для использования в настоящем изобретении, может также использоваться в данном контексте, а также могут рассматриваться дополнительные линкеры.

Поперечно связывающие реагенты используются для образования молекулярных мостиковых связей, которые связывают вместе функциональные группы из двух разных молекул, например стабилизирующего и коагулирующего агента. Для связывания двух разных белков в постадийном режиме могут использоваться гетеробифункциональные поперечно-сшивающие линкеры, которые устраняют нежелательное образование гомополимера.

Считается, что поперечно-сшивающие линкеры могут использоваться в сочетании с олекулами белка по настоящему изобретению. Бифункциональные поперечно сшивающие реагенты широко используются для множества целей, включая получение аффинных матриц, для модификации и стабилизации различных структур, идентификации сайтов связывания и для структурных исследований. В контексте настоящего изобретения, такой сшивающий линкер может использоваться для стабилизации полипептида или для того, чтобы сделать его более полезным в качестве терапевтического средства, например, за счет улучшения способности модифицированного белка к направленному воздействию или повышения общей эффективности. Поперечно-сшивающие линкеры могут быть также расщепляемыми, например, такие как дисульфидные, кислото-чувствительные линкеры и другие. Было показано, что гомобифункциональные реагенты, которые содержат две идентичные функциональные группы, являются высокоэффективными по индукции образования сшивки между идентичными и разными макромолекулами или субъединицами макромолекулы и по связыванию полипептидов со специфическими сайтами связывания на соответствующих партнерских молекулах. Гетеробифункциональные реагенты содержат две разные функциональных группы. За счет объединения преимуществ различных реактивностей двух разных функциональных групп процесс сшивки может контролироваться и селективно и последовательно. Бифункциональные сшивающие реагенты могут быть разделены по специфичности их функциональных групп, например групп, специфичных к аминогруппе, сульфгидрильной, гуанадино, индольной и карбоксильной группам. Из них реагенты, направленные на свободные аминогруппы, особенно широко используются в связи с их коммерческой доступностью, легкостью синтеза и мягкими условиями реакции, при которых они используются. Множество гетеробифункциональных сшивающих реагентов содержит первичную аминореактивную группу и тиолреактивную группу.

В другом примере описываются гетеробифункциональные сшивающие реагенты и способы использования таких сшивающих реагентов (патент США No.5889155, специально приведенный в настоящем описании в качестве ссылки в полном объеме). Сшивающие реагенты содержат объединение нуклеофильного гидразидного остатка с электрофильным малеимидным остатком, позволяя связывание, например, альдегидов со свободными тиолами. Сшивающий реагент может быть модифицирован таким образом, что он будет осуществлять сшивку различных функциональных групп, и в этом случае будет полезен для сшивки полипептидов и сахаров. В тех случаях, когда конкретный полипептид, такой как гелонин, не содержит в своей нативной последовательности остаток, подходящий для данного сшивающего реагента, в первичную последовательность могут быть введены консервативные замены аминокислот генетическими методами или методами синтеза.

В данной области известно несколько методик, подходящих для присоединения или конъюгирования полипептида со своим конъюгатным фрагментом. Некоторые методики присоединения вовлекают использование металлхелатного комплекса с использованием, например, органического хелатирующего агента, такого как ангидрид диэтилентриаминпентауксусной кислоты (DTPA); этилентриаминтетрауксусная кислота; N-хлор-п-толуолсульфонамид; и/или тетрахлор-3α-6α-дифенилгликурил-3, присоединенного к полипептиду (патенты США NoNo.4472509 и 4938948, каждый из которых приведен в настоящем описании в качестве ссылки в полном объеме.). Полипептиды могут также взаимодействовать с ферментом в присутствии связывающего агента, такого как глютаральдегид или периодат. Конъюгаты с флуоресцеиновыми маркерами получают в присутствии указанных выше связующих агентов или путем реакции с изотиоцианатом. В патенте США No.4938948 описывается визуализация опухолей молочной железы с использованием моноклональных антител, где выявляемые визуализуемые фрагменты связывают с полипептидом с использованием линкеров, таких как метил-п-гидроксибензимидат или N-суксинимидил-3-(4-гидроксифенил)пропионат.

С. Визуализующие агенты

В некоторых аспектах настоящего изобретения полипептид BLyS подвергают конъюгации по меньшей мере с одним визуализующим агентом. Неограничивающие примеры визуализующих агентов, которые могут быть конъюгированы с полипептидами, включают ферменты, радиоактивные метки, гаптены, флуоресцентные метки, фосфоресцентные молекулы, хемилюминесцентные молекулы, хромофоры, люминесцентные молекулы, молекулы, определяющие фотоаффинность, окрашенные частицы или лиганды, такие как биотин.

В данной области известно множество подходящих визуализующих агентов, а также способов их присоединения к антителам (см., например, патент США NoNo.5021236; 4938948 и 4472509, каждый из которых приведен в настоящем описании в качестве ссылки). Используемые визуализующие фрагменты могут представлять собой парамагнитные ионы; радиоактивные изотопы; флуорохромы; вещества, выявляемые методами ЯМР; рентгеновская визуализация.

В случае парамагнитных ионов в качестве примера можно отметить ионы, такие как ионы хрома (III), марганца (II), железа (III), железа (II), кобальта (II), никеля (II), меди (II), неодима (III), самария (III), иттербия (III), гадолиния (III), ванадия (II), тербия (III), диспрозия (III), гольмия (III) и/или эрбия (III), где гадолиний является особенно предпочтительным. Ионы, используемые в других контекстах, таких как рентгеновская визуализация, включают без ограничения лантан (III), золото (III), свинец (II) и в особенности висмут (III).

В случае радиоактивных изотопов, применяемых для терапевтических и/или диагностических целей, можно отметить астатин211, 14углерод, 51хром, 36хлор, 57кобальт, 58кобальт, медь67, 152Eu, галлий67, 3водород, йод123, йод125, йод131, индий111, 59железо, 32фосфор, рений186, рений188, 75селен, 35серу, технеций99m и/или иттрий90. 125I зачастую предпочтителен для использования в некоторых вариантах осуществления настоящего изобретения, а технеций99m и/или индий111 также часто предпочтительны в связи с их низкой энергией и приемлемостью для выявления в широком диапазоне. Радиоактивно меченые моноклональные антитела по настоящему изобретению могут быть получены в соответствии с известными в данной области методиками. Например, моноклональные антитела могут быть подвергнуты иодированию при взаимодействии с иодидом натрия и/или калия и химическим окислителем, таким как гипохлорид натрия, или ферментативным окислителем, таким как лактопероксидаза. Промежуточные функциональные группы, которые часто используют для связывания радиоактивных изотопов, существующих в виде сочетания ионов металлов с полипептидом, включают диэтилентриаминпентауксусную кислоту (DTPA) или этилендиаминтетрауксусную кислоту (ЭДТА).

В число флуоресцентных меток, которые могут использоваться в качестве конъюгатов, входят Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, Cascade Blue, Cy3, Cy5,6-FAM, изотиоцианат флуоресцеина, HEX, 6-JOE, орегон зеленый 488, орегон зеленый 500, орегон зеленый 514, пасифик синий, REG, родамин зеленый, родамин красный, ренографин, ROX, TAMRA, TET, тетраметилродамин и/или техасский красный.

Могут также использоваться молекулы, содержащие азидогруппы, для формирования ковалентных связей с белками через реакционноспособные нитреновые интермедиаты, которые образуются под действием низкоинтенсивного ультрафиолетового света (Potter & Haley, 1983). В частности, используют 2- и 8-азидоаналоги пуриновых нуклеотидов в качестве сайт-направленных фотозондов для идентификации связывания нуклеотидов с белками в неочищенных клеточных экстрактах (Owens & Haley, 1987; Atherton et al., 1985). 2- и 8-азидонуклеотиды используются для картирования нуклеотидсвязывающих доменов в очищенных белках (Khatoon et al., 1989; King et al., 1989; и Dholakia et al., 1989) и могут использоваться в качестве связывающих агентов.

V. Терапевтические агенты

В конкретных аспектах настоящего изобретения рассматриваемые в нем полипептиды BLyS подвергают конъюгации с другой молекулой, которая может действовать как терапевтический агент. В конкретных аспектах терапевтический агент может представлять собой цитотоксический агент, радиоактивный изотоп, малую молекулу, химиотерапевтический агент, про-апоптозный агент, природный продукт, антитело, цитокин, хемокин, ангиогенный ингибитор, регулятор программированной гибели клеток и т.п.

Некоторые примеры терапевтических агентов обсуждаются в приведенном ниже тексте.

А. Цитотоксические агенты

Настоящее изобретение относится к использованию цитотоксической активности направленной молекулы, и в конкретных вариантах осуществления настоящего изобретения цитотоксическая активность может рассматриваться в контексте токсина. Любой токсин приемлем для использования в настоящем изобретении, при условии, что он не мешает действию направленного фрагмента конъюгированного полипептида (например), и при условии, что он по меньшей мере замедляет, если полностью не ингибирует, пролиферацию клетки-мишени.

Токсины с ингибирующей активностью в отношении рибосом (RIT) представляют собой мощные ингибиторы синтеза белка в эукариотах. Ферментативный домен указанных белков действует как цитотоксическая n-гликозидаза, которая способна инактивировать каталитически активные рибосомы, поскольку обладает способностью входить во внутриклеточное пространство. Указанный процесс сопровождается расщеплением н-гликозидной связи аденина в положении 4324 в 28srРНК, что приводит к необратимой инактивации рибосомы, по всей видимости, за счет разрушения сайта связывания с факторами элонгации. RIT, которые были изолированы из бактерий, превалируют в высших растениях. В растениях выявлено два типа RIT: токсины типа I содержат одноцепочечный полипептид, обладающий ингибирующей активностью для рибосом, а токсины типа II содержат А цепь, сравнимую с таковой в белке типа I, которая связана дисульфидной связью с B цепью, обладающей сайт-связывающей способностью. Примеры RIT типа I включают гелонин, додекандрин, трикозантин, трикокирин, бриодин, антивирусный белок из Mirabilis, белок, инактивирующий рибосомы белка ячменя (BRIP), антивирусные белки лаконоса (PAP), сапорины, люффины и момордины. Токсины типа II включают рицин и абрин. Токсины могут быть конъюгированы или подвергнуты экспрессии в виде слитого белка с любым из полипептидов, приведенных в настоящем описании.

В качестве части настоящего изобретения следует отметить, что приемлемы такие токсины, как А цепь рицина (Burbage, 1997), дифтерийный токсин А (Massuda et al., 1997; Lidor, 1997), субъединица А коклюшного токсина, субъединица А энтеротоксина E. coli, субъединица А холерного токсина и С-концевой участок токсина Pseudomonas. Было показано, что трансфекция плазмиды, содержащей регулируемый ген для цепи А дифтерийного токсина в слитом белке, обладает цитотоксичностью для раковых клеток. Другие токсины, рассматриваемые как полезные для осуществления настоящего изобретения, включают абрин, A/B термолабильные токсины, ботулинический токсин, токсины Helix pomatia, плода хлебного дерева или джекфрута, агглютинин арахиса, Sambucus nigra, Tetanus, Ulex и Viscumin.

Считается, что любой из указанный выше терапевтических агентов может быть конъюгирован с полипептидами по настоящему изобретению. В некоторых случаях предпочтительно осуществлять рекомбинантную экспрессию химерных белков, включающих токсиновые части других белков. В других случаях может быть желательно осуществить химическую конъюгацию соединений на основе малых молекул с конвертированными полипептидами интернализации, приведенными в настоящем описании.

В конкретных вариантах указанный токсин включает мутацию, которая все еще позволяет молекуле проявлять цитотоксическую активность. Указанная мутация может присутствовать в полинуклеотиде, кодирующем токсин.

B. Радиоактивные фармацевтические средства

Множество различных радиоактивных веществ, включая радиоактивные изотопы, может использоваться при раковой терапии. Примеры радиоактивных изотопов, применяемых для терапевтической цели, включают, например, астатин211, 51хром, 36хлор, 57кобальт, 58кобальт, медь67, 152европий, галлий67, йод123, йод125, йод131, индий111, 59железо, 32фосфор, рений186, рений188, 75селен, 35серу, технеций99m, иттрий90, лютеций177, самарий153, гольмий166 и актиний225.

С. Химиофармацевтические препараты

Термин «химиотерапия» относится к использованию лекарственных средств для лечения рака. Термин «химиотерапевтический агент» используется для обозначения соединений или композиций, которые вводят при лечении рака. Один из подтипов химиотерапии, известный как биохимиотерапия, включает объединение химиотерапии с биологической терапией.

Химиотерапевтические агенты включают без ограничения 5-фторурацил, блеомицин, бусульфан, камптотецин, карбоплатину, хлорамбуцил, цисплатину (CDDP), циклофосфамид, дактиномицин, даунорубицин, доксорубицин, агенты, связывающие рецептор эстрогена, этопозид (VP16), ингибитор трансферазы фарнезил-белка, гемцитабин, ифосфамид, меклоретамин, мелфалан, митомицин, навелбин, нитрозомочевину, пликомицин, прокарбазин, ралоксифен, тамоксифен, таксол, темазоломид (водная форма DTIC), трансплатину, винбластин и метотрексат, винкристин или любой аналог или производное указанных выше соединений. Приведенные агенты или лекарственные средства распределяются по категориям в зависимости от способа проявления их активности внутри клетки, например, на какую стадию клеточного цикла они оказывают воздействие. Альтернативно такого рода агент может быть охарактеризован по его способности непосредственно поперечно сшиваться с ДНК, интеркалировать в ДНК или индуцировать хромосомальные или митотические аберрации путем воздействия на синтез нуклеиновой кислоты. Большинство химиотерапевтических агентов попадает в следующие категории: алкилирующие агенты, антиметаболиты, противоопухолевые антибиотики, кортикостероидные гормоны, ингибиторы митоза и нитрозомочевины, гормональные агенты, а также другие агенты и любые аналоги, производные или варианты указанных выше агентов.

Химиотерапевтические агенты и способы их введения, дозировки и т.п. известны специалистам в данной области (см., например, Goodman & Gilman's «The Pharmacological Basis of Therapeutics» и в руководстве Ремингтона «Remington's Pharmaceutical Sciences», где указанные работы включены в настоящее описание применительно к конкретным разделам в качестве ссылки) и могут быть использованы в настоящем изобретении в свете приведенного описания. Некоторые вариации в дозировке будут необходимы в зависимости от состояния индивидуума, подлежащего лечению. Лицо, ответственное за введение, должно в любом случае определить соответствующую дозу для конкретного индивидуума. Примеры конкретных химиотерапевтических агентов и режимов дозирования также описаны в настоящем тексте. И разумеется, все указанные дозировки, агенты, приведенные в настоящем описании, являются лишь репрезентативными, а не ограничивающими, и другие дозы или агенты могут использоваться специалистами в данной области применительно к конкретному пациенту или варианту использования. Любая дозировка, лежащая между указанными точками, или любой диапазон, получаемых из них, также ожидается возможным для использования в настоящем изобретении.

1. Алкилирующие агенты

Алкилирующие агенты включают без ограничения бусульфан, хлорамбуцил, цисплатин, циклофосфомид (цитоксан), дакарбазин, ифосфамид, меклоретамин (мустарген) и мелфалан. В конкретных аспектах может использоваться троглитазон для лечения рака в сочетании с одним или несколькими указанными алкилирующими агентами, некоторые из которых обсуждаются ниже.

2. Антиметаболиты

Антиметаболиты включают без ограничения 5-фторурацид (5-FU), цитарабин (Ara-C), флударабин, гемцитабин и метотрексат. Пуриновые аналоги и родственные соединения включают без ограничения меркаптопурин (6-меркаптопурин; 6-MP), тиогуанин (6-тиогуанин; TG) и пентостатин (2-дезоксикоформицин). Меркаптопурин используют при острых лимфоцитарных, острых гранулоцитарных и хронических гранулоцитарных лейкозах. Тиогуанин используют при лечении таких видов рака, как острый гранулоцитарный лейкоз, острый лимфоцитарный лейкоз и хронический лимфоцитарный лейкоз. Пентостатин используют при таких видах рака, как лейкемический ретикулез, грибовидный микоз и хронический лимфоцитарный лейкоз. Ингибиторы митоза включают, например, доцетаксел, этопозид (VP16), тенипозид, паклитаксел, таксол, винбластин, винкристин и винорелбин. Эпиподофиллотоксины включают такие соединения, как тенипозид и VP16. Таксоиды включают без ограничения такие соединения, как доцетаксел и паклитаксел. Алкалоиды красавки включают такие соединения, как винбластин (VLB) и винкристин.

3. Противоопухолевые антибиотики

Противоопухолевые антибиотики обладают и антимикробной и цитотоксической активностью. Указанные лекарственные препараты также взаимодействуют с ДНК за счет химического ингибирования ферментов и митоза или путем изменения клеточных мембран. Указанные агенты не обладают специфичностью к конкретной фазе клеточного цикла, поскольку действуют на всех фазах клеточного цикла. Таким образом, они широко используются в случае различных видов рака. Примеры противоопухолевых антибиотиков включают без ограничения блеомицин, дактиномицин, даунорубицин, доксорубицин (адриамицин), пликамицин (митрамицин) и идарумицин. Широко используемые в клинических условиях для лечения неоплазм, указанные соединения в основном вводят внутривенной инъекцией болюсом или перорально.

4. Гормоны

Кортикостероидные гормоны рассматриваются как химиотерапевтические средства, когда они используются для уничтожения или замедления роста раковых клеток. Кортикостероидные гормоны могут повышать эффективность других химиотерапевтических агентов и в этой связи они часто используются в сочетанных видах терапии. Преднизон и дексаметазон представляют собой примеры кортикостероидных гормонов.

Прогестины, такие как капроат гироксипрогестерона, ацетат медроксипрогестерона и ацетат мегестрола, используют при раке эндометрия и молочной железы. Эстрогены, такие как диэтилстилбестрол и этинилэстрадиол, используют при таких видах рака, как рак молочной железы и рак предстательной железы. Антиэстрогены, такие как тамоксифен, используют для лечения таких видов рака, как рак молочной железы. Андрогены, такие как пропионат тестостерона и флуоксиместрон, используют при лечении рака молочной железы. Антиандрогены, такие как флутамид, используют при лечении рака предстательной железы. Аналоги гонадотропин-высвобождающего гормона, такие как леупролид, используют при лечении рака предстательной железы.

5. Другие агенты

Некоторые химиотерапевтические агенты не поддаются классификации по указанным выше категориям с точки зрения их активности. Они включают без ограничения координационные комплексы платины, антрацендион, замещенную мочевину, производные метилгидразина, супрессор адренокортикотропного гормона, амсакрин, L-аспарагиназу и третиноин.

D. Природные продукты

Природные продукты в основном относятся к соединениям, которые первоначально были выделены из природного источника и идентифицируются по своей фармакологической активности. Такие соединения, их аналоги и производные могут быть выделены из природного источника, могут быть химически синтезированы или получены рекомбинантными методиками в соответствии с известной данной области процедурой. Природные продукты включают такие группы соединения, как ингибиторы митоза, противоопухолевые антибиотики, ферменты и модификаторы биологического ответа.

Ингибиторы митоза включают растительные алкалоиды и другие природные агенты, которые могут ингибировать либо синтез белка, необходимый для клеточного деления, либо митоз. Они действуют на специфической фазе клеточного цикла. Ингибиторы митоза включают, например, доцетаксел, этопозид (VP16), тенипозид, паклитаксел, таксол, винбластин, винкристин и винорелбин.

Таксоиды представляют собой класс близко родственных соединений, выделенных из коры ясеня Taxus brevifolia. Таксоиды включают без ограничения соединения, такие как доцетаксел и паклитаксел. Паклитаксел связывается с тубулином (в сайте, удаленном от того, который используют алкалоиды винка) и ускоряет сборку микротрубочек.

Алакалоиды красавки относятся к такому типу растительных алкалоидов, которые были идентифицированы как обладающие фармацевтической активностью. Они включают такие соединения, как винбластин (VLB) и винкристин.

Е. Миметики пептидов

Другой вариант получения полипептидов по настоящему изобретению относится к использованию пептидных миметиков. Миметики представляют собой пептидсодержащие молекулы, которые имитируют элементы вторичной структуры белка (см., например, Johnson et al., «Peptide Turn Mimetics» in BIOTECHNOLOGY AND PHARMACY, Pezzuto et al., Eds., Chapman and Hall, New York (1993), где указанная работа приведена в настоящем описании в качестве ссылки). Основным принципом, лежащим в основе использования пептидных миметиков, является понимание того, что пептидный скелет белков существует просто для ориентации боковых цепей аминокислот, с тем чтобы облегчить молекулярные взаимодействия, такие как взаимодействия антитела и антигена. Пептидный миметик, как ожидается, будет позволять молекулярные взаимодействия аналогично природной молекуле. Указанные принципы могут быть использованы для получения молекул второй генерации, обладающих многими природными свойствами направленных пептидов согласно настоящему описанию, но с измененными или даже улучшенными характеристиками.

F. Антитела

В некоторых вариантах осуществления настоящего изобретения возникает потребность создать антитела против идентифицированных направленных пептидов или их рецепторов. Соответствующий направленный пептид или рецептор или их части могут быть объединены, связаны, присоединены, конъюгированы или химически связаны с одним или несколькими агентами за счет использования линкеров, полилинкеров или производных аминокислот. Указанный процесс может быть осуществлен таким образом, что создается биспецифическая или мультивалентная композиция или вакцина. Также предполагается, что способы получения указанных композиций известны специалистам в данной области и должны быть подходящими для введения человеку, то есть должны быть фармацевтически приемлемыми. Предпочтительные агенты включают носители, которые представляют собой гемоцианин из Megathura crenulata (KLH) или бычий сывороточный альбумин (БСА).

Термин «антитело» в контексте настоящего описания используется для обозначения любой антителоподобной молекулы, которая содержит антигенсвязывающий участок и включает антительные фрагменты, такие как Fab', Fab, F(ab')2, антитела с одним доменом (DAB), Fv, scFv (одноцепочечный Fv) и т.п. Методики получения и использования различных антител на основе определенных конструкций и фрагментов известны специалистам в данной области. Способы создания и характеристики антител также известны в данной области (см., например, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988; где указанная работа приведена в настоящем описании в качестве ссылки).

G. Цитокины и хемокины

В некоторых вариантах осуществления настоящего изобретения может быть желательно связать специфические биоактивные агенты с одним или несколькими направленными пептидами для мишеневой доставки в орган или ткань. Такие агенты включают без ограничения цитокины, хемокины, про-апоптозные факторы и антиангиогенные факторы. Термин «цитокин» представляет собой родовой термин, обозначающий белки, высвобождаемые одной клеточной популяции, которые действуют на другую клетку в качестве межклеточных медиаторов. Примеры таких цитокинов включают лимфокины, монокины, факторы роста и традиционные полипептидные гормоны. В группу цитокинов включаются гормоны роста, такие как гормон роста человека, N-метионильное производное гормона роста человека и бычий гормон роста; паратиреоидный гормон; тироксин; инсулин; проинсулин; релаксин; прорелаксин; гликопротеиновые гормоны, такие как фолликулостимулирующий гормон (ФСГ), тиреотропный гормон (ТСГ) и лютеинизирующий гормон (ЛГ); фактор роста печеночных клеток; простагландин; фактор роста фибробластов; пролактин; плацентарный лактоген, OB белок; фактор некроза опухоли альфа- и бета-; муллериан-ингибирующее вещество; пептид, ассоциированный с гонадотропином мыши, ингибин; активин; фактор роста эндотелия сосудов; интегрин; тромбопоэтин (TPO); факторы роста нервных клеток, такие как NGF-β; фактор роста тромбоцитов; трансформирующие ростовые факторы (TGF), такие как TGF-α и TGF-β; инсулиноподобный фактор роста -I и -II; эритропоэтин (EPO); остеоиндуктивные факторы; интерфероны, такие как интерферон -α, -β и -γ; колониестимулирующие факторы (КСФ), такие как макрофагальный КСФ (М-КСФ), гранулоцитарно-макрофагальный КСФ (ГМ-КСФ) и гранулоцитарный КСФ (Г-КСФ); интерлейкины (IL-1, IL-1.альфа, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, LIF, Г-КСФ, ГМ-КСФ, М-КСФ, EPO, набор лигандов или FLT-3, ангиостатин, тромбоспондин, эндостатин, фактор некроза опухоли и LT. В контексте настоящего описания термин «цитокины» включает белки из природных источников или из рекомбинантной клеточной культуры и биологически активные эквиваленты нативной последовательности цитокинов.

Могут использоваться цитокины, обладающие стимулирующей активностью, или такие цитокины, которые обладают ростингибирующей активностью, и в конкретных вариантах композиция по настоящему изобретению включает один из них.

Хемокины в основном действуют как хемоаттрактанты для рекрутмента эффекторных клеток в сайт экспрессии хемокинов. Может быть полезно провести экспрессию гена конкретного хемокина в сочетании, например, с геном цитокина для повышения рекрутмента других компонентов иммунной системы в сайт лечения. Хемокины включают без ограничения RANTES, MCAF, MIPI-альфа, MIPI-бета и IP-10. Для специалистов в данной области понятно, что некоторые цитокины также обладают хемоаттрактирующим эффектом и могут быть классифицированы в группу хемокинов.

Н. Регуляторы программированной гибели клеток

Апоптоз или программированная гибель клеток представляет собой процесс, обязательный для нормального эмбрионального развития, поддержания гомеостаза во взрослых тканях и подавления канцерогенеза (Kerr et al., 1972). Было показано, что представители семейства белков Bcl-2 и ICE-подобные протеазы являются важными регуляторами и эффекторами апоптоза в других системах. Bcl-2 белок, выявленный в сочетании с фолликулярной лимфомой, выполняет важную роль в контроле апоптоза и повышении выживания клеток в ответ на различные апоптозные стимулы (Bakhshi et al., 1985; Cleary and Sklar, 1985; Cleary et al., 1986; Tsujimoto et al., 1985; Tsujimoto and Croce, 1986). Эволюционно консервативный Bcl-2 белок известен в настоящее время как представитель семейства родственных белков, которые могут быть выделены в категории агонистов гибели клеток или антагонистов гибели клеток.

После открытия Bcl-2 было показано, что Bcl-2 действует в направлении супрессии гибели клеток, запущенной множеством стимулов. Кроме того, в настоящее время очевидно, что имеется семейство белков Bcl-2, регулирующих гибель клеток, которые имеют общие структурные особенности и гомологию по последовательности. Было показано, что различные представители указанного семейства обладают аналогичными функциями с Bcl-2 (например, BclXL, BclW, Bcl-S, Mcl-1, A1, Bfl-1) или противодействуют функции Bcl-2 и ускоряют гибель клеток (например, Bax, Bak, Bik, Bim, Bid, Bad, Harakiri).

Репрезентативные апоптозные агенты также включают TNF, любую каспазу, в том числе каспазу-3, каспазу-7, каспазу-6, каспазу-9 или каспазу 10a/b, например, любой гранзим, включая гранзим A или гранзим B.

Неограничивающие примеры про-апоптозных агентов, входящих в область настоящего изобретения, включают грамицидин, магаинин, меллитин, дефензин, цекропин или их сочетание или смесь.

I. Ангиогенные ингибиторы

В некоторых вариантах осуществления настоящего изобретения может возникнуть проблема с введением направленных пептидов, присоединенных к антиангиогенным агентам, таким как ангиотензин, ламининовые пептиды, фибронектиновые пептиды, ингибиторы активатора плазминогена, ингибиторы тканевой металлопротеиназы, интерфероны, интерлейкин 12, тромбоцитарный фактор 4, IP-10, Gro-β, тромбоспондин, 2-метоксиоэстрадиол, пролиферин-родственный белок, карбоксиамидотриазол, СМ101, маримастат, полисульфат пентозана, ангиопоэтин 2 (Regeneron), интерферон-альфа, гербимицин А, PNU145156E, 16К, фрагмент пролактина, линомид, талидомид, пентоксифиллин, генистеин, TNP-470, эндостатин, паклитаксел, аккутин, ангиостатин, цидофовир, винкристин, блеомицин, AGM-1470, тромбоцитарный фактор 4 или миноциклин.

J. Дозировки

Специалисты в данной области могут обратиться к руководству Ремингтона («Remington's Pharmaceutical Sciences» 15th Edition, chapter 33) и в особенности к страницам 624-652. Некоторые вариации в дозировке будут необходимы в зависимости от состояния индивидуума, подлежащего лечению. Лицо, ответственное за введение, должно в любом случае определить соответствующую дозировку для каждого отдельного пациента. Кроме того, для введения людям препараты должны удовлетворять критериям стерильности, пирогенности и общей безопасности, а также чистоты в соответствии с биологическими стандартами Федерального Агентства США по контролю за лекарственными препаратами (FDA Office of Biologics standards).

Дозы любого из указанных терапевтических агентов могут быть определены специалистом в данной области. В некоторых вариантах соответствующие дозы могут составлять от примерно 0,1 мг/кг до примерно 0,3 мг/кг или от примерно 1,5 мг/м2 до примерно 2 мг/м2. Альтернативно соответствующей дозой может быть доза, равная примерно 0,1 мг/м2, примерно 0,12 мг/м2, примерно 0,14 мг/м2, примерно 0,15 мг/м2, примерно 0,2 мг/м2, примерно 0,25 мг/м2, примерно 0,5 мг/м2, примерно 1,0 мг/м2, примерно 1,2 мг/м2, примерно 1,4 мг/м2, примерно 1,5 мг/м2, примерно 2,0 мг/м2, примерно 2,5 мг/м2, примерно 5,0 мг/м2, примерно 6 мг/м2, примерно 8 мг/м2, примерно 9 мг/м2 и примерно 10 мг/м2.

VI. Слитые белки

Другие варианты настоящего изобретения относятся к слитым белкам. Указанные молекулы в основном содержат весь или существенную часть направленного пептида, присоединенного на N- или С-конце ко второму полипептиду или белку, ко всему или к их части. Например, слияние может вовлекать лидерные последовательности из других видов для осуществления рекомбинантной экспрессии белка в гетерологичном хозяине. Другие используемые варианты слияния включают добавление иммунологически активного домена, такого как детерминанта антитела, для облегчения очистки слитого белка. Включение сайта расщепления в месте соединения сливаемых фрагментов или рядом с ним будут облегчать удаление чужеродного полипептида после очистки. Другие полезные варианты слияния включают связывание функциональных доменов, таких как активные сайты ферментов, домены гликозилирования, клеточные целевые сигналы или трансмембранные участки. В предпочтительных вариантах слитые белки по настоящему изобретению включают направленный пептид, присоединенный к терапевтическому белку или пептиду. Примеры белков или пептидов, которые могут быть включены в состав слитого белка, включают цитотоксические белки, цитоцидные белки, про-апоптозные агенты, анти-ангиогенные агенты, гормоны, цитокины, факторы роста, пептидные лекарственные препараты, антитела, Fab-фрагменты антител, антигены, белки рецептора, ферменты, лектины, белки ГКГ, белки клеточной адгезии и связывающие белки. Указанные примеры не следует рассматривать как ограничивающие и следует понимать, что в область настоящего изобретения может быть включен фактически любой белок или пептид, который можно встроить в слитый белок, включающий направленный пептид. Способы создания слитых белков известны специалистам в данной области. Такие белки могут быть получены, например, путем химического присоединения с использованием бифункциональных поперечно-сшивающих реагентов, при синтезе de novo полного слитого белка или путем присоединения последовательности ДНК, кодирующей направленный пептид, к последовательности ДНК, кодирующей второй пептид или белок, с последующей экспрессией интактного слитого белка.

VII. Синтетические пептиды

В связи со своими относительно малыми размерами направленные пептиды по настоящему изобретению могут быть синтезированы в растворе или на твердой подложке в соответствии с традиционными процедурами. В настоящее время коммерчески доступны различные автоматизированные синтезаторы, которые могут использоваться в рамках известных методик. См., например, работы Stewart and Young (1984); Tam et al. (1983); Merrifield (1986); и Barany and Merrifield (1979), каждая из которых приведена в настоящем описании в качестве ссылки. Короткие пептидные последовательности обычно размером от примерно 6 до примерно 35-50 аминокислот могут быть синтезированы в рамках таких методик. Альтернативно может быть использована технология на основе рекомбинантной ДНК, в соответствии с которой нуклеотидную последовательность, которая кодирует пептид по настоящему изобретению, встраивают в вектор экспрессии и затем трансформируют или трансфицируют в соответствующую клетку-хозяин и культивируют в условиях, подходящих для экспрессии.

VIII. Очистка белков

Поскольку некоторые варианты осуществления настоящего изобретения включают рекомбинантные белки, настоящее изобретение в некоторых своих вариантах относится к использованию методик и способов очистки белков, включающих рекомбинантные белки. В основном указанные методики включают на одном уровне грубое фракционирование клеточной среды на полипептидную и не полипептидную фракции. При отделении полипептида от других белков интересующий полипептид можно затем подвергнуть очистке с использованием методов хроматографии и электрофореза для достижения частичной или полной очистки (или очистки до гомогенности). Аналитические методы, которые особенно подходят для получения чистого пептида, представляют собой ионообменную хроматографию, вытеснительную хроматографию, электрофорез в полиакриламидном геле, изоэлектрическое фокусирование. Особенно эффективным методом очистки белков является быстрая жидкостная хроматография белков или даже ВЭЖХ. Кроме того, условия, в которых такие методы осуществляются, могут оказывать воздействие на такие характеристики, как функциональная активность очищенных молекул.

Некоторые аспекты настоящего изобретения относятся к очистке и в конкретных вариантах весьма значительной очистке кодируемого белка или пептида. Термин «очищенный белок или пептид» в контексте настоящего описания применяется для обозначения композиции, изолируемой от других компонентов, где указанный белок или пептид очищен до некоторой степени относительно того своего состоянии, в котором его получают из природного источника. В этой связи очищенный белок или пептид также обозначает белок или пептид, свободный от компонентов окружающей среды, в которой он встречается в естественном виде. Это так называемый в описании значительно очищенный белок или пептид.

В основном термин «очищенный» относится к белковой или пептидной композиции, которая была подвергнута фракционированию для целей удаления различных других компонентов, и где указанная композиция, по существу, сохраняет свою биологическую активность. В том случае, когда используется термин «значительно очищенный», это обозначение относится к композиции, в которой указанный белок или пептид составляет основной компонент данной композиции, например составляет примерно 50%, примерно 60%, примерно 70%, примерно 80%, примерно 90%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99%, примерно 99,2%, примерно 99,4%, примерно 99,6%, примерно 99,8% и примерно 99,9% или более от белков в указанной композиции.

Специалистам в данной области известны различные методики количественной оценки степени очистки белка или пептида, которые могут быть применимы для настоящего изобретения. Указанные методики включают, например, определение удельной активности активной фракции или оценку количества полипептидов в конкретной фракции при проведении анализа с использованием электрофореза в SDS/PAGE. Предпочтительным способом оценки чистоты фракции является расчет удельной активности фракции для сравнения ее с удельной активностью исходного экстракта, с последующим расчетом степени чистоты, выражаемой в тексте настоящего описания в виде параметра кратности очистки. Фактические единицы, используемые для обозначения величины активности, будут, разумеется, зависеть от конкретной выбранной для использования методики тестирования чистоты и от того, демонстрирует ли экспрессированный белок или пептид выявляемую активность.

Различные методики, подходящие для использования при очистке белка, хорошо известны специалистам в данной области. Они включают, например, осаждение сульфатом аммония, использование ПЭГ, антител и т.п. или использование тепловой денатурации с последующим центрифугированием; различные стадии хроматографирования, такие как ионообменная хроматография, гель-фильтрация, хроматография с обращением фазы, хроматография на гидроксилапатите и аффинная хроматография; изоэлектрическое фокусирование; гель-электрофорез; и сочетания указанных и других методик. Считается в соответствии с общеизвестными в данной области представлениями, что порядок проведения различных стадий очистки может быть изменен или что некоторые стадии могут быть опущены и метод все еще будет достаточно приемлемым для получения, по существу, очищенного белка или пептида.

В основном отсутствует принципиальная потребность в том, чтобы белок или пептид поставлялись всегда в своем наиболее очищенном состоянии. Фактически считается применительно к некоторым вариантам осуществления настоящего изобретения, что могут использоваться продукты, степень очистки которых меньше, чем это можно характеризовать термином «значительная». Частичная очистка может быть достигнута при использовании меньшего числа стадий при их сочетании или при использовании разных форм одной и той же общей схемы очистки. Например, общепризнано, что катионообменная колоночная хроматография, проводимая на аппарате для ВЭЖХ, будет в основном приводить к достижению большей «кратности» очистки, чем та же методика, но с использованием системы хроматографирования при низком давлении. Способы, демонстрирующие меньшую степень относительной очистки, могут иметь преимущества, определяемые полным выделением белкового продукта или сохранением активности экспрессированного белка.

Известно, что миграция полипептида может варьировать, иногда значительно, в разных условиях проведения электрофореза в SDS/PAGE (Capaldi et al., 1977). В этой связи, считается, что значения кажущегося молекулярного веса очищенных или частично очищенных продуктов экспрессии могут варьировать, если электрофорез проводят в разных условиях.

Рассматривается также использование пептидной метки в сочетании со способами и композициями по настоящему изобретению. Указанная метка имеет то преимущество, что позволяет взаимодействие между двумя полипептидами. Часть одного из полипептидов, которая вовлекается во взаимодействие, может использоваться как метка. Например, связывающий участок глютатион-S-трансферазы (GST) может выполнять функцию метки, так что шарики с глютатионом могут использоваться для обогащения соединения, содержащего GST метку. Может использоваться эпитопная метка из того участка, аминокислоты которого распознаются антителом или Т-клеткой. Указанная метка может кодироваться сегментом нуклеиновой кислоты, который функционально связан с сегментом нуклеиновой кислоты, кодирующим модифицированный белок, так что слитый белок будет кодироваться молекулой нуклеиновой кислоты. Другие подходящие слитые белки включают слияние с β-галактозидазой, убихитином, гексагистидином (6xHis) и т.п.

IX. Молекулы нуклеиновой кислоты

В одном аспекте настоящего изобретения используется молекула нуклеиновой кислоты, кодирующая конъюгированный полипептид по настоящему изобретению.

А. Полинуклеотиды, кодирующие конъюгированные полипептиды

Настоящее изобретение относится к полинуклеотидам, выделенным из клеток, которые не содержат суммарной геномной ДНК и которые способны к экспрессии всего или части белка или слитого полипептида по настоящему изобретению. Полинуклеотид может кодировать нативный белок, которым можно манипулировать, с тем чтобы достичь кодирования целевого слитого белка. Например, полинуклеотид может кодировать множественные фрагменты, такие как полипептид гелонин, который ковалентно присоединен к целевому полипептиду BLyS. В контексте настоящего описания термин «полинуклеотид» относится к молекуле нуклеиновой кислоты, которая была отделена от суммарной геномной нуклеиновой кислоты. В этой связи фраза «полинуклеотид, кодирующий полипептид» относится к сегменту ДНК, который охватывает выделяемые последовательности, кодирующие полипептид, или который очищен от суммарной геномной ДНК млекопитающего или, в частности, человека. В этой связи, например, в том случае, когда настоящая заявка относится к функции или активности гелонина, фраза «нативный полипептид гелонина» или «слитый полипептид на основе гелонина», который кодируется полинуклеотидом, означает, что полинуклеотид кодирует молекулу, которая обладает активностью гелонина.

В контексте настоящего описания термин «сегмент ДНК» относится к молекуле ДНК, которая была отделена от суммарной геномной ДНК конкретного вида. В этой связи сегмент ДНК, кодирующий полипептид, обозначает сегмент ДНК, который содержит кодирующие полипептид последовательности дикого типа, полиморфные или мутантные последовательности, уже отделенные от суммарной геномной ДНК млекопитающего или, в частности, человека или очищенные от нее. В термин «сегмент ДНК» включается один или несколько полипептидов, сегменты ДНК, которые меньше, чем полипептид, и рекомбинантные векторы, включающие, например, плазмиды, космиды, фаг, вирусы и т.п.

Термин «кДНК» используется для обозначения ДНК, полученной с использованием мессенджера РНК (мРНК) в качестве матрицы. Преимущество использования кДНК в отличие от геномной ДНК или ДНК, полимеризованной на основе геномной, непроцессированной или частично процессированной матрицы РНК, заключается в том, что кДНК преимущественно включает кодирующие последовательности для соответствующего белка. Могут быть случаи, когда предпочтительна полная или частичная геномная последовательность, например, когда для оптимальной экспрессии требуются некодирующие участки или когда некодирующие участки, такие как интроны, являются мишенью в рамках антисмысловой стратегии.

Считается также, что конкретный полипептид из данного вида может быть представлен природными вариантами, для которых имеются несколько различающиеся последовательности нуклеиновой кислоты, но, тем не менее, они кодируют один и тот же белок (см. таблицу 1).

Аналогично полинуклеотид, включающий ген для выделенного или очищенного полипептида дикого типа, полиморфного или мутантного полипептида, относится к сегменту ДНК, включающему последовательности, кодирующие полипептид дикого типа, полиморфный или мутантный полипептид и, в некоторых аспектах, также регуляторные последовательности, в существенной мере отделенные от других природных генов или кодирующих последовательностей для белков. В данном контексте термин «ген» используется для упрощения обозначения функциональной единицы, кодирующей белок, полипептид или пептид. Как очевидно специалистам в данной области, указанная функциональная единица включает геномные последовательности, последовательности кДНК и более мелкие сконструированные генные фрагменты, которые экспрессируют или могут быть адаптированы для экспрессии белков, полипептидов, доменов, пептидов, конъюгированных полипептидов и мутантов. Нуклеиновая кислота, содержащая весь или часть нативного или модифицированного полипептида, может содержать непрерывную последовательность нуклеиновой кислоты, кодирующую весь или часть полипептида указанной ниже длины: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, 1050, 1060, 1070, 1080, 1090, 1095, 1110, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 9000, 10000 или более нуклеотидов, нуклеозидов или пар оснований. Считается, что одна молекула полинуклеотида может кодировать 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 или более разных полипептидов (весь или частично).

Настоящее изобретение в конкретных вариантах осуществления относится к выделенным сегментам ДНК и рекомбинантным векторам, включающим последовательности ДНК, которые кодируют полипептид с направленным действием или слитый пептид, который включает в состав своей аминокислотной последовательности последовательность последовательных аминокислот, соответствующую или, по существу, соответствующую нативному полипептиду. Таким образом, выделенный сегмент ДНК или вектор, содержащий сегмент ДНК, может кодировать, например, слитый полипептид на основе гелонина, который обладает инактивирующей активностью в отношении рибосом и специфичностью нативного полипептида гелонина и который функционально связан с полипептидом BLyS, например, SEQ ID NO:4 или SEQ ID NO:5. Термин «рекомбинантный» может использоваться в сочетании с полипептидом или обозначением конкретного полипептида, получаемых на основе молекулы нуклеиновой кислоты, которая была использована для манипуляций in vitro или которая представляет собой продукт репликации такой молекулы.

Сегменты нуклеиновой кислоты, используемые в рамках настоящего изобретения, независимо от длины самой кодирующей последовательности могут быть объединены с другими последовательностями нуклеиновой кислоты, такими как промоторы, сигналы полиаденилирования, дополнительные сайты для ферментов рестрикции, множественные сайты клонирования и т.п., так что суммарная длина может варьировать в значительной мере. В этой связи следует полагать, что может использоваться фрагмент нуклеиновой кислоты практически любой длины, тогда как суммарная длина предпочтительно ограничивается в случае получения и использования по процедурам стратегии рекомбинантной ДНК.

Следует полагать, что конструкции нуклеиновой кислоты по настоящему изобретению могут кодировать полипептид полной длины из любого источника или могут кодировать усеченный вариант полипептида, например усеченный полипептид гелонин, так что транскрипт кодирующего участка будет представлять собой усеченную версию. Усеченный транскрипт может быть затем подвергнут трансляции с образованием усеченного белка. Альтернативно последовательность нуклеиновой кислоты может кодировать последовательность полипептида полной длины с наличием дополнительных гетерологичных кодирующих последовательностей, например, для целей облегчения очистки полипептида, транспорта, секреции, пост-трансляционной модификации или для достижения терапевтического эффекта, такого как целевое воздействие или эффективность. Как отмечалось выше, к модифицированной последовательности, кодирующей полипептид, могут быть добавлены метка или другой гетерологичный полипептид, где термин «гетерологичный» относится к полипептиду, который отличается от того полипептида, который рассматривается как модифицированный полипептид.

В неограничивающем примере одна или несколько конструкций нуклеиновой кислоты могут быть изготовлены таким образом, что они будут содержать непрерывный тяж нуклеотидов, идентичный или комплементарный конкретному гену, такому как ген токсина гелонин. Конструкция нуклеиновой кислоты может включать по меньшей мере 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 15000, 20000, 30000, 50000, 100000, 250000, 500000, 750000, по меньшей мере 1000000 нуклеотидов в длину, а также может включать конструкции более крупного размера, вплоть до размеров хромосомы, включая такие размеры (а также включая все промежуточные длины и промежуточные диапазоны), что в итоге приводит к получению таких конструкций нуклеиновой кислоты, как, например, искусственная хромосома дрожжей, известная специалистам в данной области. Следует понимать, что термины «промежуточные длины» и «промежуточные диапазоны» в контексте настоящего описания обозначают любую длину или диапазон, включающие или находящиеся между приведенными значениями (т.е. все целые числа, включающие указанные значения и находящиеся между ними).

В контексте настоящего описания термин «сегмент ДНК» относится к молекуле ДНК, которая была отделена от суммарной геномной ДНК из организма конкретного вида. В этой связи сегмент ДНК, кодирующий полипептид, относится к такому сегменту ДНК, который содержит последовательности, кодирующие полипептид дикого типа, полиморфный или мутантный полипептид, который уже отделен или очищен после его выделения от суммарной геномной ДНК млекопитающего или конкретно человека. В данном контексте термин «сегмент ДНК» используется применительно к одному или нескольким полипептидам, сегментам ДНК, меньшим, чем требуется для полипептида, а также к рекомбинантным векторам, включающим, например, плазмиды, космиды, фаг, вирусы и т.п. В контексте настоящего описания сегменты ДНК относятся к биологически функциональному эквиваленту полипептидов или пептидов, например к модифицированному функциональному эквиваленту токсина гелонин или к модифицированному функциональному эквиваленту BLyS. Такие последовательности могут возникать как результат избыточности кодонов и функциональной эквивалентности, которые, как известно, происходят в естественном состоянии в последовательностях нуклеиновых кислот и белков, которые они кодируют. Альтернативно функционально эквивалентные белки или пептиды могут быть получены в рамках рекомбинантной стратегии ДНК, в соответствии с которой могут быть введены изменения в структуру белка, с учетом свойств обмениваемых аминокислот. Изменения, запрограммированные человеком, могут быть введены по методам сайт-направленного мутагенеза, например, с целью усиления цитотоксичности белка или повышения эффективности любого протокола лечения с использованием белка.

В. Векторы

Нативные и модифицированные полипептиды могут кодироваться молекулой нуклеиновой кислоты, включенной в вектор. Термин «вектор» используется для обозначения молекулы нуклеиновой кислоты, выполняющей функцию носителя, в которую может быть встроена последовательность нуклеиновой кислоты для введения ее в клетку, где она будет реплицироваться. Последовательность нуклеиновой кислоты может быть «экзогенной», где данный термин означает, что она является чужеродной для клетки, в которую вектор вводится, или что указанная последовательность гомологична последовательности, имеющейся в клетке, но находится в том положении в нуклеиновой кислоте клетке-хозяине, где последовательность обычно не встречается. Векторы включают плазмиды, космиды, вирусы (бактериофаги, вирусы животных и вирусы растений) и искусственные хромосомы (например, YAC). Специалист со средним уровнем в данной области сможет сконструировать вектор с использованием стандартных рекомбинантных методик, которые описаны в руководстве Самбрука с соавт. и Аусубеля с соавт. (Sambrook et al., 1989 and Ausubel et al., 1996), которые приведены в настоящм описании в качестве ссылки. Вектор, кроме того, что он будет кодировать модифицированный полипептид, такой как модифицированный гелонин, может кодировать немодифицированные полипептидные последовательности, такие как фрагмент метки или направленная молекула. Используемые векторы, которые кодируют такие слитые белки, включают pIN векторы (Inouye et al., 1985), векторы, кодирующие гистидиновый тяж, и pGEX векторы, применяемые для получения растворимых слитых белков на основе глютатион-S-трансферазы (GST), с проведением впоследствии очистки и выделения или расщепления. Направленная молекула представляет собой такую молекулу, которая направляет модифицированный полипептид на определенный орган, ткань, клетку или в другое положение в организме индивидуума.

Термин «вектор экспрессии» относится к вектору, содержащему последовательность нуклеиновой кислоты, кодирующую по меньшей мере часть генного продукта, способного к транскрипции. В некоторых случаях молекулы РНК далее транслируются с образованием белка, полипептида или пептида. В других случаях указанные последовательности не транслируются, например, при образовании антисмысловых молекул или рибозимов. Векторы экспрессии могут содержать множество разных «контрольных последовательностей», где данный термин относится к последовательностям нуклеиновой кислоты, нужным для транскрипции и, возможно, трансляции функционально связанной кодирующей последовательности в организме конкретного хозяина. Векторы и векторы экспрессии, кроме контрольных последовательностей, которые направляют транскрипцию и трансляцию, могут содержать последовательности нуклеиновой кислоты, выполняющие также другие функции, которые будут описаны ниже.

1. Промоторы и энхансеры

Термин «промотор» относится к контрольной последовательности, которая представляет собой участок последовательности нуклеиновой кислоты, где происходит инициация и контроль скорости транскрипции. Она может содержать генетические элементы, с которыми регуляторные белки и молекулы могут связываться, такие как РНК-полимеразы и другие факторы транскрипции. Фразы «функционально расположенный», «функционально связанный», «под контролем» и «под контролем транскрипции» означают, что промотор находится в правильном функциональном положении и/или ориентации относительно последовательности нуклеиновой кислоты для целей контроля инициации транскрипции и/или экспрессии данной последовательности. Промотор может использоваться в сочетании с термином «энхансер», но может и не использоваться в сочетании с указанным термином, где данный термин относится к цис-активной регуляторной последовательности, вовлекаемой в активацию транскрипции последовательности нуклеиновой кислоты.

Промотор может представлять собой промотор, естественно ассоциированный с геном или последовательностью, и может быть получен при выделении 5' некодирующих последовательностей, расположенных против направления считывания информации с кодирующего сегмента и/или экзона. Такой промотор может рассматриваться как «эндогенный». Аналогично энхансер может представлять собой такой энхансер, который в природном состоянии ассоциирован с последовательностью нуклеиновой кислоты, расположенной либо в направлении считывания информации либо против считывания информации с последовательности. Альтернативно некоторые преимущества могут определяться расположением кодирующего сегмента нуклеиновой кислоты под контролем рекомбинантного или гетерологичного промотора, который относится к промотору, в норме не ассоциированному с последовательностью нуклеиновой кислоты в ее природном окружении. Рекомбинантный или гетерологичный энхансер относится к энхансеру, который в норме не ассоциирован с последовательностью нуклеиновой кислоты в ее природном окружении. Такие промоторы или энхансеры могут включать промоторы или энхансеры из других генов, а также промоторы и энхансеры, выделенные из любой другой прокариотической, вирусной или эукариотической клетки, и промоторы или энхансеры «неприродного происхождения», то есть содержащие различные элементы или различные регуляторные участки транскрипции и/или мутации, которые изменяют экспрессию. В дополнение к получению последовательностей нуклеиновой кислоты для промоторов или энхансеров в процессе синтеза указанные последовательности могут быть получены по методам рекомбинантного клонирования и/или амплификации нуклеиновой кислоты, включая PCRTM, в сочетании с композициями, приведенными в настоящем описании (см. патенты США NoNo.4683202, 5928906, каждый из которых включен в настоящее описание в качестве ссылки). Кроме того, считается, что также могут использоваться контрольные последовательности, направляющие транскрипцию и/или экспрессию последовательностей в неядерных органеллах, таких как митохондрии, хлоропласты и т.п.

Разумеется, может быть важно использовать промотор и/или энхансер, который эффективно направляет экспрессию сегмента ДНК в данном типе клеток, органеллы и организма, выбранных для экспрессии. Специалистам в области молекулярной биологии в основном известны варианты использования промоторов, энхансеров и сочетаний клеточных типов для экспрессии белка (см., например, работу Самбрука (Sambrook et al., 1989), приведенную в настоящем описании в качестве ссылки). Используемые при этом промоторы могут быть конститутивными, тканеспецифичными, индуцибельными и/или используемыми в соответствующих условиях для направления высокого уровня экспрессии встроенного сегмента ДНК, что может быть полезно при крупномасштабной продукции рекомбинантных белков и/или пептидов. Промотор может быть гетерологичным или эндогенным.

Идентичность тканеспецифичных промоторов или элементов, а также тесты для характеристики их активности известны специалистам в данной области. Примеры такого рода участков включают ген LIMK2 человека (Nomoto et al., 1999), ген рецептора 2 соматостатина (Kraus et al., 1998), ген компонента, связывающегося с ретиноевой кислотой эпидидимуса мыши (Lareyre et al., 1999), ген человека CD4 (Zhao-Emonet et al., 1998), альфа2 мыши (XI) коллагена (Tsumaki et al, 1998), ген рецептора допамина D1A (Lee et al., 1997), ген инсулиноподобного фактора роста II (Wu et al., 1997), молекулы-1 адгезии с тромоцитарной эндотелиальной клеткой человека (Almendro et al., 1996).

Промоторы, которые могут рассматриваться в контексте использования при экспрессии конъюгированных полипептидов, таких как слитые белки по настоящему изобретению, показаны ниже в таблице 3.

ТАБЛИЦА 3
Промоторы и/или энхансеры
Промотор/энхансер Ссылки
Тяжелая цепь иммуноглобулина Banerji et al., 1983; Gilles et al., 1983; Grosscheld et al., 1985; Atchinson et al., 1986, 1987; Imler et al., 1987; Wienberger et al., 1984; Kiledjian et al., 1988; Porton et al., 1990
Легкая цепь иммуноглобулина Queen et al., 1983; Picard et al., 1984
Рецептор Т-клеток Liria et al., 1987; Winoto et al., 1989; Redondo et al., 1990
HLA DQ и/или DQ β Sullivan et al., 1987
β-интерферон Goodbourn et al., 1986; Fujita et al., 1987; Goodbourn et al., 1988
Интерлейкин-2 Greene et al., 1989
Рецептор интерлейкина-2 Greene et al., 1989; Lin et al., 1990
ГКГ класса II 5 Koch et al., 1989
ГКГ класс II HLA-Dra Sherman et al., 1989
β-актин Kawamoto et al., 1988; Ng et al., 1989
Мышечная креатинкиназа (MCK) Jaynes et al., 1988; Horlick et al., 1989; Johnson et al., 1989
Преальбумин (Транстиретин) Costa et al., 1988
Эластаза I Ornitz et al., 1987
Металлотионеин (MTII) Karin et al., 1987; Culotta et al., 1989
Коллагеназа Pinkert et al., 1987; Angel et al., 1987
Альбумин Pinkert et al., 1987; Tronche et al., 1989, 1990
α-фетопротеин Godbout et al., 1988; Campere et al., 1989
γ-глобин Bodine et al., 1987; Perez-Stable et al., 1990
β-глобин Trudel et al., 1987
c-fos Cohen et al., 1987
c-HA-ras Triesman et al., 1986; Deschamps et al., 1985
Инсулин Edlund et al., 1985
Молекула адгезии невральной клетки (NCAM) Hirsch et al., 1990
α1-антитрипсин Larimer et al., 1990
H2B (TH2B) гистон Hwang et al., 1990
Коллаген мыши и/или коллаген типа I Ripe et al., 1989
Глюкозо-регулируемые белки (GRP94 и GRP78) Chang et al., 1989
Крысиный гормон роста Latsen et al., 1986
Сывороточный амилоид человека А (SAA) Edbrooke et al., 1989
Тропонин I (TN I) Yutzey et al., 1989
Тромбоцитарный фактор роста (PDGF) Pech et al., 1989
Мышечная дистрофия Дюшена Klamut et al., 1990
SV40 Banerji et al., 1981; Moreau et al., 1981; Sleigh et al., 1985; Firak et al., 1986; Herr et al., 1986; Imbra et al., 1986; Kadesch et al., 1986; Wang et al., 1986; Ondek et al., 1987; Kuhl et al., 1987; Schaffner et al., 1988
Полиома Swartzendruber et al., 1975; Vasseur et al., 1980; Katinka et al., 1980, 1981; Tyndell et al., 1981; Dandolo et al., 1983; Villiers et al., 1984; Hen et al., 1986; Satake et al., 1988; Campbell и/или Villarreal et al., 1988
Ретровирусы Kriegler et al., 1982; Levinson et al., 1982; Kriegler et al., 1983, 1984a, b, 1988; Bosze et al., 1986; Miksicek et al., 1986; Celander et al., 1987; Thiesen et al., 1988; Celander et al., 1988; Choi et al., 1988; Reisman et al., 1989
Папилломавирус Campo et al., 1983; Lusky et al., 1983; Spandidos и/или Wilkie et al., 1983; Spalholz et al., 1985; Lusku et al., 1986; Cripe et al., 1987; Gloss et al., 1987; Hirochika et al., 1987; Stephens et al., 1987
Вирус гепатита В Bulla et al., 1986; Jameel et al., 1986; Shaul et al., 1987; Spandau et al., 1988; Vannice et al., 1988
Вирус иммунодефицита человека Muesing et al., 1987; Hauber et al., 1988; Jakobovits et al., 1988; Feng et al., 1988; Takebe et al., 1988; Rosen et al., 1988; Berkhout et al., 1989; Laspia et al., 1989; Sharp et al., 1989; Braddock et al., 1989
Цитомегаловирус (CMV) Weber et al., 1984; Boshart et al., 1985; Foecking et al., 1986
Вирус обезьяньего лейкоза гиббона Holbrook et al., 1987; Quinn et al., 1989

2. Сигналы инициации и внутренние сайты связывания рибосом

Для эффективной трансляции кодирующих последовательностей может также потребоваться специфический сигнал инициации. Указанные сигналы включают кодон инициации ATG или соседние последовательности. Могут потребоваться экзогенные сигналы контроля трансляции, включающие кодон инициации ATG. Специалист в данной области способен определить такую потребность и обеспечить наличие необходимых сигналов. Также хорошо известно, что кодон инициации должен быть «внутри рамки считывания», так чтобы рамка считывания желательной кодирующей последовательности гарантировала трансляцию всей вставки. Экзогенные сигналы контроля трансляции и кодоны инициации могут быть либо природного происхождения либо синтетическими. Эффективность экспрессии может быть повышена за счет включения соответствующих энхансерных элементов транскрипции.

В некоторых вариантах осуществления настоящего изобретения могут использоваться элементы, включающие внутренние сайты входа рибосомы (IRES), для создания мультигенных или полицистронных мессенджеров. IRES элементы способны обходить зависимую от 5' метилированного Cap трансляцию в рамках липосомальной модели трансляции и начинать трансляцию на внутренних сайтах (Pelletier and Sonenberg), 1988). Были описаны IRES элементы из двух представителей семейства пикорнавирусов (полиовирус и вирус энцефаломиокардита) (Pelletier and Sonenberg, 1988), а также элементы IRES из мессенджера млекопитающего (Macejak and Sarnow, 1991). IRES элементы могут быть связаны с гетерологичными открытыми рамками считывания. Множественные открытые рамки считывания могут транскрибироваться вместе, каждая из которых разделена IRES, создавая полицистронные мессенджеры. За счет IRES элемента каждая открытая рамка считывания становится доступной для рибосом с целью эффективной трансляции. Множество генов может эффективно экспрессироваться с использованием одного промотора/энхансера для транскрипции одного мессенджера (см. патенты США No. 5 925 565 и 5 935 819, каждый из которых приведен в настоящем описании в качестве ссылки).

3. Множественные сайты клонирования

Векторы могут включать множественный сайт клонирования (MCS), который представляет собой участок нуклеиновой кислоты, содержащий сайты для множества ферментов рестрикции, каждый из которых может использоваться в рамках стандартной рекомбинантной технологии для расщепления вектора (см. Carbonelli et al., 1999, Levenson et al., 1998 и Cocea, 1997, где указанные работы приведены в настоящем описании в качестве ссылки). Фраза «расщепление рестрикционным ферментом» относится к каталитическому расщеплению молекулы нуклеиновой кислоты ферментом, который функционирует только в определенных положениях в молекуле нуклеиновой кислоты. Множество рестрикционных ферментов в настоящее время коммерчески доступно. Использование таких ферментов широко известно специалистам в данной области. Зачастую вектор подвергают линеаризации или фрагментируют с использованием ферментов рестрикции, которые разрезают участок в пределах MCS, позволяя тем самым экзогенным последовательностям лигировать с вектором. Термин «лигирование» относится к процессу формирования фосфодиэфирных связей между двумя фрагментами нуклеиновой кислоты, который могут соприкасаться друг с другом, но могут и не соприкасаться. Методики, относящиеся к использованию ферментов рестрикции и реакций лигирования, известны специалистам в области рекомбинантной технологии.

4. Сайты сплайсинга

Большая часть транскрибированных молекул эукариотической РНК подвергается РНК-сплайсингу для удаления интронов от первичных транскриптов. В случае векторов, содержащих геномные эукариотические последовательности, может потребоваться наличие донорных и/или акцепторных сайтов сплайсинга для гарантии соответствующего процессинга транскрипта с целью экспрессии белка (см. Chandler et al., 1997, где указанная работа приведена в настоящем описании в качестве ссылки).

5. Терминирующие сигналы

Векторы или конструкции по настоящему изобретению в основном включают по меньшей мере один терминирующий сигнал. Термин «терминирующий сигнал» или «терминатор» включает последовательности ДНК, вовлекаемые в специфическую терминацию РНК транскрипта под действием РНК-полимеразы. Таким образом, в некоторых вариантах осуществления настоящего изобретения рассматривается терминирующий сигнал, который завершает продукцию РНК-транскрипта. Терминатор может быть необходим in vivo для достижения желательных уровней мессенджера.

В эукариотических системах участок терминатора может также включать специфические последовательности ДНК, которые позволяют осуществлять сайт-специфическое расщепление нового транскрипта, с тем чтобы открыть для взаимодействия сайт полиаденилирования. Это дает сигнал специализированной эндогенной полимеразе добавлять тяж длиной примерно 200 А остатков (полиА) к 3'-концу транскрипта. Молекулы РНК, модифицированные полиА-фрагментом, по всей видимости, более стабильны и транслируются более эффективно. Таким образом, в других вариантах, относящихся к эукариотам, предпочтительно, чтобы терминатор включал сигнал для расщепления РНК, и еще более предпочтительно, чтобы терминирующий сигнал ускорял полиаденилирование мессенджера. Терминатор и/или сайт полиаденилирования могут выполнять функции элементов, действующих в направлении повышения уровней мессенджера и/или минимизации считывания с одной кассеты в другие последовательности.

Терминаторы, рассматриваемые для использования в контексте настоящего изобретения, относятся к любому известному терминатору транскрипции из числа приведенных в настоящем описании или известных специалистам в данной области, включающему, например, без ограничения последовательности терминации генов, такие как, например, терминатор бычьего гормона роста или вирусные терминирующие последовательности, такие как, например, терминатор SV40. В некоторых вариантах осуществления настоящего изобретения терминирующий сигнал утратил транскрибируемую или транслируемую последовательность, например, в результате усечения последовательности.

6. Сигналы полиаденилирования

В экспрессию, особенно в эукариотическую экспрессию обычно вовлекается сигнал полиаденилирования для осуществления соответствующего полиаденилирования транскрипта. Природа сигнала полиаденилирования не рассматривается как решающая для успешного осуществления настоящего изобретения и/или может использоваться любая такая последовательность. Предпочтительные варианты включают сигнал полиаденилирования SV40 и/или сигнал полиаденилирования бычьего гормона роста, удобные для работы и/или в отношении которых известно, что они хорошо функционируют в различных клетках-мишенях. Полиаденилирование может повышать стабильность транскрипта или может облегчать цитоплазматический транспорт.

7. Ориджины репликации

Вектор для размножения в клетке-хозяине может содержать один или несколько сайтов ориджинов репликации (часто называемых сокращенно «ори»), которые представляют собой специфическую последовательность нуклеиновой кислоты, где инициируется репликация. Альтернативно может использоваться автономно реплицирующаяся последовательность (ARS), если клетка-хозяин представляет собой клетку дрожжей.

8. Маркеры, подходящие для селектируемого скрининга

В некоторых вариантах осуществления настоящего изобретения клетки, содержащие конструкцию нуклеиновой кислоты по настоящему изобретению, могут быть идентифицированы in vitro или in vivo за счет включения маркера в вектор экспрессии. Такие маркеры будут привносить в клетку идентифицируемые различными способами изменения, позволяя легко идентифицировать клетки, содержащие вектор экспрессии. В основном селектируемый маркер представляет собой такой маркер, который привносит свойство, позволяющее осуществлять селекцию. Позитивным селективным маркером является такой маркер, в присутствии которого возможен отбор по нему, тогда как негативный маркер представляет собой такой маркер, присутствие которого не позволяет проводить по нему отбор. Примером позитивного маркера является маркер лекарственной резистентности.

Обычно включение маркера селекции по лекарственному средству позволяет клонировать и идентифицировать трансформанты, например это могут быть гены, которые придают резистентность к неомицину, пуромицину, гигромицину, DHFR, GPT, зеоцину и гистидинолу, представляя собой полезные селектируемые маркеры. В настоящем изобретении кроме маркеров, влияющих на фенотип, которые позволяют осуществлять разделение трансформантов при использовании соответствующих условий, рассматривается также использование других типов маркеров, включающих подходящие для скрининга маркеры, такие как зеленый флуоресцентный белок (GFP), выявление которого основано на результатах колориметрического анализа. Альтернативно для скрининга могут использоваться ферменты, такие как тимидинкиназа вируса простого герпеса (tk) или хлорамфеникол-ацетилтрансфераза (CAT). Для специалистов в данной области понятно, как следует использовать иммунологические маркеры, причем возможно в сочетании с методиками анализа на основе флуоресцентного сортировщика (FACS анализа). Считается, что природа используемого маркера не является решающим фактором, главное, чтобы он был способен экспрессироваться одновременно с нуклеиновой кислотой, кодирующей нужный генный продукт. Специалистам в данной области известны также другие примеры селектируемых маркеров и маркеров, подходящих для скрининга.

9. Клетки-хозяева

В контексте настоящего изобретения термины «клетка», «клеточная линия» и «клеточная культура» могут использоваться взаимозаменяемо. Все указанные термины также включают их потомство, которое представляет собой одно любое потомство и все его последующие генерации. Следует понимать, что все такие генерации необязательно должны быть идентичными в связи с наличием слабых или необратимых мутаций. В контексте экспрессии последовательности гетерологичной нуклеиновой кислоты, термин «клетка-хозяин относится к прокариотической или эукариотической клетке и включает любые подлежащие трансформации организмы, которые способны реплицировать вектор и/или экспрессировать гетерологичный ген, кодируемый вектором. Клетка-хозяин может быть и была использована в качестве реципиента для векторов. Клетка-хозяин может быть «трансфицирована» или «трансформирована», где указанный термин обозначает процесс, посредством которого экзогенная нуклеиновая кислота, такая как модифицированная последовательность, кодирующая белок, переносится или вводится в клетку-хозяин. Трансформированная клетка включает первичную клетку-индивидуум и ее потомство.

Клетки-хозяева могут быть получены из прокариот или эукариот, включая дрожжевые клетки, клетки насекомых и клетки млекопитающих, в зависимости от того, какой желателен эффект: репликация вектора или экспрессия части или всей последовательности нуклеиновой кислоты, кодируемой вектором. В настоящее время доступно множество клеточных линий и культур для использования в качестве клетки-хозяина, которые могут быть получены из Американской Коллекции типовых культур (American Type Culture Collection, ATCC), представляющей собой организацию, деятельность которой направлена на поддержание живых культур и генетических материалов (www.atcc.org). Соответствующий хозяйский организм может быть определен специалистом в данной области на основе векторного скелета и с учетом желательного результата. Плазмида или космида, например, могут быть введены в прокариотическую клетку-хозяин для репликации многих векторов. Бактериальные клетки, используемые в качестве клеток-хозяев для репликации и/или экспрессии вирусов, включают DH5α, JM109 и KC8, а также множество коммерчески доступных бактериальных клеток-хозяев, таких как компетентные клетки SURE® Competent Cells и так называемые золотые клетки SOLOPACKTM Gold Cells (STRATAGEN®, La Jolla). Альтернативно в качестве клеток-хозяев для фаговых вирусов могут использоваться бактериальные клетки, такие как E coli LE392. Соответствующие клетки дрожжей включают Saccharomyces cerevisiae, Saccharomyces pombe и Pichia pastoris.

Примеры эукариотических клеток-хозяев для репликации и/или экспрессии вектора включают HeLa, NIH3T3, Jurkat 293, Cos, CHO, Saos и PC12. Специалистам в данной области известно и доступно множество клеток-хозяев разных клеточных типов и из разного типа организмов. Аналогично может использоваться вирусный вектор в сочетании либо с эукариотической либо с прокариотической клеткой-хозяином, особенно такой клеткой, которая позволяет репликацию или экспрессию вектора.

В некоторых векторах могут использоваться последовательности, которые позволяют им реплицироваться и/или экспрессироваться и в прокариотических и в эукариотических клетках. Для специалиста в данной области также известны условия, при которых следует проводить инкубацию всех указанных выше клеток-хозяев для их поддержания и для осуществления репликации вектора. Также очевидны и известны методики и условия, которые могут позволять крупномасштабную продукцию векторов, а также получение нуклеиновых кислот, кодируемых векторами, и соответствующих им полипептидов, белков или пептидов.

10. Системы экспрессии

Существуют различные системы экспрессии, которые включают по меньшей мере часть или всю описанную выше композицию. Системы прокариотического и/или эукариотического типа могут использоваться в рамках настоящего изобретения для получения последовательностей нуклеиновых кислот или соответствующих им полипептидов, белков и пептидов. Многие такие системы коммерчески доступны и широко используются.

Система на основе клеток насекомых/бакуловируса может использоваться для продукции высоких уровней белка при экспрессии сегмента гетерологичной нуклеиновой кислоты, например, как описано в патентах США No. 5 871 985 и 4 879 236, каждый из которых включен в настоящее описание в качестве ссылки, которая может быть приобретена под торговым наименованием MaxBac® 2.0 от компании Invitrogen® и под торговым наименованием BacPackTM Baculovirus Expression System от компании Clontech®.

Кроме описанных выше систем экспрессии другие примеры систем экспрессии по настоящему изобретению включают индуцибельную систему экспрессии в клетках млекопитающих STRATAGENE®'s COMPLETE CONTROLTM и систему экспрессии в клетках E. coli. pET. Другой вариант индуцибельной системы экспрессии доступен от компании INVITROGEN®, которая содержит систему T-RexTM (тетрациклин-регулируемая экспрессия), которая представляет индуцибельную систему экспрессии в клетках млекопитающих с использованием промотора CMV полной длины. Компания INVITROGEN® также предлагает систему экспрессии в клетках дрожжей, называемую Системой экспрессии в клетках Pichia methanolica, которая была разработана для достижения высокого уровня продукции рекомбинантных белков в метилотрофных дрожжах Pichia methanolica. Специалистам в данной области известно, каким образом осуществлять экспрессию вектора, такого как конструкция экспрессии, для получения последовательности нуклеиновой кислоты или соответствующего ей полипептида, белка или пептида.

11. Вирусные векторы

Известно множество способов, посредством которых векторы экспрессии могут быть встроены в клетки. В некоторых вариантах осуществления настоящего изобретения вектор экспрессии включает вирусный или генетически сконструированный вектор, полученный из вирусного генома. Первыми вирусами, использованными в качестве вирусных генных векторов, были ДНК вирусы, включающие паповавирусы (обезьяний вирус 40, вирус бычьей папилломы и вирус полиомы) (Ridgeway, 1988; Baichwal and Sugden, 1986) и аденовирусы (Ridgeway, 1988; Baichwal and Sugden, 1986). Они обладают относительно низкой емкостью для последовательностей чужеродной ДНК и характеризуются ограниченным спектром хозяйских организмов. Кроме того, их онкогенный потенциал и цитопатические эффекты в пермиссивных клетках вызывают опасения в плане их безопасности. Они могут адаптировать только до 8 кБайт чужеродного генетического материала, но могут быть легко введены во множество клеточных линий и в лабораторных животных (Nicolas and Rubenstein, 1988; Temin, 1986). Ретровирусы представляют собой группу вирусов с одноцепочечной РНК, характеризующиеся способностью превращать свою РНК в двуцепочечную ДНК в инфицированных клетках. Они также могут использоваться в качестве векторов. Другие вирусные векторы также могут использоваться в качестве конструкции экспрессии по настоящему изобретению. Могут использоваться векторы, полученные из вирусов, таких как вирус осповакцины (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al., 1988), аденоассоциированный вирус (AAV) (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat and Muzycska, 1984) и вирусы герпеса. Они характеризуются некоторыми полезными особенностями для их применения в различных клетках млекопитающих (Friedman, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al., 1988; Horwich et al., 1990).

Х. Способы лечения

Молекулы по настоящему изобретению, то есть белковые конъюгаты, рассматриваемые в контексте их терапевтического использования, представляют собой молекулы, которые сохраняют специфичность BLyS части в сочетании с цитотоксическим потенциалом токсина или терапевтического агента.

В рамках настоящего изобретения предполагается, что рассматриваемые в нем полипептиды вводятся в терапевтически эффективных количествах пациенту, при наличии такой необходимости. Термин «терапевтически эффективный» используется в данном контексте применительно к количеству соединения, требуемого для улучшения некоторого симптома, ассоциированного с заболеванием. Например, при лечении рака, соединение, которое до некоторой степени ослабляет рак или останавливает любой симптом рака, будет рассматриваться как терапевтически эффективное. Например, ослабление рака может представлять собой ингибирование ангиогенеза раковой клетки и/или ткани, ингибирование или задержка роста клеток, усиление клеточной гибели или их сочетание. Терапевтически эффективное количество соединения не рассматривается как то количество, которое требуется для излечивания заболевания, но оно предлагается для лечения заболевания.

По настоящему изобретению рассматриваются полипептиды, которые полезны для лечения В-клеточного хронического лимфоцитарного лейкоза/малой лимфоцитарной лимфомы при пролимфоцитарном лейкозе В-клеток, иммуноцитомы/лимфоплазмацитарной лимфомы (+/- макроглобулинемии Валденштрома), лимфомы клеток мантии, лимфомы В-клеток пограничной зоны в лимфоидной ткани, ассоциированной со слизистой (MALT типа), лимфомы В-клеток пограничной зоны селезенки (+/- ворсинчатые лимфоциты), лейкемического ретикулеза, диффузной лимфомы крупных В-клеток, медиастинальной (вилочковой) лимфомы крупных В-клеток, внутрисосудистой лимфомы крупных В-клеток, лимфомы Буркитта, миеломы плазматических клеток (множественной миеломы), моноклональной гаммопатии или гаммопатии неясного генеза (MGUS), индолентной миеломы, миеломы Смолдеринга, остеосклеротической миеломы (POEMS синдрома), лейкоза плазматических клеток, несекретирующей миеломы, плазмацитомы, солитарной плазмоцитомы кости, экстрамедуллярной плазмацитомы, макроглобулинемии Валденштрома, болезни, вызванной патологией тяжелой цепи (HCD), заболевания, связанного с осаждением иммуноглобулина, системной патологии легкой цепи и первичного амилоидоза.

В предпочтительных вариантах осуществления настоящего изобретения рассматриваемые в нем полипептиды используют для лечения людей.

XI. Сочетанное лечение/терапия рака

Для повышения эффективности конъюгированного полипептида по настоящему изобретению или кодирующей его конструкции экспрессии может быть желательно объединить указанные композиции с другими агентами, эффективными в плане лечения В-клеточных пролиферативных расстройств, таких как противораковые агенты. Фактически в конкретных вариантах конъюгированные полипептиды по настоящему изобретению используются в сочетании с одним или несколькими химиотерапевтическими агентами, которые придают эффективность химиотерапевтическом агенту в отношении клетки, включая чувствительную или резистентную клетку. Конъюгированные полипептиды сами по себе или в сочетании с одним или несколькими терапевтическими агентами могут вводиться индивидууму с В-клеточным пролиферативным расстройством, в дополнение к другой раковой терапии, такой как облучение, хирургическое вмешательство, генная терапия и т.п.

Термин «противораковый» применительно к агенту обозначает агент, способный отрицательно воздействовать на проявление рака у индивидуума, например, за счет уничтожения раковых клеток, включая апоптоз раковых клеток, за счет снижения скорости роста раковых клеток, снижения частоты или количества метастаз, снижения размера опухоли, ингибирования роста опухоли, снижения снабжения кровью опухолевых или раковых клеток, усиления иммунного ответа против раковых клеток или опухоли, за счет предупреждения или ингибирования прогрессии рака или повышения длительности времени выживания индивидуума с раком. В более общем случае указанные другие композиции будут предлагаться в комбинированном сочетании в количестве, эффективном для уничтожения клеток или ингибирования их пролиферации. Указанный процесс может вовлекать одновременный контакт клеток с конструкцией экспрессии и одним или несколькими агентами или одним или несколькими факторами. Это может быть достигнуто путем контакта клетки с одной композицией или фармакологическим препаратом, которые включают оба агента или путем контакта клетки с двумя разными композициями или препаратами в одно и то же время, где одна композиция включает конструкцию экспрессии, а другая включает один или несколько вторых агентов.

Резистентность опухолевой клетки к химиотерапии и лучевой терапии представляет собой основную проблему клинической онкологии. Одной из целей исследований в области лечения рака является нахождение способов повышения эффективности химио- и лучевой терапии путем объединения их с другим видом терапии. Например, ген тимидинкиназы (HS-tK) из вируса простого герпеса при доставке в опухоли мозга векторной системой на основе ретровируса успешно индуцирует чувствительность к антивирусному агенту ганцикловиру (Culver, et al., 1992). В настоящем изобретении считается, что конъюгированные полипептиды могут использоваться в сочетании с химиотерапией, лучевой терапией, генной терапией или иммунотерапевтическими методами лечения, в дополнение к использованию других про-апоптозных агентов или агентов, регулирующих клеточный цикл.

Данная терапия может предшествовать другому виду лечения или она может следовать за другим видом лечения с некоторыми интервалами времени, варьирующими от нескольких минут до недель. В тех вариантах осуществления настоящего изобретения, когда другой агент и конъюгированный полипептид доставляются в клетку по отдельности, следует в основном предусмотреть гарантии того, что не пройдет слишком большой период времени между моментами каждой из доставок, с тем чтобы агент и конструкция экспрессии могли оказывать полезный объединенный эффект на клетку. В таких случаях считается, что можно осуществлять контакт клетки с обоими видами функциональных компонентов в течение примерно 12-24 часов, более предпочтительно в течение примерно 6-12 часов. В некоторых ситуациях может быть желательно существенно увеличить длительность лечения, сохраняя, однако, промежуток от нескольких дней (2, 3, 4, 5, 6 или 7) до нескольких недель (1, 2, 3, 4, 5, 6, 7 или 8) между соответствующими введениями.

Могут использоваться различные сочетания, где терапия конъюгированным полипептидом обозначена как «А», а терапия с использованием вторичного агента, например лучевой терапии или химиотерапии, обозначена как «B»:

A/В/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B

В/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A

В/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A

Введение пациенту терапевтических конструкций экспрессии по настоящему изобретению осуществляют по основным протоколам, используемым для введения химиотерапевтических препаратов, при этом принимается во внимание токсичность, при ее наличии, данного вектора. Ожидается, что циклы лечения, при необходимости, будут повторяться. Считается, что могут быть использованы различные стандартные виды терапии, равно как и хирургическое вмешательство, в сочетании с описанной терапией гиперпролиферативных клеточных расстройств.

А. Химиотерапия

Лечение рака также включает множество сочетанных видов терапии с использованием как химических препаратов, так и курсов лечения, основанных на облучении. Сочетанная химиотерапия включает, например, использование цис-платины (CDDP), карбоплатины, прокарбазина, меклоретамина, циклофосфамида, камптотецина, ифосфамида, мелфалана, хлорамбуцила, бусульфана, нитрозомочевины, дактиномицина, даунорубицина, доксорубицина, блеомицина, пликомицина, митомицина, этопозида (VP16), тамоксифена, ралоксифена, агентов, связывающихся с рецептором эстрогена, таксола, гемцитабина, навелбина, ингибиторов фарнезил-протеинтрансферазы, трансплатины, 5-фторурацила, винкристина, винбластина и метотрексата, или любого аналога или производного варианта указанных выше агентов.

B. Лучевая терапия

Другие факторы, которые вызывают повреждение ДНК и широко используются, включают широко известные виды, такие как γ-лучи, рентгеновские лучи и/или направленная доставка радиоактивных изотопов в опухолевые клетки. Рассматриваются также другие формы факторов, повреждающих ДНК, такие как микроволны и УФ-облучение. Весьма вероятно, что указанные факторы воздействуют на большой диапазон повреждений ДНК, на предшественники ДНК, на репликацию и восстановление ДНК, а также на сборку и поддержание целостности хромосом. Диапазоны дозирования рентгеновских лучей варьируют от дневных доз до 50-200 рентген в течение длительного периода времени (3-4 недели) до однократных доз, включающих от 2000 до 6000 рентген. Диапазоны дозирования радиоактивных изотопов широко варьируют и зависят от периода полураспада изотопа, мощности и типа излучения, а также от их поглощения клетками неоплазм.

Термины «контактирующая» и «открытая для воздействия» применительно к клетки используются для описания процесса, посредством которого терапевтические конструкции и химиотерапевтический или радиотерапевтический агент доставляется в клетку-мишень или помещается в непосредственной близости от клетки-мишени. Для уничтожения клетки или стаза оба агента доставляют в клетку в таком суммарном количестве, которое эффективно для уничтожения клетки или для предупреждения ее деления.

С. Иммунотерапия

Иммунотерапевтические препараты в целом основаны на использовании иммунных эффекторных клеток и молекул, которые направляются в раковые клетки и разрушают их. Иммунный эффектор может представлять собой, например, антитело, специфичное для некоторого маркера на поверхности опухолевой клетки. Одно антитело может служить в качестве эффектора терапии или может служить для рекрутмента других клеток для достижения фактического уничтожения клеток. Антитело может быть также конъюгировано с лекарственным препаратом или токсином (химиотерапевтический препарат, радионуклид, цепь А рицина, холерный токсин, токсин коклюша и т.п.) и просто выполнять функцию направленного агента. Альтернативно эффектор может представлять собой лимфоцит, характеризующийся тем, что поверхность его молекулы взаимодействует напрямую или опосредованно с опухолевой клеткой-мишенью. Различные эффекторные клетки включают цитотоксические Т-клетки и NK-клетки.

Таким образом, иммунотерапия может использоваться в составе комбинированной терапии как ее часть, например, в сочетании с генной терапией. Ниже обсуждается основная стратегия объединенной терапии. В основном опухолевая клетка должна нести некоторый маркер, на который можно воздействовать, то есть он не присутствует на большинстве других клеток. Существует множество опухолевых маркеров и каждый их них может использоваться в контексте настоящего изобретения. Чаще всего используемые опухолевые маркеры включают карциноэмбриональный антиген, антиген, специфичный для предстательной железы, антиген, ассоциированный с опухолью мочевого тракта, фетальный антиген, тирозиназу (p97), gp68, TAG-72, HMFG, сиалильный антиген Льюиса, MucA, MucB, PLAP, рецептор эстрогена, рецептор ламинина, erb B и p155.

D. Гены

В еще одном варианте осуществления настоящего изобретения вторичная терапия представляет собой генную терапию, в рамках которой терапевтический полинуклеотид вводят до, после или одновременно с конъюгированным полипептидом по настоящему изобретению. Доставка конъюгированного полипептида в сочетании со вторым вектором, кодирующим один из указанных генных продуктов, оказывает объединенный анти-гиперпролиферативный эффект на целевые ткани. Альтернативно может использоваться один вектор, кодирующий оба гена. Настоящее изобретение относится к множеству белков, ряд из которых будет описан ниже.

1. Индукторы клеточной пролиферации

Белки, которые индуцируют клеточную пролиферацию, также можно распределить по разным категориям, в зависимости от их функции. Общей характеристикой всех указанных белков является их способность регулировать клеточную пролиферацию. Например, форма PDGF, будучи sis онкогеном, представляет собой секретируемый фактор роста. Онкогены редко возникают из генов, кодирующих факторы роста, и в настоящее время sis является единственным известным онкогенным фактором роста естественного происхождения. В одном варианте осуществления настоящего изобретения считается, что антисмысловая мРНК, направленная против конкретного индуктора клеточной пролиферации, используется для предотвращения экспрессии индуктора клеточной пролиферации.

Белки EMS, ErbA, ErbB и neu представляют собой рецепторы факторов роста. Мутации указанных рецепторов приводят к потере функции регулируемости. Например, точка мутации, затрагивающая трансмембранный домен белкового рецептора Neu, приводит к образованию антигена neu. Онкоген erbA образуется из внутриклеточного рецептора тиреоидного гормона. Считается, что модифицированный онкогенный ErbA рецептор конкурирует с эндогенным рецептором тиреоидного гормона, вызывая неконтролируемый рост.

Самый крупный класс онкогенов включает белки сигнальной трансдукции (например, Src, Abl и Ras). Белок Src представляет собой цитоплазматическую протеинтирозинкиназу, трансформация которой из протоонкогена в онкоген происходит в ряде случаев через мутации в остатке тирозина 527. Тогда как трансформация ГТФ-азного белка ras из протоонкогена в онкоген происходит в одном примере через мутацию валина в глицин по аминокислоте 12 в последовательности, снижая ГТФ-азную активность ras.

Белки Jun, Fos и Myc представляют собой такие белки, которые как факторы транскрипции оказывают непосредственный эффект на ядерные функции.

2. Ингибиторы клеточной пролиферации

Функция опухолевого супрессора онкогенов заключается в ингибировании избыточной клеточной пролиферации. Инактивация указанных генов разрушает их ингибирующую активность, приводя к нерегулируемой пролиферации. Ниже описаны опухолевые супрессоры p53, p16 и C-CAM.

Высокие уровни мутанта p53 выявлены во многих клетках трансформированными химическими канцерогенами, ультрафиолетовым облучением и некоторыми вирусами. Ген p53 представляет собой достаточно частую мишень для мутационной инактивации в большом числе человеческих опухолей и, как было показано, представляет собой наиболее часто встречающийся мутированный ген во многих видах рака человека. Он мутирует более чем в 50% случаев NSCLC у человека (Hollstein et al,. 1991) и в широком спектре других опухолей.

Ген p53 кодирует фосфопротеин, состоящий из 393 аминокислот, который может формировать комплексы с хозяйскими белками, такими как крупный T антиген и E1B. Данный белок найден в нормальных тканях и клетках, но в меньших концентрациях, чем в трансформированных клетках и опухолевой ткани.

Ген p53 дикого типа известен как важный регулятор роста в клетках различных типов. Миссенс-мутации является общими для гена p53 и обязательными для проявления трансформирующей способности онкогена. Единичное генетическое изменение, создаваемое точечными мутациями, может генерировать канцерогенный потенциал p53. Однако известно, что в отличие от других онкогенов точечная мутация в p53 происходит по меньшей мере в 30 отдельных кодонах, создавая зачастую доминантные аллели, которые несколько меняют клеточный фенотип без снижения гомозиготности. Дополнительно многие из указанных доминантных негативных аллелей, по всей видимости, характеризуются толерантностью для организма и проходят в зародышевой линии. Различные мутантные аллели, как это видно, варьируют от проявления минимальной дисфункции до сильно проникающих доминантных негативных аллелей (Weinberg, 1991).

Другим ингибитором клеточной пролиферации является p16. Основные процессы перехода между стадиями клеточного цикла у эукариотов запускаются циклин-зависимыми киназами или CDK. Одна из CDK, циклин-зависимая киназа 4 (CDK4) регулирует продвижение клеточного цикла от G1. Активность данного фермента связана с фосфорилированием Rb на поздней стадии G1. Активность CDK4 контролируется активирующей субъединицей, циклином D-типа и ингибирующей субъединицей p16INK4, которая биохимически характеризуется как белок, способный специфически связываться и ингибировать CDK4, и таким образом, может регулировать фосфорилирование Rb (Serrano et al., 1993; Serrano et al., 1995). Поскольку белок p16INK4 представляет собой ингибитор CDK4 (Serrano, 1993), делеция данного гена может повышать активность CDK4, что приводит к гиперфосфорилированию белка Rb. Известно также, что p16 регулирует функцию CDK6.

p16INK4 принадлежит к недавно описанному классу CDK-ингибирующих белков, который также включают p16B, p19, p21WAF1 и p27KIP1. Ген p16INK4 был картирован на 9p21, на хромосомном участке, который во многих типах опухоли часто делетирован. Гомозиготные делеции и мутации в гене p16INK4 часто встречаются в клеточных линиях опухоли человека. Данное наблюдение позволяет полагать, что ген 16INK4 представляет собой опухолевый ген-супрессор. Однако такую интерпретацию трудно согласовать с тем фактом, что частота изменений гена p16INK4 значительно ниже в первичных некультивированных опухолях, чем в культивируемых клеточных линиях (Caldas et al., 1994; Cheng et al., 1994; Hussussian et al., 1994; Kamb et al., 1994; Kamb et al., 1994; Mori et al., 1994; Okamoto et al., 1994; Nobori et al., 1995; Orlow et al., 1994; Arap et al., 1995). Восстановление функции p16INK4 дикого типа путем трансфекции плазмидным вектором экспрессии снижает уровень образования колоний теми же клеточными линиями рака человека (Okamoto, 1994; Arap, 1995).

Другие гены, которые могут быть использованы в соответствии с настоящим изобретением, включают Rb, APC, DCC, NF-1, NF-2, WT-1, MEN-I, MEN-II, zac1, p73, VHL, MMAC1/PTEN, DBCCR-1, FCC, rsk-3, p27, слитые гены p27/p16, слитые гены p21/p27, антитромботические гены (например, COX-1, TFPI), PGS, Dp, E2F, ras, myc, neu, raf, erb, fms, trk, ret, gsp, hst, abl, E1A, p300, гены, вовлекаемые в ангиогенез (например, VEGF, FGF, тромбоспондин, BAI-1, GDAIF или их рецепторы) и MCC.

3. Регуляторы программированной гибели клеток

Апоптоз или программированная гибель клеток представляет собой обязательный процесс для нормального эмбрионального развития, поддержания гомеостаза во взрослых тканях и подавления канцерогенеза (Kerr et al., 1972). Было показано, что белки Bcl2 семейства и ICE-подобные протеазы являются важными регуляторами и эффекторами апоптоза в других системах. Bcl2 белки, открытые в ассоциации с фолликулярной лимфомой, играют важную роль в контроле апоптоза и повышении выживаемости клеток в ответ на различные апоптозные стимулы (Bakhshi et al., 1985; Cleary and Sklar, 1985; Cleary et al., 1986; Tsujimoto et al., 1985; Tsujimoto and Croce, 1986). В настоящее время эволюционно консервативный белок Bcl2 рассматривается как представитель семейства родственных белков, которые могут быть классифицированы как агонисты гибели или антагонисты гибели клеток.

После открытия Bcl2 было показано, что указанный белок действует в направлении супрессии гибели клеток, запускаемой множеством стимулов. Кроме того, в настоящее время очевидно, что имеется целое семейство белков Bcl2, регуляторов гибели клеток, которые имеют общие структурные особенности и характеризуются гомологией по последовательности. Было показано, что различные представители данного семейства либо обладают функциями, близкими к Bcl2 (например, BclXL, BclW, BclS, Mcl-1, A1, Bfl-1), либо препятствуют функции Bcl2 и способствуют гибели клеток (например, Bax, Bak, Bik, Bim, Bid, Bad, Harakiri).

Е. Хирургия

Примерно 60% лиц с раком подвергаются разного типа хирургическому вмешательству, которое включает превентивную, диагностическую или направленную на определение стадии, излечивающую или паллиативную хирургию. Излечивающая хирургия представляет собой вид воздействия на рак, который может применяться в сочетании с другими видами терапии, такими как лечение по настоящему изобретению, химиотерапия, лучевая терапия, гормональная терапия, генная терапия, иммунотерапия и/или альтернативные виды терапии. Химерные молекулы по настоящему изобретению могут использоваться в качестве неоадъювантной хирургической стратегии, с тем чтобы снизить размер опухоли перед резекцией или может использоваться в качестве пост-адъювантной хирургической стратегии, с тем чтобы простерилизовать хирургический участок после удаления части или всей опухоли.

Излечивающая хирургия включает резекцию, при которой раковую ткань полностью или частично физически удаляют, вырезают и/или разрушают. Резекция опухоли обозначает физическое удаление по меньшей мере части опухоли. Кроме резекции опухоли лечение хирургическими методами включает лазерную хирургию, криохирургию, электрохирургию и хирургию, контролируемую под микроскопом (Mohs' хирургия). Кроме того, считается, что настоящее изобретение может использоваться в сочетании с удалением поверхностных видов рака, предраков или случайных количеств нормальных тканей.

При иссечении части или в полном объеме раковых клеток, ткани или опухоли в теле может образоваться полость. Лечение может осуществляться в рамках дополнительной противораковой терапией перфузией, непосредственной инъекцией или локальным нанесением на данную область. Такое лечение может повторяться, например, каждые 1, 2, 3, 4, 5, 6 или 7 дней или каждые 1, 2, 3, 4 или 5 недель, или каждые 1,2, 3, 4, 5, 6, 7, 8, 9, 10, 11 или 12 месяцев. Указанные виды лечения могут также проводиться с использованием различных дозировок.

F. Другие агенты

Считается, что другие агенты могут использоваться в сочетании с настоящим изобретением для повышения терапевтической эффективности лечения. Указанные дополнительные агенты включают иммуномодулирующие агенты, агенты, которые действуют в направлении положительной регуляции рецепторов клеточной поверхности и GAP сочленений, цитостатические агенты и агенты, воздействующие на дифференциацию, ингибиторы клеточной адгезии или агенты, которые повышают чувствительность гиперпролиферирующих клеток к индукторам апоптоза. Иммуномодулирующие агенты включат фактор некроза опухоли, интерферон-альфа, бета и гамма; IL-2 и другие цитокины; F42K и другие аналоги цитокинов или MIP-1, MIP-1бета, MCP-1, RANTES и другие хемокины. Считается также, что положительная регуляция рецепторов клеточной поверхности или их лигандов, таких как Fas/Fas лиганд, DR4 или DR5/TRAIL, будет потенцировать апоптоз-индуцирующие способности по настоящему изобретению за счет создания аутокринного или паракринного эффекта на гиперпролиферирующие клетки. Повышение межклеточной сигнальной функции за счет роста числа GAP сочленений будет усиливать антигиперпролиферативные эффекты в отношении соседней популяции гиперпролиферующих клеток. В других вариантах используют цитостатический агент или агент, воздействующий на дифференциацию, в сочетании с настоящим изобретением для усиления антигиперпролиферативной эффективности лечения. Ингибиторы клеточной адгезии рассматриваются как агенты, повышающие эффективность настоящего изобретения. Примеры ингибиторов клеточной адгезии включают ингибиторы очаговой киназы адгезии (FAK) и ловастатин. Кроме того, считается, что могут использоваться другие агенты, которые повышают чувствительность гиперпролиферирующей клетки к апоптозу, такие как антитело с225, в сочетании с настоящим изобретением для повышения эффективности лечения.

Гормональная терапия также может использоваться в сочетании с настоящим изобретением или в сочетании с любым другим видом лечения рака, описанного ранее. Использование гормонов может применимо при лечении некоторых видов рака, таких как рак молочной железы, предстательной железы, яичника или цервикальный рак, для снижения уровня некоторых гормонов, таких как тестостерон или эстроген, или блокирования их эффектов. Такой вид лечения часто используют в сочетании по меньшей мере с одним другим видом терапии рака как вариант лечения или с целью снижения риска развития метастаз.

XII. Фармацевтические композиции и способы введения

Настоящее изобретение относится к молекулам нуклеиновой кислоты, кодирующим слитые белки. В некоторых вариантах фармацевтические композиции вводят индивидууму. Различные аспекты настоящего изобретения относятся к ведению эффективного количества водной композиции. Такие композиции в основном растворяют или диспергируют в фармацевтически приемлемом носителе или водной среде. Дополнительно такие композиции могут быть введены в сочетании с другим видом лечения в зависимости от заболевания или состояния, подлежащего лечению. Лечение лимфомы может включать введение химиотерапевтического препарата, проведение лучевой терапии, иммунотерапии или введение гормонов.

Специалистам в данной области хорошо известно, как применять метод генной доставки в ситуациях in vivo и ex vivo. В случае вирусных векторов обычно готовят вирусный вектор, используемый для хранения. В зависимости от вида вируса и от его титра пациенту может быть доставлено 1 - 100, 10 - 50, 100 - 1000 или до 1·104, 1·105, 1·106, 1·107, 1·108, 1·109, 1·1010, 1·1011 или 1·1012 вирусных частиц. Аналогичные цифры могут быть получены экстраполяцией для липосомальных или других невирусных композиций на основе сравнения относительных эффективностей поглощения. Ниже приводится описание композиции, такой как фармацевтически приемлемая композиция.

Фраза «фармацевтически приемлемый» или «фармакологически приемлемый» относится к молекулярным единицам, которые не вызывают неблагоприятной, аллергической или другой нежелательной реакции при введении животному или человеку, что приемлемо в конкретной ситуации. В контексте настоящего описания фраза «фармацевтически приемлемый носитель» включает любой и все растворители, диспергирующие среды, среды для покрытия, бактериальные и противогрибковые агенты, изотонические агенты и агенты, задерживающие поглощение и т.п. Использование таких сред и агентов для фармацевтических активных веществ известно в данной области. За исключением тех случаев, когда какие-либо традиционные среды или агенты несовместимы с данными активными ингредиентами, рассматривается использование указанных выше компонентов в терапевтических композициях. Вспомогательные активные ингредиенты, такие как противораковые агенты, также могут быть включены в композицию.

Активные соединения по настоящему изобретению могут быть изготовлены в виде, пригодном для парентерального введения, например виде композиции для инъекции путем внутривенного, внутримышечного, интратекального, подкожного или даже внутрибрюшинного введения. Получение водной композиции, которая содержит одно или несколько соединений, повышающих экспрессию молекул ГКГ класса I, будет понятно специалистам в данной области в свете приведенного описания. В типичном случае такие композиции могут быть изготовлены в виде инъецируемых препаратов, в виде жидких растворов или суспензий; могут быть также получены твердые формы, приемлемые для использования с целью изготовления раствора или суспензии при добавлении жидкости перед инъекцией; и, кроме того, препараты могут быть также эмульгированы.

Растворы активных соединений в виде свободного основания или фармакологически приемлемых солей могут быть получены в водной форме при соответствующем объединении с поверхностно-активным веществом, таким как гидроксипропилцеллюлоза. Дисперсии могут быть приготовлены в глицерине, жидких полиэтиленгликолях и в их смесях и в маслах. В обычных условиях хранения и использования такие препараты содержат консервант для предотвращения роста микроорганизмов.

Фармацевтические формы, приемлемые для инъекции, включают стерильные водные растворы или дисперсии; композиции, включающие кунжутное масло, арахисовое масло или водный пропиленгликоль; а также стерильные порошки для приготовления стерильных растворов или дисперсий непосредственно перед инъекцией. Во всех случаях получаемая форма должна быть стерильной и должна разжижаться до такой степени, чтобы ее можно было легко инъецировать. Она должна быть стабильной в условиях производства и хранения и должна содержать консерванты, препятствующие контаминации микроорганизмами, такими как бактерии и грибы.

Активные соединения могут быть введены в состав композиции в нейтральной или в солевой форме. Фармацевтически приемлемые соли включают аддитивные соли кислоты (образуемые на основе свободных аминогрупп белка), соли, получаемые с использованием неорганических кислот, таких как, например, хлористоводородная кислота или фосфорная кислота, или таких органических кислот, как уксусная, щавелевая, винная, миндальная кислоты и т.п. Соли, образуемые с использованием свободных карбоксильных групп, могут быть получены из неорганических оснований, таких как, например, гидроксиды натрия, калия, аммония, кальция или железа, и таких органических оснований, как изопропиламин, триметиламин, гистидин, прокаин и т.п.

Носитель может также представлять собой растворитель или среду для дисперсии, содержащую, например, воду, этанол, полиол (например, глицерин, пропиленгликоль и жидкий полиэтиленгликоль и т.п.), их подходящие смеси и растительные масла. Соответствующая текучесть может поддерживаться, например, при использовании покрытия, такого как лецитин, за счет поддержания требуемого размера частиц, в случае дисперсии, или путем использования поверхностно-активных веществ. Предотвратить воздействие микроорганизмов можно за счет использования различных антибактериальных и противогрибковых агентов, например парабенов, хлорбутанола, фенола, сорбиновой кислоты, тимеросала и т.п. Во многих случаях предпочтительно включать агенты, способствующие изотоничности, например сахара или хлорид натрия. Пролонгированная абсорбция инъецируемых композиций может быть достигнута за счет использования в композициях агентов, задерживающих абсорбцию, например моностеарата алюминия и желатина.

Стерильные инъецируемые растворы получают при включении активных соединений в требуемом количестве в подходящий растворитель, в сочетании с различными другими перечисленными выше агентами, при потребности, с последующим проведением стерильного фильтрования. В основном дисперсию получают путем включения различных простерилизованных активных ингредиентов в стерильный носитель, который содержит основную диспергирующую среду и другие требуемые ингредиенты из числа перечисленных выше. В случае стерильных порошков, используемых для изготовления стерильных инъецируемых растворов, предпочтительными способами получения являются вакуумная сушка и методы сушки при замораживании, которые приводят к образованию порошка активного ингредиента, плюс дополнительный желательный ингредиент из предварительно стерильно профильтрованного раствора.

Введение терапевтических композиций по настоящему изобретению может осуществляться с помощью любого известного способа, главное, чтобы ткань-мишень была доступна при таком способе введения. В тех случаях, когда в настоящем изобретении используется вирусный вектор, основной проблемой будет достижение нужной локализации гетерогенных последовательностей, содержащихся в векторе. Способы введения включают пероральный, назальный, трансбуккальный, ректальный, вагинальный или местный способ введения. Альтернативно введение может осуществляться ортотопической, интрадермальной, подкожной, внутримышечной, внутрибрюшинной или внутривенной инъекцией. Такие композиции в норме вводятся в виде фармацевтически приемлемых композиций, которые включают физиологически приемлемые носители, буферы или другие эксципиенты. Для лечения патологии легких рассматривается аэрозольная доставка в легкие. Объем аэрозоля составляет примерно от 0,01 мл до 0,5 мл. Аналогично предпочтительным способом лечения заболевания, ассоциированного с ободочной кишкой, может быть использование клизмы. Объем содержимого клизмы составляет примерно от 1 мл до 100 мл. Прямая внутриопухолевая инъекция является предпочтительным способом, тогда как непрерывная внутриопухолевая перфузия представляет собой более конкретный вариант осуществления изобретения.

В некоторых вариантах осуществления настоящего изобретения может быть желательно обеспечить непрерывную доставку терапевтических композиций в организм индивидуума. В случае внутривенных или внутриартериальных способов введения такая доставка осуществляется с помощью капельной системы. Для местных введений применяют повторное введение. При различных стратегиях предусматривается использование композиций с задержанным высвобождением, которые обеспечивают поступление ограниченных, но постоянных количеств терапевтического агента в течение длительного периода времени. В случае внутреннего внесения может быть предпочтительна непрерывная перфузия в нужный участок, например, с использованием вирусного вектора, содержащего сегмент гетерологичной нуклеиновой кислоты. Такое введение может быть достигнуто путем послеоперативной катетеризации, в ряде случаев с последующим непрерывным введением терапевтического агента. Длительность периода перфузии определяет лечащий врач с учетом показателей конкретного пациента и соответствующей ситуации, при этом указанный период времени варьирует от примерно 1-2 часов до 2-6 часов, до примерно 6-10 часов, до примерно 10-24 часов, до примерно 1-2 дней, до примерно 1-2 недель или дольше. В основном доза терапевтической композиции, доставляемой при непрерывной перфузии, будет эквивалента дозе, вводимой путем однократной или множественной инъекции, откорректированной для периода времени, в течение которого проводят инъекцию. Однако считается, что при перфузии могут быть достигнуты более высокие дозы.

Для парентерального введения в водном растворе, например, раствор должен быть соответствующим образом забуферен, при необходимости, и жидкий разбавитель вначале делают изотоничным за счет добавления достаточного количества солевого раствора или глюкозы. Указанные конкретные водные растворы особенно приемлемы для внутривенного, внутримышечного, подкожного и внутрибрюшинного введения. В данной связи могут использоваться стерильные водные среды, что будет понятно для специалистов в данной области в свете приведенного описания. Например, одна дозировка может быть растворена в 1 мл изотонического раствора NaCl и либо добавлена к 1000 мл жидкости для подкожного введения, либо инъецирована в предполагаемый сайт инфузии (см., например, Remington's Pharmaceutical Sciences, 1990). Некоторые вариации в дозировках обязательно будут иметь место в зависимости от состояния индивидуума, подлежащего лечению. Лицо, ответственное за введение, должно будет в любом случае определить соответствующую дозу для конкретного индивидуума.

Эффективное количество терапевтической композиции определяют на основе предполагаемой цели. Термин «единичная доза» или «дозировка» относится к физически дискретным единицам, приемлемым для использования индивидуумом, где каждая единица содержит заданное количество терапевтической композиции, рассчитанной с целью продуцирования желательных ответов, в соответствии с приведенным выше обсуждением, в сочетании с данным введением, то есть с подходящим способом введения и режимом лечения. Количество, подлежащее введению как с точки зрения числа введения, так и стандартной дозы, зависит от желательного уровня достигаемой защиты.

Точные количества терапевтической композиции также определяются лечащим врачом и варьируют для каждого индивидуума. Факторы, влияющие на дозу, включают физическое и клиническое состояние пациента, способ введения, предполагаемую цель лечения (ослабление симптомов или излечивание), а также эффективность, стабильность и токсичность конкретного терапевтического вещества.

После изготовления растворы вводят способом, который должен быть совместим с композицией дозировки, и в таком количестве, которое будет терапевтически эффективным. Композиции могут без труда вводиться в широком диапазоне дозированных форм, таких как инъецируемые растворы описанного выше типа, но могут использоваться также капсулы с измененным высвобождением лекарственных агентов и т.п.

В контексте настоящего описания термин «введение in vitro» относится к манипуляции, осуществляемой на клетках, взятых из организма животных, включая, без ограничения, клетки в культуре. Термин «ведение ex vivo» относится к клеткам, которые подвергают манипуляциям in vitro и затем вводят в организм живого животного. Термин «введение in vivo» включает все манипуляции, производимые на клетках внутри животного.

В некоторых аспектах настоящего изобретения композиции могут вводиться in vitro, ex vivo и in vivo. В некоторых вариантах введения in vitro конструкция экспрессии, кодирующая модифицированный белок, может быть трансдуцирована в клетку-хозяин. Трансдуцированные клетки затем могут быть использованы для анализа in vitro или альтернативно для введения in vivo.

В патентах США NoNo.4690915 и 5199942, где оба документа включены в настоящее описание в качестве ссылки, изложены способы манипуляции ex vivo с мононуклеарными клетками крови и клетками костного мозга для использования их с терапевтической целью.

В настоящем изобретении также рассматривается введение in vivo рассматриваемых в нем композиций. Указанные примеры включают без ограничения трансдукцию в эпителий мочевого пузыря путем интравезикулярной катетеризации мочевого пузыря (Bass, 1995) и трансдукцию в клетки печени путем инфузии соответствующих трансдуцирующих композиций через портальную вену с помощью катетера (Bao, 1996). Дополнительные примеры включают непосредственную инъекцию в опухоли трансдуцирующих композиций по настоящему изобретению и либо интраназальную либо интратекальную (Dong, 1996) инстилляцию трансдуцирующих композиций для трансдукции в клетки легкого.

По настоящему изобретению введение может осуществляться внутривенно, интрадермально, внутриартериально, внутрибрюшинно, внутрь повреждения, интракраниально, внутрисуставно, внутрь предстательной железы, внутриплеврально, интратрахеально, интраназально, в стекловидное тело, интравагинально, ректально, местным способом, внутрь опухоли, внутримышечно, внутрибрюшинно, подкожно, внутривезикулярно, в слизистую, интраперикардиально, перорально, местно, локально и с использованием аэрозольного введения, инъекции, инфузии, непрерывной инфузии, локализованной перфузии зоны, окружающей клетки-мишени, непосредственно или с помощью катетера и/или лаважа.

XIII. Наборы по настоящему изобретению

Любая из приведенных в настоящем описании композиций может входить в состав набора. В рамках неограничивающего примера конъюгат BLyS и необязательно дополнительный агент могут включаться в состав набора. Таким образом, наборы включают в подходящем контейнере конъюгат BLyS и необязательно дополнительный агент по настоящему изобретению.

Наборы могут включать соответствующую аликвоту конъюгата BLyS и необязательно дополнительный агент в составе композиций по настоящему изобретению, меченые или немеченые. Компоненты набора могут быть упакованы в виде препарата в водной среде или в лиофилизированной форме. Форма контейнеров в данных наборах в основном включает по меньшей мере одну ампулу, опытную пробирку, колбу, флакон, шприц или другой контейнер, внутрь которого может быть помещен указанный компонент и предпочтительно в соответствующем отобранном количестве. В том случае, когда набор включает более одного компонента, указанный набор также в основном включает второй, третий или другой дополнительный контейнер, внутрь которого могут быть порознь введены дополнительные компоненты. Кроме того, во флакон могут быть введены различные сочетания компонентов. Наборы по настоящему изобретению также в типичном случае включают устройство для поддержания контейнера с конъюгатом BLyS, дополнительным агентом или любым другим реагентом в определенном сочетании для коммерческого применения. Такие контейнеры могут включать контейнеры для инъекций или плоские формованные контейнеры, внутрь которых помещают желательные флаконы.

Терапевтические наборы по настоящему изобретению представляют собой наборы, включающие конъюгат BLyS, которые в основном содержат в соответствующем контейнере его фармацевтически приемлемую композицию. Указанный набор может включать одно контейнерное устройство и/или может содержать несколько контейнерных устройств для каждого соединения.

В том случае, когда компоненты набора предлагаются в составе одного и/или более жидких растворов, указанный жидкий раствор представляет собой водный раствор, при этом стерильный водный раствор особенно предпочтителен. Одна или несколько композиций конъюгата BLyS могут быть изготовлены в виде композиции в составе шприца-тюбика. В этом случае контейнерное устройство может само по себе представлять шприц, пипетку и/или другой аналогичный аппарат, из которого может отбираться композиция и наноситься на пораженную область тела, инъецироваться в организм животного и/или наноситься или смешиваться с другими компонентами набора.

Кроме того, компоненты указанного набора могут предлагаться в виде одного или нескольких высушенных порошков. В том случае, когда реагенты и/или компоненты предлагаются в виде сухого порошка, указанный порошок может быть восстановлен путем добавления подходящего растворителя. В одном из вариантов может быть также предложен растворитель в составе другого контейнерного устройства. Указанные наборы могут также включать второе контейнерное устройство для содержания стерильного фармацевтически приемлемого буфера и/или другого разбавителя.

Наборы по настоящему изобретению в типичном случае также включают устройство для хранения флаконов в виде компактного ансамбля для коммерческого применения, такого как, например, флаконы для инъекции и/или пластиковые формованные контейнеры, внутри которых могут храниться нужные флаконы.

Независимо от количества и/или типа контейнеров наборы по настоящему изобретению могут также включать и/или быть упакованы вместе с инструментом, нужным для инъекции/введения и/или для помещения готовой композиции в организм животного и/или для введения внутрь организма животного. Таким инструментом может быть шприц, пипетка, пинцет и/или любой разрешенный для медицинской доставки носитель.

Таким образом, в конкретных вариантах осуществления настоящего изобретения композиция включается в фармацевтически приемлемый носитель и/или соответствующим образом отбирается для доставки индивидууму.

ПРИМЕРЫ

Приведенные ниже примеры включены для демонстрации предпочтительных вариантов осуществления настоящего изобретения. Для специалиста в данной области очевидно, что данные методики, описанные в приведенных ниже примерах, охватывают те методики, которые были выявлены заявителем как хорошо функционирующие в практике осуществления настоящего изобретения и поэтому могут рассматриваться как составляющие предпочтительные способы его практического применения. Однако для специалиста в данной области будет очевидно в свете приведенного описания, что может быть введено множество изменений в конкретные варианты, раскрытые явным образом в описании, но которые все еще позволяют достичь аналогичного или близкого результата, без отступления от принципов и области настоящего изобретения.

ПРИМЕР 1

РАЗРАБОТКА ПОЛИПЕПТИДА РЕКОМБИНАНТНЫЙ ГЕЛОНИН/BLyS

кДНК, кодирующую BLys человека и рекомбинантный гелонин, сливают вместе в рамках ПЦР по методу перекрывающегося сплайсинг-расширения (OE-PCR) (Higuchi et al., 1988) с использованием BLyS и рекомбинантной ДНК гелонин в качестве матриц. Ориентацию А (BLys-rGel) или ориентацию В (rGel-BLys) слитых белков по методу ОЕ-ПЦР с использованием полного кодирующего участка BLys и рекомбинантного гелонина в качестве матриц ДНК для амплификации отдельных генных фрагментов. Для конструирования BLys-rGel проводят амплификацию против направления считывания информации ОЕ-ПЦР фрагмента, кодирующего сайт расщепления энтерокиназой, и с использованием ферментов рестрикции KPN I проводят амплификацию от N-концевого участка гена BLys с использованием олигонуклеотидных праймеров PET BLys (5'-GGCGGAAGCGGTACCGACGACGACGACAAGGCCGTTCAGGGTCCA-3' SEQ ID NO: 12) и BLys Bac Link (5'-GCTCCCGCCTCCCCCCAGCAGTTTCAATGC-3' SEQ ID NO: 13). Амплифицируют присоединяющийся фрагмент ОЕ-ПЦР по направлению считывания информации, кодирующий G4S линкер и фермент рестрикции XHo I из рекомбинантного гена гелонина с использованием олигонуклеотидных праймеров Link RGel (5'-GGGGGAGGCGGGAGCGGCCTGGACACCGTG-3' SEQ ID NO: 14) и RGel Bac, (5'-GCTCGTGTCGACCTCGAGTCATTATTTAGGATCTTTATC-3' SEQ ID NO: 15). Фрагменты ОЕ-ПЦР против направления и по направлению считывания информации затем подвергают перегруппировке в виде слитого гена BLys-rGel полной длины, кодирующего слитый белок, за счет введения дополнительной стадии ПЦР с использованием пары олигонуклеотидных праймеров PET BLys For и RGel Bac, фланкирующих 5'- и 3'-концы (см. приведенное выше описание). Конечный фрагмент ПЦР очищают и расщеплют с использованием рестрикционных эндонуклеаз KPN I и Xho I и затем клонируют в векторе экспрессии pET-32a Novagen, в котором используется промотер T7 для контроля транскрипции встроенного слитого гена. Корректность конструкции слитого гена BLys-rGel подтверждают секвенированием ДНК перед экспрессией белка. В случае ориентации B для RGel-BLys используют описанные выше процедуры для манипуляций с ДНК с использованием олигонуклеотидных праймеров PET Gel For (5'-AGCCCAGATCTGGGTACCGACGACGACGACAAGGGCCTGGACACCGTGAGC-3' SEQ ID NO: 16); RGel Bac Link (5'-GCTCCCGCCTCCCCCTTTAGGATCTTT-3' SEQ ID NO: 17) для фрагмента против направления считывания информации и BLys For (5'-GGGGGAGGCGGGAGCGCCGTTCAGGGTCCA-3' SEQ ID NO: 18); BLys Rev, (5'-GCCGTCGACCTCGAGTCATTACAGCAGTTTCAATGC-3' SEQ ID NO: 19) для фрагмента по направлению считывания информации. Конечный фрагмент слитого гена амплифицируют за счет введения дополнительной стадии ПЦР с использованием олигонуклеотидных праймеров PET Gel For и BLys Rev. Затем конструкции трансформируют в штамм Eschrechia coli AD494(DE3)pLysS для экспрессии слитого белка.

ПРИМЕР 2

ХИМИЧЕСКАЯ КОНЪЮГАЦИЯ BLYS С РЕКОМБИНАНТНЫМ ГЕЛОНИНОМ И ОЧИСТКА ХИМИЧЕСКОГО КОНЪЮГАТА BLYS/RGEL

Получают рекомбинантный гелонин (rGel), содержащий дополнительный цистеиновый остаток для сайт-специфической конъюгации, как было описано ранее, и осуществляют конъюгирование с BLys при использовании SPDP, как было описано в литературе (Rosenblum et al., 1991; Mujoo et al., 1995; Rosenblum et al., 1996). Химический конъюгат BLys/rGel очищают с использованием системы быстрого жидкостного хроматографирования белка (Pharmacia, New York, NY), которая объединяет гель-фильтрацию (S-200) и аффинную хроматографию (Blue Sepharose). Чистоту конъюгата BLys/rGel оценивают при проведении электрофореза в SDS-PAGE и по результатам вестерн-блот-анализа.

ПРИМЕР 3

ИССЛЕДОВАНИЕ ЦИТОТОКСИЧНОСТИ

Ниже в таблице 4 суммированы результаты различных исследований цитотоксичности, проведенных с использованием слитых белков rGel/BLys.

Таблица 4
Экспрессия BLys, BAFF-R, TACI, BCMA и сравнительные значения показателя ИК590 для rGel/BLys против
клеточных линий разного типа
Клеточ-ная
линия
Тип клетки BLyS BAFF-R TACI BCMA ИК50 (нМ) Индекс
достижения
мишени
(п.н.) 313 256 196 285 rGel rGel/
BLyS
Jurkat острый Т-клеточный лейкоз + ++ - - 3000 1500 2,0
KBM-5 миелоидный лейкоз + + - - 250 70 3,6
THP-1 острый моноцитарный лейкоз + ++ - - 110 30 3,7
HL-60 острый промиелоцитарный лейкоз + ++ - - 1000 300 3,3
IM-9 множественная миелома + +++ + + 700 200 3,5
MM1.S множественная миелома + + + + 600 220 2,7
MM1.R множественная миелома + + + + 1000 280 3,6
RPMI 8226 плазмацитомная миелома + ++ + + 280 10 28
8226/LR-5 плазмацитомная миелома + ++ + + 200 110 1,8
JEKO лимфома клеток мантии + +++ + + 200 0,002 100000
SP53 лимфома клеток мантии + +++ + + 60 0,001 60000
Mino лимфома клеток мантии + +++ + + 35 0,005 7000
Granta лимфома клеток мантии + ++ + + 1500 700 2,1
BCL-1 В-лимфома мыши N.D. N.D. N.D. N.D. 150 0,0008 187500
* Индекс достижения мишени соответствует ИК50 для rGel/ИК50 для rGel/BLys.
N.D. = обозначает ситуацию, при которой определение не проводилось.

На фиг. 1 показана ориентация BLyS и rGel. На фиг. 2 показаны репрезентативные последовательности ДНК (SEQ ID NO: 9) и белка (SEQ ID NO: 8) для репрезентативного слитого токсина BLyS/rGel, и на фиг. 3 показаны репрезентативные последовательности ДНК (SEQ ID NO: 11) и белка для (SEQ ID NO: 10) репрезентативного слитого токсина rGel/BLyS. На фиг. 4 проиллюстрирована конструкция репрезентативного слитого токсина rGel/BLyS.

На фиг. 5 показана очистка слитого токсина rGel/BLyS. Как видно по результатам окрашивания кумасси красителем при анализе методом электрофореза в SDS-PAGE слитого токсина rGel/BLyS, показатель M r для rGel/BLyS составляет 45 кДа, что указывает на молярное соотношение BLyS и rGel, равное 1:1 (левая панель). Результаты вестерн-блоттинга с использованием антитела против гелонина или антитела против BLyS показывают, что слитый токсин rGel/BLyS содержит токсиновый компонент и компонент BLyS в слитом токсине (правая панель).

На фиг. 7 приведены результаты сравнения цитотоксической активности слитого токсина rGel/BLyS и BLyS/rGel против клеточной линии клеток мантии JEKO. Клетки клеточной линии мантии JEKO высевают (с плотностью 5·103/лунку) в лунки 96-луночных микротитрационных планшетов с плоским дном и добавляют rGel, rGel/BLyS или BLyS/rGel в лунки в четырехкратном повторе. Через 96 часов к каждой лунке добавляют 75 мкл XTT-меченой смеси, после чего клетки инкубируют еще в течение 4 часов. Определяют поглощение на спектрофотометре при длине волны 450 нм с использованием счетчика для ELISA.

На фиг. 8А-8М показаны кривые зависимости «доза-ответ» для слитого токсина rGel/BLyS против различных опухолевых клеточных линий: Jurkat (8A), KBM-5 (8B), THP-1 (8C), HL-60 (8D), IM-9 (8E), MM1.S (8F), MM1.R (8G), RPMI18226 (8H), 8226/LR-5 (8I), JEKO (8J), SP53 (8K), Mino (8L) и Gratna (8M). Клетки тринадцати опухолевых клеточных линий высевают (с плотностью 5·103/лунку) в лунки 96-луночных микротитрационных планшетов с плоским дном и добавляют в лунки rGel или rGel/BLyS в четырехкратном повторе. Через 96 часов к каждой лунке добавляют 75 мкл XTT-меченой смеси, после чего клетки инкубируют еще в течение 4 часов. Определяют поглощение на спектрофотометре при длине волны 450 нм с использованием счетчика для ELISA.

На фиг. 9 продемонстрирована специфичность слитого токсина rGel/BLyS против клеток в клеточной линии мантии JEKO, экспрессирующих рецепторы BLyS. Клетки клеточной линии мантии JEKO высевают (с плотностью 5·103/лунку) в лунки 96-луночных микротитрационных планшетов с плоским дном и добавляют в лунки BLyS, rGel, CTP/rGel и rGel/BLyS в четырехкратном повторе. Через 96 часов к каждой лунке добавляют 75 мкл XTT-меченой смеси, после чего клетки инкубируют еще в течение 4 часов. Определяют поглощение на спектрофотометре при длине волны 450 нм с использованием счетчика для ELISA.

На фиг. 6 продемонстрирована ингибирующая активность слитого токсина rGel/BLyS в бесклеточной системе синтеза белка. Для оценки н-гликозидной активности rGel компонента в слитом токсине rGel/BLyS указанный материал добавляют к исследуемой системе трансляции белка in vitro с использованием [3H]-лейцина для оценки его включения изолированными ретикулоцитами кролика. Сравнивают кривые ингибирования для слитого токсина rGel/BLyS и нативного rGel.

На фиг. 10 показаны кривые зависимости «доза-ответ» для слитого токсина rGel/BLyS в сравнении с клеточными линиями множественной миеломы, чувствительными к десаметазону (MM1.S) и резистентными к дексаметазону (MM1.R). Клетки клеточных линий MM1.S и MM1.R высевают (с плотностью 5·103/лунку) в лунки 96-луночных микротитрационных планшетов с плоским дном и добавляют в лунки rGel, Dex или rGel/BLyS в четырехкратном повторе. Через 96 часов к каждой лунке добавляют 75 мкл XTT-меченой смеси, после чего клетки инкубируют еще в течение 4 часов. Определяют поглощение на спектрофотометре при длине волны 450 нм с использованием счетчика для ELISA.

На фиг. 11 проиллюстрирована максимальная толерантная доза (MTD) применительно к rGel/BLyS. Для получения значения MTD для rGel/BLyS мышам Balb/C инъецируют внутривенно, в хвостовую вену, варьирующие концентрации rGel/BLyS в течение 5 последовательных дней и определяют массу тела и количество выживших мышей.

ПРИМЕР 5

КОНСТРУИРОВАНИЕ, ЭКСПРЕССИЯ И ОЧИСТКА СЛИТОГО ТОКСИНА rGel/BLyS

Авторы настоящего изобретения создали конструкцию слияния rGel/BLyS, ориентирующую rGel на N-конце с последующим фрагментом G4S пептида на присоединение к молекуле BLyS, с использованием ПЦР по методу перекрывающегося сплайсинг-расширения (Ho et ak., 1989) (фиг. 4). Конструкцию слияния затем лигируют с сайтами расщепления KpnI и XhoI в векторе pET-32a(+) и трансформируют в E. coli штамм AD494 (DE3). rGel/BLyS экспрессируют и очищают с использованием аффинной хроматографии, включающей иммобилизированный ион металла (Amersham). После энзиматического удаления фрагмента His-фрагмента размером 20 кДа очищенный rGel/BLyS мигрирует при электрофорезе в SDS-PAGE в виде мономера с расчетным молекулярным весом 5 кДа в восстановительных условиях. rGel/BLyS также характеризуется иммунореактивностью с антителами BLyS и rGel, демонстрируя таким образом присутствие в конструкции слияния обоих компонентов: токсинового и BLyS (фиг.5).

ПРИМЕР 6

БИОЛОГИЧЕСКАЯ АКТИВНОСТЬ R/GEL КОМПОНЕНТА В СЛИТОМ ТОКСИНЕ RGEL/BLYS

Биологическая активность токсина может быть существенно ослаблена при конъюгации или слиянии с другими белками. Для определения н-гликозидной активности rGel компонента в слитом токсине rGel/BlyS данный материал добавляют в систему бесклеточного синтеза белка с использованием теста на продукцию люциферазы. Сравнивают кривые ингибирования для rGel/BLyS и нативного rGel. Было показано, что расчетные показатели ИК50 для rGel/BLyS и rGel составляют 10 пМ и 61 пМ соответственно. В этой связи полученные результаты позволяют полагать, что энзиматическая активность rGel компонента в rGel/BLyS несколько выше, чем у свободного rGel (фиг. 6). Аналогичные результаты были получены для конструкции слияния VEGF121 и rGel. Гомодимер VEGF121/rGel, как было показано, обладает повышенной удельной активностью в сравнении с самим токсином rGel (Veenendaal et al., 2002). Приведенные данные показывают, что мультимеризация rGel компонента может позволить достичь совместного эффекта между объединяемыми молекулами токсина в некоторых вариантах осуществления настоящего изобретения.

ПРИМЕР 7

ЭКСПРЕССИЯ BLyS, BAFF-R, TACI и BCMA И РЕАКЦИЯ НА RGEL/BLYS

Авторы настоящего изобретения исследовали профиль экспрессии BLyS лиганда и трех его рецепторов по методу ОТ-ПЦР с использованием набора клеточных линий лейкоза, миеломы и лимфомы клеток мантии. Тринадцать клеточных линий (Jurkat, KBM-5, THP-1, HL-60, IM-9, MM1.S, MM1.R, RPMI8226, 8226/LR-5, Jeko-1, SP53, Mino и Gratna 519) экспрессируют BLyS и BAFF-R, тогда как TACI и BCMA экспрессируются только в 9 исследованных репрезентативных клеточных линиях, за исключением 4 клеточных линий лейкоза (Jurkat, KBM-5, THP-1 и HL-60).

На следующем этапе авторы исследовали, существует ли корреляция между уровнями экспрессии одного или нескольких рецепторов BLyS и чувствительностью к rGel/BLyS. С этой целью провели сравнительный анализ показателей ИК50 для rGel/BLyS против 13 репрезентативных клеточных линий, включая линии лейкоза, миеломы и лимфомы клеток мании. Для каждого типа клеток вычисляют соотношение показателей ИК50 для rGel и rGel/BLyS. Указанное соотношение (индекс достижения мишени) характеризует способность компонента BLyS в rGel/BLyS опосредовать доставку токсинового компонента в цитоплазму клетки-мишени. Как показано в таблице 4, клеточные линии Jurkat, KBM-5, THP-1, HL-60, IM-9, MM1.S, MM1.R, 8226/LR-5 и Gratna 519 демонстрируют индекс достижения мишени в диапазоне от 2 до 4, тогда как 3 MCL клеточные линии (Jeko-1, SP53 и Mino), экспрессирующие BAFF-R, TACI и BCMA, были высоко чувствительны к rGel/BLyS и демонстрировали индекс достижения мишени в диапазоне от 7000 до 100000. MCL клеточная линия JeKo-1, как было показано, является наиболее чувствительной к rGel/BLyS (индекс достижения мишени = 100000). Авторы настоящего изобретения не смогли установить непосредственную корреляцию между уровнями экспрессии одного или нескольких рецепторов BLyS и чувствительности к rGel/BLyS.

ПРИМЕР 8

СВЯЗЫВАЮЩАЯ АКТИВНОСТЬ RGEL/BLYS

Проводят сравнительный анализ активности BLyS компонента в rGel/BLyS по связыванию с клетками с использованием интактных клеточных линий JeKo-1 и HL-60. Слитый токсин rGel/BLyS демонстрирует удельную активность по связыванию с JeKo-1 с клетками, экспрессирующими все три рецептора BLyS, тогда как rGel не связывается с JeKo-1 и клетками HL-60. Интересно отметить, что rGel/BLyS не связывается с клетками HL-60, экспрессирующими только BAFF-R, по результатам оценки методом ПЦР (фиг. 12).

ПРИМЕР 9

СПЕЦИФИЧНОСТЬ RGEL/BLYS

При оценке специфичности rGel/BLyS против клеток, экспрессирующих рецептор BLyS, авторы обработали клетки JeKo-1 самим BLyS, свободным rGel, CTP/rGel (не B-клеточным направленным химическим конъюгатом) или rGel/BLyS. BLyS сам по себе способствует пролиферации клеточного роста, тогда как не B-клеточный направленный конъюгат CTP/rGel демонстрирует показатель ИК50, близкий к соответствующему показателю для свободного rGel. Тогда как rGel/BLyS демонстрирует высокую цитотоксичность для клеток JeKo-1, экспрессирующих три рецептора BLyS (фиг. 9).

Предварительная обработка с использованием BLyS демонстрирует сдвиг в кривой зависимости «доза-ответ» в клетках JeKo-1, обработанных rGel/BLyS, но не в клетках JeKo-1, обработанных rGel (фиг. 13А). Дополнительно предварительная обработка BAFF-R:Fc, TACI:Fc или BCMA:Fc блокирует цитотоксическую активность rGel/BLyS в клетках JeKo-1, но не в клетках JeKo-1, обработанных rGel и BLyS (фиг. 13В). Приведенные результаты демонстрируют тот факт, что цитотоксические эффекты rGel/BLyS, по всей видимости, опосредованы рецепторов BLyS. Кроме того, очевидно, что любой из трех рецепторов может быть эффективным при его вовлечении в клеточные цитотоксические эффекты слитого белка.

ПРИМЕР 10

ИНТЕРНАЛИЗАЦИЯ RGEL/BLYS В КЛЕТОЧНОЙ ЛИНИИ ЛИМФОМЫ КЛЕТОК МАНТИИ (MCL) JEKO-1

Интернализацию rGel/BLyS выявляют с использованием анти-rGel антитела кролика. Фрагмент rGel из rGel/BLyS выявляют в цитоплазме и ядре после 1-часовой экспозиции с rGel/BLyS, что указывает на способность слитого белка rGel/BLyS эффективно связываться с клетками по механизму связывания BLyS с рецепторами BLyS, для целей быстрой интернализации и доставки rGel токсина в цитоплазму и ядро клеток JeKo-1.

ПРИМЕР 11

ЭФФЕКТЫ RGEL/BLYS НА ПУТИ АПОПТОЗА

Для выявления, ассоциирован ли цитотоксический эффект rGel/BLyS с механизмом апоптоза, клетки JeKo-1 обрабатывают с использованием 100 пМ BLyS, 100 пМ rGel или 100 пМ rGel/BLyS. Через 96 часов клетки JeKo-1 анализируют при окрашивании по методу TUNEL для оценки апоптоза. Клетки JeKo-1, обработанные rGel/BLyS, демонстрируют в 34% случаев гибель клеток от апоптоза, тогда как обработка rGel не индуцирует апоптоз (фиг. 14А и фиг. 14В).

Известно, что белки серии каспазы представляют собой центральный медиатор процесса клеточного апоптоза. Для выявления, активируется ли каспаза-3 в клетках JeKo-1 при rGel/BLyS-индуцированной гибели клеток, авторы исследовали расщепление каспазы-3 и ее субстрата поли(АДФ)-рибозополимеразы (PARP). Обработка BLyS или rGel не оказывает эффекта на расщепление каспазы-3 и PARP, тогда как обработка rGel/BLyS приводит через 96 часов к расщеплению каспазы-3 и PARP (фиг. 14С).

ПРИМЕР 12

ЗНАЧЕНИЕ РЕЗУЛЬТАТОВ НАСТОЯЩЕГО ИЗОБРЕТЕНИЯ

BLyS представляет собой обязательный фактор роста, ускоряющий развитие периферических В-клеток, и ростстимулирующие эффекты BLyS опосредованы тремя рецепторами клеточной поверхности, обозначенными как BAFF-R, TACI и BCMA (Thompson et al., 2001; von Bulow and Bram, 1997; Laabi et al., 1992). Имеющиеся сообщения позволяют полагать, что BLyS, по всей видимости, экспрессируется по-разному в образцах B-ХЛЛ, так что может быть описано множество пациентов с врожденной резистентностью к терапевтическим агентам. В этой связи авторы изобретения выбрали BLyS как мишенивой лиганд для специфической доставки rGel токсина в опухолевые клетки, экспрессирующие один или несколько рецепторов BLyS. Авторы изобретения выбрали rGel/BLyS ориентацию, а не BLyS/rGel, для конструкции слияния, поскольку по неопубликованным данным следует, что незакрытый С-конец молекулы BLyS важен для тримеризации и распознавания рецептора. Другие исследования с использованием неактивной конструкции слияния BLyS/rGel подтвердили данное наблюдение.

Для выявления потенциальной корреляции между уровнями клеточной экспрессии рецептора BLyS и чувствительностью к rGel/BLyS авторы настоящего изобретению исследовали уровни экспрессии BLyS и трех его рецепторов и проанализировали в сравнительном аспекте показатели ИК50 для rGel/BLyS и rGel против различных клеточных линий человека, включая клеточные линии лейкоза, множественной миеломы, лимфомы клеток мантии человека и клеточных линий В-лимфомы мыши. Клетки клеточных линий В-лимфомы мыши BCL-1 демонстрируют наивысший индекс достижения мишени (187500). Канакараджи с соавт. (Kanakaraji et al., 2001) сообщили, что клетки BCL-1 содержат 4800 сайтов связывания/на клетку, тогда как клетки IM-9 содержат 3200 сайтов связывания/на клетку. Отзывчивость клеток BCL-1 на rGel/BLyS может быть также связана с общим числом рецепторов BLyS. Три клеточные линии MCL (JeKo-1, SP53 и Mino), экспрессирующие BAFF-R, TACI и BCMA, обладают высокой чувствительностью к rGel/BLyS и продемонстрируют индекс достижения мишени от 7000 до 100000, тогда как клетки клеточной линии Granta 519 демонстрируют индекс достижения мишени от 2 до 4, даже в том случае, когда клетки Granta 519 экспрессируют все три рецептора для BLyS на уровне, который примерно соответствует экспрессии на клетках JeKo-1, при оценке по методу ОТ-ПЦР. Было показано, что клетки клеточной линии JeKo-1 MCL характеризуются наивысшей чувствительностью к rGel/BLyS (индекс достижения мишени = 100000). Среди клеточных линий MCL клетки Granta 519 характеризуются самой высокой резистентностью к rGel/BLyS и самому rGel. Авторы изобретения не смогли выявить прямой корреляции между уровнем экспрессии одного или нескольких рецепторов BLyS и чувствительностью к rGel/BLyS и исследовали различные цитотоксические механизмы rGel/BLyS в указанных двух клеточных линиях MCL для идентификации механизмов, которые могут отвечать за различные цитотоксические эффекты. Авторы изобретения показали rGel/BLyS может быстро интернализоваться в наиболее чувствительной клеточной линии JeKo-1, но не Granta 519 (результаты не приведены). Данный результат указывает на то, что rGel/BLyS может интернализоваться в клетки JeKo-1 после связывания с рецепторами BLyS и доставлять rGel токсин в клеточную линию JeKo-1 MCL, экспрессирующую три рецептора BLyS.

Лимфома клеток мантии (MCL) представляет собой особый тип B-клеточной неходжкинской лимфомы, которая характеризуется совокупностью морфологических, иммунофенотипических и цитогенетических особенностей и которая экспрессирует циклин D1. Традиционная цитотоксическая терапия в этом случае неэффективна и общий прогноз достаточно неблагоприятный (Leonard, et al., 2001). MCL остается наиболее резистентной к терапии В-клеточной неходжкинской лимфомой (Weisenburger et al., 2000). Резистентность MCL к применяемому в настоящее время методу химиотерапии указывает на необходимость новых терапевтических подходов к лечению MCL. Полученные результаты указывают на то, что слитый токсин rGel/BLyS является прекрасным терапевтическим агентом, по меньшей мере для случая лимфомы клеток мантии, то есть лимфомы, которая устойчива к большей части имеющихся в настоящее время методов химиотерапии.

Множественная миелома (ММ) представляет собой B-клеточную неоплазию, которая характеризуется клональной экспансией плазматических клеток в костном мозге и которая не поддается лечению даже при введении высоких доз препаратов в рамках традиционных режимов лечения. Гринштейн с соавт. (Greenstein et al., 2003) установили три формы ММ: MM1.S (дексаметазон-чувствительные клетки), MM1RE (ранняя форма дексаметазон-резистентных клеток MM1.R) и MM1.RL (поздняя форма дексаметазон-резистентных клеток ММ1.R) для исследования этиологии MM, эффектов химиотерапевтических агентов и развития клинической резистентности. Интересно отметить, что авторы изобретения показали, что чувствительные к дексаметазону (MM1.S) и резистентные к дексаметазону (MM1.R) клеточные линии одинаково чувствительны к rGel/BLyS (показатели ИК50 равны 300 нМ для rGel/BLyS). Авторы изобретения также показали, что исходные клетки множественной миеломы, чувствительные к мелфалану RPMI8226 и резистентные к мелфалану 8226/LR-5, одинаково чувствительны к rGel (200 против 280 соответственно), но не к rGel/BLyS (10 против 110 соответственно) (таблица 4). Указанные наблюдения свидетельствуют о том, что клеточная резистенция к дексаметазону не является результатом развития перекрестной резистентности к слитому токсину rGel/BLyS, тогда как клеточная резистентность к мелфалану появляется в результате развития перекрестной резистентности к мелфалану. В настоящее время проводятся исследования сигнальной функции для выявления цитотоксического механизма rGel/BLyS у чувствительных и резистентных к лекарственному препарату клеточных линий.

Взятые вместе полученные данные указывают на то, что rGel/BLyS представляет собой хороший потенциальный агент для лечения по меньшей мере лимфомы клеток мантии, и в конкретных вариантах BLyS служит в качестве мишенивого лиганда для специфической доставки токсина к В-клеткам, экспрессирующим один или несколько рецепторов для BLyS.

ПРИМЕР 13

РЕПРЕЗЕНТАТИВНЫЕ МАТЕРИАЛЫ И МЕТОДЫ

Настоящее изобретение относится к указанным ниже репрезентативным материалам и методам, используемым для его осуществления.

Материалы

Реагенты для ПЦР, набор для выделения РНК и наборы для проведения обратной транскрипции (ОТ)-ПЦР доступны от компании Life Technologies, Inc. (Frederick, MD). Ферменты рестрикции приобретают от компании New England Biolabs (Beverly, MA). Наборы для очистки РНК и ДНК получают от компании Qiagen, Inc. (Valencia, CA). Бактериальные штаммы, pET плазмиды экспрессии в бактериях и рекомбинантную энтерокиназу (rEK) получают от компании Novagen (Madison, WI). Hi-Trap хелатирующую смолу HP и другие виды смол для хроматографии приобретают от компании Amersham Bioscience (Uppsala, Sweden). Мышиное моноклональное анти-PARP антитело (Ат), кроличье антитело против циклина D1, и козье антитело против β-актина получают от компании Santa Cruz Biotechnology (Santa Cruz, CA). Кроличье поликлональное антитело против активной каспазы-3 получают от компании BD Biosciences (San Jose, CA).

Клеточные линии и клеточная культура

Доксорубицин-чувствительная клеточная линия множественной миеломы MM1.S и такая же резистентная клеточная линия MM1.R были любезно предоставлены доктором Варша Ганди (Dr.Varsha Gandhi (M.D. Anderson Cancer Center, Houston, TX)). Резистентная к мелфалану клеточная линия плазмацитомной миеломы 8226/LR-5 была любезно предоставлена доктором Вильямом Далтоном (Dr. William Dalton (Arizona Cancer Center, Tucson)) (Philips, et al., 2003). Четыре клеточные линии лимфомы клеток мантии (MCL) (JeKo-1, SP53, Mino и Granta 519) были любезно предоставлены доктором Хешам Амин (Dr. Hesham Amin (M.D. Anderson Cancer Center, Houston, TX) (Kanakaraj et al., 2001). Клеточные линии Jurkat, KBM-5, THP-1, HL-60, IM-9, RPMI 8226, MM1.S, MM1.R и JeK-1 растят в среде RPMI 1640 (ATCC Manassas, VA) с добавкой 10% инактивированной нагреванием фетальной сыворотки теленка (ФСТ), 100 Ед/мл пенициллина и 100 мкг/мл стрептомицина. В среду RPMI 1640 добавляют 5 мкМ мелфалана (ATCC) для клеточной линии RPMI8226/LR-5. Клеточную линию Granta 519 растят в среде DMEM (Invitrogen, Grand Island, NY) с добавкой 10% инактивированной нагреванием фетальной сыворотки теленка (ФСТ), 100 Ед/мл пенициллина и 100 мкг/мл стрептомицина. Клеточные линии SP53 и Mino растят в среде RPMI 1640 (ATCC) с добавкой 20% инактивированной нагреванием фетальной сыворотки теленка (ФСТ), 100 Ед/мл пенициллина и 100 мкг/мл стрептомицина.

Конструирование слитого токсина rGel/BLyS

Выделяют РНК из клеток JeKo-1 и амплифицируют кДНК, кодирующую BlyS человека, по методу ОТ-ПЦР с использованием следующих праймеров: BLySf (5'→3'): GGAGAAGGCAACTCCAGTCAGAAC (SEQ ID NO: 22) и BLySr (5'→3'): GTCCATGTCTTTGGGGATGAATTG (SEQ ID NO: 23) (Schneider et al., 1999). Конструкцию ДНК для слитого белка rGel/BLyS создают в рамках ПЦР по методу перекрывающегося сплайсинг-расширения (OE-PCR) (Weisenburger et al., 2000) с использованием полного кодирующего участка BLyS и рекомбинантного гелонина в качестве матриц ДНК для амплификации отдельных генных фрагментов. Для конструирования конструкции ДНК, соответствующей слитому белку rGel/BLyS, амлифицируют против направления считывания информации в рамках OE-PCR фрагмент, кодирующий энтерокиназу и сайты расщепления рестрикционными ферментами Kpn I, от N-концевой части рекомбинантного гелонина с использованием олигонуклеотидных праймеров PETgelfor (5'-AGCCCAGATCTGGGTACCGACGACGACGACAAGGGCCTGGACACCGTGAGC-3'; SEQ ID NO: 16); rGelbaclink (5'-GCTCCCGCCTCCCCCTTTAGGATCTTT-3'; SEQ ID NO: 17). В рамках ОЕ-ПЦР по направлению считывании информации амплифицируют присоединяющийся фрагмент, кодирующий G4S линкер и сайт расщепления ферментом рестрикции XHo I, от гена BLyS с использованием олигонуклеотидных праймеров BLySfor, (5'-GGGGGAGGCGGGAGCGCCGTTCAGGGTCCA-3', SEQ ID NO: 18) и BLySrev, (5'-GCCGTCGACCTCGAGTCATTACAGCAGTTTCAATGC-3', SEQ ID NO: 19). Фрагменты ОЕ-ПЦР против направления и по направлению считывания информации подвергают затем перегруппировке в виде слитого гена для rGel/BLyS полной длины за счет введения дополнительной стадии ПЦР с использованием пары олигонуклеотидных праймеров PETgelfor и BLySrev, фланкирующих 5'- и 3'-концы (см. приведенное выше описание). Конечный фрагмент ПЦР очищают и расщеплют с использованием рестрикционных эндонуклеаз Kpn I и Xho I и затем клонируют в векторе экспрессии pET-32a (Novagen) с использованием промотора T7 для контроля транскрипции встроенного слитого гена. Корректность генных конструкций для слитого токсина rGel/BLyS подтверждают секвенированием ДНК и корректные конструкции слияния трансформируют в Escherichia coli штамм AD494 (DE3) для экспрессии слитого токсина.

Экспрессия и индукция rGel/BLyS в E. coli

Бактериальные колонии, трансформированные плазмидой, содержащей вставку rGel/BLyS, культивируют в бульонной среде Лурия, содержащей 400 мкг/мл ампициллина и 30 мкг/мл канамицина, при температуре 37°С в течение ночи на качалке со скоростью 235 об/мин. Затем бактериальные культуры разбавляют в соотношении 1:100 свежей средой LB, содержащей антибиотики, и растят до показателя A600 = 0,8 при температуре 37°С. После этого культуры разбавляют в соотношении 1:1 свежей средой KB плюс 400 мкг/мл ампициллина и 30 мкг/мл канамицина и индуцируют экспрессию фактора роста слитого токсина rGel/BLyS при температуре 23°С добавлением 100 мкМ идопропил-1-тио-β-D-галактопиранозида (IPTG) в течение ночи. Клетки собирают центрифугированием, ресуспендируют 40 мМ Трис-HCl (pH 8) и замораживают (-80°С).

Очистка rGel/BLyS

Замороженные бактериальные клетки оттаивают и лизируют путем физического разрушения (Bead Beater, Biospec Product, Bartlesville, OK) при температуре 4°С. Бактериальные лизаты повергают ультрацентрифугированию при 40000·g в течение 1,5 часа. Конечную концентрацию NaCl в супернатанте корректируют до 500 мМ NaCl и затем наносят на Hi-Trap хелатирующую HP смолу (Amersham), содержащую 200 мМ Ni2SO4. Колонку промывают 40 мМ Трис-HCL (pH 8) и 500 мМ NaCl, содержащего 30 мМ имидазола, и элюируют с использованием 40 мМ Трис-HCl (pH 8) и 500 мМ NaCl, содержащего 300 мМ имидазола. Фракции, содержащие rGel/BLyS, объединяют и диализуют в буфере для диализа, содержащем 20 мМ Трис-HCl (pH 7,4) и 150 мМ NaCl. Для удаления гистидиновой метки слитый токсин rGel/BLyS, содержащий гистидиновую метку, оставляют на ночь при комнатной температуре для расщепления рекомбинантной энтерокиназой (rEK, Novagen). Неспецифический белок и гистидиновую метку размером 20 кДа удаляют ионообменной хроматографией на сефарозе (Q-Sepharose Fast Flow (Amersham)) и аффинной хроматографией на Blue-Sepharose CL-6B (Amersham). Очищенные образцы rGel/BLyS стерильно фильтруют, отбирают аликвоты и хранят при температуре 4°С.

Анализ rGel/BLyS

Для оценки наличия токсинового компонента rGel и компонента BLyS в слитом токсине rGel/BLyS конечные образцы анализируют электрофорезом в 12% SDS-PAGE в восстановительных условиях. Очищенный rGel/BLyS (5 мкг) отделяют электрофорезом в SDS-PAGE (8-15%) и электрофоретически переносят на мембрану PVDF (Millipore Corporation, Bedford, MA) в течение ночи при температуре 4°С в буфере для переноса [25 мМ Трис-HCl (pH 8,3), 190 мМ глицина, 20% метанола]. Мембраны PVDF блокируют в течение 1 часа Трис-забуференным солевым раствором (TBS), содержащим 5% обезжиренного молока, и затем зондируют антителом кролика против гелонина или козьим антителом против BLyS. Используют козье антикроличье или свиное антикозье антитело, конъюгированные с пероксидазой хрена (Bio-Red Laboratories, Herciles, CA), для визуализации иммунореактивных белков в разбавлении 1:4000, с использованием выявляющего реагента ECL (Amersham Pharmacia Biotech Inc., Piscataway, NJ). BLyS или рекомбинантный гелонин используют в качестве позитивных контролей. Данные выражают в виде средней плотности белковых полос, нормализованных до β-актина. Интенсивность полос определяют количественно с помощью гистограммы.

Ингибирующая активность rGel/BLyS в бесклеточной системе белкового синтеза

Н-гликозидную ингибирующую активность рекомбинантного rGel токсина оценивают в сравнении с соответствующей активностью слитого токсина rGel/BLyS. Оценивают индуцированное токсином ингибирование белковой продукции в тесте с использованием с лизата ретикулоцитов кролика по инструкции производителя (Promega, Madison, WI), как ранее было описано (Hale, 2001).

Активность rGel/BLyS по связыванию с рецептором BLyS

Для оценки связывающей активности слитого токсина rGel/BLyS с рецептором BLyS клетки JeKo-1 и HL-60 иммобилизуют в лунках 96-луночных планшетов, покрытых слоем поли-L-лизина (Becton Dickinson Labware, Franklin Lakes, NJ), с плотностью 1·105 клеток/лунку. Планшеты обезвоживают, блокируют добавлением 3% БСА и затем инкубируют с разными концентрациями rGel/BLyS или rGel в буфере для разбавления (ФБР, 0,1% Твин 20, 0,1% БСА) в течение 2 часов при комнатной температуре. После промывки планшеты инкубируют с кроличьим поликлональным антителом против гелонина в течение 1 часа при комнатной температуре, промывают 4 раза ФБРТ (1мкг/мл в ФБР, 0,1% Твин 20, 0,1% БСА) и затем добавляют к каждой лунке по 100 мкл козьего антикроличьего IgG, конъюгированного с пероксидазой (1 мкг/мл в буфере для разбавления; Vector, Burlingame, CA). Планшеты инкубируют в течение 1 часа при комнатной температуре, промывают 4 раза с использованием ФБРТ и добавляют для окрашивания субстрат тетраметилбензидин (Sigma). Измеряют поглощение при длине волны 450 нм с использованием прибора Spentra Max 3000 (Molecular Devices, Sunnyvale, CA).

Выявление экспрессии BLyS, BAFF-R TACI и BCMA в различных клеточных линиях

Экспрессию BLyS, BAFF-R, TACI и BCMA оценивают в 13 клеточных линиях по процедуре полимеразно-цепьевой реакции с обратной транскриптазой (анализ ОТ-ПЦР). Выделяют суммарную РНК из 13 клеточных линий и используют для синтеза первой цепи кДНК, которую, в свою очередь, амплифицируют по методу ПЦР с использованием специфических праймеров, разработанных для амплификации человеческих BLyS (313 п.н.) (Schneider et al., 1999), BAFF-R (256 п.н.) (Kern et al., 2004), TACI (196 п.н.) (Phillips, et al., 2003) и BCMA (285 п.н.) (Phillips, et al., 2003). GADPH используют в качестве контроля.

Цитотоксическая активность rGel/BLyS и конкурентное ингибирование свободным BLyS или ложными рецепторами

Для сравнительной оценки показателей ИК50 rGel/BLyS против 13 клеточных линий указанные тринадцать клеточные линии высевают (с плотностью 5·103 клеток/лунку) в лунки 96-луночных планшетов с плоским дном (Becton Dickinson) и в лунки в четырехкратном повторе добавляют сам rGel или rGel/BLyS. Через 96 часов к каждой лунке добавляют по 50 мкл ХТТ-меченой смеси (Roche), после чего клетки инкубируют еще в течение ночи. Определяют поглощение на спектрофотометре при длине волны 450 нм с использованием счетчика для ELISA (Bio-Tek Instruments, Inc., Winooski, VT).

Для оценки специфичности rGel/BLyS против клеток, экспрессирующих рецептор BLyS, авторы обработали клетки JeKo-1 самим BLyS, свободным rGel, CTP/rGel (не В-клеточным направленным химическим конъюгатом), rGel/BLyS или средой, добавляемыми в лунки в четырехкратном повторе. Для анализа конкурентного ингибирования клетки JeKo-1 высевают (с плотностью 5·103 клеток/лунку) в лунки 96-луночных микротитрационных планшетов с плоским дном (Becton Dickinson) и проводят предварительную обработку с использованием 1 нМ BLyS, 50 нМ BLyS, 10 мкг/мл BAFF-R:Fc, 10 мкг/мл TACI:Fc или 10 мкг/мл BCMA:Fc в течение 2 часов и затем в лунки в четырехкратном повторе добавляют rGel/BLyS или сам rGel.

Интернализация rGel/BLyS в клеточной линии JeKo-1 лимфомы клеток мантии (MCL)

Клеточную линию JeKo-1 MCL добавляют к слайдам 16-луночной камеры, покрытым лизином (Nunc, Rochester, NY), с плотностью 1·104 клеток/лунку и обрабатывают с использованием 100 нМ rGel или 100 нМ rGel/BLyS в течение разного периода времени. Затем клетки помещают на слайды с использованием цитоцентрифуги (Shandon, Pittsburg, PA), после чего белки, связанные с клеточной поверхностью, снимают путем 10-минутной инкубации с глициновым буфером [500 мМ NaCl и 0,1 М глицин (pH 2,5)], нейтрализуют в течение 5 минут с использованием 0,5 М Трис (pH 7,4), промывают быстро ФБР и фиксируют в 3,7% формальдегиде (Sigma, St. Louis, MO) в течение 20 минут при комнатной температуре с последующей промывкой в ФБР. Затем клетки подвергают обработке в течение 10 минут для воздействия на их проницаемость с использованием ФБР, содержащего 0,2% Тритон Х-100 промывают три раза ФБР и блокируют ФБР, содержащим 3% БСА, в течение 1 часа при комнатной температуре. После быстрой промывки ФБР клетки инкубируют с кроличьим анти-rGel поликлональным антителом, разбавленным в соотношении 1:500 в ФБР, содержащем 0,1% Твин 20 и 0,2% БСА, в течение 1 часа при комнатной температуре. Клетки промывают три раза в ФБР, содержащем 0,1% Твин 20, в течение 15 минут и инкубируют с антикроличьим IgG, связанным с FITC (Sigma), в разбавлении 1:100, с добавкой 1 мкг/мл иодида пропидия (PI). После трех промывок с использованием ФБР, содержащего 0,1% Твин 20, клетки еще один раз промывают в ФБР в течение 10 минут и наносят на среду DABCO. Далее слайды анализируют с использованием лазерного сканирующего микроскопа Zeiss LSM510 (Carl Zeiss, Jena, Germany).

Выявление апоптоза

Апоптоз выявляют по методу TdT-опосредованного dUTP меченого концевого разрыва (тест TUNEL). Для оценки апоптоза клетки JeKo-1 добавляют к слайдам 16-луночной камеры, покрытым полилизином (Nunc), с плотностью 5·103 клеток/лунку и обрабатывают с использованием 100 пМ BLyS, 100 пМ rGel, 100 пм rGel/BLyS или среды в течение 4 дней. Всплывшие клетки собирают и прикрепляют к слайдам с использованием цитоцентрифуги (Shandon), сушат и фиксируют в 3,7% формальдегиде (Sigma) в течение 20 минут при комнатной температуре и затем быстро промывают в ФБР. Далее клетки подвергают обработке в течение 10 минут для воздействия на их проницаемость с использованием ФБР, содержащего 0,2% Тритон Х-100 и 0,1 % цитрата натрия, промывают три раза ФБР и блокируют ФБР, содержащим 3% БСА, в течение 1 часа при комнатной температуре. Фиксированные клетки окрашивают in situ с использованием набора для идентификации погибших клеток (Roche). После проведения конечной стадии быстрой промывки слайды вносят в соответствующую среду и анализируют под флуоресцентным микроскопом.

Вестерн-блот анализ

Для исследования эффектов rGel/BLyS на экспрессию расщепленной каспазы-3 и PARP, клетки JeKo-1 высевают с плотностью 5·105 клеток/лунку 24-луночного планшета и затем обрабатывают с использованием 100 пМ BLyS, 100 пМ rGel, 100 пМ rGel/BLyS или среды. Через 96 часов клетки промывают два раза фосфатно-буферным раствором (ФБР) или лизируют на льду в течение 20 минут в 0,3 мл буфера для лизирования (10 мМ Трис-HCl, pH 8, 60 мМ KCl, 1 мМ ЭДТА, 1 мМ ДТТ, 0,2% NP-40). Клеточные лизаты (50 мкг) отделяют электрофорезом в SDS-PAGE (8-15%) и электрофоретически переносят на PVDF мембраны (Millipore Corporation, Bedford, MA) в течение ночи при температуре 4°С в буфере для переноса [25 мМ Трис-HCl (pH 8,3), 190 мМ глицина, 20% метанола]. Мембраны PVDF блокируют в течение 1 часа Трис-забуференным солевым раствором (TBS), содержащим 5% обезжиренного молока, и затем зондируют мышиными моноклональными антителами (Ат) против PARP, кроличьими поликлональными антителами против активной каспазы-3 или козьим антителом против β-актина. Используют козье антимышиное/антикроличье антитело или свиное антикозье антитело, конъюгированные с пероксидазой хрена (Rio-Bad Laboratories, Herciles, CA), для визуализации иммунореактивных белков, в разбавления 1:4000, с использованием выявляющего реагента ECL (Amersham Pharmacia Biotech Inc., Piscataway, NJ). Данные выражают в виде относительной плотности белковых полос, нормализованных до β-актина. Интенсивность полос определяют количественно с помощью гистограммы.

ССЫЛКИ

Все патенты и публикации, цитированные в описании, являются показательными для уровня знаний, достигнутого к настоящему времени в той области, к которой относится изобретение. Все патенты и публикации включены в список цитируемой литературы в той мере, в которой каждая конкретная публикация специфически и индивидуально соответствует конкретной ссылке.

ПАТЕНТЫ И ПАТЕНТНЫЕ ЗАЯВКИ

Патент США No.5631348

Патент США No.6669938

Патент США No.RE37462

Патент США No.6750329

Патент США No.6599505

Патент США No.6214974

Патент США No.5624827

Патент США No.5053226

СПИСОК ЦИТИРОВАННОЙ ЛИТЕРАТУРЫ

Amin HM, McDonnell TJ, Medeiros J, et al. Characterization of 4 mantle cell lymphoma cell lines. Arch Pathol Lab Med. 2003; 127:424-431.

Backer MV, Backer JM. Targeting endothelial cells overexpressing VEGFR-2: selective toxicity of Shiga-like toxin-VEGF fusion proteins. Bioconjug Chem. 2001; 12:1066-1073.

Bellamy WT, Dalton WS, Gleason MC, Grogan TM, Trent JM. Development and characterization of a melphalan-resistant human multiple myeloma cell line. Cancer Res. 1991; 51:995-1002.

Briones J, Timmerman JM, Hilbert DM, Levy R. BLyS and BLyS receptor expression in non-Hodgkin's lymphoma. Exp Hematol. 2002; 30:135-141.

Chen, G., Zou, MJ., Peng, S., Wang, J.X. Cloning, expression and activity determination of the recombinant human soluble B lymphocyte stimulator and its two mutants. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai). 2002; 34(6):731-6.

Chen, G., Peng, S., Zou, M., Xu, H., Xu, D., Wang, J. Construction and function of two Cysl46-mutants with high activity, derived from recombinant human soluble B lymphocyte stimulator. 2004; 136(l):73-9.

Chen, G., Du, H., Zhang, Z., Peng, S., Xu, D., Wang, J. Primary immune effects of eukaryotic expression plasmids encoding two hyperactive mutants of human soluble B lymphocyte stimulator. J. Clin. Immunol. 25(5):445-51.

Craxton A, Magaletti D, Ryan EJ, Clark EA. Macrophage- and dendritic cell-dependent regulation of human B-cell proliferation requires the TNF family ligand BAFF. Blood. 2003; 101:4464-4471.

Do RK, Chen-Kiang S. Mechanism of BLyS action in B cell immunity. Cytokine Growth Factor Rev. 2002; 13:19-25.

Duzkale H, Pagliaro LC, Rosenblum MG, et al. Bone marrow purging studies in acute myelogenous leukemia using the recombinant anti-CD33 immunotoxin HuM195/rGel. Biol Blood Marrow Transplant. 2003; 9:364-372.

Foss FM. Interleukin-2 fusion toxin: targeted therapy for cutaneous T cell lymphoma. Ann NY Acad Sci. 2001; 941:166-176.

Frankel A, Tagge E5 Chandler J5 et al. IL2-ricin fusion toxin is selectively cytotoxic in vitro to IL2 receptor-bearing tumor cells. Bioconjug Chem. 1995; 6:666-672.

Greenstein S, Krett NL, Kurosawa Y, et al. Characterization of the MM1.1 human multiple myeloma (MM) cell lines: A model system to elucidate the characteristics, behavior, and signaling of steroid-sensitive and -resistant MM cells. Exp Hematol 2003; 31:271-282.

Hahne M, Kataoka T, Schroter M5 et al. APRIL, a new ligand of the tumor necrosis factor family, stimulates tumor cell growth. J Exp Med. 1998; 188:1185-1190.

Hale ML. Microtiter-based assay for evaluating the biological activity of ribosome-inactivating proteins. Pharmacol Toxicol. 2001; 88:255-260.

Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene. 1989; 77:51-59.

Hotz HG, Gill PS, Masood R, et al. Specific targeting of tumor vasculature by diphtheria toxin-vascular endothelial growth factor fusion protein reduces angiogenesis and growth of pancreatic cancer. J Gastrointest Surg. 2002; 6:159-166.

Joshi BH, Kawakami K, Leland P, Puri RK. Heterogeneity in interleukin-13 receptor expression and subunit structure in squamous cell carcinoma of head and neck: differential sensitivity to chimeric fusion proteins comprised of interleukin-13 and a mutated form of Pseudomonas exotoxin. Clin Cancer Res. 2002,8:1948-1956.

Kanakaraj P, Migone T-S, Nardelli B, et al. BLyS binds to B cells with high affinity and induces activation of the transcription factors NF-B and ELF-I. Cytokine. 2001; 13:25-31.

Kern C, Cornuel JF, Billard C, et al. Involvement of BAFF and APRIL in the resistance to apoptosis of B-CLL through an antocrine pathway. Blood. 2004; 103:679-688.

Kiyokawa T, Williams DP, Snider CE, Strom TB, Murphy JR. Protein engineering of diphtheria-toxin-related interleukin-2 fusion toxins to increase cytotoxic potency for high-affinity IL-2-receptor-bearing target cells. Protein Eng. 1991; 4:463-468.

Kreitman RJ, Pastan I. Immunobiological treatments of hairy-cell leukaemia. Best Pract Res Clin Haematol. 2003; 16:117-133.

Laabi Y, Gras MP, Carbonnel F, et al. A new gene, BCM, on chromosome 16 is fused to the interleukin 2 gene by a t(4;16)(q26;pl3) translocation in a malignant T cell lymphoma. EMBO J. 1992; 11:3897-3904.

Lakkis F, Landgraf B, Wen Z, Strom TB, Murphy JR. Phe496 and Leu497 are essential for receptor binding and cytotoxic action of the murine interleukin-4 receptor targeted fusion toxin DAB389-mIL-4. Protein Eng. 1992; 5:241-248.

Leonard JP, Schattner EJ, Coleman M. Biology and management of mantle cell lymphoma. Curr Opin Oncol. 2001; 13:342-347.

Liger D, vanderSpek JC, Gaillard C, et al. Characterization and receptor specific toxicity of two diphtheria toxin-related interleukin-3 fusion proteins DAB389-mIL-3 and DAB389-(Gly4Ser)2-mIL-3. FEBS Lett. 1997; 406:157-161.

Liu Y, Cheung LH, Thorpe P, Rosenblum MG. Mechanistic studies of a novel human fusion toxin composed of vascular endothelial growth factor (VEGF)121 and the serine protease granzyme B: directed apoptotic events in vascular endothelial cells. MoI Cancer Ther. 2003; 2:949-959.

Mackay F, Ambrose C. The TNF family members BAFF and APRIL: the growing complexity. Cytokine Growth Factor Rev. 2003; 14:311-324.

Mackay F, Schneider P, Rennert P, Browning J. BAFF and APRIL: a tutorial on B cell survival. Annu Rev Immunol. 2003; 21:231-264.

May RD, Vitetta ES, Moldenhauer G, Dorken B. Selective killing of normal and neoplastic human B cells with anti-CD19- and anti-CD22-ricin A chain immunotoxins. Cancer Drag Deliv. 1986; 3:261-272.

Moore PA, Belvedere O, Orr A, et al. BLyS: member of the tumor necrosis factor family and B lymphocyte stimulator. 1999; 285:260-263.

Nardelli B, Belvedere O, Roschke V, et al Synthesis and release of B-lymphocyte stimulator from myeloid cells. Blood. 2001; 97:198-204.

Nardelli B, Moore PA, Li Y5 Hubert DM. B-lymphocyte stimulator (BLyS): a therapeutic trichotomy for the treatment of B lymphocyte diseases. Leuk Lymphoma. 2002; 43:1367-1373.

Novak AJ, Bram RJ, Kay NE, Jelinek DF. Aberrant expression of B-lymphocyte stimulator by B chronic leukemia cells: a mechanism for survival. Blood. 2002; 100:2973-2979.

O'Boyle KP, Colletti D, Mazurek C, et al. Potentiation of antiproliferative effects of monoclonal antibody Lym-1 and immunoconjugate Lym-1-gelonin on human Burkitt's lymphoma cells with gamma-interferon and tumor necrosis factor. J Immunother Emphasis Tumor Immunol. 1995; 18:221-230.

Phillips TA, Ni J, Hunt JS. Cell-specific expression of B-lymphocyte (APRIL, BLyS)- and Th2 (CD30L/CD153)-promoting tumor necrosis factor superfamily ligands in human placentas. J Leukoc Biol. 2003; 74:81-87.

Riccobene TA, Miceli RC, Lincoln C, et al. Rapid and specific targeting of 1251-labeled B lymphocyte stimulator to lymphoid tissues and B cell tumors in mice. J Nucl Med. 2003; 44:422-433.

Rosenblum MG, Cheung LH, Liu Y, Marks JW. Design, expression, purification, and characterization, in vitro and in vivo, of an antimelanoma single-chain Fv antibody fused to the toxin gelonin. Cancer Res. 2003; 63:3995-4002.

Rosenblum MG, Murray JL, Cheung L, Rifkin R, Salmon S, Bartholomew R. A specific and potent immunotoxin composed of antibody ZME-018 and the plant toxin gelonin. Mol Biother. 1991; 3:6-13.

Rosenblum MG, Shawver LK, Marks JW, Brink J, Cheung L, Langton- Webster B. Recombinant immunotoxins directed against the c-erb-2/HER2/neu oncogene product: in vitro cytotoxicity, pharmacokinetics, and in vivo efficacy studies in xenograft models. Clin Cancer Res. 1999; 5:865-874.

Rosenblum MG, Zuckerman JE, Marks JW, Rotbein J, Allen WR. A gelonin-containing immunotoxin directed against human breast carcinoma. MoI Biother. 1992; 4:122-129.

Scapini P, Nardelli B, Nadali G, et al. G-CSF-stimulated neurophils are a prominent source of functional BLyS. J Exp Med. 2003; 197:297-302.

Schneider P, Mackay F, Steiner V, et al. BAFF, a novel ligand of the tumor necrosis factor family, stimulates B cell growth. 1999; 189:1747-1756.

Schnell R, Vitetta E, Schindler J, et al. Treatment of refractory Hodgkin's lymphoma patients with an anti-CD25 ricin A-chain immunotoxin. Leukemia. 2000; 14:129-135.

Shapiro ME, Kirkman RL, Kelley VR, Bacha P, Nichols JC, Strom TB. In vivo studies with chimeric toxins. Interleukin-2 fusion toxins as immunosuppressive agents. Targeted Diagn Ther. 1992; 7:383-393.

Thompson JS, Bixler SA, Qian F, et al BAFF-R, a newly identified TNF receptor that specifically interacts with BAFF. Science. 2001; 293:2108-2111.

Uckun F M, Jaszcz W, Ambrus JL, et al Detailed studies on expression and function, of CD 19 surface determinant by using B43 monoclonal antibody and the clinical potential of anti-CD19 immunotoxins. Blood. 1988; 71:13-29.

van Horssen PJ, van Oosterhout YV, Evers S, et al. Influence of cytotoxicity enhancers in combination with human serum on the activity of CD22-recombinant ricin A against B cell lines, chronic and acute lymphocytic leukemia cells. Leukemia. 1999; 13:241-249.

van Oosterhout YV, van den Herik-Oudijk IE, Wessels HM, de Witte T, van de Winkel JG, Preijers FW. Effect of isotype on internalization and cytotoxicity of CD19-ricin A immunotoxins. Cancer Res. 1994; 54:3527-3532.

Veenendaal LM, Jin H, Ran S, et al In vitro and in vivo studies of a VEGF121/rGelonin chimeric fusion toxin targeting the neovasculature of solid tumors. Proc Natl Acad Sci USA. 2002; 99:7866-7871.

von Bulow GU, Bram RJ. NFAT activation induced by a CAML-interacting member of the tumor necrosis factor receptor superfamily. Science. 1997; 278:138-141.

Weisenburger DD, Vose JM5 Greiner TC, et al. Mantle cell lymphoma: a clinicopathologic study of 68 cases from the Nebraska Lymphoma Study Group. Am J Hematol. 2000; 64:190-196.

Несмотря на то, что настоящее изобретение и его преимущества были подробно описаны, следует понимать, что в указанный текст могут быть введены различные изменения, замещения или перестановки без отступления от сущности и рамок настоящего изобретения, определяемых прилагаемой формулой изобретения. Кроме того, область настоящего изобретения не ограничивается конкретными вариантами способа, устройства, процесса производства, композиции, средств, методов и стадий, приведенных в описании. Как это очевидно специалистам в данной области, на основании описания настоящего изобретения способы, устройства, процесс производства, композиции, средства, методы и стадии, существующие в настоящее время или которые могут быть разработаны позже и которые выполняют, по существу, ту же самую функцию и достигают, по существу, того же результата, что и в приведенных соответствующих вариантах изобретения согласно настоящему описанию, могут использоваться в соответствии с настоящим изобретением. В этой связи прилагаемая формула изобретения включает в свою область такие способы, устройства, процесс производства, композиции, средства, методы или стадии.

1. Фармацевтическая композиция для нацеливания на клетки, несущие рецептор BLyS, содержащая эффективное количество слитого белка, состоящего из полипептида BLyS, слитого с цитотоксическим полипептидом, где цитотоксический полипептид расположен на N-конце слитого белка, а полипептид BLyS расположен на С-конце слитого белка, и фармацевтически приемлемый носитель.

2. Композиция по п.1, отличающаяся тем, что полипептид BLyS содержит B-клеточный направленный домен.

3. Композиция по п.1, отличающаяся тем, что полипептид BLyS содержит D-E петлю распознавания рецептора.

4. Композиция по п.2, отличающаяся тем, что полипептид BLyS и цитотоксический агент конъюгированы химически.

5. Композиция по п.2, отличающаяся тем, что указанный цитотоксический агент содержит молекулу гелонина.

6. Композиция по п.2, отличающаяся тем, что указанный цитотоксический агент выбран из группы, состоящей из рицина А, дифтерийного токсина, абрина, додекандрина, трикозантина, трикокирина, бриодина, антивирусного агента Mirabilis, белка, инактивирующего рибосомы ячменя (BRIP), антивирусного белка из лаконоса (РАР), сапонина, люффина, экзотоксина Pseuodomonas и момордина.

7. Способ лечения индивидуума с B-клеточным пролиферативным расстройством, включающий введение указанному индивидууму терапевтически эффективного количества композиции по любому из пп.1-6.

8. Способ по п.7, отличающийся тем, что указанное B-клеточное пролиферативное расстройство выбрано из группы, состоящей из B-клеточного хронического лимфоцитарного лейкоза/малой лимфоцитарной лимфомы при пролимфоцитарном лейкозе В-клеток, иммуноцитомы/лимфоплазмацитарной лимфомы (+/- макроглобулинемии Валденштрома), лимфомы клеток мантии, лимфомы В-клеток пограничной зоны в лимфоидной ткани, ассоциированной со слизистой (MALT типа), лимфомы В-клеток пограничной зоны селезенки (+/- ворсинчатые лимфоциты), лейкемического ретикулеза, диффузной лимфомы крупных В-клеток, медиастинальной (вилочковой) лимфомы крупных В-клеток, внутрисосудистой лимфомы крупных В-клеток, лимфомы Буркитта, миеломы плазматических клеток (множественной миеломы), моноклональной гаммопатии или гаммопатии неясного генеза (MGUS), индолентной миеломы, миеломы Смолдеринга, остеосклеротической миеломы (POEMS синдрома), лейкоза плазматических клеток, не секретирующей миеломы, плазмацитомы, солитарной плазмоцитомы кости, экстрамедуллярной плазмацитомы, макроглобулинемии Валденштрома, болезни, вызванной патологией тяжелой цепи (HCD), заболевания, связанного с осаждением иммуноглобулина, системной патологии легкой цепи, первичного амилоидоза, неходжкинской лимфомы, системной красной волчанки или артрита.

9. Способ селективного воздействия на клетки, экспрессирующие рецептор BLyS, включающий контактирование клетки с эффективным количеством композиции по любому из пп.1-7.

10. Набор, содержащий композицию по любому из пп.1-7, помещенную в приемлемый контейнер.

11. Набор по п.10, отличающийся тем, что указанную композицию отбирают соответствующим образом для доставки индивидууму.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к получению белковых комплексов, и может быть использовано в медицине. .

Изобретение относится к области генной и белковой инженерии и может быть использовано в медико-биологической промышленности. .

Изобретение относится к биотехнологии, в частности к генетической инженерии, и позволяет получать микробиологическим синтезом по упрощенной технологии новый гибридный полипептид GST-CFP10 со свойствами видоспецифичного белка-антигена Mycobacterium tuberculosis CFP10, который может быть использован для ранней видоспецифичной диагностики туберкулезной инфекции.

Изобретение относится к области биотехнологии, а именно к получению рекомбинантного проинсулина человека, и может быть использовано в биомедицинской промышленности.

Изобретение относится к области генной инженерии, конкретно к невирусному трансгенезу клеток, и может быть использовано в медицинской и сельскохозяйственной биотехнологии для доставки экзогенов.

Изобретение относится к области иммунологии. .

Изобретение относится к области медицины, фармакологии и биотехнологии, конкретно к новому диагностикуму в виде дозированной лекарственной формы для внутрикожного введения, позволяющему осуществить диагностику туберкулезного процесса, новому гибридному белку CFP10-ESAT6, полученному с помощью новой рекомбинантной плазмидной ДНК.

Изобретение относится к области биотехнологии, конкретно к получению новых пептидов, и может быть использовано в лечении и профилактике цитокинзависимых нарушений.

Изобретение относится к области биотехнологии и биохимии и может быть использовано в медико-биологической промышленности. .

Изобретение относится к биотехнологии и медицине и может быть использовано для получения tag7 полипептида и ингибирования развития опухоли. .

Изобретение относится к медицине и касается способа стабилизации высокоочищенного фактора некроза опухоли из плазмы или сыворотки кролика, индуцированного липополисахаридами.

Изобретение относится к новому химическому соединению, а именно к метиловому эфиру 2-циано-3-оксо-18,19-дегидроглициррет-1-еновой кислоты формулы (I): которое может быть использовано в медицине в качестве лекарственного средства, обладающего противоопухолевым действием.

Изобретение относится к биологически активным соединениям, в частности к - и -кристаллическим модификациям 5'-дезокси-N4 -карбопентилокси-5-фторцитидина, способу их получения и фармацевтическим композициям на их основе.

Полипептиды с направленным действием

Наверх