Рекомбинантная плазмидная днк pfk2, обеспечивающая синтез рекомбинантного пептида, являющегося аналогом фрагмента каппа-казеина человека, способ получения рекомбинантного пептида и рекомбинантный пептид, аналог фрагмента каппа-казеина человека, обладающий апоптотической активностью по отношению к раковым клеткам



Рекомбинантная плазмидная днк pfk2, обеспечивающая синтез рекомбинантного пептида, являющегося аналогом фрагмента каппа-казеина человека, способ получения рекомбинантного пептида и рекомбинантный пептид, аналог фрагмента каппа-казеина человека, обладающий апоптотической активностью по отношению к раковым клеткам
Рекомбинантная плазмидная днк pfk2, обеспечивающая синтез рекомбинантного пептида, являющегося аналогом фрагмента каппа-казеина человека, способ получения рекомбинантного пептида и рекомбинантный пептид, аналог фрагмента каппа-казеина человека, обладающий апоптотической активностью по отношению к раковым клеткам
Рекомбинантная плазмидная днк pfk2, обеспечивающая синтез рекомбинантного пептида, являющегося аналогом фрагмента каппа-казеина человека, способ получения рекомбинантного пептида и рекомбинантный пептид, аналог фрагмента каппа-казеина человека, обладающий апоптотической активностью по отношению к раковым клеткам
Рекомбинантная плазмидная днк pfk2, обеспечивающая синтез рекомбинантного пептида, являющегося аналогом фрагмента каппа-казеина человека, способ получения рекомбинантного пептида и рекомбинантный пептид, аналог фрагмента каппа-казеина человека, обладающий апоптотической активностью по отношению к раковым клеткам
Рекомбинантная плазмидная днк pfk2, обеспечивающая синтез рекомбинантного пептида, являющегося аналогом фрагмента каппа-казеина человека, способ получения рекомбинантного пептида и рекомбинантный пептид, аналог фрагмента каппа-казеина человека, обладающий апоптотической активностью по отношению к раковым клеткам
Рекомбинантная плазмидная днк pfk2, обеспечивающая синтез рекомбинантного пептида, являющегося аналогом фрагмента каппа-казеина человека, способ получения рекомбинантного пептида и рекомбинантный пептид, аналог фрагмента каппа-казеина человека, обладающий апоптотической активностью по отношению к раковым клеткам
Рекомбинантная плазмидная днк pfk2, обеспечивающая синтез рекомбинантного пептида, являющегося аналогом фрагмента каппа-казеина человека, способ получения рекомбинантного пептида и рекомбинантный пептид, аналог фрагмента каппа-казеина человека, обладающий апоптотической активностью по отношению к раковым клеткам

 


Владельцы патента RU 2401307:

Учреждение Российской академии наук Институт химической биологии и фундаментальной медицины Сибирского отделения РАН (ИХБФМ СО РАН) (RU)
Российская Федерация в лице Федерального агентства по науке и инновациям (ФАНИ) (RU)

Изобретение относится к биотехнологии и может быть использовано в медико-биологической промышленности для получения лекарственных препаратов с противоопухолевой активностью. Сконструирована плазмидная ДНК pFK2, обеспечивающая синтез рекомбинантного аналога фрагмента каппа-казеина человека, в клетках Escherichia coli, и описан способ получения рекомбинантного продукта с ее использованием. Рекомбинантный аналог фрагмента каппа-казеина человека, выделенный из клеток Escherichia coli, трансформированных рекомбинантной плазмидной ДНК pFK2, имеет молекулярную массу около 16 кДа; состоит из остатка метионина, фрагмента каппа-казеина человека с 24 по 134 аминокислотный остаток и С-концевого гистидинового тракта и обладает апоптотической активностью по отношению к раковым клеткам. 3 н.п. ф-лы, 6 ил.

 

Изобретение относится к биотехнологии, генетической и белковой инженерии, конкретно - к получению генетической конструкции, обеспечивающей синтез в клетках Escherichia coli рекомбинантного пептида, являющегося аналогом фрагмента каппа-казеина человека с 24 по 134 аминокислотный остаток с С-концевым гистидиновый тракт и обладающего апоптотической активностью по отношению к раковым клеткам.

Онкологические заболевания являются одной из главных причин смертности взрослого населения России. Снижение смертности людей от злокачественных образований является одной из задач современной медицины. Одним из направлений при решении данной задачи является разработка и внедрение современных противоопухолевых средств. Особого внимания заслуживает создание препаратов, индуцирующих апоптоз раковых клеток. В настоящее время несколько таких белковых препаратов уже применяются в клиниках для терапии некоторых онкологических заболеваний. В основном это препараты на основе фактора некроза опухолей (TNF-α) и его аналогов (TRIAL, Fast). Однако препараты на основе противовоспалительных цитокинов вызывают серьезные побочные эффекты, что ограничивает их применение. Поэтому поиск новых белков, способных подавлять рост и вызывать апоптотическую гибель раковых клеток является актуальной задачей.

Ранее был обнаружен и исследован природный пептид, названный лактаптином, обладающий цитотоксическим действием на раковые клетки [1]. Этот пептид, являющийся фрагментом каппа-казеина из человеческого молока, имеет молекулярную массу около 8,6 кДа и содержит установленную последовательность из 74 аминокислотных остатков [1], в которую входит протеолитический фрагмент каппа-казеина с 63 по 123 аминокислотный остаток [2]. Известный пептид обладает апоптотической активностью в отношении культур клеток аденокарциномы молочной железы MCF-7 [2].

Основным недостатком препарата на основе природного каппа-казеина человека является дороговизна и ограниченность источника сырья для его производства. Эта же причина делает невозможным производство такого препарата в достаточных количествах для клинического применения, в связи с чем необходима разработка рекомбинантного аналога каппа-казеина человека. В Российской Федерации и за рубежом такие аналоги отсутствуют.

Технической задачей изобретения является создание рекомбинантной плазмиды, обеспечивающей синтез рекомбинантного пептида, являющегося аналогом фрагмента каппа-казеина человека и получение рекомбинантного пептида, аналога фрагмента каппа-казеина человека, обладающего апоптотической активностью по отношению к раковым клеткам.

Поставленная техническая задача достигается конструированием плазмиды pFK2 путем встройки в плазмидный вектор pGSDI [3] фрагмента ДНК, кодирующего остаток метионина, фрагмент каппа-казеина человека с 24 по 134 аминокислотный остаток и С-концевой гистидиновый тракт. Трансформация полученной плазмидой клеток Escherichia coli обеспечивает синтез рекомбинантного пептида, аналога фрагмента каппа-казеина человека, обладающего апоптотической активностью по отношению к раковым клеткам.

Сущность изобретения заключается в следующем.

Генно-инженерными методами получают плазмиду pFK2, несущую ген, кодирующий рекомбинантный пептид, аналог фрагмента каппа-казеина человека, созданный на основе последовательности ДНК, кодирующей фрагмент каппа-казеина человека с 24 по 134 аминокислотные остатки и гистидиновый олигопептид.

Клетки E.coli XL-blu, несущие ген РНК-полимеразы фага Т7 под индуцибельным lacUV5 промотором, трансформируют сконструированной плазмидой pFK2 и выращивают в течение ночи. Ночную культуру (1/50) засевают в свежую среду YTx2 с ампициллином (50 мкг/мл). Синтез РНК-полимеразы индуцируют добавлением изопропилтиогалактазида до концентрации 0.5 мМ в тот момент, когда культура достигает среднелогарифмической фазы роста. Индуцированные клетки растят 6 часов при 30°С, после чего собирают центрифугированием при 5000 g. Индуцированные клетки E.coli XL-blu/pFK2 используют для очистки рекомбинантного фрагмента каппа-казеина человека с помощью аффинной хроматографии. В результате получают рекомбинантный пептид, аналог фрагмента каппа-казеина человека, имеющий молекулярную массу около 16 кДа, состоящий из остатка метионина, фрагмента каппа-казеина человека с 24 по 134 аминокислотный остаток и С-концевого гистидинового тракта, обладающий апоптотической активностью по отношению к раковым клеткам человека, включающий аминокислотную последовательность, кодируемую нуклеотидной последовательностью SEQ ID NO: 1 (фиг.1).

Исходным генетическим материалом для конструирования рекомбинантной плазмиды pFK2 являются:

а) плазмидный вектор pGSDI [3], обеспечивающий встройку фрагмента ДНК, кодирующего фрагмент каппа-казеина человека, его экспрессию под контролем позднего промотора Т7 ДНК-полимеразы;

б) фрагмент ДНК, кодирующий фрагмент каппа-казеина, который получают в полимеразной цепной реакции с использованием в качестве матрицы геномной ДНК, выделенной из плаценты человека, и олигонуклеотидных праймеров: CDCex3U55 5'GCCCAGATCTATGAA-CCAGAAACAACCAGCATGCCATGAG-AATG (подчеркиванием выделен введенный стартовый кодон) и IPTI376L67 5'GCCCGTCGA-CTTAGTGATGGTGATGGTGATGTGATCCGCCGATGGTAGGGA-TGAT-TATTTTATCCTG (подчеркиванием выделен введенный стоп-кодон), соответствующих 5'- и 3'-концу ДНК, кодирующей фрагмент каппа-казеина с 24 по 134 аминокислотный остаток, и обеспечивающих наличие в амплификационном фрагменте сайтов рестрикции SalI и BglII соответственно.

Полученная в результате плазмида pFK2 (фиг.2) характеризуется следующими признаками:

- имеет молекулярную массу 2,09 МДа и размер 3164 п.о.;

- кодирует рекомбинантный пептид, аналог фрагмента каппа-казеина человека, содержащий остаток метионина, фрагмент каппа-казеина с 24 по 134 аминокислотный остаток и пептид с аминокислотной последовательностью GGSHHHHHH;

- состоит из следующих элементов:

а) фрагмента ДНК, размером 373 п.о., кодирующего остаток метионина, фрагмент каппа-казеина с 24 по 134 аминокислотный остаток и пептид с аминокислотной последовательностью GGSHHHHHH,

б) плазмидного вектора pGSDI [3], обеспечивающего эффективную транскрипцию полученного гена, кодирующего фрагмент каппа-казеина человека, и его экспрессию

- содержит:

а) сайт инициации репликации плазмиды pBR322;

б) промотор бактериофага Т7;

в) генетические маркеры: AMPr - ген ампициллин резистентности (ген β-лактамазы), определяющий устойчивость к ампициллину при трансформации Escherichia coli;

г) искусственный ген, кодирующий стартовый кодон, фрагмент каппа-казеина человека с 24 по 134 аминокислотный остаток, олигопептид с последовательностью GGSHHHHHH и стоп-кодон;

д) уникальные сайты узнавания рестрикционными эндонуклеазами, имеющими следующие координаты: EcoRI (1595), BglII (1613), SalI (1985), PstI (1995), HindIII (2000), ClaI (2053).

Таким образом, впервые получена плазмидная ДНК, обеспечивающая продукцию в клетках Escherichia coli рекомбинантного пептида, аналога каппа-казеина человека, состоящего из фрагмента каппа-казеина человека с 24 по 134 аминокислотный остаток и С-концевого гистидинового тракта и обладающего апоптотической активностью по отношению к раковым клеткам.

Изобретение иллюстрируется следующими чертежами:

Фиг.1. Нуклеотидная последовательность и кодируемая ею аминокислотная последовательность SalI/BglII-фрагмента плазмиды pFK2, кодирующая фрагмент каппа-казеина человека с 24 по 134 аминокислотный остаток с С-концевым гистидиновым трактом.

Фиг.2. Общая схема структурной организации плазмиды pFK2. FK2 - ген, кодирующий рекомбинантный аналог каппа-казеина человека, SD - сайт посадки рибосом, Т7 - промотор фага Т7, AMPr-ген устойчивости к ампициллину; указаны некоторые сайты рестрикции.

Фиг.3. Электрофореграмма в 12% SDS-ПААГ лизатов клеток E.coli XL-blu/pFK2, дорожка 1 и E.coli XL-blu/pGSDI (дорожка 2). Дорожка 3 - маркеры молекулярных весов.

Фиг.4. Электрофореграмма в 12% SDS-ПААГ белковых фракций и очищенного рекомбинантного фрагмента каппа-казеина человека. Дорожки: 1 - лизат клеток E.coli, содержащих плазмиду pFK2, 2 - фракции, не взаимодействующие с хроматографическим сорбентом, 3 - фракции, эллюируемые 50 мМ имидазолом, 4 - фракции, эллюируемые 250 мМ имидазолом, 5 - фракции, эллюируемые 6М гуанидин-HCl, 6 - маркеры молекулярных весов.

Фиг.5. Жизнеспособность клеток аденокарциномы молочной железы человека линии MCF-7 и контрольных мезенхимальных стволовых клеток MSC, инкубированных в течение 3-х суток в полной культуральной среде в присутствии различных концентраций рекомбинантного аналога каппа-казеина человека. За 100% принята жизнеспособность клеток, инкубированных в отсутствии рекомбинантного аналога каппа-казеина человека.

Фиг.6. Гистограммы распределения клеток МСF-7 по интенсивности окраски FITC-меченым аннексином V (по шкале X) и пропидий йодидом (Y). Клетки инкубировали с рекомбинантным аналогом каппа-казеина человека (24, 48, 72 ч) и без аналога (72 ч, контроль), после чего прикрепившиеся (монослой) и открепленные клетки окрашивали FITC-аннексином V/PI и анализировали проточной цитометрией. G1-G3 - субпопуляции клеток, вклад которых в % указан после обозначения субпопуляции. Границы субпопуляций указаны линиями.

Для лучшего понимания сущности предлагаемого изобретения ниже следуют примеры его осуществления.

Пример 1. Конструирование плазмиды pFK2.

В качестве источника гена, кодирующего фрагмент каппа-казеина человека, используют геномную ДНК, выделенную из плаценты человека. Амплификацию гена, кодирующего фрагмент каппа-казеина человека, проводят методом ПЦР с использованием ДНК-полимеразы «rTth DNA Polymerase XL» («Applied Biosystems», США), которая имеет редактирующую активность и позволяет синтезировать продукты с частотой мутаций около 1×10-6 ошибок / нуклеотид, что на один-два порядка меньше, чем частота мутаций при использовании Tag ДНК-полимеразы. Для синтеза фрагмента ДНК, кодирующего фрагмент каппа-казеина человека, в реакционную смесь добавляют праймеры CDCex3U55 5'GCCCAGAT-CTATGAACCAGAAACAACCAGCATGCCATGAGAATG (подчеркиванием выделен введенный стартовый кодон) и IPTI376L67 5'GCCCGTCGACTTAGTGATGGTGATGGTGATGTGATCCGCCGATGGT A-GGGATGATTATTTTATCCTG (подчеркиванием выделен введенный стоп-кодон), соответствующих 5'- и 3'-концу ДНК, кодирующей фрагмент каппа-казеина с 24 по 134 аминокислотный остаток, и обеспечивающих в амплификационном фрагменте наличие сайтов рестрикции SalI и BglII соответственно. Реакцию проводят с использованием технологии горячего старта в амплификаторе «GeneAmp PCR System 9700» («Applied Biosystems», США). Условия проведения ПЦР: предварительная денатурация - 2 минуты при 94°С; 10 циклов - 30 секунд при 94°С, 40 секунд при 60°С (с последующим понижением температуры на 1°С на цикл), 30 секунд при 68°С; 20 циклов - 30 секунд при 94°С, 40 секунд при 50°С, 30 секунд при 68°С; заключительная стадия - 20 минут при 72°С.

Продукт аплификации, кодирующий фрагмент каппа-казеина человека, расщепляют рестриктазами SalI и BglII в реакционной смеси, содержащей 50 mM трисНСl, рН 7.5; 10 mM MgCl2; 50 mM NaCl и по 50 ед. активности соответствующих ферментов. Аналогично ведут обработку рестриктазами ДНК плазмиды pGSDI. Реакцию ведут 1 час при 37°С. Аналогично ведут обработку рестриктазами ДНК векторной плазмиды pGSDI. После этого ПЦР-фрагмент и линеаризованный вектор очищают электрофорезом в 1,5% агарозном геле с последующим выделением ДНК с помощью набора QIAquick Gel Extraction («Qiagen», США) в соответствии с рекомендациями производителя.

Лигирование фрагмента ДНК, кодирующего фрагмент каппа-казеина человека, и векторной ДНК ведут в стандартных условиях [4].

Пример 2. Получение штамма-продуцента фрагмента каппа-казеина человека - продукта плазмиды pFK2.

Клетки E.coli XL-blu, несущие ген РНК-полимеразы фага Т7 под индуцибельным lacUV5 промотором, трансформируют сконструированной плазмидой pFK2. Клетки E.coli XL-blu, трансформированные плазмидой pFK2, выращивают в течение ночи. Ночную культуру (1/50) засевают в свежую среду YTx2 с ампициллином (50 мкг/мл). Синтез РНК-полимеразы индуцируют добавлением изопропилтиогалактазида до концентрации 0.5 мМ в тот момент, когда культура достигает среднелогарифмической фазы роста. Индуцированные клетки растят 6 часов при 30°С, после чего собирают центрифугированием при 5000 g и анализируют методом электрофореза по Лэммли [5] в 12% SDS-полиакриламидном геле (ПААГ). Результаты этого анализа, представленные на фиг.3, показывают наличие в индуцированной культуре клеток E.coli XL-blu/pFK2 дополнительного белка с молекулярной массой около 16 кДа (фиг.3, дорожка 1), который отсутствует в контрольном лизате клеток E.coli XL-blu/pGSDI (фиг.3, дорожка 2).

Пример 3. Очистка рекомбинантного пептида, аналога фрагмента каппа-казеина человека из клеток E.coli XL-blu/pFK2.

Индуцированные клетки E.coli XL-blu/pFK2 используют для очистки рекомбинантного фрагмента каппа-казеина человека с помощью аффинной хроматографии на Ni-NTA агарозе (Sigma, США), согласно инструкции производителя. На хроматографическую колонку, упакованную 5 мл Ni-NTA агароза (Sigma, США) и уравновешенную буфером А, содержащим 50 мМ Na-фосфатный буфер рН 8.0, 300 мМ NaCl, 10 мМ имидазол, 1 мМ фенилметилсульфонил фторид, 10 мМ 2-меркаптоэтанол, наносят лизат индуцированных клеток со скоростью потока 1 мл/мин. Для удаления неспецифически сорбирующихся белков E.coli проводят предварительную элюцию 20 мл буфера А, содержащего 50 мМ имидазола. Рекомбинантный пептид элюируют 10 мл буфера А, содержащего 250 мМ имидазола, а затем проводят дополнительную элюцию в денатурирующих условиях 10 мл буфера, содержащего 50 мМ Трис-HCl рН 8.0, 6 М гуанидин-HCl. Полученные белковые фракции диализуют против 150 мМ NaCl, Трис-HCl рН 7.5 (две смены по 18 ч при 5°С) и анализируют электрофорезом в ПААГ с SDS по Лэммли [5], приготавливая образцы для нанесения на гель в присутствии 2-меркаптоэтанола. Пример такой очистки приведен на фиг.4. Фракции, содержащие рекомбинантный пептид, аналог фрагмента каппа-казеина человека, концентрируют ионообменной хроматографией на DEAE-целлюлозе.

Определение концентрации белка в препаратах рекомбинантных аналогов лактаптина проводят по методу Брэдфорд [6]. Для построения калибровочной кривой используют бычий сывороточный альбумин (Serva, США). Определение концентрации белка показывает, что общий выход составляет 150 мкг из 500 мл культуры клеток Escherichia coli.

Пример 4. Исследование апоптотической активности рекомбинантного пептида, аналога фрагмента каппа-казеина человека по отношению к раковым клеткам.

Для анализа влияния рекомбинантного пептида, аналога фрагмента каппа-казеина человека, используют клетки аденокарциномы молочной железы человека линии MCF-7 из Российской коллекции клеточных культур позвоночных, ИНЦ РАН, Санкт-Петербург, которые культивируют в среде IMDM с 10 мМ L-глутамина и 40 мкг/мл гентамицина в присутствии 10% эмбриональной сыворотки крупного рогатого скота при 37°С в атмосфере 5% СО2 в культуральных флаконах с площадью поверхности дна 25 см2. Подсчет количества клеток проводят в камере Горяева. 2×106 клеток MCF-7 культивируют в 96-луночном планшете в течение 2-х суток (экспоненциальная фаза роста, 50% монослой). К культуральной среде добавляют рекомбинантный аналог каппа-казеина человека и инкубируют в течение 3-х суток, после чего оценивают морфологические изменения с помощью световой микроскопии и анализируют жизнеспособность клеток с помощью МТТ-теста [7]. Для этого клетки MCF-7 инкубируют в присутствии 1 мг/мл МТТ 1 ч, 37°С, среду с МТТ удаляют. МТТ-формазан растворяют в изопропиловом спирте и определяют оптическую плотность раствора при длине волны 570 нм с контролем при длине волны 630 нм на приборе "Multiskan RC", ThermoLabs (США).

Результаты эксперимента представлены на фиг.5. Результаты эксперимента показывают, что инкубация MCF-7 в присутствии созданного рекомбинантного аналога каппа-казеина человека приводит к существенному снижению их жизнеспособности (на 62%, 3 суток инкубации). Снижение жизнеспособности сопровождается морфологическими изменениями, характерными для апоптоза клеток в культуре: откреплением от пластиковой подложки, конденсацией цитоплазмы и ядер и появлением вторичных некротических клеток, окрашиваемых трипановым синим. На третьи сутки инкубации количество вторичных некротических клеток достигает 20-25%.

Кроме того, проводят количественное определение апоптотических клеток в культуре с помощью проточной цитометрии. Для этого клетки MCF-7 культивируют в 24-луночном планшете 2 суток (2×105 клеток/лунку, экспоненциальная фаза роста, 50% монослой). К культуральной среде добавляют рекомбинантный аналог каппа-казеина человека по методу, описанному в [2]. Клетки инкубируют 24, 48 либо 72 часа.

После инкубации клетки, открепившиеся от подложки, собирают с культуральной средой, центрифугируют 15 мин при 2000 g, после чего среду удаляют, а клетки суспендируют в буфере для окраски ВАР (30 мМ HEPES-NaOH рН 7.5, 3 мМ CaCl2, 140 мМ NaCl, 100 мкг/мл PI и 1 мкл/(мл клеточной суспензии) раствора FITC-меченого аннексии V (BD Biosciences, США). Клетки в составе монослоя промывают TBS (140 мМ NaCl, Трис-HCl рН 7.5), инкубируют с 100 мкг/мл трипсина в фосфатно-солевом буфере. Затем трипсин инактивируют добавлением среды IMDM с 10% эмбриональной сыворотки крупного рогатого скота, клетки осаждают центрифугированием 15 мин при 2000 g, среду удаляют, а клетки суспендируют в буфере для окраски ВАР. Все клетки анализируют на проточном цитофлуориметре BD FACSAria с использованием системы светофильтров ВР 585/42 (PI) и ВР 530/30 (FITC).

Результаты экспериментов представлены на фиг.6. Результаты экспериментов подтверждают, что созданный рекомбинантный аналог каппа-казеина человека индуцирует апоптотическую гибель этих клеток: инкубация клеток в присутствии рекомбинантного аналога каппа-казеина человека приводит к разрушению монослоя и откреплению клеток от пластиковой подложки. Прирост числа некротических клеток происходит благодаря убыли апоптотических клеток. Следовательно, некротические клетки являются вторичными некротическими, т.е. результатом апоптотической гибели.

Таким образом, впервые получена плазмидная ДНК pFK2, содержащая ген, кодирующий рекомбинантный пептид, аналог фрагмента каппа-казеина человека с 24 по 134 аминокислотный остаток и С-концевого гистидинового тракта, что обеспечивает продукцию в клетках Escherichia coli рекомбинантного пептида, аналога фрагмента каппа-казеина человека, обладающего апоптотической активностью по отношению к раковым клеткам.

ИСТОЧНИКИ ИНФОРМАЦИИ

1. Власов В.В., Рихтер В.А., Семенов Д.В., Некипелая В.В., Кулигина Е.В., Потапенко М.О. Пептид, обладающий апоптотической активностью по отношению к раковым клеткам человека. // Патент RU 2317304 С1. 2006.

2. Некипелая В.В., Семенов Д.В., Потапенко М.О., Кулигина Е.В., Кит Ю.Я., Романова И.В., Рихтер В.А. Лактаптин - белок человеческого молока, индуцирующий апоптоз клеток аденокарциномы MCF-7. // Докл. АН. - 2008. - Т.419. - С.268-271.

3. Белавин П.А., Нетесова Н.А., Решетников С.С., Иванисенко В.А., Ерошкин A.M., Протопопова Е.В., Локтев В.Б., Малыгин Э.Г. Экспрессия фрагментов гена Е вируса японского энцефалита в клетках Escherichia coli. // Биотехнология. - 1997. - Т.3. - С.3-9.

4. Маниатис Т., Фрич Э., Сэмбрук Д. Молекулярное клонирование. М.: Мир, 1984.

5. Laemmli U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. // Nature. - 1970. - V.227. - P.680-685.

6. Bradford M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. // Anal. Biochem. - 1976. - V.72. - P.248-254.

7. Mosmann T.J. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxic assays. // J. Immunol. Meths. - 1983. - V.65. - P.55-63.

1. Рекомбинантная плазмидная ДНК pFK2, обеспечивающая синтез рекомбинантного пептида, являющегося аналогом фрагмента каппа-казеина человека, в клетках Escherichia coli, с молекулярной массой 2,1 MDa и размером 3164 п.о., содержащая:
плазмидный вектор pGSDI, гидролизованный по SalI и BglII сайтам и содержащий сайт инициации репликации плазмиды pBR322, промотор фага Т7 и уникальные сайты рестрикции EcoRI (1595), BglII (1613), SalI (1985), PstI (1995), HindIII (2000), ClaI (2053);
BglII-SalI фрагмент размером 372 п.о., включающий стартовый кодон, сегмент, кодирующий фрагмент каппа-казеина человека с 24 по 134 аминокислотный остаток и олигопептид с последовательностью GGSHHHHHH, истоп-кодон;
генетические маркеры: АМРr - ген ампициллин резистентности (ген β-лактамазы), определяющий устойчивость к ампициллину при трансформации Escherichia coli.

2. Способ получения рекомбинантного пептида, являющегося аналогом фрагмента каппа-казеина человека, предусматривающий трансформацию клеток E.coli XL-blu, несущих ген РНК-полимеразы фага Т-7 под индуцибельным lacUV5 промотором, сконструированной плазмидой pFK2 по п.1; выращивание трансформированных клеток в среде с ампициллином до среднелогарифмической стадии роста с индуцированном 0,5 мМ изопропилтиогалактазидом и последующим культивированием в течение 5-7 ч при 28-30°С; отделение клеток центрифугированием с последующей очисткой рекомбинантного фрагмента каппа-казеина человека с помощью аффинной хроматографии на Ni-NTA агарозе.

3. Рекомбинантный пептид, аналог фрагмента каппа-казеина человека, имеющий молекулярную массу около 16 кДа, состоящий из остатка метионина, фрагмента каппа-казеина человека с 24 по 134 аминокислотный остаток и С-концевого гистидинового тракта, обладающий апоптотической активностью по отношению к раковым клеткам, включающий аминокислотную последовательность, кодируемую нуклеотидной последовательностью SEQ ID NO: I.



 

Похожие патенты:

Изобретение относится к биотехнологии. .

Изобретение относится к области биотехнологии, конкретно к получению модифицированного антагониста рецептора мутеина IL-4 (IL-4RA), и может быть использовано для лечения заболеваний дыхательных путей, таких как астма, эмфизема или хронический бронхит.

Изобретение относится к области биотехнологии и может быть использовано для получения инсулиновых соединений. .

Изобретение относится к биотехнологии, конкретно к области генной инженерии, касается способа получения активного рекомбинантного белка летального фактора сибирской язвы LF, рекомбинантной плазмидной ДНК рЕТНIS-LF, кодирующей активный белок летального фактора сибирской язвы LF, и штамма бактерий Escherichia coli, продуцирующего активный белок летального фактора сибирской язвы.

Изобретение относится к области генетической инженерии и может быть использовано в медико-биологической промышленности для получения рекомбинантного гетерокарпина - антагониста человеческого рилизинг-фактора гормона роста (GHRH).

Изобретение относится к биотехнологии, генной и белковой инженерии, конкретно - к пептиду, обладающему способностью специфически взаимодействовать с антителами против бензо[ ]пирена и бенз[ ]антрацена.

Изобретение относится к области микробиологии и молекулярной генетики и может быть использовано в медицинской промышленности при производстве вакцин против Streptococcus agalactiae.

Изобретение относится к биотехнологии и может быть использовано в медицине. .

Изобретение относится к области генной инженерии и вирусологии. .

Изобретение относится к области биотехнологии, конкретно к получению тимус-специфических белков, и может быть использовано в медицине. .
Наверх