Индукция апоптоза в опухолевых клетках, экспрессирующих toll-подобный рецептор



Индукция апоптоза в опухолевых клетках, экспрессирующих toll-подобный рецептор
Индукция апоптоза в опухолевых клетках, экспрессирующих toll-подобный рецептор
Индукция апоптоза в опухолевых клетках, экспрессирующих toll-подобный рецептор
Индукция апоптоза в опухолевых клетках, экспрессирующих toll-подобный рецептор
Индукция апоптоза в опухолевых клетках, экспрессирующих toll-подобный рецептор
Индукция апоптоза в опухолевых клетках, экспрессирующих toll-подобный рецептор
Индукция апоптоза в опухолевых клетках, экспрессирующих toll-подобный рецептор

 


Владельцы патента RU 2401661:

ШЕРИНГ КОРПОРЕЙШН (US)

Группа изобретений относится к медицине, а именно к онкологии, и может быть использована для приготовления медикамента для лечения рака с экспрессией TLR3 у пациента. Для этого используют агонист TLR3 в сочетании с интерфероном типа I в низкой дозе. Изобретение позволяет воздействовать на опухоль за счет индуцирования апоптоза в экспрессирующей TLR3 раковой клетке. Эффективность воздействия обусловлена синергетическим эффектом между агонистом TLR3 и интерфероном. 2 н. и 16 з.п. ф-лы, 1 ил.

 

Область изобретения

Изобретение относится к способам лечения видов рака и опухолевых клеток, экспрессирующих Toll-подобный рецептор (TLR), путем выбора TLR-экспрессирующей опухолевой клетки и контакта этой клетки с терапевтически эффективным количеством лиганда TLR. Изобретение, в частности, относится к способам лечения TLR3-экспрессирующих видов рака и опухолевых клеток при использовании агонистов TLR3.

Предшествующий уровень техники

Рак является одной из ведущих причин смерти в мире. Поэтому важно разработать новые способы лечения этой смертельной болезни. Многие существующие способы лечения рака воздействуют на быстро делящиеся клетки. Эти способы лечения имеют разрушительные побочные эффекты, потому что они воздействуют на все быстро делящиеся клетки, такие как клетки желудочно-кишечного тракта и волосяных фолликулов, а не только на раковые клетки. Таким образом, необходимы новые способы лечения, не имеющие таких разрушительных побочных эффектов. Настоящая заявка идентифицирует Toll-подобный рецептор 3 как терапевтическую мишень при лечении рака.

Белки Toll дрозофилы (Drosophila toll) управляют спинно-брюшинным паттерном эмбриона дрозофилы, и предполагается, что они представляют древний механизм иммунной защиты.

Были также идентифицированы человеческие гомологи Drosophila toll, называемые Toll-подобными рецепторами (TLRs). Выравнивание последовательностей Toll белков человека и дрозофилы показывает наличие гомологии по всей длине белковых цепей. Соответственно, предполагается, что TLR являются важным компонентом врожденного иммунитета у людей. Семейство Toll-подобных рецепторов человека состоит из десяти высоко консервативных белков рецепторов, TLR1-TLR10. Подобно белку Drosophila Toll TLR человека представляют собой трансмембранные белки типа 1 с внеклеточным доменом, состоящим из домена повтора, богатого лейцином (LRR), который распознает молекулярные паттерны, ассоциированные с патогеном (РАМР), и цитоплазматическим доменом, гомологичным цитоплазматическому домену рецептора интерлейкина-1 (IL-1) человека. Подобно сигнальным путям как для рецептора Drosophila Toll, так и для рецептора IL-1, Toll-подобные рецепторы человека передают сигнал через путь NF-κB.

Хотя TLR млекопитающих имеют много общих характеристик и механизмов передачи сигнала, их биологические функции очень различны. Это объясняется частично тем фактом, что с TLR в различных комбинациях ассоциированы четыре различных молекулы адаптера (MyD88, TIRAP, TRIF и TRAF) и они опосредуют различные пути передачи сигналов. Кроме того, различные лиганды к одному TLR могут избирательно активировать различные пути передачи сигнала. Кроме того, TLR дифференцированно экспрессируются в различных кроветворных и не-кроветворных клетках. Соответственно, ответ на лиганд TLR зависит не только от пути сигнала, активизированного TLR, но также и от природы клеток, в которых экспрессируется конкретный TLR.

Хотя лиганды для некоторых TLR еще не идентифицированы, уже сообщалось о ряде специфических лигандов TLR. Например, как Poly IC, так и Poly AU являются агонистами TLR3.

Полиинозиновая-полицитидиловая кислота (Poly IC) представляет собой высокомолекулярную синтетическую двухцепочечную РНК, гетерогенную по размеру. Poly IC является агонистом TLR3, но она также является мощным активатором PKR, убиквитарного фермента, участвующего в противовирусных реакциях и посттранскрипционном регулировании гена.

Полиадениловая-полиуридиловая кислота (Poly AU) представляет собой двухцепочечный комплекс синтетических полирибонуклеотидов. Poly AU является агонистом TLR3. Poly AU является модулятором как гуморальных, так и клеточных иммунных реакций, а также она является индуктором интерферона.

Хотя как Poly IC, так и Poly AU использовались в нескольких клинических испытаниях в качестве адъювантной терапии при различных видах рака, таких как рак груди, мочевого пузыря, почки и желудка, эти агенты не использовались ранее в новых способах, описанных в настоящем изобретении.

Как было указано ранее, в настоящем изобретении идентифицирован Toll-подобный рецептор 3 в качестве терапевтического агента для лечения рака. Приведенные ниже опубликованные исследования относятся к взаимосвязи TLR и апоптоза.

В работе Aliprantis et al. описаны эксперименты, изучающие влияние бактериальных липопротеинов (BLP) на индукцию апоптоза в клеточной линии моноцитов, экспрессирующих Toll-like рецептор 2 человека (hTLR2). См. Aliprantis et al., "Cell Activation and Apoptosis by Bacterial Lipoproteins Through Toll-like Receptor-2", Science, vol. 285, pp.736-739 (July 30, 1999).

Другая работа Aliprantis et al. относится к роли TLR2 в запуске активации каспазы 8 через вовлечение адаптера FADD. См. Aliprantis et al., "The apoptotic signaling pathway activated by Toll-like receptor-2", Embo J., vol. 19(13), pp.3325-3336 (2000).

Работа Sabroe et al. относится к роли TLR2 в выживании нейтрофилов. См. Sabroe et al., "Selective Roles for Toll-Like Receptor (TLR)2 and TLR4 in the Regulation of Neutrophil Activation and Life Span", J. Immunology, vol. 170, pp.5268-5275 (2003).

Работа Bannerman и Goldblum относится к исследованиям, характеризующим TLR4 и TLR2 как рецепторы бактериальных липополисахаридов (LPS). См. Bannerman and Goldblum, "Mechanisms of bacterial lipopolysaccharide-induced endothelial apoptosis". Am. J. Physiology Lung Cell Molecular Physiology, vol. 284, pp.L899-L914 (2003).

Работа Meyer et al. относится к изучению индукции апоптоза агонистом TLR7 в линиях клеток эпителия человека (HeLa S3), кератиноцитах (клетки НаСаТ и А431) и фибробластах мышей (клетки МсСоу). См. Meyer et al., "Induction of apoptosis by Toll-like Receptor-7 agonist in tissue cultures", British J. Dermatology, vol. 149 (supp.66), pp.9-13 (2003).

В работе Wen et al. предполагается, что диабет частично индуцируется комбинацией прямого распознавания вирус-подобного стимула панкреатическими островками через экспрессию природного иммунного рецептора, TLR3. Wen и соавторы также предполагают, что индукция апоптоза Poly IC, возможно, опосредована TLR3. См. Wen et al., "The Effect of Innate Immunity on Autoimmune Diabetes and the Expression of Toll-Like Receptors on Pancreatic Islets", J: Immunology, vol. 172, pp.3173-3180 (2004).

Наконец, работа Han et al. относится к индукции апоптоза в клетках 293, сверхэкспрессирующих белок TRIF. Работа Han et al. также относится к предложенной модели TRIF-индуцированных внутриклеточных сигнальных путей (ISRE/IFNβ, NF-κB и апоптоз), которые активируются TLR3. См. Han et al., "Mechanisms of the TRIF-induced Interferon-stimulated Response Element and NF-κВ Activation and Apoptosis Pathways", J. Biological Chemistry, vol. 279, no. 15, pp.15652-15661 (2004).

Краткое описание изобретения

Вариант осуществления изобретения обеспечивает способ лечения рака, содержащий:

а) выбор пациента, у которого наблюдается рак с экспрессией TLR, и b) введение такому пациенту терапевтически эффективного количества лиганда TLR. Предпочтительно, лиганд является агонистом или антагонистом.

Альтернативный вариант осуществления изобретения обеспечивает способ индуцирования апоптоза опухолевой клетки, содержащий: а) выбор опухолевой клетки, экспрессирующей TLR, и b) контактирование клетки с лигандом TLR в количестве, эффективном для индуцирования апоптоза в клетке. Предпочтительно, лиганд является агонистом или антагонистом.

Другой вариант осуществления изобретения обеспечивает способ лечения рака, содержащий: а) выбор пациента, у которого наблюдается рак с экспрессией TLR, и b) введение пациенту терапевтически эффективного количества лиганда TLR3. Предпочтительно, лиганд является агонистом или антагонистом. Более предпочтительно, агонист представляет собой Poly AU. Наиболее предпочтительно, агонист представляет собой Poly IC. Как вариант, антагонист представляет собой антитело или его фрагмент. Предпочтительно, рак, экспрессирующий TLR3, представляет собой рак толстой кишки. Наиболее предпочтительно, рак, экспрессирующий TLR3, представляет собой рак груди. Способ может дополнительно содержать введение пациенту химиотерапевтического агента или лечение рака. Способ может также дополнительно содержать введение пациенту низкой дозы интерферона типа I (IFN I) до введения лиганда TLR3.

Альтернативный вариант осуществления изобретения обеспечивает способ для индуцирования апоптоза опухолевой клетки, содержащий: а) выбор опухолевой клетки, экспрессирующей TLR3, и b) контактирование клетки с лигандом TLR3 в количестве, эффективном для индуцирования апоптоза в клетке. Предпочтительно, лиганд является агонистом или антагонистом. Более предпочтительно, агонист представляет собой Poly AU. Наиболее предпочтительно, агонист представляет собой Poly IC. Как вариант, антагонист представляет собой антитело или его фрагмент. Предпочтительно, опухолевая клетка, экспрессирующая TLR3, представляет собой клетку рака толстой кишки. Наиболее предпочтительно, опухолевая клетка, экспрессирующая TLR3, представляет собой клетку рака груди. Способ может дополнительно содержать контактирование клетки с химиотерапевтическим агентом или лечение рака. Способ может также дополнительно содержать контактирование клетки с низкой дозой интерферона типа I (IFN I) до введения лиганда TLR3.

Краткое описание чертежа

Вышеупомянутые и другие свойства настоящего изобретения будут более понятны из последующего подробного описания изобретения и краткого описания чертежа, который представляет собой ряд графиков, демонстрирующих влияние подавления TLR3 при помощи siPHK (малых интерферирующих РНК) на апоптоз клеток Саmа-1 после инкубации в течение 48 часов с Poly IC.

Подробное описание изобретения

Все процитированные публикации включены в настоящее описание в своей полноте посредством ссылки.

Определения

Термин "апоптоз" означает запрограммированную гибель клетки.

Термин "агонист" означает лиганд, способный связываться с рецептором и активировать его.

Термин "антагонист" означает лиганд, способный связываться с рецептором и блокировать или инактивировать его. Альтернативно, "антагонист" может связываться с агонистом и блокировать или инактивировать его, чтобы предотвратить его связывание с рецептором.

Термин "антитело" означает полный иммуноглобулин, то есть содержащий два фрагмента Fab, связанных с фрагментом Fc. Термин "антитело" включает поликлональные, моноклональные, химерные, приматизированные, гуманизированные и антитела человека.

Термин "антитело" включает любой из пяти основных классов иммуноглобулинов: IgA, IgD, IgE, IgG и IgM, а также подклассы (изотипы) иммуноглобулинов, то есть IgG1, IgG2, IgG3, IgG4, IgA и IgA2.

Термин "фрагмент антитела" означает любой фрагмент или комбинацию фрагментов полного иммуноглобулина, таких как фрагменты Fab, Fc, F(ab)2 и Fv.

Термин "рак" описывает физиологическое состояние, которое обычно характеризуется неконтролируемым ростом клеток. К примерам рака относятся, без ограничения, карцинома, лимфома, бластома, саркома и лейкоз. К более специфическим примерам относятся плоскоклеточный рак, мелкоклеточный рак легкого, не-мелкоклеточный рак легкого, рак желудочно-кишечного пути, рак поджелудочной железы, глиобластома, цервикальный рак, рак яичников, рак печени, рак мочевого пузыря, гепатома, рак груди, рак толстой кишки, колоректальный рак, карцинома эндометрия, рак слюнной железы, рак почки, рак простаты, рак вульвы, рак щитовидной железы, карцинома печени и различные типы рака головы и шеи.

Термин "химиотерапевтический агент" означает химическое соединение, применимое в лечении рака.

Термин "лечение" подразумевает терапевтические, профилактические или суппрессивные меры воздействия на болезнь или нарушение, ведущие к любому клинически желательному или полезному эффекту, включая, без ограничения, облегчение одного или более симптомов, регрессию, замедление или прекращение прогрессии заболевания или нарушения.

Термин "siPHK" означает малую интерферирующую рибонуклеиновую кислоту.

Термин "TLR" означает Toll-подобный рецептор. TLR может представлять собой любой вид Toll-подобных рецепторов. Предпочтительно, термин относится к Toll-подобному рецептору человека (hTLR), такому как один из TLRs 1-10.

Термин "рак, экспрессирующий TLR" означает опухоль, содержащую клетки, экспрессирующие Toll-подобный рецептор.

Термин "опухолевая клетка, экспрессирующая TLR" означает опухолевую клетку, которая экспрессирует Toll-подобный рецептор.

Термины "экспрессировать", "экспрессирует", "экспрессия" и "экспрессирующий" означают транскрипцию и трансляцию нуклеиновой кислоты с образованием полипептида. В клетке это означает, что полипептид либо будет секретироваться, либо останется в цитоплазме, либо будет находиться, по меньшей мере, частично, в мембране клетки.

Термин "лиганд" означает любую молекулу, способную специфически связываться с другой молекулой, такой как рецептор. Термин "лиганд" включает как агонисты, так и антагонисты. "Лиганд" может быть, например, небольшой молекулой (органической молекулой), антителом или его фрагментом, siRNA, антисмысловой нуклеиновой кислотой, полипептидом, ДНК и РНК.

Термин "лиганд TLR" означает любую молекулу, способную специфически связываться с Toll-подобным рецептором, в частности с рецепторами человека TLRs 1-10. Термин "лиганд TLR" включает как агонисты, так и антагонисты TLRs. "Лиганд TLR" может, например, представлять собой небольшую молекулу (органическую молекулу), антитело или его фрагмент, siRNA, антисмысловую нуклеиновую кислоту, полипептид, ДНК и РНК.

Термин "соответствующий лиганд TLR" означает лиганд, связывающийся с конкретным TLR. Например, лиганд TLR1 является соответствующим лигандом TLR для TLR1. Аналогично, лиганд TLR2 является соответствующим лигандом TLR для TLR2. Этот же принцип применим к TLRs 3-10.

Термин "пациент" означает как человека, так и животных.

Термин "Poly IC" означает полиинозиновую-полицитидиловую кислоту.

Термин "Poly AU" означает полиадениловую-полиуридиловую кислоту.

Термин "терапевтически эффективное количество" означает количество композиции, такой как лиганд TLR, которое смягчает один или более параметров, характеризующих медицинские состояния, вызываемые или опосредуемые TLR, такие как рак.

Термины "эффективное количество" и "количество, эффективное для" означают количество фармацевтической композиции, такой как лиганд TLR, которое вызывает определенный эффект, такой как индукция апоптоза в клетке.

Термин "низкая доза" означает количество вещества, меньшее, чем количество, считающееся нормальным для достижения определенного эффекта, такого как терапевтический эффект.

Характеристика Toll-подобного рецептора (TLR)

Семейство Toll-подобных рецепторов человека (hTLRs) состоит из десяти членов, hTLRs 1-10. Нуклеотидная последовательность полной открытой рамки считывания и соответствующая аминокислотная последовательность каждого из hTLRs 1-10 известны в данной области техники. Например, последовательности для hTLRs 1-10 описаны в РСТ-публикации WO 01/90151, хотя последовательности пронумерованы иначе, чем в общей номенклатуре. Нуклеотидную и аминокислотную последовательности для каждого из hTLRs 1-10 можно также найти в базе данных GenBank ®, как показано ниже в Таблице 1.

Специалист в данной области техники, зная последовательности нуклеиновой кислоты и аминокислоты любого TLR, способен получить любой белок TLR или его фрагмент, антитело к белку или фрагменту, нуклеиновую кислоту или ее фрагмент, зонд нуклеиновой кислоты, антисмысловую, siRNA, и т.д. при использовании стандартных способов молекулярной биологии. Эти молекулы можно использовать для отбора рака или опухолевой клетки, экспрессирующих TLR.

Были идентифицированы некоторые лиганды TLR, приведенные ниже в Таблице 2. Специалист в данной области техники может выделить или получить любой из указанных ниже лигандов. Альтернативно, лиганды могут быть приобретены из коммерческих источников.

Таблица 2
TLR Лиганды
TLR1 Липопептиды микоплазмы (диацилированные липопротеины) (Sigma-Aldrich)
TLR2 Липопептиды микоплазмы (диацилированные липопротеины) (Sigma-Aldrich), бактериальные липопептиды (Sigma-Aldrich)
TLR3 Двухцепочечная РНК (dsRNA) (Invivogen), полидениловая-полиуридиловая кислота (Poly AU) (Invivogen), полиинозиновая-полицитидиловая кислота (Poly IC) (Invivogen)
TLR4 LPS (липополисахарид) (Sigma-Aldrich)
TLR5 Флагеллин (Calbiochem)
TLR6 Бактериальные липопептиды (Sigma-Aldrich)
TLR7 Имиквимод (Aldara®) (ЗМ Pharmaceuticals), R848 (ЗМ Pharmaceuticals)
TLR8 R848 (ЗМ Pharmaceuticals)
TLR9 CpG DNA (MWG Biotech)
TLR10 He известны

TLR функционируют как медиаторы иммунной реакции. Поэтому терапевтические применения для TLR существуют в областях онкологии, инфекционных заболеваний, аутоиммунитета, аллергии, астмы, хронической обструктивной болезни легких (ХОБЛ) и кардиологии.

Настоящее изобретение основано, частично, на открытии, что некоторые типы опухолевых клеток экспрессируют Toll-подобные рецепторы, и что связывание лиганда с этими TLR способствует появлению и повышению эффективности иммунных реакций, направленных на опухоль.

Выбор рака или опухолевой клетки, экспрессирующих TLR

Этап способа по изобретению включает выбор пациента, у которого наблюдается рак, экспрессирующий TLR, или выбор опухолевой клетки, экспрессирующей TLR.

Термин "выбор" означает идентификацию чего-то, представляющего интерес. В контексте настоящей заявки фраза "выбор пациента" означает идентификацию пациента, имеющего специфическую характеристику, такую как рак, экспрессирующий TLR. Фраза "выбор опухолевой клетки, экспрессирующей TLR" означает идентификацию опухолевой клетки, которая экспрессирует Toll-подобный рецептор.

Как известно в данной области техники, существует множество способов выбрать пациента, у которого наблюдается рак, экспрессирующий TLR, или выбрать опухолевую клетку, экспрессирующую TLR. Например, можно использовать антитело или фрагмент антитела для связывания и идентификации опухолевой клетки, экспрессирующей TLR. Предпочтительно, для связывания и идентификации опухолевой клетки, экспрессирующей TLR3, используют антитело к TLR3. Антитело или его фрагмент можно использовать in vivo в фармацевтической композиции или in vitro. Предпочтительно, пациенту проводят биопсию и отбирают опухолевые клетки in vitro. Также возможно увеличить экспрессию TLR перед биопсией, как потенциальное средство отбора пациентов, которые иначе не были бы включены в протокол лечения лигандом TLR. В случае TLR3, можно вводить низкую дозу интерферона типа 1 (I IFN) или самого лиганда TLR3 в течение нескольких дней перед биопсией или перед любой другой диагностической процедурой (аспирация через иглу или медицинское получение изображения). Альтернативно, для связывания и идентификации опухолевой клетки, экспрессирующей TLR, можно использовать любой из лигандов TLR, указанных в Таблице 2 настоящей заявки, или других малых молекул. Предпочтительно, для связывания и идентификации клетки, экспрессирующей TLR3, используют лиганд TLR3. В этом случае также этап выбора предпочтительно проводить in vitro. Кроме того, опухолевые клетки можно лизировать, чтобы определить, есть ли в клетках повышенные уровни конкретного белка TLR (Вестерн-блоттингом) или РНК конкретного TLR (Нозерн-блоттингом).

Процесс выбора может включать использование детектируемых меток. Например, для обнаружения описанных выше антител, фрагментов антител, малых молекул, ДНК, РНК и других лигандов их может быть необходимо пометить. Обнаружение можно проводить визуально или при помощи устройства. Обнаруживаемые метки, обычно используемые в данной области техники, включают, например, радиоактивные метки, флуоресцентные метки и ферментативные метки, хотя можно использовать любую обнаруживаемую метку.

В дополнение к идентификации опухолевой клетки, экспрессирующей TLR, на этапе выбора, вероятно, будет идентифицировано, какой именно Toll-подобный рецептор (TLRs 1-10) экспрессирует конкретная опухолевая клетка. Это объясняется тем фактом, что многие антитела, фрагменты антител, ДНК, РНК, малые молекулы или другие лиганды, используемые для отбора опухолевой клетки, экспрессирующей TLR, специфически связываются с отдельными TLR из TLRs 1-10.

Этап выбора пациента, у которого наблюдается рак, экспрессирующий TLR, или выбора опухолевой клетки, экспрессирующей TLR, может также быть осуществлен косвенным способом. Например, экспрессия специфического TLR при раке может быть связана с определенным подтипом рака с определенной этиологией. Любой маркер этой определенной этиологии, такой как вирус, может указывать на экспрессию данного TLR и может быть маркером, обусловливающим выбор используемого соответствующего лиганда TLR.

Введение пациентам лигандов TLR

Другой этап способа по изобретению включает введение пациенту терапевтически эффективного количества лиганда TLR. Этот этап включает введение лиганда TLR в фармацевтической композиции. Например, фармацевтическая композиция может быть представлена в форме таблетки, так чтобы лиганд абсорбировался в кровоток. Затем по системе кровообращения лиганд TLR может быть доставлен к раку, экспрессирующему TLR, таким образом обеспечивая контакт лиганда и рака. Этот этап контакта позволяет лиганду связаться с Toll-подобным(и) рецептором(ами) рака и вызвать ингибирование роста и апоптоз раковых клеток. Как вариант, фармацевтическую композицию можно вводить локально или топически, как при лечении меланомы.

Как указано выше, на этапе выбора вероятна идентификация конкретного TLR, экспрессируемого раком. Предпочтительно, этап введения включает введение соответствующего лиганда пациенту, у которого наблюдается рак, экспрессирующий Toll-подобный рецептор. Например, если рак экспрессирует TLR1, то пациенту предпочтительно вводить эффективное количество лиганда TLR1. Аналогично, если рак экспрессирует TLR2, то пациенту предпочтительно вводить эффективное количество лиганда TLR2. Тот же принцип применим к TLRs 3-10.

Предпочтительно, способ по изобретению включает введение пациенту, у которого наблюдается TLR3-экспрессирующй рак, эффективного количества лиганда TLR3. Предпочтительно, лиганд TLR3 является агонистом. Более предпочтительно, лиганд TLR3 представляет собой Poly AU. Наиболее предпочтительно, лиганд TLR3 представляет собой Poly IC. Предпочтительно, рак представляет собой рак толстой кишки или рак груди.

Предпочтительно, способ по изобретению дополнительно включает введение пациенту химиотерапевтического агента или лечение рака.

Предпочтительно, способ по изобретению дополнительно включает введение пациенту низкой дозы I IFN или лиганда TLR3. Например, низкая доза I IFN находится в пределах 1-3 ME, предпочтительно - 2 ME. Более предпочтительно, низкая доза I IFN составляет менее 1 ME.

Контакт опухолевых клеток, экспрессирующих TLR, с лигандами TLR

Как вариант, этап способа по настоящему изобретению включает контакт опухолевой клетки, экспрессирующей TLR, с эффективным количеством лиганда TLR. In vivo этап контакта представляет собой введение пациенту лиганда TLR в фармацевтической композиции. In vitro этап контакта представляет собой приведение опухолевой клетки, экспрессирующей TLR, и лиганда TLR в непосредственную физическую близость, таким образом, что лиганд и клетка могут контактировать друг с другом. Этот этап контакта позволяет лиганду связаться с Toll-подобным рецептором и вызвать ингибирование роста и апоптоз опухолевой клетки.

Как указано выше, на этапе выбора вероятна идентификация конкретного TLR, экспрессируемого опухолевой клеткой. Предпочтительно, этап контакта включает контакт клетки, экспрессирующей Toll-подобный рецептор, с соответствующим лигандом. Например, если рак экспрессирует TLR1, то пациенту предпочтительно вводить эффективное количество лиганда TLR1. Аналогично, если рак экспрессирует TLR2, то пациенту предпочтительно вводить эффективное количество лиганда TLR2. Тот же принцип применим к TLRs 3-10.

Предпочтительно, способ по изобретению включает контакт опухолевой клетки, экспрессирующей TLR3, с эффективным количеством лиганда TLR3. Предпочтительно, лиганд TLR3 является агонистом. Более предпочтительно, лиганд TLR3 представляет собой Poly AU. Наиболее предпочтительно, лиганд TLR3 представляет собой Poly IC. Предпочтительно, рак представляет собой рак толстой кишки или рак груди.

Предпочтительно, способ по изобретению дополнительно включает контакт клетки с химиотерапевтическим агентом или лечение рака.

Предпочтительно, способ по изобретению дополнительно включает контакт клетки с низкой дозой I IFN или лиганда TLR3. Например, низкая доза I IFN находится в пределах 1-3 ME, предпочтительно - 2 ME. Более предпочтительно, низкая доза I IFN составляет менее 1 ME.

Полипептиды

В способе по настоящему изобретению полипептиды, такие как антитело, фрагмент антитела или липопептид, могут использоваться на этапе выбора, для отбора рака или клетки, экспрессирующих TLR, на этапе введения, для доставки лиганда TLR пациенту, или на этапе контакта, для индукции ингибирования роста и апоптоза клетки, экспрессирующей TLR. Кроме того, полипептиды TLR или их фрагменты могут быть получены для идентификации или получения лигандов, таких как антитело, которые будут связываться с TLR.

В настоящем описании термин "полипептид" или "пептид" означает фрагмент или сегмент, например, полипептида, содержащего, по меньшей мере, 8, предпочтительно - по меньшей мере, 12, более предпочтительно - по меньшей мере, 20 и наиболее предпочтительно - по меньшей мере, 30 или более последовательных аминокислотных остатков, достигающих числом и включающих общее число остатков в полном белке. Термин "полипептид" также охватывает делеции, вставки, модификации, замены, аналоги, варианты и гликозилированные или негликозилированные полипептиды.

Замены включают как консервативные, так и неконсервативные замены.

Модификации аминокислотных остатков могут включать, без ограничения, алифатические эфиры или амиды карбокси-концов или остатков, содержащих карбоксильные боковые цепи, O-ацил-производные остатков, содержащих гидроксильные группы, и N-ацил-производные амино-концевой аминокислоты или остатков, содержащих аминогруппу, например, лизина или аргинина.

Аналоги представляют собой полипептиды, содержащие модификации, такие как включение неприродных аминокислотных остатков, или фосфорилированных аминокислотных остатков, таких как остатки фосфотирозина, фосфосерина или фосфотреонина. Другие возможные модификации включают сульфонирование, биотинилирование или добавление других фрагментов, особенно тех, молекулярные формы которых аналогичны форме фосфатных групп.

Методы синтеза полипептидов описаны, например, в Merrifield, J. Amer. Chem. Soc. 85:2149 (1963); Merrifield, Science 232:341 (1986); и Atherton et al., Solid Phase Peptide Synthesis: A Practical Approach, 1989, IRL Press, Oxford.

Аналоги полипептидов можно получать химическим синтезом или при использовании сайт-направленного мутагенеза [Gillman et al. Gene 8:81 (1979); Roberts et al. Nature, 328:731 (1987) или hmis (Ed.), 1990, PCR Protocols: A Guide to Methods and Applications, Academic Press, New York, NY] или метода полимеразной цепной реакции [PCR; Saiki et al. Science 239:487 (1988)], как описано, например, в Daugherty et al. [Nucleic Acids Res. 79:2471 (1991)] для модификации нуклеиновых кислот, кодирующих полные рецепторы. Также применимо добавление меток-эпитопов для очистки или детекции рекомбинантных продуктов.

Нуклеиновые кислоты

Нуклеиновые кислоты могут использоваться для выбора пациента, у которого наблюдается рак, экспрессирующий TLR, или для выбора TLR-экспрессирующей опухолевой клетки. Для выбора пациента предпочтительно проводить биопсию опухоли пациента.

Затем клетки опухоли можно анализировать in vitro на наличие экспрессии нуклеиновых кислот TLR.

Как указано в Таблице 1 настоящей заявки, последовательности нуклеиновых кислот и аминокислот каждого из hTLRs 1-10 известны в данной области техники. Специалист в данной области техники может использовать известные последовательности или их фрагменты для организации гибридизационного анализа, чтобы определить, экспрессирует ли конкретная опухолевая клетка нуклеиновые кислоты TLR. Например, используя известную последовательность конкретного TLR, специалист в данной области техники может провести Нозерн-блот-анализ, чтобы определить, экспрессирует ли опухолевая клетка этот конкретный TLR.

Кроме того, нуклеиновые кислоты, кодирующие конкретные TLR, или их фрагменты можно использовать для получения полипептидов TLR. Полипептиды TLR затем можно использовать для получения антител к специфическим TLR.

В настоящем описании "фрагмент нуклеиновой кислоты" определяется как нуклеотидная последовательность, содержащая, по меньшей мере, 17, обычно, по меньшей мере, 25, предпочтительно - по меньшей мере, 35, более предпочтительно - по меньшей мере, 45 и наиболее предпочтительно - по меньшей мере, 55 или более последовательных нуклеотидов.

Общие методы манипуляций с нуклеиновыми кислотами и их экспрессии описаны, например, в Sambrook, et al. Molecular Cloning: A Laboratory Manual (2d ed.), 1989, Vols. 1-3, Cold Spring Harbor Laboratory.

Получение антитела

В способе по настоящему изобретению антитела и их фрагменты, специфичные к TLR, можно использовать либо на этапе выбора, для отбора TLR-экспрессирующей клетки, на этапе введения, для доставки лиганда TLR пациенту, или на этапе контакта, для индукции ингибирования роста и апоптоза TLR-экспрессирующей клетки.

Можно получать антигенные (т.е. иммуногенные) фрагменты отдельного TLR. Вне зависимости от того, связывают ли они лиганды TLR, такие фрагменты, как и полные рецепторы, применимы в качестве антигенов для получения антител, которые могут связываться с полными рецепторами. Более короткие фрагменты могут быть последовательно соединены или присоединены к носителю. Поскольку в данной области техники известно, что эпитопы, в общем, содержат, по меньшей мере, около 5, предпочтительно - по меньшей мере, 8 аминокислотных остатков [Ohno et al., Proc. Natl. Acad. Sci. USA 82:2945 (1985)], то фрагменты, используемые для получения антител, в общем, будут, по меньшей мере, такого размера. Предпочтительно, они содержат даже более остатков, как описано выше. Является ли определенный фрагмент иммуногенным, можно легко определить рутинным экспериментом.

Хотя при использовании полных TLRs в качестве антигенов для стимуляции продукции антител в иммунологически компетентном хозяине это обычно не является необходимым, более маленьким антигенным фрагментам предпочтительно предварительно придать большую иммуногенность путем сшивки или последовательного соединения, или присоединения к иммуногенной молекуле-носителю (т.е. к макромолекуле, имеющей свойство независимого возбуждения иммунологического ответа в животном-хозяине). Сшивание или присоединение к молекуле-носителю могут быть необходимы, потому что небольшие полипептидные фрагменты иногда действуют как гаптены (молекулы, способные специфически связываться с антителом, но не способные вызывать продукцию антител, т.е. не являющиеся иммуногенными). Конъюгирование таких фрагментов с иммуногенной молекулой-носителем делает эти фрагменты более иммуногенными посредством эффекта, известного как "эффект носителя".

К подходящим молекулам-носителям относятся, например, белки и природные или синтетические полимерные соединения, такие как полипептиды, полисахариды, липополисахариды и т.д. Особенно предпочтительными являются белковые молекулы-носители, включая, без ограничения, гемоцианин лимфы улитки и белки сыворотки млекопитающих, такие как гамма-глобулин человека или быка, сывороточный альбумин человека, быка или кролика, или метилированные или другие производные таких белков. Специалисту в данной области техники будут также очевидны другие белковые носители. Предпочтительно, но необязательно, белковый носитель является чужеродным для животного-хозяина, в котором будут получать антитела к фрагментам.

Ковалентное присоединение к молекуле-носителю может быть осуществлено при использовании известных в данной области техники методов, выбор которых обусловлен природой используемой молекулы-носителя. Если иммуногенной молекулой-носителем является белок, то фрагменты по изобретению могут быть присоединены, например, при использовании водорастворимых карбодиимидов, таких как дициклогексилкарбодиимид или глутаровый альдегид.

Агенты присоединения, подобные указанным, можно также использовать для сшивки фрагментов друг с другом без использования отдельной молекулы-носителя. Такая сшивка в агрегаты может также повысить иммуногенность. Иммуногенность можно также повысить при использовании известных адъювантов, по отдельности или в комбинации с присоединением или агрегированием.

К подходящим адъювантам для вакцинации животных относятся, без ограничения, Адъювант 65 (содержащий арахисовое масло, маннид моноолеат и моностеарат алюминия); полный или неполный адъювант Фрейнда; минеральные гели, такие как гидроксид алюминия, фосфат алюминия или квасцы; поверхностно-активные вещества, такие как гексадециламин, октадециламин, лизолецитин, диметилдиоктадециламмония бромид, N,N-диоктадецил-N',N'-бис(2-гидроксиметил) пропандиамин, метоксигексадецилглицерин и плурониковые полиолы; полианионы, такие как пиран, декстран сульфат, poly IC, полиакриловая кислота и карбопол; пепиды, такие как мурамил дипептид, диметилглицин и туфтсин; и масляные эмульсии. Полипептиды также можно вводить после включения в липосомы или другие микроносители.

Информация, касающаяся адъювантов и различных аспектов иммунологических исследований, приведена, например, в серии Р. Tijssen, Practice and Theory of Enzyme Immunoassays, 3rd Edition, 1987, Elsevier, New York. К другим полезным ссылкам, описывающим методы получения поликлональных антисывороток, относятся Microbiology, 1969, Hoeber Medical Division, Harper and Row; Landsteiner, Specificity of Serological Reactions, 1962, Dover Publications, New York, и Williams, et al. Methods in Immunology and Immunochemistry, Vol.1, 1967, Academic Press, New York.

Сыворотку, полученную от животных, иммунизированных при использовании стандартных методов, можно использовать непосредственно, или от сыворотки можно отделить фракцию IgG при использовании стандартных методов, таких как плазмафорез или адсорбционная хроматография с адсорбентами, специфическими к IgG, такими как иммобилизованный Протеин А. Альтернативно, можно получить моноклональные антитела.

Гибридомы, продуцирующие моноклональные антитела против TLR или их антигенных фрагментов, получают хорошо известными методами. Обычно процесс включает слияние клеточной линии, придающей бессмертие, с В-лимфоцитом, продуцирующим требуемое антитело. Альтернативно, для получения перевиваемых (бессмертных) клеточных линий, продуцирующих антитело, можно использовать методы, не требующие слияния, например, вирус-индуцированную трансформацию [Casali et al., Science 234:476 (1986)]. Клеточные линии, придающие бессмертие, обычно представляют собой трансформированные клетки млекопитающих, особенно миеломные клетки, полученные от грызуна, быка или человека. Наиболее часто используют клеточные линии миеломы мышей или крыс, ввиду удобства и доступности.

Способы получения лимфоцитов, продуцирующих антитело, от млекопитающих, которым введены антигены, хорошо известны. В общем, если используют клетки, полученные от человека, то используют лимфоциты периферической крови (PBL), а для клеток, полученных из других млекопитающих, используют клетки селезенки или лимфатического узла. Животному-хозяину вводят повторяющиеся дозы очищенного антигена (клетки человека сенсибилизируют in vitro), и оставляют животное до появления клеток, продуцирующих требуемое антитело, затем их собирают для слияния с клеточной линией, придающей бессмертие. Методы слияния также хорошо известны в данной области техники, и в общем, включают смешивание клеток с агентом слияния, таким как полиэтиленгликоль.

Гибридомы отбирают стандартными методами, такими как селекция HAT (гипоксантин-аминоптерин-тимидин). Гибридомы, секретирующие требуемое антитело, отбирают при использовании стандартных методов иммунологического анализа, таких как Вестерн-блоттинг, ELISA (твердофазный иммуноферментный анализ), РИА (радиоиммунологический анализ), или подобные. Антитела выделяют из среды при использовании стандартных методов очистки белков [Tijssen, Practice and Theory of Enzyme Immunoassays (Elsevier, Amsterdam, 1985)].

Руководство по применению упомянутых методов можно найти в различных источниках [Kohler et al., Hybridoma Techniques (Cold Spring Harbor Laboratory, New York, 1980); Tijssen, Practice and Theory of Enzyme Immunoassays (Elsevier, Amsterdam, 1985); Camp-bell, Monoclonal Antibody Technology (Elsevier, Amsterdam, 1984); Hurrell, Monoclonal Hybridoma Antibodies: Techniques and Applications (CRC Press, Boca Raton, FL, 1982)]. Моноклональные антитела можно также получить при использовании хорошо известных систем фаговых библиотек. См., например, Huse, et al., Science 246:1275 (1989); Ward, et al., Nature, 341:544 (1989).

Полученные таким образом антитела, поликлональные или моноклональные, можно использовать, например, в иммобилизованной форме, связанными с твердой подложкой при помощи хорошо известных методов, для выделения рецепторов иммуноаффинной хроматографией.

В качестве основы для иммунологических анализов на TLR можно также использовать антитела к антигенным фрагментам, немеченые или меченные стандартными методами. Использование конкретной метки зависит от типа иммунологического анализа. Примерами меток, которые можно использовать, являются, без ограничения, радиоактивные метки, такие как 32P, 125I, 3H и 14С; флуоресцентные метки, такие как флуоресцеин и его производные, родамин и его производные, дансил и умбеллиферон; хемилюминесцентные метки, такие как люцифериа и 2,3-дигидрофталазиндионы; и ферменты, такие как пероксидаза хрена, щелочная фосфатаза, лизоцим и глюкоза-6-фосфат дегидрогеназа.

Метки можно присоединять к антителам известным методами. Например, для присоединения к антителам флуоресцентных, хемилюминесцентных или ферментных меток можно использовать присоединяющие агенты, такие как альдегиды, карбодиимиды, дималеимид, имидаты, сукцинимиды, бисдиазотированный бензадин и подобные соединения. Общие методы хорошо известны в данной области техники и описаны, например, в Immunoassays Practical Guide, 1987, Chan (Ed.), Academic Press, Inc., Orlando, FL. Такие иммунологические анализы можно проводить, например, на фракциях, полученных при очистке рецепторов.

Антитела настоящего изобретения можно также применять для идентификации конкретных клонов кДНК, экспрессирующих TLR в экспрессионных системах клонирования.

Нейтрализующие антитела, специфичные к лиганд-связывающему сайгу рецептора, можно также использовать в качестве антагонистов (ингибиторов) для блокирования связывания лиганда. Такие нейтрализующие антитела можно легко идентифицировать путем рутинного эксперимента, например, при использовании исследования связывания с радиолигандом, описанного ниже. Эффекта антагонизма к активности TLR можно достичь при использовании целых молекул антител или хорошо известных антиген-связывающих фрагментов, таких как фрагменты Fab, Fc, F(ab)2 и Fv.

Определения таких фрагментов можно найти, например, в Klein, Immunology (John Wiley, New York, 1982); Parham, Chapter 14, в Weir, ed. Immunochemistry, 4th Ed. (Blackwell Scientific Publishers, Oxford, 1986). Также описано использование и получение фрагментов антител, например, фрагментов Fab [Tijssen, Practice and Theory of Enzyme Immunoassays (Elsevier, Amsterdam, 1985)], фрагментов Fv [Hochman et al., Biochemistry 12:1130 (1973); Sharon et al., Biochemistry 15:1591 (1976); Ehriich et. al., U.S. Patent No. 4,355,023] и половин молекул антител (Auditore-Hargreaves, U.S. Patent No. 4,470,925). Способы получения рекомбинантных фрагментов Fv, основанные на известных последовательностях вариабельных областей тяжелых и легких цепей антител, также описаны, например, в Moore et al. (Патент США 4,642,334) и в Pluckthun [Bio/Technology 9:545 (1991)]. Альтернативно, их можно синтезировать известными химическими методами.

Антиидиотипические антитела как поликлональные, так и моноклональные, можно также получить при использовании антител, полученных против рецепторов в качестве антигенов. Такие антитела могут быть полезны, так как они могут быть подобны рецепторам.

Фармацевтические композиции

Агонисты TLR и антагонисты можно использовать терапевтически, для стимуляции или блокирования активности TLR, и таким образом, для лечения любого медицинского состояния, вызванного или опосредованного TLR. Режим дозировки, используемый при терапевтическом применении, определяется лечащим врачом, с учетом различных факторов, которые могут изменять действие терапевтического вещества, например, состояния, массы тела, пола и диеты пациента, времени введения, и других клинических факторов.

Типичные протоколы для терапевтического введения таких веществ хорошо известны в данной области техники. Введение фармацевтических композиций обычно осуществляют парентеральной, внутрибрюшинной, внутривенной, подкожной или внутримышечной инъекцией, или вливанием или любым другим приемлемым системным методом. Часто дозировки лечения титруются вверх от низкого уровня для оптимизации безопасности и эффективности. В общем, суточные дозировки находятся в диапазоне от около 0,01 до 20 мг белка на килограмм массы тела. Как правило, диапазон дозировки составляет от около 0,1 до 5 мг на килограмм массы тела.

Дозировки изменяются для учета меньших размеров молекул и возможно сниженных периодов полураспада (периодов клиренса) после введения. Специалисту в данной области техники будет понятно, однако, что антагонисты TLR охватывают нейтрализующие антитела или их связывающие фрагменты в дополнение к другим типам ингибиторов, включая малые органические молекулы и ингибирующие аналоги лиганда, которые могут быть идентифицированы при использовании способов по изобретению.

Хотя фармацевтические композиции могут применяться в простом растворе, они более типично используются в комбинации с другими материалами, такими как носители, предпочтительно фармацевтические носители. Применимые фармацевтические носители могут представлять собой любые совместимые, нетоксичные вещества, подходящие для доставки фармацевтических композиций пациенту. Стерильная вода, этиловый спирт, жиры, воски и инертные твердые вещества могут быть включены в носитель. В фармацевтическую композицию могут также быть включены фармацевтически приемлемые адъюванты (буферные агенты, диспергирующие агенты). Как правило, композиции, применимые при парентеральном введении таких препаратов, хорошо известны, см., например, Remington's Pharmaceutical Science, 17th Ed. (Mack Publishing Company, Easton, PA, 1990). Альтернативно, фармацевтические композиции можно вводить в тело пациента посредством имплантируемых систем доставки лекарственного средства [Urquhart et al., Ann. Rev. Pharmacol. Toxicol. 24:199(1984)].

Терапевтические составы могут применяться в виде различных обычных составов дозировки. Составы обычно включают, по меньшей мере, один активный ингредиент, вместе с одним или более фармацевтически приемлемыми носителями. Составы могут предназначаться для перорального, ректального, назального или парентерального (включая подкожное, внутримышечное, внутривенное и внутрикожное) введения.

Составы могут быть удобно представлены в форме дозировочной единицы и могут быть получены любыми методами, известными в области фармацевтики. См., например, Gilman et al. (eds.) (1990), The Pharmacological Bases of Therapeutics, 8th Ed., Pergamon Press; и Remington's Pharmaceutical Sciences, выше, Easton, Penn.; Avis et al. (eds.) (1993) Pharmaceutical Dosage Forms: Parenteral Medications Dekker, New York; Lieberman et al. (eds.) (1990) Pharmaceutical Dosage Forms: Tablets Dekker, New York; и Lieberman et al. (eds.) (1990), Pharmaceutical Dosage Forms: Disperse Systems Dekker, New York.

Комбинированные терапии

Эффективности лиганда TLR в предотвращении или лечении рака можно повысить путем введения лиганда в комбинации с другим агентом или лечением, эффективным для этой цели. Например, лиганд TLR можно вводить в комбинации с химиотерапевтическим агентом или с лечением рака. Предпочтительно, лиганд TLR представляет собой агонист TLR3.

"Химиотерапевтический агент" представляет собой химическое соединение, применимое при лечении рака. Примерами химиотерапевтических агентов являются алкилирующие агенты, такие как тиотепа и циклосфосфамид (CYTOXAN™); алкилсульфонаты, такие как бусульфан, импросульфан и пипосульфан; азиридины, такие как бензодопа, карбоквон, метуредопа и уредопа; этиленимины и метиламеламины, включая альтретамин, триэтиленмеламин, триэтиленфосфорамид, триэтилентиофосфорамид и триметиломеламин; ацетогенины (особенно буллатацин и буллатацинон); камптотецин (включая синтетический аналог топотекан); бриостатин; каллистатин; СС-1065 (включая его адозелезиновый, карзелезиновый и бизелезиновый синтетические аналоги); криптофицины (особенно криптофицин 1 и криптофицин 8); доластатин; дуокармицин (включая синтетические аналоги, KW-2189 и CBI-TMI); элеутеробин; панкратистатин; саркодиктиин; спонгистатин; азотистые иприты (nitrogen mustards); такие как хлорамбуцил, хлорнафазин, хлорофосфамид, эстрамустин, ифосфамид, мехлорэтамин, мехлорэтамин оксид гидрохлорид, мелфалан, новембихин, фенестерин, преднимустин, трофосфамид и урамустин (uracil mustard); нитрозмочевины, такие как кармустин, хлорозотоцин, фотемустин, ломустин, нимустин, ранимустин; антибиотики, такие как энедииновые антибиотики (например, калихеамицин, особенно калихеамицин gamma 1 I и калихеамицин phil1, см., например, Agnew, Chem Intl. Ed. Engl., 33:183-186 (1994); динемицин, включая динемицин А; бисфосфонаты, такие как клодронат; эсперамицин; а также неокарциностатиновый хромофор и связанные хромофоры - хромопротеин энедииновые антибиотики, аклациномизины, актиномицин, аутрамицин, азасерин, блеомицины, кактиномицин, карабицин, карминомицин, карцинофилин, хромомицины, дактиномицин, даунорубицин, деторубицин, 6-диазо-5-оксо-L-норлейцин, доксорубицин (Adriamycin™) (включая морфолино-доксорубицин, цианоморфолино-доксорубицин, 2-пирролидино-доксорубицин и деоксидоксорубицин), эпирубицин, эзорубицин, идару-бицин, марселломицин, митомицины, такие как митомицин С, микофеноловая кислота, ногаламицин, оливомицины, пепломицин, потфиромицин, пуромицин, квеламицин, ро-дорубицин, стрептонигрин, стрептозоцин, туберцидин, убенимекс, зиностатин и зорубицин; антиметаболиты, такие как метотрексат и 5-фтороурацил (5-FU); аналоги фолиевой кислоты, такие как деноптерин, метотрексат, птероптерин и триметрексат; аналоги пурина, такие как флударабин, 6-меркаптопурин, тиамиприн и тиогуанин; аналоги пиримидина, такие как анцитабин, азацитидин, 6-азауридин, кармофур, цитарабин, дидезоксиуридин, доксифлуридин, эноцитабин и флоксуридин; андрогены, такие как калустерон, дромостанолон пропионат, эпитиостанол, мепитиостан и тестолактон; антиадреналиновые препараты, такие как аминоглутетимид, митотан и трилостан; компенсатор фолиевой кислоты, такой как фролиновая кислота; ацеглатон; альдофосфамид гликозид; аминолевулиновая кислота; энилурацил; амсакрин; бестрабуцил; бисантрен; эдатраксат; дефофамин; демеколцин; диазиквон; элфорнитин; эллиптиниум ацетат; эпотилон; этоглуцид; нитрат галлия; гидроксимочевина; лентинан; лонидамин; мэйтансиноиды, такие как мэйтансин и ансамитоцины; митогуазон; митоксантрон; мопидамол; нитракрин; пентостатин; фенамет; пирарубицин; лозоксантрон; подофиллиновая кислота; 2-этилгидразид; прокарбазин; PSK®; разоксан; ризоксин; сизофиран; спирогерманий; тенуазоновая кислота; триазиквон; 2,2',2''-трихлортриэтиламин; трихотецены (особенно Т-2 токсин, верракурин А, роридин А и ангуидин); уретан; виндезин; дакарбазин; манномустин; митобронитол; митолактол; пипоброман; гацитозин; арабинозид ("Ara-С"); циклофосфамид; тиотепа; таксоиды, например, паклитаксел (TAXOL®, Bristol Myers Squibb Oncology, Princeton, N.J.) и доксетаксел (TAXOTERE®, Rhone-Poulenc Rorer, Antony, France); хлорамбуцил; гемцитабин (Gemzar™); 6-тиогуанин; меркаптопурин; метотрексат; платиновые аналоги, такие как цисплатин и карбоплатин; винбластин; платина; этопозид (VP-16); ифосфамид; митоксантрон; винкристин; винорелбин (Navel-bineT™); новантрон; тенипозид; эдатрексат; дауномицин; аминоптерин; кселода; ибандронат; СРТ-11; ингибитор топоизомераз RFS 2000; дифторметилорнитин (DMFO); ретиноиды, такие как ретиноевая кислота; капецитабин; и фармацевтически приемлемые соли, кислоты или производные любого из вышеупомянутых соединений. Также это определение охватывает антигормональные агенты, которые регулируют или ингибируют действие гормона на опухолях, такие как антиэстрогены и селективные модуляторы эстрогенового рецептора (SERM), включая, например, тамоксифен (включая Nolvadex™), ралоксифен, дролоксифен, 4-гидрокситамоксифен, триоксифен, кеоксифен, LY 117018, онапристон и торемифен (Fareston™); ингибиторы ароматазы, которые ингибируют фермент ароматазу, который регулирует продукцию эстрогена в надпочечниках, такие как, например, 4(5)-имидазолы, аминоглутетимид, мегестрол ацетат (Magace™), экземестан, форместан, фадрозол, ворозол (Rivisor™), летрозол (Femara™), и анастрозол (Arimidex™); и антиандрогены, такие как флутамид, нилутамид, бикалутамид, лейпролид и гозерелин; и фармацевтически приемлемые соли, кислоты или производные любого из вышеупомянутых соединений.

"Лечение рака" включает операцию по удалению рака и радиационное лечение, для уменьшения или уничтожения рака или опухоли.

Эффективность лиганда TLR в предотвращении или лечении рака можно также повысить путем введения лиганда в комбинации с низкой дозой интерферона типа I (I IFN). Например, низкая доза интерферона типа I находится в пределах 1-3 ME (MU), предпочтительно - 2 ME. Более предпочтительно, низкая доза интерферона типа I составляет менее 1 ME. Предпочтительно, лиганд TLR представляет собой агонист TLR3.

Как указано выше, режим дозировки, используемый в комбинированной терапии, определяется лечащим врачом.

Примеры

Настоящее изобретение будет лучше понятно при ссылке на следующие неограничивающие примеры, которые приведены в качестве примера осуществления изобретения. Следующие примеры приведены с целью более полной иллюстрации изобретения и никоим образом не должны рассматриваться как ограничивающие объем изобретения. Если не указано иначе, процентные соотношения, приведенные ниже для твердых веществ в твердых смесях, жидкостей в жидкостях, и твердых веществ в жидкостях, выражены на основании отношений масса/масса, объем/объем и масса/объем, соответственно. Как правило, при культивировании клеток поддерживают стерильные условия.

Материалы и общие методы

Используют стандартные методы, описанные, например, в Maniatis et al., Molecular Cloning: A Laboratory Manual, 1982, Cold Spring Harbor Laboratory, Cold Spring Harbor Press; Sambrook et al., Molecular Cloning: A Laboratory Manual, (2d ed.), Vols 1-3, 1989, Cold Spring Harbor Press, NY; Ausubel et al., Biology, Greene Publishing Associates, Brooklyn, NY; или Ausubel, et al. (1987 и Дополнения), Current Protocols in Molecular Biology, Greene/Wiley, New York; Innis et al. (eds.) PCR Protocols: A Guide to Methods and Applications, 1990, Academic Press, N.Y.

Клеточные линии и реактивы

Линии клеток рака груди человека, Cama-1, SW527, ВТ-483 и MCF-7 получают из коллекции АТСС (Rockville, MD) и культивируют в среде DMEM F12, содержащей 4,5 г/мл глюкозы (Invitrogen, San Diego, CA) с добавлением 2 мМ L-глутамина (Life Technologies, Paisley Park, GB), 10% эмбриональной сыворотки телят (Life Technologies), 160 мкг/мл генталлина (Schering Plough, Kenilworth, NJ), 2,5 мг/мл бикарбоната натрия (Life Technologies), аминокислот (Invitrogen) и 1 мМ пирувата натрия (Sigma-Aldrich, Saint Louis, МО) (такую среду называют полной средой). Полиинозиновую-полицитидиловую кислоту. Poly IC, получают из Invivogen (San Diego, CA). Пепти-догликан (PGN) и липополисахарид (LPS) приобретают в Sigma-Aldrich. Моноклональное антитело (mAb), блокирующее рецептор интерферона типа I, приобретают в PBL Biochemical Laboratories (Piscataway, NJ), a mAb, нейтрализующее TNF-α, приобретают в Genzyme (Cambridge, MA). Антитела к Stall, фосфорилированному Stall (тирозин 701) и PKR приобретают в Cell Signaling (Beverly, MA). Антитела к IFN-β человека приобретают в R&D Systems (Minneapolis, MIN). Антитела к субъединице NF-κB р65, TRAF6 и β-тубулину приобретают в Santa Cruz Biotechnology (Santa Cruz, CA). Общий ингибитор капазы z-VAD-fmk приобретают в R&D Systems. Циклогексимид (СНХ) приобретают в Sigma-Aldrich.

Первичный образец рака груди человека получен в Centre Léon Bérard (Lyon, France) в соответствии с протоколами госпиталя по биоэтике. Моноклеточную суспензию получают после расщепления коллагеназой А (Sigma-Aldrich) и промывки и обогащения в клетках, положительных по эпителиальному антигену человека (Human Epithelial Antigen (НЕА)) при использовании микробусин с НЕА (Mylteni Biotech, Bergisch Gladbach, Germany) согласно инструкции производителя. Конечная моноклеточная суспензия содержит более 80% НЕА-положительных клеток и менее 2% CD4+ гематопоэтических примесей.

Анализ апоптоза

Восстановление клеток после обработки лигандами TLR измеряют окрашиванием кристалл-виолетом (Sigma-Aldrich). Клетки засевают с плотностью 104 клеток/лунку в 96-луночные планшеты. Через 72 часа культивирования с лигандом TLR или без него клетки промывают PBS (фосфатным солевым буфером), фиксируют в 6% формальдегиде (Sigma-Aldrich) в течение 20 минут, дважды промывают, а затем окрашивают 0,1% кристалл-виолетом в течение 10 минут. После промывки и инкубации в 1% SDS (додецилсульфате натрия) в течение 1 часа считывают поглощение при 605 нм на считывателе для планшетов Vmax plate reader (Molecular Devices, Sunnyvale, CA). Проводят окрашивание аннексином (Annexin) V при использовании набора для обнаружения апоптоза (annexin-FITC apoptosis detection kit, BD Pharmingen, San Diego, CA) согласно инструкции производителя. Субдиплоидные клетки обнаруживают окрашиванием 3 мкг/мл пропидия йодида (PI) (Molecular probes, Eugene, OR) после пермеабилизации в течение ночи в 70% этаноле. Флуоресценцию анализируют проточной цитометрией на приборе FACScalibur (Becton Dickinson, Mountain View, CA), оборудованном модулем дискриминации дублетов и при использовании программного обеспечения Cellquest Pro (Becton Dickinson).

Биохимия

Клетки Cama-1 лизируют в буфере, содержащем 1% нонидет Р40 (Nonidet-P40). На дорожку в SDS-полиакриламидном геле (Invitrogen) загружают в общем 20 мкг белка. Вестерн-блоттинг (WB) проводят стандартным методом при использовании антител, описанных выше. Моноклональные антитела анти-IRAK-4 получают в лаборатории согласно протоколу, описанному в Fossiez et al., "T cell interleukin-17 induces stromal cells to produce promflammatory and hematopoietic cytokines", J. Exp.Med., vol. 183(6), pp.2593-2603 (1996).

Секреция цитокина

Секрецию IL-6 измеряют в супернатантах культуры стандартным методом твердофазного иммуноферментного анализа (ELISA) при использовании набора DuoSet ELISA kit согласно инструкции производителя (R&D Systems).

Эксперимент с siPHK

Клетки Cama-1 засевают в 6-луночные планшеты с плотностью 3х105 клеток/лунку. После адгезии в течение ночи проводят трансфекции siPHK в течение 5 часов в среде ОрtiMEM (Life Technologies), содержащей 3 мкг/мл липофектамина 2000 (Invitrogen) и 100 нМ siPHK. Затем клетки промывают и культивируют 72 часа в полной среде, с последующей обработкой Poly IC и анализом апоптоза. Дуплексы siPHK, специфичные к TLR3, PKR, IRAK-4, TRAF6 и р65, приобретают в Dharmacon (Lafayette, CO) в виде реагентов SMART-Pool. siPHK к TRIF приобретают у того же производителя в виде единичных олигодуплексов (5'-GCUCUUGUAUCUGAAGCAC-3') (SEQ ID NO:23). Экспрессию TLR3 и TRIF оценивают в ПЦР (35 циклов: 1 мин 94°С, 1 мин 55°С, 2 мин 72°С) со смесью Taq PCR ReadyMix (Sigma-Aldrich) при использовании следующих праймеров:

5'-AACGATTCCTTTGCTTGGCTTC-3' (прямой) (SEQ ID NO:24)/

5'-GCTTAGATCCAGAATGGTCAAG-3' (обратный) (SEQ ID NO:25) для TLR3 и

5'-ACTTCCTAGCGCCTTCGACA-3' (прямой) (SEQ ID NO:26)/

5'-ATCTTCTACAGAAAGTTGGA-3' (обратный) (SEQ ID NO:27) для TRIF.

Экспрессию PKR, IRAK-4, TRAF6 и р65 оценивают в Вестерн-блоттинге, как описано выше.

Пример 1

В этом ряду экспериментов экспрессию TLR для каждого из TLR 1-10 обнаруживают методом ОТ-ПЦР в шести клеточных линиях колоректальной аденокарциномы человека. Используют следующие линии клеток: Сасо 2, LoVo, Colo 320 DM, SNU-C1, T84 и Colo 205. Из каждой клеточной линии экстрагируют равные количества мРНК. Затем мРНК амплифицируют методом ПЦР, 35 циклов (30 сек 94°С, 45 сек 60°С, 90 сек 72°С) при использовании праймеров, специфичных к hTLR. Используют следующие праймеры:

TLR1F: caggatcaaggtacttgatcttc (SEQ ID NO:1);

TLR1R: tttctctcatgaaggcaaatctg (SEQ ID NO:2);

TLR2F: ctcaggagcagcaagcactg (SEQ ID NO:3);

TLR2R: atcttccgcagcttgcagaag (SEQ ID NO:4);

TLR3F: aacgattcctttgcttggcttc (SEQ ID NO:5);

TLR3R: gcttagatccagaatggtcaag (SEQ ID NO:6);

TLR4F: ctcagaatgactttgcttgtac (SEQ ID NO:7);

TLR4R: gcaggacaatgaagatgatacc (SEQ ID NO:8);

TLR5F: cgaacctcatccacttatcag (SEQ ID NO:9);

TLR5R: gtgaactttagggactttaagac (SEQ ID NO:10);

TLR6F: ccaatgtacctgtgagctaag (SEQ ID NO:11);

TLR6R: ccactcactctggacaaagttg (SEQ ID NO:12);

TLR7F: ggatctgtctttcaattttgaac (SEQ ID NO:13);

TLR7R: ccaaggtctgcccatacttg (SEQ ID NO:14);

TLR8F: gctatccttgtgatgagaaaaag (SEQ ID NO:15);

TLR8R: gcattgaagcacctcggacag (SEQ ID NO:16);

TLR9F: actgtttcgccctctcgctg (SEQ ID NO:17);

TLR9R: gccagcacaaacagcgtcttg (SEQ ID NO:18);

TLR10F: ttgttcagagctgccaggaag (SEQ ID NO:19); и

TLR10R: gcaaagtagaattcataatggcac (SEQ ID NO:20)

Затем продукты ПЦР анализируют в агарозном геле, окрашенном этидия бромидом.

Результаты этих экспериментов показывают, что клеточная линия Сасо 2 экспрессирует TLR 2, 5, 7 и 9. Клеточная линия LoVo экспрессирует TLR 2, 3, 4, 5 и 6. Клеточная линия Colo 320 DM экспрессирует TLR 5 и 6. Клеточная линия SNU-C1 экспрессирует TLR 4. Клеточная линия Т84 экспрессирует TLR 4, 5 и 6. Клеточная линия Colo 205 экспрессирует TLR 4, 5 и 6.

Аналогичный анализ проводят на восьми линиях клеток легких человека (NCI-H526, SHP-77, NCI-N417, А549, NCI-H358, А427, NCI-H292, NCI-H187) и четырех линиях клеток рака груди человека (SW527, Cama-1, BT483, MCF-7). Результаты этих экспериментов показывают, что клеточная линия NCI-H526 (мелкоклеточная карцинома легких) экспрессирует TLR 2, 3, 5 и 9. Клеточная линия SHP-77 (крупноклеточный вариант мелкоклеточной карциномы легких) экспрессирует TLR 4, 5, 6, 7, 9 и 10. Клеточная линия NCI-N417 (мелкоклеточная карцинома легких) экспрессирует TLR 5. Клеточная линия А549 (карцинома легких) экспрессирует TLR 1, 2, 3, 4, 5, 6, 7 и 10. Клеточная линия NCI-H358 (бронхиолоальвеолярная карцинома) экспрессирует TLR 2, 4, 5, 6, 7 и 10. Клеточная линия А427 (карцинома легких) экспрессирует TLR 2, 3, 5 и 6. Клеточная линия NCI-H292 (эпидермоидная карцинома легких) экспрессирует TLR 1, 2, 3,4, 5, 6 и 10. Клеточная линия NCI-H187 (мелкоклеточная карцинома легких) экспрессирует TLR 5, 6 и 10. Клеточная линия SW527 (аденокарцинома груди) экспрессирует TLR 2, 4, 6 и 10. Клеточная линия Cama-1 (аденокарцинома груди) экспрессирует TLR 2, 5, 6 и 10. Клеточная линия BT483 (аденокарцинома груди) экспрессирует TLR 2, 4, 5, 6, 7, 9 и 10. Клеточная линия MCF-7 (аденокарцинома груди) экспрессирует TLR 2, 5, 6 и 9.

Очевидно, что все протестированные линии опухолевых клеток человека из толстой кишки, груди и легких экспрессируют ряд транскриптов TLR. Однако наблюдается значительная гетерогенность в конкретных TLR, экспрессируемых в каждой линии клеток, и в уровне их экспрессии.

Пример 2

Анализируют гибель клеток в ответ на Poly IC в четырех клеточных линиях рака груди человека Cama-1, SW527, BT483 и MCF-7. Клетки культивируют 72 часа с 50 мкг/мл PGN, 50 мкг/мл Poly IC или 10 мкг/мл LPS. Контрольные клетки культивируют с PBS. Цитотоксичность оценивают окрашиванием кристалл-виолетом и выражают как процент по отношению к контролю.

В среднем, для контрольных клеток продемонстрировано 100% восстановление. Для клеток с PGN продемонстрировано в среднем 95% восстановление клеток. Для клеток, обработанных LPS, показано 95% восстановление, в среднем. В среднем, для клеток, обработанных Poly IC, показано 67,5% восстановление клеток. Конкретно, для линий клеток Cama-1, SW527, ВТ483 и MCF-7 продемонстрировано восстановление клеток на 33%, 75%, 67% и 100%, соответственно.

Данные показывают, что Poly IC запускает снижение восстановления клеток в трех из протестированных линий леток, Cama-1, ВТ483 и SW527. Как видно из данных, для клеточной линии Cama-1 показано наиболее значительное снижение. Однако Poly IC не вызывает снижения восстановления клеток в линии MCF-7.

Кроме того, тестируют дополнительные лиганды TLR для определения возможного воздействия на цитотоксичность. Анализируют следующие лиганды: PGN, LPS, флагеллин, R848 и CpG. Клетки культивируют 72 часа с 5 мкг/мл PGN, 10 мкг/мл LPS, 50 нг/мл флагеллина, 6 мкг/мл R848, 10 мкг/мл олигодезоксинуклеотида CpG ODNs, или с PBS в качестве контроля. Восстановление клеток оценивают окрашиванием кристалл-виолетом и выражают как процент по отношению к контролю. Ни один из этих лигандов значительно не снижает восстановление клеток какой-либо из четырех клеточных линий рака груди (Cama-1, ВТ483, SW527 и MCF-7). Хотя PGN не оказывает влияния на восстановление клеток, он индуцирует секрецию IL-8 в определенных клеточных линиях, таким образом, устанавливая, что недостаток цитотоксичности не обусловлен отсутствием запуска TLR.

Пример 3

Клетки Cama-1 анализируют на экспрессию мРНК TLR в ответ на Poly IC. Клетки Cama-1 культивируют в полной среде (DMEM F12, содержащей 4,5 г/мл глюкозы, с добавлением 2 мМ L-глутамина, 10% эмбриональной сыворотки телят, 160 мкг/мл генталлина, 2,5 мг/мл бикарбоната натрия) в течение 48 часов либо с LPS (5 мкг/мл) и/или Poly IC (5 мкг/мл), либо без них. Из клеток каждой группы экстрагируют мРНК. Затем проводят обратную транскрипцию мРНК и амплификацию методом ПЦР, 35 циклов (как указано выше в Примере 1) с праймерами, специфичными к hTLR3: TLR3F: aacgattcctttgcttggcttc (SEQ ID NO:5) и TLR3R: gcttagatccagaatggtcaag (SEQ ID NO:6). мРНК TLR3 из покоящихся клеток Cama-1 амплифицировать нельзя.

Амплифицированную ДНК из ОТ-ПЦР при использовании праймеров, специфичных к hTLR3, наносят на гель. Гель показывает наличие экспрессии TLR3 в положительном контроле (плазмида TLR3), в клетках, обработанных Poly IC, и в клетках, обработанных как Poly IC, так и LPS. Гель не показывает экспрессии TLR в клетках, обработанных либо LPS, либо ничем не обработанных (отрицательный контроль).

Данные показывают, что экспрессия мРНК TLR3 индуцируется Poly IC в клетках карциномы груди человека Cama-1. Таким образом, обработка Poly IC положительно регулирует экспрессию распознаваемого рецептора, TLR3, в определенных линиях опухолевых клеток. С другой стороны, обработка LPS не влияет на экспрессию мРНК TLR3 в клетках Cama-1.

Пример 4

Две линии клеток, линию клеток рака толстой кишки LS174T и линию клеток рака груди Cama-1, анализируют на гибель и изменения клеточного цикла. Клетки культивируют 48 часов в присутствии или в отсутствие Poly IC (5 мкг/мл). После 30-минутной обработки 1 мкг/мл бромдезоксиуридина (BrdU) клетки фиксируют в течение ночи при 4°С в 70% этаноле перед окрашиванием связанным с FITC (флуоресцеин изотиоцианатом) моноклональным антителом анти-BrdU и 3 мкг/мл пропидия йодида. Гибель клеток и клеточный цикл анализируют проточной цитометрией (FACS). Включение BrdU является мерой пролиферации, в то время как окрашивание пропидия йодидом позволяет количественно оценить содержание ДНК, особенно популяцию субдиплоидных клеток, подвергающихся апоптозу.

Данные показывают, что процент клеток LS 174Т, включивших BrdU, изменилось с 27% до обработки до 9% после 48-часового культивирования в присутствии Poly IC. Напротив, процент клеток LS174T, содержащих субдиплоидную ДНК, изменился с 3% до обработки до 23% после 48-часового культивирования в присутствии Poly IC, что указывает на сильную цитотоксичность Poly IC.

Данные также показывают, что процент клеток Саmа-1, включивших BrdU, изменился с 15% до обработки до 2% после 48-часового культивирования в присутствии Poly IC. Напротив, процент клеток Саmа-1, содержащих субдиплоидную ДНК, изменился с 4% до обработки до 17% после 48-часового культивирования в присутствии Poly IC, что указывает на то, что апоптоз запускается Poly IC.

Эти данные показывают, что после обработки Poly IC в течение 48 часов как клетки LS174T, так и клетки Саmа-1 прекращают деление и подвергаются апоптозу.

Пример 5

Для дальнейшего исследования влияния обработки Poly IC на линии клеток рака груди гибель клеток Саmа-1 анализируют окрашиванием аннексином V. Клетки культивируют 24 часа с добавлением 5 мкг/мл Poly IC или без нее. Апоптоз измеряют окрашиванием аннексином V и проточной цитометрией. Данные показывают, что более 70% клеток Саmа-1 окрашиваются Аннексином V, что дополнительно указывает на апоптоз, индуцированный Poly IC.

Также была предпринята попытка определить кинетику апоптоза, индуцированного Poly IC. Клетки Саmа-1 культивируют либо с добавлением 5 мкг/мл или 50 нг/мл Poly IC, либо без нее. В течение последующих 30 часов в культуре измеряют процент клеток в апоптозе (аннексин-положительных). Данные показывают, что в необработанных клетках через 30 часов наблюдается 15% спонтанного апоптоза. Однако для 80% клеток, обработанных Poly IC, показана гибель клеток. Более точно, Poly IC индуцирует апоптоз в клетках Cama-1, начиная с 9 часов после добавления Poly IC и достигая до 80% клеток в апоптозе через 30 часов обработки.

Затем была предпринята попытка определить влияние Poly IC на первичные клетки рака груди человека. Свежевосстановленные моноклеточные суспензии опухолевых клеток инкубируют либо с PBS, либо с Poly IC (50 мкг/мл) в течение 48 часов. Апоптоз измеряют окрашиванием PI (пропидия йодидом). Процент представляет собой пропорцию клеток с низким содержанием ДНК (клеток суб G0/G1), т.е. клеток в апоптозе. Данные показывают, что 19,5% клеток, обработанных PBS, имеют низкое содержание ДНК, в то время как 38,6% клеток, обработанных Poly IC, имеют низкое содержание ДНК. Таким образом, аналогичный цитотоксический эффект Poly IC наблюдается на первичных клетках рака груди человека.

Пример 6

Анализируют роль TLR3 в апоптозе, индуцированном Poly IC. Клетки Cama-1 трансфицируют siPHK, соответствующими либо: несвязанной последовательности (Scr RNA; последовательность: ACUAGUUCACGAGUCACCUtt) (SEQ ID NO:21), orhTLR3 (последовательность: CAGUGUUGAACCUUACCCAtt) (SEQ ID NO:22). Трансфекции siPHK проводят в течение 5 часов в 1 мл среды OptiMEM™, содержащей 3 мкг/мл липофектамина 2000 и 100 нМ siPHK. Затем клетки промывают раствором фосфатного солевого буфера (PBS) и культивируют 72 часа в полной среде с последующей 48-часовой обработкой 5 мкг/мл Poly IC. Затем методом FACS (проточной цитометрией) анализируют клеточный цикл после окрашивания этидия бромидом, как указано в Примере 3.

Результаты этих опытов приведены на чертеже. Данные показывают, что 48-часовая инкубация клеток Cama-1, трансфицированных несвязанной, скремблированной РНК, в присутствии Poly IC повышает процент субдиплоидных клеток с 2% до 45%. Однако 48-часовая инкубация клеток Cama-1, трансфицированных siPHK hTLR3, в присутствии Poly IC не повышает процент субдиплоидных клеток, он остается неизменным на уровне 3%.

Эти данные показывают, что сигнал апоптоза, передаваемый клеткам Cama-1 Poly IC, требует экспрессии TLR3.

Пример 7

Анализируют влияние Poly AU на апоптоз. Клетки Cama-1 культивируют 48 часов либо с PBS, либо с увеличивающимися концентрациями Poly AU в пределах от 5 нг/мл до 50 мкг/мл. Апоптоз анализируют измерением процента аннексии V-положительных клеток. Данные показывают, что, как и Poly IC, Poly AU запускает апоптоз.

Пример 8

Анализируют влияние IFN на апоптоз, индуцированный Poly IC, in vivo. Мыши TRP-Tag экспрессируют Т-антиген SV40 в пигментированном эпителии сетчатки, и у них обычно развиваются опухоли глаз с полной пенетрантностью в течение недель от момента рождения.

В этих экспериментах от 14 до 16 мышей TRP-Tag/IFNαβγR-/- на эксперимент (это мыши TPR-Tag, скрещенные с мышами, одновременно дефицитными по рецептору для интерферонов типа I (IFNαβR) и рецептору для интерферона типа II (IFNγR)) обрабатывают в дни 21, 23, 25, 27 и 29 внутривенным введением либо Poly IC (100 мкг/дозу), либо PBS. 2-3 раза в неделю отслеживают кинетику развития видимой опухоли глаза.

Появление опухолей глаза задерживается на время до 21 дня у мышей, обработанных Poly IC, по сравнению с мышами, обработанными PBS. Так как использованные в этих экспериментах мыши не имеют функциональной системы ответа интерферона, данные показывают, что ингибирование роста опухоли, индуцированное Poly IC, не зависит от интерферона типов I и II in vivo.

Пример 9

Для определения пути индуцируемой Poly IC токсичности для клеток Cama-1 используют интерференцию РНК для эффективного отрицательного регулирования экспрессии TRIF и PKR. Клетки Саmа-1 засевают в 6-луночные планшеты с плотностью 3×105 клеток/лунку. После адгезии в течение ночи проводят трансфекции siPHK в течение 5 часов в среде OptiMEM (Life Technologies), содержащей 3 мкг/мл липофектамина 2000 (Invivogen) и 100 нМ siPHK. Клетки трансфицируют либо ложно (MOCK, вода), либо контрольной скремблированной дуплексной siPHK (scr), TRIP siPHK или PKR siPHK.

Дуплексы siPHK, специфические к PKR, приобретают в Dharmacon (Lafayette, CO) в виде реагентов SMART-Pool. TRIF siPHK приобретают у того же поставщика в виде единичных олигодуплексов 5'-GCUCUUGUAUCUGAAGCAC-3' (SEQ ID NO:23). Экспрессию TLR3 и TRIF оценивают методом ПЦР (35 циклов: 1 мин 94°С, 1 мин 55°С, 2 мин 72°С) со смесью Taq PCR ReadyMix (Sigma-Aldrich) при использовании следующих праймеров: 5'-AACGATTCCTTTGCTTGGCTTC-3' (SEQ ID NO: 24) (прямой)/ 5'-GCTTAGATCCAGAATGGTCAAG-3' (SEQ ID NO:25) (обратный) для TLR3 и 5'-ACTTCCTAGCGCCTTCGACA-3' (SEQ ID NO:26) (прямой)/ 5'-ATCTTCTACAGAAAGTTGGA-3' (SEQ ID NO:27) (обратный) для TRIP. Экспрессию PKR оценивают методом Вестерн-блоттинга. Для TRIP мРНК ПЦР проводят через 24 часа дополнительного культивирования с добавлением 5 мкг/мл Poly IC или без нее.

Данные показывают, что интерференция РНК использована для эффективного обратного регулирования экспрессии TRIP и PKR.

Через 72 часа после трансфекции siPHK клетки Cama-1 культивируют еще 24 часа с добавлением 5 мкг/мл Poly IC или без нее. Степень апоптоза измеряют окрашиванием аннексином V и выражают как процент клеток в апоптозе в культуре. В среднем, 10% необработанных контрольных клеток (MOCK и scr) подверглись апоптозу. Напротив, около 75% контрольных клеток (MOCK и scr), обработанных Poly IC, подверглись апоптозу. В группах siPHK TRIP для необработанных клеток наблюдается 10% апоптоз, в то время как в клетках, обработанных siPHK TRIP, наблюдается 20% клеток в апоптозе. Наконец, в группе siPHK PKR для необработанных клеток наблюдается 10% клеток в апоптозе, в то время как в клетках, обработанных siPHK PKR, наблюдается 80% клеток в апоптозе.

Таким образом, обработка siPHK к TRIP практически сводит на нет апоптоз, индуцированный Poly IC, в то время как в отсутствие экспрессии PKR гибель клеток происходит нормально.

Эти данные наглядно демонстрируют, что индуцированный Poly IC апоптоз в клетках Саmа-1 опосредуется как TLR3, так и TRIF, и не зависит от PKR.

Пример 10

Для дальнейшего исследования цитотоксичности, опосредованной TLR3, оценивают роль сигнальных молекул IRAK-4 и TRAF6, являющихся расположенными ниже медиаторами сигнала TLR. Клетки Саmа-1 засевают в 6-луночные планшеты с плотностью 3×105 клеток/лунку. После адгезии в течение ночи проводят трансфекции siPHK в течение 5 часов в среде OptiMEM (Life Technologies), содержащей 3 мкг/мл липофектамина 2000 (Invivogen) и 100 нМ siPHK. Клетки трансфицируют либо контрольной скремблированной дуплексной siPHK (scr), IRAK-4 siPHK или TRAF-6 siPHK. Затем клетки промывают и культивируют 72 часа в полной среде с последующей обработкой Poly IC и анализом апоптоза. Дуплексы siPHK, специфичные к IRAK-4 и TRAF6, приобретают в Dharmacon (Lafayette, CO) в виде реагентов SMART-Pool.

Экспрессию IRAK-4 и TRAF6 анализируют Вестерн-блоттингом. Вестерн-блот показывает, что siPHK IRAK-4 и TRAF6 siRNA сводит на нет экспрессию соответствующих белков.

Через 72 часа после трансфекции siPHK клетки Саmа-1 культивируют еще 24 часа с добавлением 5 мкг/мл Poly IC или без нее. Степень апоптоза измеряют окрашиванием аннексином V и выражают как процент клеток в апоптозе в культуре. В среднем, 10% необработанных контрольных клеток (scr) подверглись апоптозу. Напротив, около 75% контрольных клеток, обработанных Poly IC, подверглись апоптозу. В группах siPHK IRAK-4 в культурах наблюдалось только 20% клеток в апоптозе, в то время как в группах siPHK TRAF6 75% клеток к концу культивирования подверглись апоптозу. В группах siPHK TRAF6 для необработанных клеток наблюдалось 15% клеток в апоптозе, в то время как для клеток, обработанных siPHK TRAF6, наблюдалось 75% клеток в апоптозе.

Эти данные показывают, что ингибирование экспрессии IRAK-4 приводит к ингибированию цитотоксичности, опосредованной TLR3. Однако ингибирование экспрессии TRAF6 не приводит к ингибированию цитотоксичности, опосредованной TLR3. Это наблюдение неожиданно, так как предполагается, что TRAF6 находится ниже от IRAK-4 в пути сигнала TLR. Таким образом, это предполагает, что TLR3 может передавать сигнал через IRAK-4 и активировать путь апоптоза, не зависимый от TRAF6.

Параллельно методом ELISA определяют концентрацию IL-6 в супернатантах клеток Cama-1, трансфицированных siPHK и культивированных 24 часа с добавлением 5 мкг/мл Poly IC или без нее. Данные показывают, что для группы scr в группе необработанных и обработанных клеток концентрации IL-6 (пг/мл/106 клеток) составляют 10 и 110, соответственно. В группе siPHK IRAK-4 в группе необработанных и обработанных клеток концентрации IL-6 (пг/мл/106 клеток) составляют 10 и 40, соответственно. В группе siPHK TRAF6 в группе необработанных и обработанных клеток концентрации IL-6 (пг/мл/106 клеток) составляют 10 и 20, соответственно. Эти данные показывают, что как IRAK-4, так и TRAF6 необходимы для продукции цитокина.

Пример 11

Оценивают роль интерферона типа 1 в апоптозе, опосредованном TLR3. Клетки Cama-1 инкубируют с добавлением 5 мкг/мл Poly IC в течение 0 часов, 1, 6, 18 или 24 часов. Методом Вестерн-блоттинга анализируют наличие в лизате клеток IFN-β, фосфорилированного Stat1 (тирозина 701) (P-Stat-1) и общего Stat-1.

Данные показывают, что продукция IFN-β в высокой степени индуцируется при обработке Poly IC. Также наблюдается фосфорилирование Stat1. Эти наблюдения показывают, что сигнал интерферона типа 1 (1 IFN) в клетках Cama-1 запускается Poly IC. Что интересно, максимум фосфорилирования Stat1 наблюдается через 6 часов после обработки Poly IC, когда продукция IFN-β еще едва обнаруживается.

В другом эксперименте клетки Саmа-1 предварительно инкубируют 1 час с 20 мкг/мл либо нейтрализующего антитела (mAb) к рецептору IFN типа I (anti-IFN R1), либо изотипического контроля (мышиный IgG1). Затем клетки культивируют 24 часа с добавлением 5 мкг/мл Poly IC или без нее, или со смесью 1000 Ед/мл каждого из IFN-α или IFN-β. Степень апоптоза измеряют окрашиванием аннексином V и выражают как процент клеток в апоптозе в культуре.

В отсутствие антитела в необработанных клетках и клетках, обработанных Poly IC и IFNα/β, наблюдается 10%, 70% и 20% клеток в апоптозе, соответственно. В группе mlgG1 в необработанных клетках и клетках, обработанных Poly IC и IFNα/β, наблюдается 10%, 70% и 20% клеток в апоптозе, соответственно. В группе anti-IFN R1 в необработанных клетках и клетках, обработанных Poly IC и IFNα/β, наблюдается 10%, 30% и 15% клеток в апоптозе, соответственно.

Эти данные показывают, что нейтрализация рецепторов I IFN специфическим моноклональным антителом значительно снижает апоптоз, индуцированный Poly IC. Это показывает, что интерфероны типа I необходимы для апоптоза, опосредованного TLR3.

Обработка клеток Саmа-1 смесью IFNα и IFNβ не вызывает значительного апоптоза. Это показывает, что сигнал I IFN необходим для цитотоксичности, запускаемой TLR3, но сам по себе он не достаточен для индукции гибели клеток.

Пример 12

Была предпринята попытка определить, играет ли TNF-α роль в апоптозе, опосредованном TLR3. Клетки Саmа-1 предварительно инкубируют с добавлением или без добавления 20 мкг/мл нейтрализующего mAb анти-TNF-α или 10 мкг/мл СНХ (циклогексимида). Клетки затем культивируют с добавлением или без добавления 5 мкг/мл Poly IC или 25 нг/мл TNF-α. Степень апоптоза измеряют окрашиванием аннексином V и выражают как процент клеток в апоптозе в культуре.

В отсутствие антитела в необработанных клетках и клетках, обработанных Poly IC и TNF-α, наблюдается 10%, 70% и 40% клеток в апоптозе, соответственно. В группе mAb анти-TNF-α в необработанных клетках и клетках, обработанных Poly IC и TNF-α, наблюдается 10%, 65% и 10% клеток в апоптозе, соответственно. В группе СНХ в необработанных клетках и клетках, обработанных Poly IC и TNF-α, наблюдается 15%, 40% и 70% клеток в апоптозе, соответственно.

Эти данные показывают, что нейтрализующее антитело анти-TNF-α, которое защищает клетки Cama-1 от апоптоза, вызываемого TNF-α, не влияет на гибель клеток, запускаемую Poly IC. Таким образом, TNF-α не играет роли в апоптозе, опосредованном TLR3.

Как указано выше, клетки Cama-1 предварительно обрабатывают общим ингибитором транскрипции СНХ, о котором известно, что он сенсибилизирует клетки к апоптозу, индуцированному TNF-α, путем блокирования программы выживания, контролируемой NFκB.

Данные показывают, что СНХ значительно сенсибилизирует клетки Cama-1 к апоптозу, индуцированному TNF-α. Напротив, СНХ частично защищает клетки от апоптоза, индуцированного Poly IC. Это подтверждает, что этими двумя проапоптическими стимулами запускаются различные механизмы.

Затем для оценки роли NFκB в апоптозе, опосредованном TLR3, используют интерференцию РНК. Клетки Саmа-1 за 72 часа до этого трансфицированные siPHK к р65 или контрольным скремблированным дуплексом (scr), культивируют 24 часа с добавлением или без добавления 50 нг/мл или 5 мкг/мл Poly IC. Ослабление экспрессии белка р65 перед обработкой Poly IC оценивают Вестерн-блоттингом. Степень апоптоза измеряют окрашиванием аннексином V. Результат выражают как процент клеток в апоптозе в культуре.

В группе scr в необработанных клетках и клетках, обработанных Poly IC (50 нг/мл) и Poly IC (5 мкг/мл), наблюдается 10%, 20% и 70% клеток в апоптозе, соответственно. В группе siPHK p65 в необработанных клетках и клетках, обработанных Poly IC (50 нг/мл) и Poly IC (5 мкг/мл), наблюдается 10%, 10% и 20% клеток в апоптозе, соответственно.

Данные показывают, что siPHK-ингибирование экспрессии NFκB p65 приводит к значительной защите от цитотоксичности, индуцированной Poly IC. Это подтверждает проапоптическую роль NFκB в апоптозе, запускаемом Poly IC.

Все вместе эти результаты показывают, что секреция TNF-α не отвечает за апоптоз, индуцированный Poly IC. Кроме того, эти результаты показывают проапоптическую роль NFκB в апоптозе, опосредованном TLR3, что противоположно его анти-апоптическому эффекту при обработке TNF.

Пример 13

Затем оценивают роль каспаз в апоптозе. Клетки Сата-1 предварительно инкубируют с 25 мкМ общего ингибитора каспаз z-VAD-fmk или DMSO (диметилсульфоксидом) в течение 1 часа перед культивированием в течение 24 часов с добавлением или без добавления 5 мкг/мл Poly IC или 25 нг/мл TNF-α (используемого в качестве положительного контроля). Степень апоптоза измеряют окрашиванием аннексином V и результат выражают как процент клеток в апоптозе в культуре.

В группе DMSO в необработанных клетках и клетках, обработанных Poly IC и TNF-α, наблюдается 10%, 70% и 40% клеток в апоптозе, соответственно. В группе z-VAD-fmk в необработанных клетках и клетках, обработанных Poly IC и TNF-α, наблюдается 10%, 30% и 10% клеток в апоптозе, соответственно.

Данные показывают, что ингибирование активности каспаз при помощи широкого ингибитора каспаз z-VAD-fmk значительно снижает апоптоз, индуцированный Poly IC. Это предполагает очень важную роль каспаз в цитотоксичности, запускаемой TLR3.

В другом эксперименте лизаты полученных выше клеток анализируют Вестерн-блоттингом на расщепление PARP, Каспазы 3 и Каспазы 8.

Данные показывают, что в клетках Cama-1 при обработке Poly IC происходит расщепление PARP, что является признаком апоптоза, зависимого от каспаз. Это подтверждает вовлечение каспаз в апоптоз, опосредованный TLR3. Действительно, Каспаза 3 активируется при обработке Poly IC, что подтверждается Вестерн-блот-анализом.

Пример 14

Была предпринята попытка выяснить, существует ли синергизм между лигандами TLR3 и интерфероном типа I. Первичные клетки карциномы груди SKBr3 засевают в 6-луночные планшеты с плотностью 3×105 клеток/лунку. После адгезии в течение ночи проводят трансфекции siPHK в течение 5 часов в среде OptiMEM (Life technologies), содержащей 3 мкг/мл липофектамина 2000 (Invivogen) и 100 нМ siPHK. Клетки трансфицируют либо ложно (MOCK, вода), либо siPHK TLR3 или siPHK PKR. Затем клетки промывают и культивируют 72 часа в полной среде с последующей обработкой в течение 24 часов 50 мкг/мл Poly IC и анализом апоптоза.

В группе MOCK в необработанных клетках и клетках, обработанных Poly IC (50 мкг/мл), наблюдается 10% и 22% клеток в апоптозе, соответственно. В группе siPHK TLR3 в необработанных клетках и клетках, обработанных Poly IC (50 мкг/мл), наблюдается 8% и 13% клеток в апоптозе, соответственно. В группе siPHK PKR в необработанных клетках и клетках, обработанных Poly IC (50 мкг/мл), наблюдается 12% и 22% клеток в апоптозе, соответственно.

Данные показывают, что клетки аденокарциномы груди линии SKBr3 подвергаются частичному апоптозу при обработке Poly IC. Кроме того, данные показывают, что предварительная обработка клеток siPHK TLR3 снижает апоптоз, в то время как siPHK PKR не обладает протективным эффектом.

В другом эксперименте была предпринята попытка определить, действуют ли IFN и Poly IC синергически в индукции апоптоза. Клетки SKBr3 не обрабатывают или предварительно обрабатывают 10 Ед/мл или 100 Ед/мл низкодозовой смеси IFN-α или IFN-β. Poly IC вводят в следующих дозах: 0, 0,5, 5 и 50 мкг/мл в течение 48 часов.

Данные показывают, что в группе, не обработанной Poly IC, в необработанных клетках и клетках, обработанных IFN-α/β (10 Ед/мл) и IFN-α/β (100 Ед/мл), наблюдается 10%, 14% и 22% клеток в апоптозе, соответственно. В группе 0,5 мкг/мл Poly IC в необработанных клетках и клетках, обработанных IFN-α/β (10 Ед/мл) и IFN-α/β (100 Ед/мл), наблюдается 15%, 45% и 55% клеток в апоптозе, соответственно. В группе 5 мкг/мл Poly IC в необработанных клетках и клетках, обработанных IFN-α/β (10 Ед/мл) и IFN-α/β (100 Ед/мл), наблюдается 20%, 55% и 60% клеток в апоптозе, соответственно. В группе 50 мкг/мл Poly IC в необработанных клетках и клетках, обработанных IFN-α/β (10 Ед/мл) и IFN-α/β (100 Ед/мл), наблюдается 20%, 55% и 60% клеток в апоптозе, соответственно.

Таким образом, IFN способен действовать синергически с Poly IC при индукции апоптоза. Эта синергетика имеет два проявления: 1) при предварительной обработке клетки SKBr3 становятся чувствительными к апоптозу, индуцируемому Poly IC в концентрациях, в 100 раз более низких по сравнению с необработанными клетками; и 2) процент клеток SKBr3, индуцированных к апоптозу Poly IC, вырос с 22% до 66% после предварительной обработки интерфероном типа I.

В заключение, предварительная обработка интерфероном типа I сенсибилизирует клетки аденокарциномы груди SKBr3 к апоптозу, индуцированному Poly IC и опосредованному TLR3. Таким образом, предварительное лечение пациентов с раком груди низкой дозой интерферона типа I не только повышает эффективность лечения Poly IC, но также позволяет включить в лечение пациентов, которым иначе лечение Poly IC не принесло бы пользы. Пациентов можно лечить низкой дозой интерферона типа I перед операцией для повышения процента опухолей, которые будут расценены как положительные при иммуногистохимическом анализе биопсии, и которые будут отвечать на лиганды TLR3. Кроме того, комбинация низкой дозы интерферона типа I и низкой дозы Poly IC может быть более эффективна, чем более высокая доза одной Poly IC. Эта комбинация может также снизить риск побочных эффектов.

1. Применение агониста TLR3 и низкой дозы интерферона типа I для приготовления медикамента для лечения рака с экспрессией TLR3 у пациента.

2. Применение по п.1, где низкая доза интерферона типа I находится в пределах 1-3 ME.

3. Применение по п.1, где низкая доза интерферона типа I составляет 2 ME.

4. Применение по п.1, где низкая доза интерферона типа I составляет менее 1МЕ.

5. Применение по любому из пп.1-4, в котором указанный агонист TLR3 представляет собой Poly IC.

6. Применение по любому из пп.1-4, в котором указанный агонист TLR3 представляет собой Poly AU.

7. Применение по любому из пп.1-6, в котором указанный рак, экспрессирующий TLR3, представляет собой рак груди.

8. Применение по любому из пп.1-6, в котором указанный рак, экспрессирующий TLR3, представляет собой рак толстой кишки.

9. Применение по любому из пп.1-8, в котором указанный медикамент дополнительно содержит химиотерапевтический агент.

10. Применение агониста TLR3 и низкой дозы интерферона типа I для приготовления медикамента для индуцирования апоптоза в экспрессирующей TLR3 раковой клетке.

11. Применение по п.10, где низкая доза интерферона типа I находится в пределах 1-3 ME.

12. Применение по п.10, где низкая доза интерферона типа I составляет 2 ME.

13. Применение по п.10, где низкая доза интерферона типа I составляет менее 1 ME.

14. Применение по любому из пп.10-13, в котором указанный агонист TLR3 представляет собой Poly IC.

15. Применение по любому из пп.10-13, в котором указанный агонист TLR3 представляет собой Poly AU.

16. Применение по любому из пп.10-15, в котором указанный рак, экспрессирующий TLR3, представляет собой рак груди.

17. Применение по любому из пп.10-15, в котором указанный рак, экспрессирующий TLR3, представляет собой рак толстой кишки.

18. Применение по любому из пп.10-17, в котором указанный медикамент дополнительно содержит химиотерапевтический агент.



 

Похожие патенты:

Изобретение относится к анти-М-СSF-специфическим антителам, полученным на основе RX1 или происходящим от RX1, и которые более чем на 75% конкурируют с моноклональными антителами RX1, МС1 и/или МС3 за связывание с M-CSF (макрофагальному колониестимулирующему фактору).

Изобретение относится к новому химическому соединению, а именно к метиловому эфиру 2-циано-3,12-диоксо-1(2),11(9)-диен-11-дезоксоглицирретовой кислоты формулы (1): которое может быть использовано в медицине в качестве лекарственного средства, обладающего противоопухолевым действием.

Изобретение относится к пирролотриазинам формулы (I) , где R1 выбран из группы, включающей фенил, нафтил, бензил и гетероарил, который означает моно- или бициклический радикал, содержащий от 5 до 10 кольцевых атомов и до 2 гетероатомов, выбранных из группы, состоящей из азота, кислорода и серы, по меньшей мере, одно кольцо которого является ароматическим, где фенил и гетероарил при необходимости могут быть замещены 0, 1 или 2 заместителями, независимо выбранными из группы, состоящей из -(С1-С4)алкила, где (С1-С 4)алкил может быть замещен 0, 1, 2 или 3 галогенами, 0 или 1 пирролидином, -(С1-С3)алкоксигруппы, где (С1-С3)алкоксигруппа при необходимости может быть замещена (С1-С3)алкиламиногруппой, -галогена, -трифторметила, -трифторметоксигруппы, -фенила, при необходимости замещенного 1 или 2 галогенами, , где Х означает О, -нитрогруппы, -(С1-С 3)алкилтиогруппы, -трифторметилтиогруппы, -(С1 -С3)алкилкарбонила, -(C1-С6)алкоксикарбонила, и -феноксигруппы, и где бензил может быть замещен 0, 1, 2 или 3 группами, выбранными из группы, включающей галоген; R2 выбран из группы, состоящей из водорода, галогена; R3 выбран из группы, состоящей из -карбоксила, -(C1-С 6)алкилкарбонила, -(С3-С6)циклоалкилкарбонила, -(С1-С6)алкоксикарбонила, при необходимости замещенного 0, 1, 2 или 3 группами, выбранными из группы, включающей аминогруппу и (С1-С6)алкоксикарбонил, -аминокарбонила, -(С1-С6)алкиламинокарбонила, где (С 1-С6)алкиламинокарбонил при необходимости может быть замещен 0, 1, 2 или 3 заместителями, независимо выбранными из группы, состоящей из (С3-С6)циклоалкила, галогена, аминогруппы, (С1-С6)алкиламиногруппы, гидроксигруппы, (С1-С6)алкоксигруппы, (С 1-С6)алкоксикарбонила, (С1-С 6)алкилтиогруппы, (С1-С6)алкоксикарбониламиногруппы, и где (С1-С6)алкиламинокарбонил при необходимости может быть замещен или 0 или 1 гетероциклилом, который означает моноциклический, неароматический радикал, содержащий от 5 до 8 кольцевых атомов и до 2 гетероатомов, выбранных из азота и кислорода, где гетероциклил при необходимости может быть замещен 0 или 1 (С1-С6)алкилом, -гетероциклилкарбонила, при необходимости замещенного 0 или 1 (С1-С6 )алкиламиногруппой, циклоалкилом или (С1-С6 )алкилом, где (С1-С6)алкил при необходимости может быть замещен 0 или 1 (С1-С6)алкиламиногруппой, и где гетероциклил означает моноциклический, неароматический радикал, содержащий от 5 до 8 кольцевых атомов и до 2 гетероатомов, выбранных из азота и кислорода, -(С1-С6 )алкила, при необходимости замещенного 0, 1 или 2 заместителями, независимо выбранными из группы, состоящей из а) гидроксила, b) (С1-С6)алкиламиногруппы, где (С 1-С6)алкиламиногруппа может быть замещена 0, 1 или 2 заместителями, независимо выбранными из группы, состоящей из галогена, алкиламиногруппы, метоксигруппы, метилтиогруппы и метилсульфонила, с) фениламиногруппы, где фениламиногруппа может быть замещена 0, 1 или 2 заместителями, независимо выбранными из группы, состоящей из (С1-С6)алкоксигруппы и трифторметила, d) гетероциклила, где гетероцикл означает моноциклический, неароматический радикал, содержащий от 5 до 8 кольцевых атомов и до 2 гетероатомов, выбранных из азота и кислорода, и где гетероциклил может быть замещен 0 или 1 (С1-С6)алкилами, где (C1-С6)алкил может быть замещен 0 или 1 метоксигруппами или пиридилами, е) имидазолила, f) пиридиламиногруппы, g) (С1-С3)алкоксигруппы, при необходимости замещенной фтором или пипередином, где пиперидин при необходимости может быть замещен 0 или 1 (C1-С6)алкилом, h) (С1-С3)алкокси(С2-С3 )алкоксигруппы, и i) (С1-С6)алкоксикарбонила, j) (С3-С6)циклоалкила, k) цианогруппы, -(С3-С6)циклоалкиламинокарбонила, -цианогруппы, -гетероарила, где гетероарил означает моноциклический радикал, содержащий от 5 до 6 кольцевых атомов и до 3 гетероатомов, выбранных из группы, состоящей из азота и кислорода, кольцо которого является ароматическим, где гетероарил может быть замещен 0, 1 или 2 группами, независимо выбранными из группы, состоящей из q) (С1 -С6)алкила, где (C1-С6)алкил может быть замещен 0 или 1 морфолином или 0 или 1 гидроксигруппой, r) (C1-С6)алкоксикарбонила, -тиофенкарбонила, и R4 выбран из группы, состоящей из водорода; или к его фармацевтически приемлемой соли.

Изобретение относится к новым соединениям формулы (I), в частности соединений формулы (Ia), обладающих ингибирующим действием при аномальной активности киназ выбранных из Abl, BCR-AbI, PDGF-R, trkB, c-SRC, BMX, FGFR3, b-RAF, SGK, Tie2, Lck, JNK2a2, MKK4, c-RAF, MKK6, SAPK2a и SAPK2P и фармацевтическим композициям, включающим такие соединения.

Изобретение относится к новым пиримидиновым производным, обладающим ингибирующей активностью в отношении FAK, формулы (I), где R0 означает водород; R1 означает 5- или 6-членный гетероцикл, включающий 1 или 2 атома азота, замещенных (С1-С7)алкилом, гидроксигруппой, диалкиламиногруппой или 6-членным гетероциклом, включающим один атом азота; R2 означает водород; R 3 означает карбамоил, замещенный один или два раза (С 1-С7)алкилом; 5-членный гетероцикл, включающий 4 атома азота; SO2N(R12)R13, где R12 означает водород или (низш.)алкил, и R 13 означает водород, (С1-С7)алкил, (С1-С7)алкокси(С1-С7 )алкил, ди(С1-С7)алкиламино(С1 -С7)алкил, гидрокси(С1-С7)алкил, или R12 и R13 образуют вместе с атомом азота, с которым они соединены, 6-членный гетероцикл, включающий два атома азота, который является незамещенным или замещенным (С1-С7)алкилом; R4 означает водород; R5 означает галоид; R6 означает водород; R7 означает водород; (С1-С 7)алкокси; карбамоил, незамещенный или замещенный (низш.)алкилом; 5- или 6-членный гетероцикл, включающий 1 или 2 атома азота или кислорода, незамещенный или замещенный ди(С1-С 7)алкиламино, (С1-С7)алкилом, гидрокси, 6-членным гетероциклом, включающим 1 или 2 кольцевых атомов азота или кислорода, незамещенный или замещенный (С1-С 7)алкилом; 6-членный гетероциклокси, включающий 1 кольцевой атом азота, незамещенный или замещенный (С1-С 7)алкилом; гетероцикл(С1-С7)алкилокси, где гетероцикл означает 5- или 6-членный гетероцикл, включающий 1 или 2 кольцевых атома азота или кислорода, незамещенный или замещенный (С1-С7)алкилом; R8 означает водород; галоид; (C1-С7)алкокси; карбамоил, незамещенный или замещенный (С1-С7 )алкилом; гетероцикл(С1-С7)алкилокси, где гетероцикл означает 5-членный гетероцикл, включающий 1 кольцевой атом азота, незамещенный или замещенный (С1-С 7)алкилом; 5- или 6-членный гетероцикл, включающий 1 или 2 атома азота или кислорода, незамещенный или замещенный один или два раза заместителем, независимо выбранным из гидрокси, (С1-С7)алкила, аминокарбонила и (С 1-С7)алкиламино; 6-членный гетероциклокси, включающий 1 кольцевой атом азота, незамещенный или замещенный 1-5 раз (С 1-С7)алкилом или ди(С1-С7 )алкиламино; или R7 и R8 образуют вместе с атомами, с которыми они соединены, 6-членный гетероцикл, включающий 2 атома азота или кислорода, незамещенный или замещенный один или два раза (С1-С7)алкилом или оксогруппой; R9 означает водород; R10 означает (С 1-С7)алкокси, а также к их фармацевтически приемлемым солям.
Изобретение относится к медицине, а именно к онкологии, и может быть использовано при лечении больных орофарингеальным раком. .

Изобретение относится к фармацевтической промышленности, в частности к фармацевтической композиции для лечения сифилиса и вирусных заболеваний. .

Изобретение относится к новым кристаллическим модификациям [6-метокси-5-(2-метоксифенокси)-2-пиридин-4-илпиримидин-4-ил]амида 5-метилпиридин-2-сульфоновой кислоты, продуцирующим эндотелиальный антагонистический эффект и пригодным для лечения заболеваний связанных с аномальным сосудистым тонусом и эндотелиальной дисфункцией, таких как сердечная недостаточность, легочная гипертензия и др.
Изобретение относится к медицине, онкологии, и может быть использовано для химиолучевого лечения низкорасположенных опухолей прямой кишки и анального канала. .
Изобретение относится к медицине, онкологии, и может быть использовано для лечения местно-распространенного и неоперабельного рака пищевода. .
Изобретение относится к медицине, а именно к ортопедии, и может быть использовано для комплексной терапии у детей раннего возраста с цитомегаловирусом и патологией опорно-двигательного аппарата при плановых оперативных вмешательствах.
Изобретение относится к медицине, в частности к вирусологии, и может быть использовано при лечении хронического вирусного гепатита С генотипа 3а. .
Изобретение относится к медицине, а именно к гепатологии, и может быть использовано при лечении хронического вирусного гепатита С 1-генотипа с умеренной активностью и репликативностью.
Изобретение относится к медицине, а именно к онкологии, и может быть использовано при лечении больных с генерализованными (диссеминированными) формами почечно-клеточного рака.
Изобретение относится к медицине, а именно к вирусологии, и может быть использовано для профилактики заболевания, вызванного вирусом гриппа птиц А субтипа H5N1. .
Изобретение относится к медицине, в частности к гастроэнтерологии, и касается применения конъюгата интерферона с водорастворимым полимером в комбинации с рибавирином и циклоспорином А для приготовления лекарственного средства, предназначенного для лечения вызываемой HCV инфекции.
Изобретение относится к медицине, а именно к лечению инфекционных болезней, и может быть использовано при установлении неспецифического противоинфекционного действия иммуномодулирующего иммунобиологического препарата (ИИП).
Изобретение относится к медицине, а именно к онкологии, и может быть использовано при лечении больных распространенным и рецидивным раком кожи. .

Изобретение относится к медицине и касается гипергликолизованного варианта родительского интерферона типа 1, в котором гипергликолизованный вариант родительского интерферона типа 1 был модифицирован для включения, по меньшей мере, трех дополнительных гликолизованных сайтов.
Изобретение относится к медицине, а именно к онкологии, и может быть использовано при лечении рака шейки матки. .
Наверх