Способ выявления госпитальных штаммов


 


Владельцы патента RU 2404254:

Государственное образовательное учреждение высшего профессионального образования "Санкт-Петербургская государственная медицинская академия им. И.И. Мечникова Федерального агентства по здравоохранению и социальному развитию" (RU)

Изобретение относится к выявлению госпитальных штаммов микроорганизмов в лечебно-профилактических учреждениях и проведению соответствующих противоэпидемических мероприятий в них. Способ включает определение генотипических характеристик вирулентности исследуемых штаммов и сопоставление их с генотипическими характеристиками вирулентности штаммов, выделенных в лечебно-профилактическом учреждении от больных и окружающих предметов. Штаммы относят к госпитальным при соответствии генотипической характеристики вирулентности исследуемых штаммов генотипическим характеристикам вирулентности хотя бы одного из штаммов, выделенных в лечебно-профилактическом учреждении от больных и окружающих предметов. Использование способа упрощает выявление госпитальных штаммов и позволяет сократить время выявления госпитальных штаммов. 1 табл.

 

Изобретение относится к области медицины, а именно к эпидемиологии, и может быть использовано для выявления циркуляции госпитальных штаммов и для проведения противоэпидемических мероприятий в лечебно-профилактических учреждениях (ЛПУ).

Актуальность проблемы внутрибольничных инфекций определяется широким распространением их в медицинских учреждениях различного профиля и значительным ущербом, наносимым этими заболеваниями здоровью населения [1].

Заболеваемость внутрибольничными инфекциями, главным образом, обусловлена госпитальными штаммами. В настоящее время госпитальный штамм определяется как «штамм, который в процессе циркуляции адаптировался к условиям стационара», т.е. приобрел большие возможности к паразитированию, специфичному для больных данного стационара, а именно вирулентность, устойчивость к неблагоприятным внешним факторам, также специфичным для данного стационара, и способность вызывать групповые внутрибольничные случаи заболеваний» [2].

Для выявления циркуляции госпитальных штаммов в микробиологической практике используют методы эпидемиологического маркирования, суть которых состоит в том, что выделенные культуры идентифицируют до рода и вида, а затем проводят внутривидовую идентификацию с целью установления биовара, серовара, эковара, устойчивости к антибактериальным веществам, генотипа [3]. Предлагаемые методы требуют значительных материальных затрат и длительного времени на проведение лабораторных исследований.

Известен способ выявления госпитальных штаммов по определению чувствительности штаммов к антибиотикам, составлению антибиотикограмм и сопоставлению антибиотикограмм культур бактерий, выделенных от больных и из окружающей среды [4].

Недостатком предложенного способа является недостаточная специфичность ввиду широкого распространения устойчивости к антибиотикам, в том числе у негоспитальных штаммов возбудителей, а также сложность интерпретации результатов ввиду высокой степени гетерогенности госпитальной популяции возбудителя по устойчивости к антибиотикам.

Известен способ идентификации госпитальных штаммов, включающий в себя определение биоритмов бактерий, выделенных от больных, и сравнение полученных биоритмов с биоритмами эталонных негоспитальных штаммов данного вида бактерий [5]. Анализ биоритмов проводят по периоду репродуктивной активности бактерий, частоте ритма, мезору, амплитуде репродуктивной активности бактерий и акрофазе. При несовпадении биоритмов выделенного штамма бактерий с биоритмами эталонного негоспитального штамма выделенный штамм относят к госпитальному.

К недостаткам данного способа относится сложность интерпретации результатов, низкая специфичность ввиду значительного разнообразия госпитальных и негоспитальных генотипов, обладающих различными биоритмами. Кроме того, при осуществлении данного способа требуется круглосуточная работа врача-микробиолога, проводящего измерения через 8, 12, и 24 часа от начала исследований.

В качестве прототипа по наиболее близкой технической сущности нами выбран способ диагностики госпитального штамма синегнойной палочки PSEUDOMONAS AERUGIOSA, включающий определение чувствительности штамма к антибиотикам, его фаготипа и серотипа, устойчивости к дезинфицирующим веществам, плазмидного профиля, коэффициента адгезии к эпителиальным клеткам, штамм PSEUDOMONAS AERUGIOSA диагностируют как госпитальный при отсутствии его чувствительности к девяти и более антибиотикам, одинаковом фагосеротипе, устойчивости к пяти дезинфицирующим веществам, сходном плазмидном профиле и коэффициенте адгезии 15±0,2 и более [6].

К недостаткам способа, принятого за прототип, относится то, что способ является трудоемким и длительным, так как требует определения многих характеристик исследуемых штаммов, до получения окончательного результата исследования необходимо 10-15 дней. Выполнение способа требует также значительных материальных затрат.

Техническим результатом изобретения является упрощение способа выявления госпитальных штаммов и сокращение времени его проведения.

Указанный технический результат достигается тем, что определяют генотипические характеристики вирулентности исследуемых штаммов и сопоставляют их с генотипическими характеристиками вирулентности штаммов, выделенных в лечебно-профилактическом учреждении от больных и окружающих предметов. Штаммы относят к госпитальным при соответствии генотипической характеристики вирулентности исследуемых штаммов генотипическим характеристикам вирулентности хотя бы одного из штаммов, выделенных в лечебно-профилактическом учреждении от больных и окружающих предметов.

Предлагаемый способ осуществляют следующим образом.

Проводят видовую идентификацию выделенной культуры, выделяют ДНК и определяют методом полимеразно-цепной реакции или любым другим экспресс-методом наличие нуклеотидных последовательностей, соответствующих участкам генов факторов патогенности, наиболее типичных для клинически значимых изолятов данного вида.

На основании наличия тех или иных генов определяют генотипические характеристики вирулентности или патовары исследуемых штаммов и сопоставляют их с генотипическими характеристиками вирулентности или патоварами штаммов, выделенных в лечебно-профилактическом учреждении от больных и окружающих предметов и имеющих предполагаемую эпидемиологическую связь с исследуемыми штаммами. Штамм относят к госпитальным при соответствии генотипической характеристики вирулентности исследуемых штаммов генотипическим характеристикам вирулентности хотя бы одного из штаммов, выделенных от больных и окружающих предметов в лечебно-профилактическом учреждении.

Отличительными существенными признаками заявляемого способа является:

- определение генотипических характеристик вирулентности исследуемых штаммов и их сопоставление с генотипическими характеристиками вирулентности штаммов, выделенных в лечебно-профилактическом учреждении от больных и окружающих предметов;

- отнесение штамма к госпитальным при соответствии генотипической характеристики вирулентности исследуемых штаммов генотипическим характеристикам вирулентности хотя бы одного из штаммов, выделенных от больных и окружающих предметов в лечебно-профилактическом учреждении.

Причинно-следственная связь между отличительными существенными признаками и достигаемым результатом

Выбор данных генотипических характеристик в качестве основных отличительных признаков заявляемого изобретения основан на обоснованном авторами теоретическом положении о том, что именно вирулентность является основной характеристикой госпитального штамма. Так, например, отмечено возрастание уровня вирулентности в процессе формирования госпитального штамма синегнойной палочки в урологическом стационаре [7], Serratia marcesens в отделении реанимации новорожденных [8]. При этом другие биологические характеристики госпитальных штаммов, такие как устойчивость к антибиотикам, являются второстепенными. Показано, в частности, что множественная устойчивость к антибактериальным препаратам может быть в равной степени свойственна как госпитальным, так и негоспитальным штаммам энтерококков [9]. Таким образом, с нашей точки зрения, методы выявления госпитальных штаммов, основанные на определении антибиотикограмм, не являются достаточно специфичными и требуют обязательного потверждения с использованием других методов внутривидового типирования. В то же время известно, что госпитальные популяции возбудителей внутрибольничных инфекций отличаются от негоспитальных содержанием большего количества генов факторов патогенности, обуславливающих повышенную вирулентность [10, 11]. При этом эпидемиологически связанные культуры будут обладать одним и тем же набором факторов патогенности, представляя собой один штамм. Данное обстоятельство позволяет использовать наличие генов факторов патогенности (хотя бы одного, т.к. штаммы, не обладающие ими, не имеют клинического и эпидемического значения) и их сочетание (т.е. генотипическую характеристику вирулентности) в качестве отличительного признака госпитального штамма при условии, что другие штаммы, выделенные в лечебно-профилактическом учреждении, имеют сходную генотипическую характеристику, т.е. имеются доказательства их эпидемиологической связи.

Таким образом, использование заявляемого нами способа позволяет в кратчайшие сроки выявить основные неотъемлемые свойства госпитального штамма (вирулентность и определяющие ее генетические детерминанты) и идентифицировать на основании наличия этих свойств госпитальный штамм.

Совокупность отличительных существенных признаков является новой и позволяет, в отличие от прототипа, упростить способ выявления госпитальных штаммов и сократить время его проведения.

Примеры использования способа

Пример 1

В процессе эпидемиологического наблюдения в гинекологическом стационаре осуществляли определение генетических характеристик штаммов Enterococcus spp. по заявляемому способу с помощью полимеразно-цепной реакции (ПЦР) по 5 генам вирулентности - gelE, sprE, fsrB, esp u asal. Для выделения ДНК штаммы энтерококков выращивались в триптозо-соевом бульоне ("BioMerieux"), после чего ДНК выделялась методом экспресс-ПЦР.

ПЦР проводили, начиная с предварительной инкубации проб при 94°С в течение 2 мин, а затем в течение 30 циклов при следующих условиях: денатурация (94°С) - 30 сек, отжиг (47°С-65°С, в зависимости от Г-Ц состава праймеров) - 60 сек, синтез (72°С) - 60 сек, конечный синтез 10 мин при 72°С. Для амплификации были использованы праймеры, приведенные в таблице. Эксперимент выполняли на приборе MJ Research.

Результаты ПЦР оценивались после электрофореза в 1% агарозном геле в ультафиолетовом освещении.

В процессе эпидемиологического наблюдения в гинекологическом стационаре было выявлено, что у больной Л., поступившей 09.07.2005 года с диагнозом метроэндометрит (и/б №25230), на пятые сутки пребывания в отделении был выделен Е. faecium №429. На основании определения генов вирулентности данный штамм был отнесен к генотипу 2 (присутствие гена esp при отсутствии генов gelE, sprE, fsrB, asal). В тот же день этот возбудитель соответствующего генотипа был выделен из смыва с перчаток (штамм 138 вс). При эпидемиологическом обследовании выявлено, что 11.07.05 г. при осмотре больной Л. из заднего свода влагалища и цервикального канала был выделен штамм №421, сходный по генотипическим характеристикам с вышеуказанными штаммами.

В данном случае фактором передачи могли служить считающиеся стерильными перчатки, взятые для осмотра из общего бикса, который был уже вскрыт.

Таким образом, культуры №421, 429 и 138 вс имели одинаковую генотипическую характеристику, ген фактора патогенности esp и имели очевидную эпидемиологическую связь; на основании вышеперчисленных признаков они были отнесены к госпитальному штамму.

Пример 2

В отделении гнойной остеологии проводилось эпидемиологическое наблюдение за внутрибольничными инфекциями, обусловленными метициллин-резистентными штаммами золотистого стафилококка (MRSA). В октябре 2008 года у четырех пациентов стационара был идентифицирован MRSA с генотипом 1 (наличие гена sea, при отсутствии генов seb, sec, pvl, tst). В связи с тем, что было предположено эпидемическое распространение госпитального штамма MRSA в стационаре, было решено провести бактериологическое обследование объектов окружающей среды стационара с целью выявления факторов передачи данного штамма. В результате данного обследования было выделено 4 культуры стафилококка: 139 вс (из смыва с ручки перевязочного столика), 140 вс (из смыва с ручки крана в перевязочной), 148 вс (смыв с рук медицинской сестры А.Н.), 1а (из воздуха перевязочной). Заявляемый способ был применен для отнесения данных культур к госпитальному штамму. Определение генов вирулентности (энтеротоксины А, В, С, ген токсического шока и ген токсина Пантона-Валлентайна) проводилось по методике M.Mehrortra [12] и Lina G

[13]. В результате проведенных исследований культуры 139 вс и 140 вс были отнесены к генотипу 1 (наличие гена sea, при отсутствии генов seb, sec, pvl, tst), культура 148 вс была отнесена к генотипу 2 (наличие генов sea, seb, при отсутствии генов sec, pvl, tst), a при исследовании культуры 1а оказалось, что она не содержит исследуемых генов факторов патогенности. Таким образом, при сопоставлении генетических характеристик исследуемых культур с генетическими характеристиками штаммов, ранее обнаруженных в стационаре, культуры 139 вс и 140 вс были отнесены к госпитальному штамму, а культуры 148 вс и 1а не были отнесены к госпитальным.

Заявляемый способ апробирован при организации эпидемиологического наблюдения за внутрибольничными инфекциями в стационарах Санкт-Петербурга (гинекологическое отделение ГУЗ "Мариинская больница", отделение гнойной остеологии больницы им. Петра Великого, стационар городского центра профилактики СПИД и инфекцонных заболеваний). Всего было исследовано 105 штаммов энтерококков, 61 штамм золотистого стафилококка. В первых двух стационарах апробация заявляемого способа позволила выявить формирование госпитальных штаммов энтерококков и золотистого стафилококка. В связи с тем, что традиционно применяемый метод отнесения культур к госпитальному штамму, основанный на определении антибиотикограммы, обладает недостаточной специфичностью, для верификации правильности отнесения исследуемых культур к госпитальному штамму был использован метод эпидемиологического маркирования [3]. Для определения принадлежности выделяемых культур к одному штамму (клональному типу) использована комбинацию нескольких методов внутривидового типирования, являющихся независимыми по отношению друг к другу (фаготип и антибиотикограмма для энтерококков, типирование методом электрофореза ДНК в пульсирующем поле, spa-сиквенстип и антибиотикограмма для стафилококков), а для доказательства того, что данный штамм вызывал связанные случаи заболеваний в стационаре, использован метод эпидемиологического наблюдения. Использование комбинации методов внутривидового типирования в сопоставлении с эпидемиологическими данными позволяет надежно идентифицировать госпитальный штамм [14]. Всего с использованием заявляемого способа и метода сравнения было протестировано 38 культур микроорганизмов. Во всех случаях применение указанного методического приема позволило подтвердить правильность отнесения исследуемых культур к госпитальному штамму.

Таким образом, заявляемый способ позволяет идентифицировать госпитальные штаммы.

В отличие от способа, выбранного в качестве прототипа, заявляемый способ выявления госпитальных штаммов позволяет существенно сократить затраты времени на идентификацию госпитального штамма.

По нашим наблюдениям затраты времени по выявлению 5 генов факторов патогенности в 10 бактериальных штаммах составляют от 7 до 12 часов (от момента получения чистой культуры микрорганизма), таким образом, процесс отнесения исследуемого штамма к госпитальным составляет не более двух рабочих дней, в отличие от 10-15 дней при идентификации госпитального штамма способом, выбранным в качестве прототипа.

Для выполнения данного способа, в отличие от прототипа, не требуется высокой квалификации медицинского персонала, предполагающей овладение сложными молекулярно-генетическими (выделение и рестрикция плазмид) и микробиологическими (определение адгезии микроорганизма к эпителию) методиками. Кроме того, процесс идентификации генов методом ПЦР в отличие от характеристик, определяемых по способу, выбранному в качестве прототипа, может быть частично или полностью автоматизирован при использовании робототехники, что существенно сокращает затраты времени и трудовые затраты.

К особенностям предлагаемого способа относится также легкость интерпретации результатов, поскольку отнесение исследуемой культуры к госпитальным штаммам производится на основании всего лишь одного критерия - соответствии генотипической характеристики вирулентности исследуемого штамма генотипическим характеристикам вирулентности хотя бы одного из штаммов, выделенных от больных и окружающих предметов в лечебно-профилактическом учреждении.

Таким образом, заявляемый способ позволяет упростить выявление госпитальных штаммов и сократить время проведения способа.

Литература

1. Семина Н.А. Внутрибольничные инфекции как проблема биобезопасности. /Н.А.Семина. //Вестник Российской АМН. - 2002. - №10. - С.48-50.

2. Зуева Л.П., Яфаев Р.Х. Эпидемиология: Учебник. - СПб, 2006. - 752 с.

3. Пфаллер М.А., Кормикан М.Дж. Микробиологические аспекты проблемы внутрибольничных инфекций: роль клинической лаборатории. В кн. Р.П.Венцель. Внутрибольничные инфеции. М. 2004. - 840 с.

4. RU 2245922, 10.02.2005.

5. RU 2285258, 10.10.2006.

6. RU 2110579, 10.05.1998.

7. Яфаев Р.Х., Зуева Л.П. Эпидемиология внутрибольничной инфеции. Л.: Медицина, 1989. - 168 с.

8. Любимова А.В., Зуева Л.П., Еремин С.Р., Хрусталева Н.М., Любименко В.А., Пулин A.M., Шулаева С.В., Лещинская В.Н. Успехи внедрения системы инфекционного контроля в отделениях реанимации новорожденных. В кн.: Л.П. Зуева. Опыт внедрения инфекционного контроля в лечебно-профилактических учреждениях. СПб. 2003, с.91-129.

9. Яфаев Р.Х., Колоджиева В.В., Ермоленко Е.И., Суворов А.Н. Энтерококковые инфекции урогенитального тракта в условиях стационара и поликлиники. Стационарзамещающие технологии. Амбулаторная хирургия. №3 (23), 2006 г.

10. Becker К., A.W.Friedrich, G.Lubritz, M.Weilert, G.Peters, and C. von Eiff. 2003. Prevalence of genes encoding pyrogenic toxin superantigens and exfoliative toxins among strains of Staphylococcus aureus isolated from blood and nasal specimens. J. Clin. Microbiol. 41:1434-1439.

11. Schmidt, H. and Hensel, M. (2004) Pathogenicity islands in bacterial pathogenesis. Clin. Microbiol. Rev., 17, 14-56. 12, 656-664.

12. Mehrotra M., Wang G. and Johnson W.M. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance.// J. Clin. Microbiol. - 2000, 38, 3: 1032-1035.

13. Lina G., Piemont Y., et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis 1999; 29:1128-1132.

14. Шагинян И.А. Роль и место молекулярно-генетических методов в эпидемиологическом анализе внутрибольничных инфекций. Клин. микробиология и антимикробная химиотерапия." 2000. - Т2, №3, с.82-95.

Гены и праймеры Последовательность нуклеотидов 5′-3′ Ожидаемый размер продукта амплификации н.п.
gelE gelE 1 ACCCCGTATCATTGGTTT 419
gelE 2 ACGCATTGCTTTTCCATC
esp esp 1 TTGCTAATGCTAGTCCACGACC 933
esp 2 GCGTCAACACTTGCATTGCCGAA
sprE spr 1 GCGTCAATCGGAAGAATCAT 233
spr 2 CGGGGAAAAAGCTACATCAA
fsrB fsr 1 TTTATTGGTATGCGCCACAA 316
fsr 2 TCATCAGACCTTGGATGACG
asal asa 1 CCAGCCAACTATGGCGGAATC 529
asa 2 CCTGTCGCAAGATCGACTGTA

Способ выявления госпитальных штаммов, включающий определение генотипа штамма, отличающийся тем, что определяют генотипические характеристики вирулентности исследуемых штаммов и сопоставляют их с генотипическими характеристиками вирулентности штаммов, выделенных в лечебно-профилактическом учреждении, от больных и окружающих предметов, штаммы относят к госпитальным при соответствии генотипической характеристики вирулентности исследуемых штаммов генотипическим характеристикам вирулентности хотя бы одного из штаммов, выделенных в лечебно-профилактическом учреждении, от больных и окружающих предметов.



 

Похожие патенты:

Изобретение относится к области молекулярной генетики и может быть использовано в научно-исследовательской практике при изучении механизмов развития первичной врожденной глаукомы (ПВГ).

Изобретение относится к области медицины и касается способа измерения резистентности к доцетакселу. .

Изобретение относится к области биотехнологии, конкретно к способу скрининга новорожденных на такие наследственные заболевания, как муковисцидоз, врожденный гипотиреоз, галактоземия, фенилкетонурия, и может быть использовано для обнаружения большого количества мутаций в ДНК обследуемого за один анализ крови.

Изобретение относится к области биотехнологии, в частности, к олигонуклеотиду с двойной специфичностью, способу его получения и способам, в которых он используется.

Изобретение относится к сельскому хозяйству и может быть использовано в селекции сои. .
Изобретение относится к области медицины, в частности к фтизиатрии. .
Изобретение относится к медицине, а именно к стоматологии и общей патологии, и может найти свое применение при оценке интенсивности воспаления в тканях пародонта у больных пародонтитом, на основании установлении ассоциаций между полиморфизмами генов, регулирующих реакцию воспаления CD14(C/C, С/Т, Т/Т) при С(-260) Т, TNF-a (A/A, G/A, G/G) при G(-308) A и c-fms (3'UTR ТС СА) и (del425) и показателями тканевой резистентности пародонта.
Изобретение относится к медицинской микробиологии и касается подбора высокоактивных антибактериальных средств для лечения заболеваний, вызываемых патогенными буркхольдериями.

Изобретение относится к области ветеринарии и медицины, а именно к изучению инфекционных заболеваний, и может быть использовано для моделирования стадийности течения инфекции, прогнозирования клинического исхода и оценки схем лечения в эксперименте.
Изобретение относится к медицинской и ветеринарной микробиологии и может быть использовано для диагностики энтерококков. .

Изобретение относится к области микробиологии, в частности к оптическим способам определения количества таких микробиологических объектов, как бактерийные клетки, грибы, дрожжи в процессе их культивирования, и может быть использовано для диагностических целей в медицине, а также контроле биотехнологических процессов.

Изобретение относится к биотехнологии и может быть использовано в научно-исследовательской и практической работе для бактериологической диагностики ряда условно патогенных микроорганизмов.

Изобретение относится к биотехнологии и представляет собой способ детекции живых клеток микроорганизма путем дифференцирования живых клеток от мертвых клеток или поврежденных клеток в тестируемом образце.
Изобретение относится к биотехнологии, в частности к микробиологии. .

Изобретение относится к биотехнологии и может быть использовано в медицинской микробиологии. .

Изобретение относится к микробиологии и биотехнологии и касается применения штамма Escherichia coli К12 TG 1 (lux+) с клонированными генами luxCDABE Photobacterium leiognathi 54D10 («Эколюм-9») в качестве тест-штамма для определения биологической активности катионных антимикробных пептидов (дефенсинов и их производных)
Наверх