Способ подвидовой дифференциации штаммов возбудителя чумы методом секвенирования



Способ подвидовой дифференциации штаммов возбудителя чумы методом секвенирования
Способ подвидовой дифференциации штаммов возбудителя чумы методом секвенирования

 


Владельцы патента RU 2404256:

Федеральное государственное учреждение здравоохранения "Российский научно-исследовательский противочумный институт "Микроб" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека ("РосНИПЧИ "Микроб") (RU)
Российская Федерация, от имени которой выступает Федеральная служба по надзору в сфере защиты прав потребителей и благополучия человека (RU)

Изобретение относится к биотехнологии. Дифференциацию штаммов проводят методом секвенирования. Метод предусматривает выделение хромосомной ДНК исследуемого штамма, проведение полимеразной цепной реакции, амплификацию фрагментов генов rhaS и araC и определение их нуклеотидных последовательностей. Генотип исследуемого штамма устанавливают путем сравнения с генотипами основного и неосновных подвидов. Способ позволяет быстро, эффективно и надежно проводить подвидовую дифференциацию штаммов возбудителя чумы. 1 ил., 2 табл.

 

Изобретение относится к области медицинской микробиологии, в частности к подвидовой дифференциации штаммов возбудителя чумы и к молекулярному типированию чумного микроба.

По существующей в настоящее время классификации возбудитель чумы на основании ряда биохимических признаков делится на биовары и подвиды. Однако проявление фенотипических признаков может значительно изменяться в зависимости от условий существования возбудителя. Более надежными являются способы, основанные на генетических свойствах, отличающихся большей консервативностью и поэтому дающих более стабильные и хорошо воспроизводимые результаты.

Штаммы возбудителя чумы, циркулирующие в природных очагах Российской Федерации и ближнего зарубежья, делятся на 5 подвидов: основной и 4 неосновных подвида - кавказский, алтайский, гиссарский и улегейский. Несмотря на то что все пять подвидов очень близки по свойствам, они значительно отличаются по вирулентности и эпидемической значимости. В связи с этим, важное значение имеет разработка надежных и эффективных методов генетической подвидовой дифференциации Yersinia pestis. Используемые для этих целей генетические способы основаны на сравнительном анализе числа вариабельных тандемных повторов (VNTR) - небольших повторяющихся последовательностей ДНК, расположенных в различных участках генома чумного микроба. Но эти последовательности либо отличаются очень высокой вариабельностью, не позволяющей определять подвидовую принадлежность штаммов Y.pestis, либо сами расположены в нестабильных областях генома, которые могут утрачиваться в результате протяженных делеций (Брюханов с соавт., 2001; Klevitska et al., 2001; Сучков с соавт. 2006, Булгакова с соавт., 2008). Использование VNTR анализа для молекулярного типирования штаммов бактерий необходимо сочетать с анализом других более консервативных участков ДНК. Для этого чаще всего используются гены вирулентности и жизнеобеспечения (Achtman et al., 1999; Kotetishwili et al., 2005), однако эти гены отличаются высоким консерватизмом, ограничивающим их применение для генотипирования возбудителя чумы. Кроме того, в литературе отсутствуют публикации об использовании каких-либо генов жизнеобеспечения для дифференциации именно неосновных подвидов Y.pestis.

Известен способ дифференциации иерсиний методом секвенирования фрагментов генов жизнедеятельности glnA, gyrB, recA, Y-HSP60, полученных в полимеразной цепной реакции (Kotetishwili et al. Multilocus sequence typing for studying genetic relationships among Yersinia species. J. Clin. Microbiol. 2005. Vol.43, N 6. P.2674-2684). Однако использование этих генов позволяет дифференцировать возбудителя чумы от других представителей рода Yersinia, но не проводит внутривидовую дифференциацию чумного микроба и не позволяет определять подвидовую принадлежность штамма. В литературе отсутствуют и другие публикации об использовании каких-либо генов жизнеобеспечения для подвидовой дифференциации возбудителя чумы методом секвенирования.

Задачей изобретения является поиск в геноме чумного микроба менее консервативных генов, отличающихся большей вариабельностью их нуклеотидных последовательностей, использование которых позволяет проводить подвидовую дифференциацию штаммов Y.pestis.

Впервые предложен способ дифференциации штаммов возбудителя чумы по подвидам, основанный на использовании в качестве ДНК-мишеней для секвенирования генов rhaS и araC, контролирующих ферментацию рамнозы и арабинозы. Гены rhaS и araC входят в состав rha и ara оперонов, кодирующих утилизацию моносахаридов - рамнозы и арабинозы. Ферментация рамнозы и арабинозы является дифференциально-диагностическим признаком, используемым в биохимических схемах внутривидовой дифференциации возбудителя чумы. Различные подвиды Y.pestis отличаются по фенотипическому проявлению этих признаков, что позволяет предположить наличие у некоторых из них генетических дефектов в пути биосинтеза моносахаридов и вариабельность нуклеотидной последовательности генов rha и ara оперонов, а также указывает на возможность использования этих генов жизнеобеспечения для подвидовой дифференциации чумного микроба.

Технический результат предлагаемого изобретения заключается в возможности проведения подвидовой дифференциации штаммов чумного микроба.

Технический результат достигается способом дифференциации штаммов возбудителя чумы методом секвенирования, который предусматривает выделение хромосомной ДНК исследуемого штамма, проведение полимеразной цепной реакции, амплификацию фрагментов генов rhaS и araC, регулирующих экспрессию ферментации рамнозы и арабинозы, при этом олигонуклеотидные праймеры на гены rhaS и araC имеют следующие последовательности:

RhaS s CAAATAAAGTGCTTGATTGCTTGTCTD

RhaS as GCTATTGTCGCTGTAACACAGTTGATG

AraC s - ATTGTTGGTATCACCGCTG

AraC as - TACTGGCATAACCGTAGC,

в полученной нуклеотидной последовательности фрагментов генов rhaS и araC по нуклеотидам, находящихся в позициях 482, 494, 671 гена rhaS и в позиции 773 гена araC, определяют генотип штамма, после чего проводят дифференциацию штаммов путем сравнения полученного генотипа с генотипами основного и неосновных подвидов.

Способ осуществляют следующим образом.

Выделение хромосомной ДНК исследуемого штамма чумного микроба проводят по стандартной методике в соответствии с МУ 1.3.1794-03 «Организация работы при исследованиях методом ПЦР материала, инфицированного микроорганизмами I-II групп патогенности».

Полимеразную цепную реакцию осуществляют по стандартной методике (МУ 1.3.1794-03) с применением вышеуказанных праймеров на гены rhaS и araC.

Олигонуклеотидные праймеры, используемые для амплификации в ПЦР фрагментов генов rhaS и araC, рассчитаны на основе нуклеотидных последовательностей этих генов у штаммов чумного микроба CO92 и Pestoides F, представленных в базе данных GenBank. С помощью рассчитанных праймеров проводят в ПЦР амплификацию фрагментов генов rhaS и araC и определяют нуклеотидные последовательности полученных фрагментов генов. Олигонуклеотидные праймеры на гены rhaS и araC имеют следующий состав:

RhaS s CAAATAAAGTGCTTGATTGCTTGTCTG

RhaS as GCTATTGTCGCTCTAACACAGTTGATG

AraC s - ATTGTTGGTATCACCGCTG

AraC as - TACTGGCATAACCGTAGC

Полимеразную цепную реакцию с амплификацией фрагментов генов rhaS и araC с применением праймеров RhaS-s и RhaS-as, AraC-s и AraC-as осуществляют по следующей программе: 1-й цикл - 95°С, 5 мин; затем 35 циклов - 95°С, 45 сек; 58°С, 45 сек; 72°С, 1 мин и завершающий цикл - 72°С, 5 мин.

Определение нуклеотидных последовательностей ПЦР - фрагментов генов rhaS и araC проводят на автоматическом секвенаторе по методу F. Sanger et al. (1977) с использованием прямых и обратных праймеров.

Для определения генотипа исследуемого штамма и сравнения его с генотипами основного и неосновных подвидов проводят анализ нуклеотидов, находящихся в позициях 482, 494, 671 гена rhaS и в позиции 773 гена araC. Затем устанавливают генотип штамма и сравнивают с генотипом основного и неосновных подвидов возбудителя чумы. Совпадение генотипа исследуемого штамма с генотипом одного из подвидов свидетельствует о принадлежности изучаемого штамма к этому подвиду.

Штаммы

основного подвида имеют генотип rhaS: 482-G. 494-Т, 671-А, araC: 773-Т,

кавказского подвида имеют генотип rhaS: 482-G. 494-С, 671-G, araC: 773-Т,

алтайского подвида имеют генотип rhaS: 482-G. 494-T, 671-G, araC: 773-G,

гиссарского подвида имеют генотип rhaS: 482-A. 494-Т, 671-G, araC: 773-G,

улегейского подвида имеют генотип rhaS: 482-G. 494-Т, 671-G, araC: 773-T

Результаты сравнения нуклеотидных последовательностей фрагментов генов rhaS и araC у штаммов различных подвидов Y.pestis представлены в таблице 1. Интерпретацию полученных результатов осуществляют в соответствии с таблицей 2. Принцип подвидовой дифференциации наглядно отражен на представленном чертеже.

Сущность изобретения поясняется примерами.

Пример 1. Подвидовая дифференциация штамма Y.pestis M-231 (Модельный эксперимент).

Выделение ДНК штамма Y.pestis M-231 проводят стандартным методом с помощью лизирующего раствора на основе 6М гуанидинизотиоцианата с предварительным обеззараживанием культуры путем добавления мертиолята натрия до концентрации 1:10000 с последующим прогреванием при температуре 56°С в течение 30 мин. (Организация работы при исследованиях методом ПЦР материала, инфицированного микроорганизмами I-II групп патогенности (МУ 1.3.1794-03)).

Полимеразную цепную реакцию проводят в объеме 25 мкл; реакционная смесь содержит: 1 × буфер (10 × ПЦР-буфер - 2,5 мкл), MgCl2 - 2,0 мМ, смесь dNTP - 0,3 мМ, олигонуклеотидные праймеры - 2 пмол, Taq DNA полимераза - 0,1 ед., исследуемой ДНК - 10 мкл. Продукты амплификации анализируют в 1-2% агарозном геле с добавлением этидиум бромида и просматриваются в УФ свете.

Нуклеотидные последовательности образованных в ПЦР фрагментов генов rhaS и araC определяют на автоматическом секвенаторе по методу F. Sanger et al. (1977) с использованием прямых и обратных праймеров. В определенных с помощью вышеуказанных манипуляций нуклеотидных последовательностях генов rhaS и araC устанавливают нуклеотиды, находящиеся в позициях 482, 494, 671 гена rhaS и 773 гена araC и определяют генотип штамма. Штамм Y.pestis M-231 имеет генотип rhaS: 482-G, 494-Т, 671-А, araC: 773-Т. По данным таблицы 2 устанавливают, что такой генотип имеют штаммы основного подвида чумного микроба, из чего делают вывод о принадлежности штамма Y.pestis M-231 к основному подвиду возбудителя чумы.

Пример 2. Дифференциацию штамма Y.pestis 818 проводят аналогично примеру 1. В полученных нуклеотидных последовательностях генов rhaS и araC определяют нуклеотиды, расположенные в позиции 482, 494, 671 гена rhaS и 773 гена araC, и определяют генотип штамма. Штамм Y.pestis 818 имеет генотип rhaS: 482-G, 494-С, 671-G, araC: 773-Т. По данным таблицы 2 устанавливают, что такой генотип имеют штаммы кавказского подвида чумного микроба, что свидетельствует о принадлежности штамма Y.pestis 818 к кавказскому подвиду возбудителя чумы.

Пример 3. Дифференциацию штамма Y.pestis И2359 проводят аналогично примеру 1. В полученных нуклеотидных последовательностях генов rhaS и araC определяют нуклеотиды, расположенные в позиции 482, 494, 671 гена rhaS и 773 гена araC, и определяют генотип штамма. Штамм Y.pestis И2359 имеет генотип rhaS: 482-G, 494-T/C, 671-G, araC: 773-G. По данным таблицы 2 устанавливают, что такой генотип имеют штаммы алтайского подвида чумного микроба. Делают вывод о принадлежности штамма Y.pestis И2359 к алтайскому подвиду возбудителя чумы.

Пример 4. Дифференциацию штамма Y.pestis A-1728 проводят аналогично примеру 1. В полученных нуклеотидных последовательностях генов rhaS и araC определяют нуклеотиды, расположенные в позиции 482, 494, 671 гена rhaS и 773 гена araC, и определяют генотип штамма. Штамм Y.pestis А-1728 имеет генотип rhaS: 482-А, 494-Т, 671-G, araC: 773-G. По данным таблицы 2 устанавливают, что такой генотип имеют штаммы гиссарского подвида чумного микроба. Делают вывод о принадлежности штамма Y.pestis А-1728 к гиссарскому подвиду возбудителя чумы.

Пример 5. Дифференциацию штамма Y.pestis И-3131 проводят аналогично примеру 1. В полученных нуклеотидных последовательностях генов rhaS и araC определяют нуклеотиды, расположенные в позиции 482, 494, 671 гена rhaS и 773 гена araC, и определяют генотип штамма. Штамм Y.pestis И-3131 имеет генотип rhaS: 482-G, 494-Т, 671-G, araC: 773-T. По данным таблицы 2 устанавливают, что такой генотип имеют штаммы улегейского подвида чумного микроба. Делают вывод о принадлежности штамма Y.pestis И-3131 к улегейскому подвиду возбудителя чумы.

Отличительной особенностью заявляемого способа является использование в качестве ДНК мишеней для секвенирования последовательностей генов - rhaS и araC, ранее никогда не применявшихся для подвидовой дифференциации возбудителя чумы. Преимущество использования этих генов заключается в том, что они позволяют дифференцировать не только основной и неосновные подвиды, но и проводить разделение среди неосновных подвидов с точным установлением подвидовой принадлежности изучаемого штамма и отнесением его к одному из пяти подвидов Y.pestis (основной, кавказский, алтайский, гиссарский и улегейский). Использование в заявляемом способе генов rhaS и araC, имеющих большую вариабельность нуклеотидных последовательностей по сравнению с другими генами жизнеобеспечения, применяемыми в настоящее время для генотипирования возбудителя чумы, впервые дает возможность проводить генетическую дифференциацию по подвидам, что значительно повышает эффективность внутривидового типирования Y.pestis по подвидам. Применение рассчитанных нами праймеров на гены rhaS и araC позволяет проводить секвенирование относительно небольших (соответственно 360 и 829 п.н.), но наиболее вариабельных фрагментов этих генов. Заявленный способ успешно апробирован на тридцати двух штаммах возбудителя чумы основного и неосновных подвидов.

Таким образом, заявленный способ, основанный на определении нуклеотидной последовательности фрагментов генов rhaS и araC, регулирующих ферментацию рамнозы и арабинозы, позволяет быстро, эффективно и надежно проводить дифференциацию подвидов возбудителя чумы, отличающихся по вирулентному и эпидемическому потенциалу.

Таблица 1
Способ подвидовой дифференциации штаммов возбудителя чумы методом секвенирования
Штаммы Ген, позиция
rhaS 482 rhaS 494 rhaS 671 araC 773
Y. pestis GenBank* G Т А Т
Основной подвид:
М-231 G Т А Т
А-161 G Т А Т
А-1836 G Т А Т
М-519 G Т А Т
А-1793 G Т А Т
А-1822 G Т А Т
И-2638 G Т А Т
И-3223 G Т А Т
805 G Т А Т
Кавказский подвид:
1146 G С G Т
818 G С G Т
3551 G С G Т
376 G С G Т
1470 G С G Т
Алтайский подвид:
И-2359 G Т G G
И-2998 G Т G G
KM 1203 G Т G G
Км 1205 G Т G G
4857 G Т G G
И-3085 G Т G G
И-3000 G Т G G
Гиссарский подвид:
A-1249 А Т G G
A-1633 А Т G G
A-1726 А Т G G
A-1728 А Т G G
A-1730 А Т G G
Улегейский подвид:
И-3131 G Т G Т
И-3069 G Т G Т
И-2422 G Т G Т
И-3068 G Т G Т
И-3071 G Т G Т

Способ подвидовой дифференциации штаммов возбудителя чумы методом секвенирования, включающий выделение хромосомной ДНК исследуемого штамма, проведение полимеразной цепной реакции с использованием праймеров:
RhaS s CAAATAAAGTGCTTGATTGCTTGTCTG;
RhaS as GCTATTGTCGCTGTAACACAGTTGATG;
AraC s - ATTGTTGGTATCACCGCTG;
AraC as - TACTGGCATAACCGTAGC,
на гены rhaS и araC, регулирующие ферментацию рамнозы и арабинозы, амплификацию фрагментов генов, установление их нуклеотидной последовательности и определение генотипа штамма по нуклеотидам, находящимся в позициях 482, 494, 671 гена rhaS и в позиции 773 гена araC, после чего проводят дифференциацию штаммов путем сравнения полученного генотипа с генотипами основного и неосновных подвидов.



 

Похожие патенты:
Изобретение относится к выявлению госпитальных штаммов микроорганизмов в лечебно-профилактических учреждениях и проведению соответствующих противоэпидемических мероприятий в них.

Изобретение относится к области молекулярной генетики и может быть использовано в научно-исследовательской практике при изучении механизмов развития первичной врожденной глаукомы (ПВГ).

Изобретение относится к области медицины и касается способа измерения резистентности к доцетакселу. .

Изобретение относится к области биотехнологии, конкретно к способу скрининга новорожденных на такие наследственные заболевания, как муковисцидоз, врожденный гипотиреоз, галактоземия, фенилкетонурия, и может быть использовано для обнаружения большого количества мутаций в ДНК обследуемого за один анализ крови.

Изобретение относится к области биотехнологии, в частности, к олигонуклеотиду с двойной специфичностью, способу его получения и способам, в которых он используется.

Изобретение относится к сельскому хозяйству и может быть использовано в селекции сои. .
Изобретение относится к области медицины, в частности к фтизиатрии. .
Изобретение относится к медицинской микробиологии, в частности к набору для обнаружения диагностически значимых генов и генов вирулентности возбудителя холеры в материале от больных людей и из объектов окружающей среды и набору для определения экспрессии данных генов, и может быть использовано в научно-исследовательских учреждениях, региональных и областных службах санэпиднадзора

Изобретение относится к медицинской иммунологии, а именно к способам определения функциональной активности компонентов комплемента в сыворотке крови человека при диагностике ряда заболеваний и в биологических препаратах

Изобретение относится к области медицины, а именно к способу прогнозирования профилактического и/или терапевтического эффекта агониста RAR- у онкологических больных

Изобретение относится к медицине, а именно к фтизиатрии
Изобретение относится к области медицины, в частности к онкологии и урологии, и может быть использовано для ранней ДНК-диагностики рака предстательной железы
Изобретение относится к области медицины, в частности к молекулярно-генетическим исследованиям

Изобретение относится к термоциклерами и может быть использовано для амплификации нуклеиновой кислоты

Изобретение относится к медицине, а именно фтизиатрии, и может быть использовано для прогноза развития заболевания туберкулезом органов дыхания

Изобретение относится к области биотехнологии, в частности к набору из двух праймеров для амплификации нуклеиновой кислоты вируса гепатита А, к способу обнаружения вируса гепатита А в биологическом образце, а также к набору для обнаружения вируса гепатита А в биологическом образце
Наверх