Рекомбинантная экспрессия дефенсинов в мицелиальных грибах



Рекомбинантная экспрессия дефенсинов в мицелиальных грибах
Рекомбинантная экспрессия дефенсинов в мицелиальных грибах
Рекомбинантная экспрессия дефенсинов в мицелиальных грибах
Рекомбинантная экспрессия дефенсинов в мицелиальных грибах
Рекомбинантная экспрессия дефенсинов в мицелиальных грибах
Рекомбинантная экспрессия дефенсинов в мицелиальных грибах
Рекомбинантная экспрессия дефенсинов в мицелиальных грибах
Рекомбинантная экспрессия дефенсинов в мицелиальных грибах
Рекомбинантная экспрессия дефенсинов в мицелиальных грибах
Рекомбинантная экспрессия дефенсинов в мицелиальных грибах
Рекомбинантная экспрессия дефенсинов в мицелиальных грибах
Рекомбинантная экспрессия дефенсинов в мицелиальных грибах

 


Владельцы патента RU 2404990:

НОВОЗИМС ЭДЕНИУМ БАЙОТЕК А/С (DK)

Изобретение относится к рекомбинантной экспрессии дефенсинов насекомых в клетке мицелиальных грибов рода Aspergillus. Данная клетка трансформирована генетической конструкцией, кодирующей дефенсин насекомых, и содержит одну или несколько интронных последовательностей. Интронная последовательность может быть вставлена в любое место конструкции нуклеиновой кислоты. При применении предложенной конструкции уровень рекомбинантной экспрессии дефенсина может быть улучшен более чем на 50% по сравнению с применением конструкции нуклеиновой кислоты без интронных последовательностей. 3 н. и 3 з.п. ф-лы, 1 табл.

 

Область техники

Настоящее изобретение относится к рекомбинантной экспрессии антимикробных пептидов дефенсина в мицелиальных грибах.

Уровень техники

Дефенсины принадлежат к классу малых антимикробных пептидов. Они способны уничтожать широкий спектр микроорганизмов, некоторые из которых становятся все более и более устойчивыми по отношению к традиционным антибиотикам. По этой причине все больший интерес приобретает возможность получения дефенсинов в больших количествах по низкой цене.

Так как дефенсины обычно включают только 30-50 аминокислотных остатков, их часто трудно эффективно получать с использованием способов рекомбинантной ферментации. Химический пептидный синтез является альтернативным способом, но это становится слишком дорого, когда размер пептидов превышает 25-30 аминокислотных остатков. Другая сложность состоит в том, что дефенсины отличаются особым расположением остатков цистеина, которое трудно создать с помощью химического синтеза.

Соответственно задачей настоящего изобретения является предложение способов для получения улучшенных уровней экспрессии антимикробных пептидов дефенсина в рекомбинантной ферментации мицелиальных грибов.

Сущность изобретения

Авторы настоящего изобретения обнаружили, что путем вставки одной или нескольких интронных последовательностей в конструкцию нуклеиновой кислоты, которая направляет экспрессию дефенсина, уровень рекомбинантной экспрессии может быть улучшен более чем на 50% по сравнению с применением конструкции нуклеиновой кислоты без интронных последовательностей. Интронная последовательность(и) может быть вставлена в любое место конструкции нуклеиновой кислоты, такой как последовательность, кодирующая зрелый дефенсин, или даже в последовательность, кодирующую сигнальный пептид.

Соответственно настоящее изобретение относится к рекомбинантной клетке-хозяину мицелиальных грибов, содержащей конструкцию нуклеиновой кислоты, которая содержит чужеродную последовательность нуклеиновой кислоты, кодирующую дефенсин, и одну или несколько интронных последовательностей.

Во втором аспекте настоящее изобретение относится к способу рекомбинантной продукции дефенсина в клетке-хозяине мицелиальных грибов, который включает культивирование клетки-хозяина мицелиальных грибов, содержащей конструкцию нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, кодирующую пептид дефенсина, и одну или несколько интронных последовательностей; и получение пептида дефенсина.

В третьем аспекте изобретение относится к применению конструкции нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, кодирующую пептид дефенсина и одну или несколько интронных последовательностей для улучшения уровня рекомбинантной экспрессии дефенсина в клетке-хозяине мицелиальных грибов.

Определения

Антимикробная активность: термин «антимикробная активность» обозначает здесь активность, способную уничтожать микробные клетки или ингибировать их рост. В контексте настоящего изобретения подразумевается, что термин «антимикробный» обозначает, что существует бактерицидный, и/или бактериостатический, и/или фунгицидный, и/или фунгистатический эффект, и/или вироцидный эффект, где термин «бактерицидный» следует понимать, как способный уничтожать бактериальные клетки. Термин «бактериостатический» следует понимать, как способный ингибировать бактериальный рост, т.е. ингибировать рост бактериальных клеток. Термин «фунгицидальный» следует понимать как способный уничтожать клетки грибов. Термин «фунгостатический» следует понимать, как способный ингибировать рост грибов, т.е. ингибировать рост клеток грибов. Термин «вироцидный» следует понимать, как способный инактивировать вирус. Термин «микробные клетки» обозначает бактериальные клетки или клетки грибов (включая дрожжи).

В контексте настоящего изобретения подразумевается, что термин «ингибирование роста микробных клеток» обозначает, что клетки не находятся в стадии роста, т.е. они не имеют возможности репродуцироваться.

Для целей настоящего изобретения антимикробная активность может быть определена согласно процедуре, описанной Lehrer et al., Journal of Immunological Methods, Vol. 137 (2) pp. 167-174 (1991). В качестве альтернативы антимикробная активность может быть определена согласно NCCLS рекомендациям из CLSI (Института Клинических и Лабораторных Стандартов; широко известного, как Национальный Комитет по Клиническим и Лабораторным Стандартам).

Дефенсины, имеющие антимикробную активность, могут иметь способность уменьшать количество живых клеток Escherichia coli (DSM 1576) до 1 из 100 после 8 часов (предпочтительно, после 4 часов, более предпочтительно, после 2 часов, наиболее предпочтительно, после 1 часа и в особенности, после 30 минут) инкубации при 20°С в водном растворе 25% (масс./масс.) дефенсина, имеющего антимикробную активность; предпочтительно, в 10% (масс./масс.) водном растворе; более предпочтительно, в 5% (масс./масс.) водном растворе; еще более предпочтительно, в 1% (масс./масс.) водном растворе; наиболее предпочтительно, в 0,5% (масс./масс.) водном растворе; и, в особенности, в водном растворе 0,1% (масс./масс.) дефенсина, имеющего антимикробную активность.

Дефенсины, имеющие антимикробную активность, могут также иметь способность ингибировать разрастание Escherichia coli (DSM 1576) в течение 24 часов при 25°С в микробном субстрате роста при добавлении в концентрации 1000 м.д.; предпочтительно, при добавлении в концентрации 500 м.д.; более предпочтительно, при добавлении в концентрации 250 м.д.; еще более предпочтительно, при добавлении в концентрации 100 м.д.; наиболее предпочтительно, при добавлении в концентрации 50 м.д.; и, в особенности, при добавлении в концентрации 25 м.д. Дефенсины, имеющие антимикробную активность, могут иметь способность уменьшать количество живых клеток Bacillus subtilis (ATCC 6633) до 1 из 100 после 8 часов (предпочтительно, после 4 часов, более предпочтительно, после 2 часов, наиболее предпочтительно, после 1 часа и, в особенности, после 30 минут) инкубации при 20°С в водном растворе 25% (масс./масс.) дефенсина, имеющего антимикробную активность; предпочтительно в 10% (масс./масс.) водном растворе; более предпочтительно в 5% (масс./масс.) водном растворе; еще более предпочтительно в 1% (масс./масс.) водном растворе; наиболее предпочтительно в 0,5% (масс./масс.) водном растворе; и в особенности в водном растворе 0,1% (масс./масс.) дефенсина, имеющего антимикробную активность.

Дефенсины, имеющие антимикробную активность, могут также иметь способность ингибировать разрастание Bacillus subtilis (ATCC 6633) в течение 24 часов при 25°С в микробном субстрате роста при добавлении в концентрации 1000 м.д.; предпочтительно, при добавлении в концентрации 500 м.д.; более предпочтительно, при добавлении в концентрации 250 м.д.; еще более предпочтительно, при добавлении в концентрации 100 м.д.; наиболее предпочтительно, при добавлении в концентрации 50 м.д.; и, в особенности, при добавлении в концентрации 25 м.д.

Дефенсины по настоящему изобретению имеют, по меньшей мере, 20%, предпочтительно, по меньшей мере, 40%, более предпочтительно, по меньшей мере, 50%, более предпочтительно, по меньшей мере, 60%, более предпочтительно, по меньшей мере, 70%, более предпочтительно, по меньшей мере, 80%, еще более предпочтительно, по меньшей мере, 90%, наиболее предпочтительно, по меньшей мере, 95%, и еще более предпочтительно, по меньшей мере, 100% антимикробной активности дефенсина, состоящего из аминокислотной последовательности, представленной аминокислотами 1-42 SEQ ID NO:2.

кДНК: Термин «кДНК» обозначает здесь молекулу ДНК, которая может быть получена путем обратной транскрипции из зрелой сплайсированной молекулы мРНК, полученной в эукариотической клетке. кДНК лишена интронных последовательностей, которые обычно присутствуют в соответствующей геномной ДНК. Исходный первичный транскрипт РНК является предшественником мРНК, который процессируется через серию стадий, перед тем как появится в виде зрелой сплайсированной мРНК. Эти стадии включают удаление интронных последовательностей с помощью процесса, называемого сплайсингом. кДНК, полученная из мРНК, лишена, таким образом, любых интронных последовательностей.

Конструкция нуклеиновой кислоты: Термин «конструкция нуклеиновой кислоты», использованный здесь, имеет отношение к молекуле нуклеиновой кислоты как одноцепочечной, так и двухцепочечной, которая выделена из существующего в природе гена или которая модифицирована таким образом, что содержит сегменты нуклеиновых кислот, которые иначе не могли бы существовать в природе. Термин «конструкция нуклеиновой кислоты» является синонимом термину «экспрессирующая кассета», когда конструкция нуклеиновой кислоты содержит контрольные последовательности, необходимые для экспрессии кодирующей последовательности настоящего изобретения.

Контрольная последовательность: Термин «контрольные последовательности» определяется здесь, как включающий все компоненты, которые необходимы или полезны для экспрессии полинуклеотида, кодирующего дефенсин. Каждая контрольная последовательность может быть нативной или чужеродной по отношению к нуклеотидной последовательности, кодирующей дефенсин. Такие контрольные последовательности включают, но не ограничиваются ими, лидер, последовательность полиаденилирования, пропептидную последовательность, промотор, последовательность сигнального пептида и терминатор транскрипции. Минимально контрольные последовательности включают промотор и стоп-сигналы транскрипции и трансляции. Контрольные последовательности могут быть снабжены линкерами с целью введения специфических сайтов рестрикции, облегчающих лигирование контрольных последовательностей с кодирующей областью нуклеотидной последовательности, кодирующей дефенсин.

Функционально связанный: Термин «функционально связанный» обозначает здесь конфигурацию, в которой контрольная последовательность располагается в соответствующем положении по отношению к кодирующей последовательности полинуклеотидной последовательности, таким образом, что контрольная последовательность направляет экспрессию кодирующей последовательности дефенсина.

Кодирующая последовательность: При использовании здесь термин «кодирующая последовательность» обозначает нуклеотидную последовательность, которая непосредственно определяет аминокислотную последовательность ее белкового продукта. Границы кодирующей последовательности в основном определяются открытой рамкой считывания, которая обычно начинается с ATG старт-кодона или альтернативного старт-кодона, такого как GTG или TTG. Кодирующая последовательность может быть ДНК, кДНК или рекомбинантной нуклеотидной последовательностью.

Экспрессия: Термин «экспрессия» включает любой шаг, вовлеченный в продукцию дефенсина, включая, но не ограничиваясь ими, транскрипцию, пост-транскрипционную модификацию, трансляцию, пост-трансляционную модификацию и секрецию.

Экспрессирующий вектор: Термин «экспрессирующий вектор» определяет здесь линейную или циклическую молекулу ДНК, которая содержит полинуклеотиды, кодирующие пептид дефенсина, который функционально связан с дополнительными нуклеотидами, которые обеспечивают его экспрессию.

Клетка-хозяин: Термин «клетка-хозяин», использованный здесь, включает любой тип клетки, который восприимчив к трансформации, трансфекции, трансдукции и к подобным операциям с конструкцией нуклеиновой кислоты по настоящему изобретению.

Модификация: Темин «модификация» обозначает здесь любую химическую модификацию дефенсина. Модификация(и) может быть как заменой(ами), делецией(ями) и/или вставкой(ами) аминокислоты(от), так и замещением(ями) в боковой цепи(ях) аминокислоты; или модификация может быть связана с применением неприродных аминокислот с похожими характеристиками в аминокислотной последовательности. В особенности модификации могут представлять собой амидирования, такие как амидирование по С-концу.

Идентичность: Сходство между двумя аминокислотными последовательностями или между двумя нуклеотидными последовательностями описывают с помощью параметра «идентичность».

Для целей настоящего изобретения степень идентичности между двумя аминокислотными последовательностями определяют с помощью программы FASTA, включенной в программный пакет FASTA (см. W. R. Pearson and D. J. Lipman (1988), “Improved Tools for Biological Sequence Analysis”, PNAS 85:2444-2448; и W. R. Pearson (1990) “Rapid and Sensitive Sequence Comparison with FASTP and FASTA”, Methods in Enzymology 183:63-98). Для количественной оценки матрикса использовали BLOSUM50, для штрафа пробела -12, для штрафа протяженного пробела -2.

Степень идентичности между двумя нуклеотидными последовательностями определяют с использованием того же алгоритма и пакета программного обеспечения, как описано выше. Для количественной оценки матрикса использовали идентичность матрикса, для штрафа пробела -16 и для штрафа протяженного пробела -4.

В качестве альтернативы сравнение двух аминокислотных последовательностей определяют с помощью программы Needle из EMBOSS пакета (http://emboss.org) версии 2.8.0. Программа Needle выполняет глобальный алгоритм сравнения, описанный в Needleman, S.B. and Wunsch, C.D. (1970) J. Mol. Biol. 48, 443-453. Использованной заменой матрикса является BLOSUM62, штраф открытого пробела составляет 10 и штраф протяженного пробела составляет 0,5.

Степень идентичности между двумя аминокислотными последовательностями по настоящему изобретению («последовательность по изобретению», например, последовательность аминокислот 1-40 SEQ ID NO:2) и различными аминокислотными последовательностями («чужеродная последовательность») рассчитывают как количество точных пар перекрывания при сравнении двух последовательностей, деленное на длину кратчайшей из двух последовательностей «последовательности по изобретению» или «чужеродной последовательности». Результат выражают в проценте идентичности.

Точная пара встречается, когда «последовательность по изобретению» и «чужеродная последовательность» имеют идентичные аминокислотные остатки в одних и тех же положениях перекрывания. Длиной последовательности является количество аминокислотных остатков в последовательности (например, длина последовательности аминокислот 1-40 SEQ ID NO:2-40).

Подробное описание

Дефенсины

Дефенсин по изобретению представляет собой любой антимикробный пептид, определяемый специалистом в данной области, как принадлежащий к дефенсинам - классу антимикробных пептидов. Чтобы определить, является ли антимикробный пептид дефенсином согласно изобретению, аминокислотную последовательность предпочтительно сравнивают со скрытой моделью профайлов Маркова(HMM профайлы) хорошо известной базы данных PFAM (см. Пример 6).

Дефенсины могут принадлежать к классу альфа-дефенсинов, классу бета-дефенсинов, классу тета-дефенсинов, классу дефенсинов членистоногих, классу дефенсинов насекомых, классу дефенсинов растений.

Дефенсины могут также быть синтетическими, обладающими при этом характерными чертами любого из классов дефенсинов.

В одном воплощении аминокислотная последовательность дефенсина согласно изобретению включает 4-9 или 10 остатков цистеина, предпочтительно, 6-9 или 10 остатков цистеина, более предпочтительно, 6, 8 или 10 остатков цистеина и, наиболее предпочтительно, 6 или 8 остатков цистеина.

Примеры дефенсинов включают, но не ограничиваются ими, α-Дефенсин HNP-1 (человеческий нейтрофильный пептид), HNP-2 и HNP-3; β-Дефенсин-12, Дрозомицин, Гелиомицин, γ1-пуротионин, Дефенсин насекомых А и дефенсины, описанные в РСТ заявках WO 9953053 (RHONE POULENC AGROCHIMIE) 1999-10-21 и WO 02085934 (ENTOMED) 2002-10-31, которые включены сюда посредством ссылки; или их представляют в виде зрелых аминокислотных последовательностей SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14 и SEQ ID NO:16 или аминокислотных последовательностей, идентичных этим аминокислотным последовательностям, по меньшей мере, на 60%, предпочтительно, на 70%, более предпочтительно, на 80%, еще более предпочтительно, на 90% и, наиболее предпочтительно, на 95%. Дефенсин согласно изобретению может в дальнейшем включать одну или несколько химических модификаций по сравнению с этими аминокислотными последовательностями.

Альфа-дефенсины могут быть определены как антимикробные пептиды, включающие аминокислотную последовательность:

С-Х1-С-Х2-С-Х3-С-Х4-С-С,

где Х1 представляет 1 аминокислоту; предпочтительно, Х1=Y, F, A, R, I, S, T, H или V; более предпочтительно, Х1=Y, F, A или R; еще более предпочтительно, Х1=Y или F; наиболее предпочтительно, Х1=Y;

Х2 представляет 4 или 5 аминокислот; предпочтительно, Х2 представляет 4 аминокислоты; более предпочтительно, Х2=Z1-Z2-Z3-Z4, где

Z1 представляет любую аминокислоту; предпочтительно, Z1=R, T или K; более предпочтительно, Z1=R;

Z2 представляет любую аминокислоту; предпочтительно, Z2=R, I, T, K;

Z3 представляет любую аминокислоту; предпочтительно, Z3=R, P или G;

Z4 представляет любую аминокислоту; предпочтительно, Z4=G, A или R;

Х3 представляет 9 аминокислот; предпочтительно, Х3=Z1-Z2-Z3-Z4-Z5-Z6-Z7-G-Z8, где

Z1 представляет любую аминокислоту; предпочтительно, Z1=K, L или R;

Z2 представляет любую аминокислоту; предпочтительно, Z2=R, F, A, S или G;

Z3 представляет любую аминокислоту; предпочтительно, Z3=R, G, P или T, более предпочтительно, Z3=R или G;

Z4 представляет любую аминокислоту; Z4=E или Y; предпочтительно, Z4=E;

Z5 представляет любую аминокислоту; предпочтительно, Z5=R, H или S;

Z6 представляет любую аминокислоту; предпочтительно, Z6=R, M или L;

Z7 представляет любую аминокислоту; предпочтительно, Z7=N, S, Y или I;

Z8 представляет любую аминокислоту; предпочтительно, Z8=T, S, Y или A;

Х4 представляет 9 аминокислот; предпочтительно, Х4=Z1-Z2-Z3-Z4-Z5-Z6-Z7-Z8-Z9, где

Z1 представляет любую аминокислоту; предпочтительно, Z1=R или I;

Z2 представляет любую аминокислоту; предпочтительно, Z2=K, I, Y, F или L;

Z3 представляет любую аминокислоту; предпочтительно, Z3=G, N, R или Q;

Z4 представляет любую аминокислоту; предпочтительно, Z4=G, H или N;

Z5 представляет любую аминокислоту; предпочтительно, Z5=R или L;

Z6 представляет любую аминокислоту; предпочтительно, Z6=I, L, M, V или R;

Z7 представляет любую аминокислоту; предпочтительно, Z7=Y, W, H или F;

Z8 представляет любую аминокислоту; предпочтительно, Z8=T, R или A;

Z9 представляет любую аминокислоту; предпочтительно, Z9=L, F или R; более предпочтительно, Z9=L или F.

Бета-дефенсины могут быть определены как антимикробные пептиды, включающие аминокислотную последовательность:

С-Х1-С-Х2-С-Х3-С-Х4-С-С,

где

Х1 представляет шесть аминокислот; предпочтительно, Х1=Z1-Z2-Z3-Z4-Z5-Z6, где

Z1 представляет любую аминокислоту; предпочтительно, Z1=R, V или L;

Z2 представляет любую аминокислоту; предпочтительно, Z2=R, I, K или Q;

Z3 представляет любую аминокислоту; предпочтительно, Z3=N или S;

Z4 представляет любую аминокислоту; предпочтительно, Z4=G, K или R;

Z5 представляет любую аминокислоту; предпочтительно, Z5=G;

Z6 представляет любую аминокислоту; предпочтительно, Z6=Q, I, V или F;

Х2 представляет 3 или 4 аминокислоты; предпочтительно, Х2 представляет 4 аминокислоты; более предпочтительно, Х2=Z1-Z2-Z3-Z4, где

Z1 представляет любую аминокислоту; предпочтительно, Z1=L, V, I, H или A;

Z2 представляет любую аминокислоту; предпочтительно, Z2=P или Y;

Z3 представляет любую аминокислоту; предпочтительно, Z3=S, I, N или G;

Z4 представляет любую аминокислоту; предпочтительно, Z4=R, A или S;

Х3 представляет 9 аминокислот; предпочтительно, Х3=Z1-Z2-Z3-Z4-Z5-Z6-Z7-Z8-Z9, где

Z1 представляет любую аминокислоту; предпочтительно, Z1=P;

Z2 представляет любую аминокислоту; предпочтительно, Z2=G, I, R или P;

Z3 представляет любую аминокислоту; предпочтительно, Z3=Y, N, P, R, F или H;

Z4 представляет любую аминокислоту; предпочтительно, Z4=T, M или Y;

Z5 представляет любую аминокислоту; предпочтительно, Z5=R или K;

Z6 представляет любую аминокислоту; предпочтительно, Z6=Q или I;

Z7 представляет любую аминокислоту; предпочтительно, Z7=I или Q;

Z8 представляет любую аминокислоту; предпочтительно, Z8=S;

Z9 представляет любую аминокислоту; предпочтительно, Z9=T;

Х4 представляет 6 аминокислот; предпочтительно, Х4=Z1-Z2-Z3-Z4-Z5-Z6, где

Z1 представляет любую аминокислоту; предпочтительно, Z1=Y, F, G или L;

Z2 представляет любую аминокислоту; предпочтительно, Z2=G, H, P, L, R или T;

Z3 представляет любую аминокислоту; предпочтительно, Z3=G, P или R;

Z4 представляет любую аминокислоту; предпочтительно, Z4=K, P, R, G или Q;

Z5 представляет любую аминокислоту; предпочтительно, Z5=V, A, I или G;

Z6 представляет любую аминокислоту; предпочтительно, Z6=K.

Дефенсины насекомых могут быть определены как антимикробные пептиды, включающие аминокислотную последовательность:

С-Х1-С-Х2-С-Х3-С-Х4-С- Х5-С,

где

Х1 представляет 5-16 аминокислот;

Х2 представляет 3 аминокислоты; предпочтительно, Х2=Z1-Z2-Z3, где

Z1 представляет любую аминокислоту; предпочтительно, Z1=A или H;

Z2 представляет любую аминокислоту; предпочтительно, Z2=A или R;

Z3 представляет любую аминокислоту; предпочтительно, Z3=H;

Х3 представляет 9-11 аминокислот;

Х4 представляет 4-10 аминокислот;

Х5 представляет 1 аминокислоту; предпочтительно, Х5=V, T, I, H, K, N или L.

В одном воплощении дефенсин по изобретению имеет более чем одну антимикробную активность, выбранную из антигрибковой активности, антибактериальной активности и антивирусной активности.

Дефенсин по изобретению может быть получен из микроорганизмов любого рода. Для целей настоящего изобретения термин «получен из», использованный здесь в связи с данным источником, будет обозначать, что дефенсин, кодируемый нуклеотидной последовательностью, получен с использованием этого источника или линии, в которую вставили нуклеотидную последовательность из этого источника. В предпочтительном аспекте дефенсин, полученный из данного источника, секретируется во внеклеточное пространство.

Дефенсин по настоящему изобретению может быть дефенсином грибов и, более предпочтительно, дрожжевым дефенсином, таким как дефенсин Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces или Yarrowia; или более предпочтительно, дефенсином мицелиальных грибов, таким как дефенсин Acremonium, Aspergillus, Aureobasidium, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Miceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium или Trichoderma.

В предпочтительном аспекте дефенсин является дефенсином Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis или Saccharomyces oviformis, имеющим антимикробную активность.

В другом предпочтительном аспекте дефенсин является дефенсином Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochrowm, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei или Trichoderma viride.

Будет понятно, что для вышеуказанных видов изобретение охватывает как совершенные, так и несовершенные состояния, а также другие таксономические эквиваленты, например анаморфные, несмотря на названия видов, под которыми они известны. Для специалистов в данной области будет легко определить идентичность подходящих эквивалентов.

Линии этих видов коммерчески общедоступны из ряда коллекций клеточных культур, таких как Американская Типовая Коллекция Культур (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS) и из Коллекции Культур Сельскохозяйственной Исследовательской Патентной Службы, Северного Регионального Исследовательского Центра (NRRL).

Кроме того, такие дефенсины могут быть идентифицированы и получены из других источников, включая микроорганизмы, выделенные из природных источников (например, почвы, компоста, воды и т.д.) с использованием вышеупомянутых зондов. Методики для выделения микроорганизмов из природных источников хорошо известны из уровня техники. Полинуклеотид может затем быть получен путем подобного скрининга геномной или кДНК библиотеки другого микроорганизма. Как только полинуклеотидную последовательность, кодирующую дефенсин, детектируют с помощью зондов(а), полинуклеотид может быть выделен или клонирован с использованием методик, хорошо известных среднему специалисту в данной области (см., например, SAMBROOK, Molecular Cloning: A Laboratory Manual 2,: Cold Spring Harbor Laboratory Press, 1989 ISBN 0879693096).

Дефенсины по настоящему изобретению также включают слитые дефенсины или расщепляемые слитые дефенсины, в которых другой дефенсин присоединяется к N-концу, или С-концу дефенсина, или его фрагмента. Слитый дефенсин получают путем присоединения нуклеотидной последовательности (или ее части), кодирующей другой дефенсин, к нуклеотидной последовательности (или ее части) по настоящему изобретению. Методики для получения слитых дефенсинов известны из уровня техники и включают лигирование последовательностей, кодирующих дефенсины, так, чтобы они находились в одной рамке считывания и чтобы экспрессия слитого дефенсина находилась под контролем одного и того же промотора(ов) и терминатора.

Последовательности нуклеиновых кислот

Настоящее изобретение также относится к полинуклеотидам, имеющим нуклеотидную последовательность, которая кодирует дефенсин по изобретению.

Примеры таких полинуклеотидов включают, но не ограничиваются ими, примеры, описанные в PCT заявке WO 99/53053, которая включена сюда посредством ссылки.

В предпочтительном воплощении нуклеотидная последовательность представлена в SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13 или в SEQ ID NO:15 настоящего изобретения. В другом предпочтительном воплощении нуклеотидной последовательностью является кодирующая область зрелого дефенсина из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13 или из SEQ ID NO:15. Настоящее изобретение также охватывает нуклеотидные последовательности, которые кодируют дефенсин, имеющий аминокислотную последовательность SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14 или SEQ ID NO:16, или зрелый дефенсин этих последовательностей, который отличается от SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13 или от SEQ ID NO:15 качеством вырожденности генетического кода.

Методики, которые использовали, чтобы выделить или клонировать полинуклеотид, кодирующий дефенсин, хорошо известны из уровня техники и включают выделение из геномной ДНК, получение из кДНК или их комбинацию. Клонирование полинуклеотидов, кодирующих дефенсины по изобретению, из такой геномной ДНК может быть осуществлено, например, с использованием хорошо известной полимеразной цепной реакции (ПЦР) или с помощью скрининга с антителами экспрессионных библиотек, чтобы детектировать клонированные ДНК фрагменты с похожими структурными чертами (см., например, Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York). Могут быть использованы другие процедуры амплификации нуклеиновых кислот, такие как лигазная цепная реакция (LCR), лигированная активированная транскрипция (LAT) и базирующаяся на нуклеотидной последовательности амплификация (NASBA). Полинуклеотиды могут быть клонированы из штаммов Eurotium, Aspergillus, Pseudoplectania, Crassostrea, Mesobuthus или из других, или из родственных организмов, и, таким образом, может существовать аллельный вариант или вариант по образцу области нуклеотидных последовательностей, кодирующей дефенсин.

Настоящее изобретение также относится к полинуклеотидам, имеющим нуклеотидную последовательность, которая имеет степень идентичности с кодирующей зрелый дефенсин последовательностью SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13 или в SEQ ID NO:15, по меньшей мере 60%, предпочтительно, по меньшей мере 65%, предпочтительно, по меньшей мере 70%, более предпочтительно, по меньшей мере 75%, более предпочтительно, по меньшей мере 80%, более предпочтительно, по меньшей мере 85%, более предпочтительно, по меньшей мере 90%, еще более предпочтительно, по меньшей мере 95% и наиболее предпочтительно, по меньшей мере 97% идентичности в области, которая кодирует антимикробный полипептид дефенсина.

Модификация нуклеотидной последовательности, кодирующей дефенсин по изобретению, может быть необходима для синтеза дефенсинов, по существу подобных дефенсину. Термин «по существу подобный» дефенсину имеет отношение к не встречающимся в природе формам дефенсина. Эти дефенсины могут отличаться в некоторых особенностях конструкции от дефенсина, выделенного из нативного источника, например искусственные варианты отличаются специфической активностью, термостабильностью, оптимальным значением рН или подобными. Вариант последовательности может быть сконструирован на базе нуклеотидной последовательности, представленной в виде кодирующей дефенсин области SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13 или SEQ ID NO:15, например, в виде части этих последовательностей, и/или путем введения нуклеотидных замен, которые не приводят к созданию другой аминокислотной последовательности дефенсина, кодируемого этой нуклеотидной последовательностью, но которые соответствуют используемым организмом-хозяином кодонам, предназначенным для продукции белка, или путем введения нуклеотидных замен, которые могут привести к созданию другой аминокислотной последовательности. Для общего описания нуклеотидных замен см., например, Ford et al., 1991, Protein Expression and Purification 2: 95-107.

Для специалистов в данной области будет ясно, что такие замены могут быть произведены вне области, критичной для функции молекулы, и по-прежнему приведут к получению активного дефенсина. Аминокислотные остатки, которые существенны для активности дефенсина, и таким образом, предпочтительно, не подвергаются заменам, могут быть идентифицированы согласно процедурам, известным из уровня техники, таким как сайт-направленный мутагенез или сканирующий аланином мутагенез (см., например, Cunningham and Wells, 1989, Science 244: 1081-1085). В последней методике мутации вводят в каждый положительно заряженный остаток молекулы, и полученные мутантные молекулы тестируют на предмет антимикробной активности, чтобы идентифицировать аминокислотные остатки, критичные для активности молекулы. Сайты взаимодействия также могут быть определены путем анализа трехмерной структуры, определенной такими методиками, как анализ ядерного магнитного резонанса, кристаллография или фотоафинное мечение (см., например, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, Journal of Molecular Biology 244: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).

Настоящее изобретение также относится к полинуклеотидам, кодирующим дефенсин по изобретению, которые гибридизуются в условиях низкой жесткости, предпочтительно, в условиях средней жесткости, более предпочтительно, в условиях средне-высокой жесткости, еще более предпочтительно, в условиях высокой жесткости и, наиболее предпочтительно, в условиях очень высокой жесткости с (i) кодирующей зрелый пептид нуклеотидной последовательностью, содержащейся в SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13 или SEQ ID NO:15, (ii) с последовательностью кДНК, содержащейся в SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13 или SEQ ID NO:15, или (iii) с комплементарной цепью (i) или (ii); или с аллельными вариантами и частями этих последовательностей (Sambrook et al., 1989, выше), как здесь определено.

Настоящее изобретение также относится к полинуклеотидам, полученным (a) путем гибридизации популяции ДНК при условиях низкой, средней, средне-высокой, высокой или очень высокой жесткости с (i) кодирующей зрелый дефенсин нуклеотидной последовательностью, содержащейся в SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13 или SEQ ID NO:15, (ii) с последовательностью кДНК, содержащейся в SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13 или SEQ ID NO:15, или (iii) с комплементарной цепью (i) или (ii); и (b) путем выделения гибридизующегося полинуклеотида, который кодирует полипептид, имеющий антимикробную активность.

Конструкции нуклеиновой кислоты

Настоящее изобретение также относится к конструкциям нуклеиновой кислоты, включающим полинуклеотид, кодирующий дефенсин по изобретению, функционально связанный с одной или несколькими контрольными последовательностями, которые направляют экспрессию кодирующей последовательности в подходящей клетке-хозяине при условиях, совместимых с контрольными последовательностями.

Чтобы обеспечить экспрессию дефенсина, на полинуклеотид, кодирующий дефенсин по изобретению, можно воздействовать множеством способов. Воздействие на полинуклеотидную последовательность перед ее вставкой в вектор может быть желательным или необходимым в зависимости от экспрессирующего вектора. Методики модификации полинуклеотидных последовательностей, использующие методы рекомбинантной ДНК, хорошо известны из уровня техники.

Контрольной последовательностью может быть подходящая промоторная последовательность, нуклеотидная последовательность которой распознается клеткой-хозяином для экспрессии полинуклеотида, кодирующего дефенсин по изобретению. Промоторная последовательность содержит последовательности транскрипционного контроля, которые содействуют экспрессии дефенсина. Промотором может быть любая нуклеотидная последовательность, которая демонстрирует транскрипционную активность в выбранной клетке-хозяине, включая мутантные, усеченные и гибридные промоторы, и может быть получена из генов, кодирующих внеклеточные или внутриклеточные полипептиды как гомологичные, так и чужеродные для клетки-хозяина.

Примерами подходящих промоторов для направления транскрипции конструкций нуклеиновой кислоты по настоящему изобретению в клетке-хозяине мицелиальных грибов служат промоторы, полученные из генов Aspergillus oryzae TAKA амилазы, Rhizomucor miehei аспарагиновой протеиназы, Aspergillus niger нейтральной альфа-амилазы, Aspergillus niger кислотоустойчивой альфа-амилазы, Aspergillus niger или Aspergillus awamori глюкоамилазы (glaA), Rhizomucor miehei липазы, Aspergillus oryzae щелочной протеазы, Aspergillus oryzae триозофосфат изомеразы, Aspergillus nidulans ацетамидазы, Fusarium venenatum амилоглюкозидазы (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Fusarium oxysporum трипсин подобной протеазы (WO 96/00787), Trichoderma reesei бета-глюкозидазы, Trichoderma reesei целлобиогидролазы I, Trichoderma reesei эндоглюконазы I, Trichoderma reesei эндоглюконазы II, Trichoderma reesei эндоглюконазы III, Trichoderma reesei эндоглюконазы IV, Trichoderma reesei эндоглюконазы V, Trichoderma reesei ксилоназы I, Trichoderma reesei ксилоназы II, Trichoderma reesei бета-ксилозидазы, также как NA2-tpi промотор (гибрид промоторов генов Aspergillus niger нейтральной альфа-амилазы и Aspergillus oryzae триозофосфат изомеразы); а также их мутантные, усеченные и гибридные промоторы.

Контрольной последовательностью может также быть подходящая последовательность терминатора транскрипции, распознаваемая клеткой-хозяином при терминации транскрипции. Терминаторная последовательность функционально связана 3' концом нуклеотидной последовательности, кодирующей дефенсин. В настоящем изобретении может быть использован любой терминатор, который функционален в выбранной клетке-хозяине.

Предпочтительные терминаторы для клетки-хозяина мицелиальных грибов получают из генов Aspergillus oryzae TAKA амилазы, Aspergillus niger глюкоамилазы, Aspergillus nidulans антранилат синтетазы, Aspergillus niger альфа-глюкозидазы и из Fusarium oxysporum трипсин подобной протеазы.

Контрольной последовательностью может также быть подходящая лидерная последовательность, а также нетранслируемая область мРНК, которая важна для трансляции клеткой-хозяином. Лидерная последовательность функционально связана с 5' концом нуклеотидной последовательности, кодирующей дефенсин. В настоящем изобретении может быть использована любая лидерная последовательность, которая функциональна в выбранной клетке-хозяине.

Предпочтительные лидеры для клетки-хозяина мицелиальных грибов получают из генов Aspergillus oryzae TAKA амилазы и из Aspergillus nidulans триозофосфат изомеразы.

Контрольной последовательностью может также быть последовательность полиаденилирования, функционально связанная с 3' концом нуклеотидной последовательности и которая при транскрипции распознается клеткой-хозяином как сигнал для добавления остатков полиаденозина к транскрибируемой мРНК. В настоящем изобретении может быть использована любая последовательность полиаденилирования, которая функциональна в выбранной клетке-хозяине.

Предпочтительные последовательности полиаденилирования для клетки-хозяина мицелиальных грибов получают из генов Aspergillus oryzae TAKA амилазы, Aspergillus niger глюкоамилазы, Aspergillus nidulans антранилат синтетазы, Fusarium oxysporum трипсин подобной протеазы и из Aspergillus niger альфа-глюкозидазы.

Контрольной последовательностью может также быть сигнальный пептид, кодирующий область аминокислотной последовательности, связанной с амино-концом дефенсина, и направляющий кодируемый дефенсин по пути клеточной секреции. 5' Конец кодирующей нуклеотидной последовательности может по сути содержать кодирующую область сигнального пептида, естественно связанную в трансляционной рамке считывания с сегментом кодирующей области секретируемого дефенсина. В качестве альтернативы 5' конец кодирующей последовательности может содержать кодирующую область сигнального пептида, которая чужеродна для кодирующей последовательности. Чужеродная кодирующая область сигнального пептида может быть необходима там, где кодирующая последовательность не содержит естественную кодирующую область сигнального пептида. В качестве альтернативы чужеродная кодирующая область сигнального пептида может просто замещать естественную кодирующую область сигнального пептида для того, чтобы усилить секрецию дефенсина. Однако в настоящем изобретении может быть использована любая кодирующая область сигнального пептида, которая направляет экспрессию дефенсина по пути секреции в выбранной клетке-хозяине.

Эффективные кодирующие области сигнального пептида для клетки-хозяина мицелиальных грибов получают из генов Aspergillus oryzae TAKA амилазы, Aspergillus niger нейтральной амилазы, Aspergillus niger глюкоамилазы, Rhizomucor miehei аспарагиновой протеиназы, Humicola insolens целлюлазы и из Humicola lanuginose липазы.

В предпочтительном аспекте кодирующая область сигнального пептида представляет собой нуклеотиды 1-69 последовательности SEQ ID NO:1, которые кодируют аминокислоты от -55 до -33 последовательности SEQ ID NO:2; нуклеотиды 1-60 последовательности SEQ ID NO:3, которые кодируют аминокислоты от -48 до -29 последовательности SEQ ID NO:4; нуклеотиды 1-60 последовательности SEQ ID NO:5, которые кодируют аминокислоты от -50 до -31 последовательности SEQ ID NO:6; нуклеотиды 1-66 последовательности SEQ ID NO:7, которые кодируют аминокислоты от -22 до -1 последовательности SEQ ID NO:8; нуклеотиды 1-72 последовательности SEQ ID NO:9, которые кодируют аминокислоты от -24 до -1 последовательности SEQ ID NO:10; нуклеотиды 1-66 последовательности SEQ ID NO:11, которые кодируют аминокислоты от -22 до -1 последовательности SEQ ID NO:12; нуклеотиды 1-66 последовательности SEQ ID NO:13, которые кодируют аминокислоты от -22 до -1 последовательности SEQ ID NO:14 или нуклеотиды 1-54 последовательности SEQ ID NO:15, которые кодируют аминокислоты от -26 до -9 последовательности SEQ ID NO:16.

Контрольной последовательностью может также быть кодирующая область пропептида, который кодирует аминокислотную последовательность, расположенную на амино-конце полипептида. Полученный полипептид известен как прополипептид (или в некоторых случаях зимоген). Прополипептид в основном неактивен и может быть превращен в зрелый активный полипептид путем каталитического или автокаталитического расщепления пропептидной формы прополипептида. Кодирующая область прополипептида может быть получена из генов Bacillus subtilis щелочной протеазы (aprE), Bacillus subtilis нейтральной протеазы (nprT), Saccharomyces cerevisiae альфа-фактора, Rhizomucor miehei аспарагиновой протеиназы и из Myceliophthora thermophila лакказы (WO 95/33836).

В предпочтительном аспекте кодирующая область пропептида представляет собой нуклеотиды 70-165 последовательности SEQ ID NO:1, которые кодируют аминокислоты от -32 до -1 последовательности SEQ ID NO:2; нуклеотиды 61-144 последовательности SEQ ID NO:3, которые кодируют аминокислоты от -28 до -1 последовательности SEQ ID NO:4; нуклеотиды 61-150 последовательности SEQ ID NO:5, которые кодируют аминокислоты от -30 до -1 последовательности SEQ ID NO:6 или нуклеотиды 55-78 последовательности SEQ ID NO:15, которые кодируют аминокислоты от -8 до -1 последовательности SEQ ID NO:16.

В случае, если на амино-конце полипептида представлены обе области - и сигнального пептида и пропептида, - то пропептидная область располагается следом за амино-концом полипептида, а область сигнального пептида располагается следом за амино-концом пропептида.

Может также быть желательным добавить регуляторные последовательности, которые делают возможной регуляцию экспрессии дефенсина по отношению к росту клетки-хозяина. Примерами регуляторных систем являются те, которые вызывают включение или выключение экспрессии гена в ответ на химические или физические стимулы, включая присутствие регуляторного соединения. Регуляторные системы в прокариотических системах включают системы операторов lac, tac и trp. В дрожжах может быть использована система ADH2 или GAL1. В мицелиальных грибах в качестве регуляторных последовательностей могут быть использованы ТАКА альфа-амилазный промотор, Aspergillus niger глюкоамилазный промотор и Aspergillus oryzae глюкоамилазный промотор. Другими примерами регуляторных последовательностей являются те, которые делают возможной амплификацию генов. В эукариотичеких системах эти примеры включают ген дигидрофолат редуктазы, который амплифицируется в присутствии метотрексата и металлотионеиновые гены, которые амплифицируются с тяжелыми металлами. В этих случаях нуклеотидная последовательность, кодирующая дефенсин, должна быть функционально связана с регуляторной последовательностью.

Экспрессирующие векторы

Настоящее изобретение также относится к рекомбинантным экспрессирующим векторам, содержащим полинуклеотид, кодирующий дефенсин по изобретению, промотор и стоп-сигналы транскрипции и трансляции. Различные нуклеиновые кислоты и контрольные последовательности, описанные выше, могут быть объединены вместе, чтобы получить рекомбинантный экспрессирующий вектор, который может содержать один или несколько подходящих сайтов рестрикции, чтобы предусмотреть вставку или замену по таким сайтам нуклеотидной последовательности, кодирующей дефенсин. В качестве альтернативы нуклеотидная последовательность, кодирующая дефенсин по изобретению, может экспрессироваться путем вставки нуклеотидной последовательности или конструкции нуклеиновой кислоты, включающей последовательность, в подходящий экспрессирующий вектор. В созданном экспрессирующем векторе кодирующую последовательность локализуют в векторе таким образом, чтобы кодирующая последовательность была функционально связана с подходящими контрольными последовательностями, необходимыми для экспрессии.

Рекомбинантным экспрессирующим вектором может быть любой вектор (например, плазмидный или вирусный), который может быть легко подвержен процедурам рекомбинантной ДНК и может осуществлять экспрессию нуклеотидной последовательности. Выбор вектора обычно будет зависеть от совместимости вектора с клеткой-хозяином, в которую вектор следует ввести. Векторы могут быть линейными или циклически замкнутыми плазмидами.

Вектор может быть автономно реплицирующимся, т.е. вектором, который существует как внехромосомный организм, репликация которого не зависит от хромосомной репликации, как, например, у плазмиды, внехромосомного элемента, мини-хромосомы или искусственной хромосомы. Вектор может содержать любые инструменты для обеспечения собственной репликации. В качестве альтернативы, вектор может быть таким, что при введении в клетку-хозяина он интегрируется в геном и реплицируется вместе с хромосомой(ами), в которую был интегрирован. Кроме того, может быть использован единичный вектор или плазмида либо два или более вектора или плазмид, которые вместе содержат тотальную ДНК для того, чтобы их можно было ввести в геном клетки-хозяина или в транспозон.

Векторы, использованные для экспрессии дефенсина по изобретению, предпочтительно, содержат один или несколько селективных маркеров, которые делают возможным легкую селекцию трансформированных клеток. Селективным маркером является ген, продукт которого обеспечивает биоцидную или вирусную резистентность, резистентность к тяжелым металлам, прототрофам-ауксотрофам и подобные.

Примеры селективных маркеров для использования в клетке-хозяине мицелиальных грибов включают, но не ограничиваются ими, amdS (ацетамидазу), argB (орнитин карбамоилтрансферазу), bar (фосфинотрицин ацетилтрансферазу), hph (гигромоцин фосфотрансферазу), niaD (нитрат редуктазу), pyrG (оротидин-5'-фосфат декарбоксилазу), sC (сульфат аденилтрансферазу) и trpC (антранилат синтетазу), также как их эквиваленты. Предпочтительными для использования в Aspergillus клетке являются гены amdS и pyrG из Aspergillus nidulans или Aspergillus oryzae и bar ген из Streptomyces hygroscopicus.

Векторы, предпочтительно, содержат элементы, которые делают возможной интеграцию вектора в геном клетки-хозяина или автономную репликацию вектора в клетке независимо от генома.

При интеграции в геном клетки-хозяина вектор может полагаться на полинуклеотидную последовательность, кодирующую дефенсин, или на любой другой элемент вектора, необходимый для интеграции в геном путем гомологичной или негомологичной рекомбинации. В качестве альтернативы вектор может содержать дополнительные нуклеотидные последовательности, необходимые для направленной интеграции в точное место хромосомной(ых) локализации(й) путем гомологичной рекомбинации. Чтобы увеличить вероятность интеграции в точное место локализации, интеграционные элементы должны предпочтительно содержать подходящее количество нуклеиновых кислот, таких как 100-10000 пар оснований, предпочтительно 400-10000 пар оснований и наиболее предпочтительно 800-10000 пар оснований, и иметь высокую степень идентичности с соответствующей последовательностью мишени, чтобы усилить возможность гомологичной рекомбинации. Интеграционные элементы могут быть любой последовательностью, гомологичной последовательности мишени в геноме клетки-хозяина. Кроме того, интеграционные элементы могут быть некодирующими или кодирующими нуклеотидными последовательностями. С другой стороны, вектор может быть интегрирован в геном клетки-хозяина путем негомологичной рекомбинации.

Для автономной репликации вектор может еще включать точку начала репликации, которая дает возможность вектору реплицироваться автономно в данной клетке-хозяине. Точкой начала репликации может быть любой плазмидный репликатор, содействующий автономной репликации, который функционирует в клетке. Термин «точка начала репликации» или «плазмидный репликатор» обозначает здесь нуклеотидную последовательность, которая дает возможность плазмиде или вектору реплицироваться in vivo.

Примерами точек начала репликации, используемых в клетке мицелиальных грибов, являются AMA1 и ANS1 (Gems et al., 1991, Gene 98:61-67; Cullen et al., 1987, Nucleic Acids Research 15:9163-9175; WO 00/24883). Выделение гена AMA1 и конструкция плазмид или векторов, включающих ген, может быть выполнена согласно методам, описанным в WO 00/24883.

Для того чтобы увеличить продукцию продукта гена, в клетку-хозяина может быть вставлена более чем одна копия полинуклеотида, кодирующего дефенсин по изобретению. Увеличение количества копий полинуклеотида может быть получено путем интегрирования, по меньшей мере, одной дополнительной копии последовательности в геном клетки-хозяина или путем включения способного амплифицироваться гена селективного маркера с полинуклеотидом, где клетки, содержащие способные амплифицироваться копии гена селективного маркера, и, соответственно, дополнительные копии полинуклеотида, могут быть отселектированы для культивирования в присутствии подходящего селективного агента.

Процедуры, использованные для лигирования вышеописанных элементов, чтобы сконструировать рекомбинантные экспрессирующие векторы по настоящему изобретению, хорошо известны специалисту в данной области (см., например, Sambrook et al., 1989, выше).

Клетки-хозяина мицелиальных грибов

Клетка-хозяин (или организм) по изобретению представляет собой мицелиальный гриб, включая все мицелиальные формы отделов Аскомикота, Базидиомикота, Хитридиомикота и Зигомикота (как определено Kirk, P.M. et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 9th edition, 2001, CAB International, Wallingford, UK). Мицелиальные грибы характеризуются вегетативным мицелиумом, состоящим из хитина и глюкана и/или из других сложных полисахаридов. Вегетативный рост осуществляется элонгацией с помощью гифа. Предпочтительно углеродный катаболизм является обязательно аэробным.

В одном воплощении клетка-хозяин (или организм) мицелиальных грибов принадлежит подклассу Eurotiales отдела Ascomycota; предпочтительно, более специфично принадлежит семейству Trichocomaceae.

В более предпочтительном воплощении клеткой-хозяином (или организмом) мицелиальных грибов является клетка следующих видов, но не ограничивается ими: Acremonium, Aspergillus, Emericella, Eurotium, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Eupenicillium, Thielavia, Tolypocladium и Trichoderma или телеоморфов, анаморфов, или им подобных. В еще более предпочтительном воплощении клеткой-хозяином является Aspergillus. В другом еще более предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Acremonium. В другом еще более предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Fusarium. В другом еще более предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Humicola. В другом еще более предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Mucor. В другом еще более предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Myceliophthora. В другом еще более предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Neurospora. В другом еще более предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Penicillium. В другом еще более предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Thielavia. В другом еще более предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Tolypocladium. В другом еще более предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Trichoderma. В наиболее предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus aculeatus, Aspergillus niger или Aspergillus oryzae. В другом предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Fusarium секция Дисколор (также известная как секция Fusarium). Например, клеткой-хозяином мицелиальных грибов может быть Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sulphureum или Fusarium trichothecioides. В другом предпочтительном воплощении клеткой-хозяином мицелиальных грибов является штамм Fusarium секции Elegans, например Fusarium oxysporum. В другом наиболее предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Humicola insolens или Humicola lanuginose. В другом наиболее предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Mucor miehei. В другом наиболее предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Myceliophthora thermophilum. В другом наиболее предпочтительном воплощении клеткой-хозяином мицелиальных грибов является клетка Neurospora crassa. В другом наиболее предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Penicillium purpurogenum или Penicillium funiculosum (WO 00/68401). В другом наиболее предпочтительном воплощении клеткой-хозяином мицелиальных грибов является Thielavia terrestris. В другом наиболее предпочтительном воплощении клеткой-хозяином Trichoderma является Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei или Trichoderma viride.

В особом воплощении клеткой-хозяином мицелиальных грибов является Aspergillus oryzae или Aspergillus niger.

В предпочтительном воплощении изобретения клеткой-хозяином является линия, дефицитная по протеазе или не содержащая протеазу.

Это может быть, например, дефицитный по протеазе штамм Aspergillus oryzae JaL 125, у которого делетирован ген щелочной протеазы, называемый «alp». Эта линия описана в WO 9735956 (NOVO NORDISK A/S). 1997-10-02 или EP 429490 (GENENCOR). 1991-06-05 либо свободная от ТРАР клетка-хозяин, в особенности линия Aspergillus niger, описанная в WO 9614404 (NOVO NORDISK A/S). 1996-05-17. Кроме того, клетка-хозяин, в особенности A. niger и A. оryzae с уменьшенной продукцией активатора транскрипции (prtT), как описано в WO 0168864 (NOVOZYMES A/S). 2001-09-20 также может использоваться в настоящем изобретении.

Интроны

Эукариотические гены могут прерываться промежуточными последовательностями (интронами), которые должны быть модифицированы в предшественниках транскриптов для того, чтобы получить функциональные мРНК. Этот процесс удаления интронов известен как сплайсинг пре-мРНК. Обычно последовательность точки ветвления интрона необходима для интронного сплайсинга посредством образования лариата. Сигналы для сплайсинга находятся непосредственно на границах сайтов сплайсинга интрона. Границы сайтов сплайсинга интрона обычно имеют консенсусные интронные последовательности GT и AG на 5' и 3' оконечностях, соответственно. Наряду с тем, что не было сообщено о других, отличных от AG 3' сайтах сплайсинга, существуют сообщения о нескольких исключениях для 5' GT сайта сплайсинга. Например, существуют прецеденты, где на 5' границе GT заменяется на CT или GC. Существует также сильное предпочтение для нуклеотидных оснований ANGT, следующих за GT, где N является A, C, G или T (главным образом, А или Т в образцах Saccharomyces), но не существует заметных предпочтений для любых особых нуклеотидов, чтобы заменить GT сайт сплайсинга. 3' Сайт сплайсинга AG, главным образом, заменяется пиримидиновым нуклеотидным основанием (Py), т.е. C или T.

Количество интронов, которые могут прерывать грибной ген, колеблется от одного до двух, трех, четырех, пяти, шести, семи, восьми, девяти, десяти, одиннадцати, двенадцати или более интронов. Они могут распределяться по всему гену либо могут находиться у 5' или 3' конца гена. В Saccharomyces cerevisiae интроны расположены в основном у 5' конца гена. Размер интронов в основном может быть менее чем 1 т.п.о. и обычно менее чем 400 п.о. у дрожжей и менее чем 100 п.о. у мицелиальных грибов.

Последовательность точки ветвления интронов Saccharomyces cerevisiae 5'-TACTAAC-3' редко появляется точно в интронах мицелиальных грибов. Участки последовательности, близко или отдаленно напоминающие TACTAAC, проявляются в эквивалентных точках интронов мицелиальных грибов с общим консенсусом NRCTRAC, где N - A, C, G или T, и R - A или G. Например, четвертое положение Т является инвариантным для обеих Neurospora crassa и Aspergillus nidulans предполагаемых консенсусных последовательностей. Кроме того, нуклеотиды G, A и C превалируют в более чем 80% положений 3, 6 и 7, соответственно, хотя положение 7 в Aspergillus nidulans является более гибким, в 65% представляя C. Однако положения 1, 2, 5 и 8 являются гораздо менее строгими в обоих организмах Neurospora crassa и Aspergillus nidulans. Другие мицелиальные грибы имеют похожие участки точек ветвления в эквивалентных положениях их интронов, но выборка последовательностей слишком маленькая, чтобы различить какие-либо тенденции.

Способы и применения

В первом аспекте настоящее изобретение представляет рекомбинантную клетку-хозяина мицелиальных грибов, содержащую конструкцию нуклеиновой кислоты, которая содержит чужеродную последовательность нуклеиновой кислоты, кодирующую дефенсин, и одну или несколько интронных последовательностей. Подразумевается, что термин «чужеродная последовательность нуклеиновой кислоты» обозначает последовательность нуклеиновой кислоты, которая была введена извне (из чужеродного источника).

Клетка-хозяин мицелиальных грибов может быть способна к экспрессии (продукции) дефенсина в количестве, по меньшей мере, 150%, предпочтительно, 200%, более предпочтительно, 250% и наиболее предпочтительно, 300% от количества, полученного с применением конструкции нуклеиновой кислоты без интронной последовательности, такой как последовательность кДНК.

Клетка-хозяин мицелиальных грибов может быть выращена в ростовой среде YPM в течение 3-5 дней при 30-35 градусах Цельсия при подходящем перемешивании. Этот и другие подходящие способы культивирования мицелиальных грибов хорошо известны из уровня техники. Клетка-хозяин мицелиальных грибов может быть использована для рекомбинантной продукции дефенсина.

Во втором аспекте изобретение представляет собой способ рекомбинантной продукции дефенсина в клетке-хозяине мицелиальных грибов, который включает культивирование клетки-хозяина мицелиальных грибов, содержащей конструкцию нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, кодирующую пептид дефенсина и одну или несколько интронных последовательностей; и получение пептида дефенсина. Подходящие способы получения хорошо известны из уровня техники.

Изобретение также относится к применению конструкции нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, кодирующую пептид дефенсина и одну или несколько интронных последовательностей, для улучшения уровня рекомбинантной экспрессии дефенсина в клетке-хозяине мицелиальных грибов.

Уровень экспрессии дефенсина может быть, по меньшей мере, на 50% выше, предпочтительно, по меньшей мере, на 75% выше, более предпочтительно, по меньшей мере, на 100% выше, еще более предпочтительно, по меньшей мере, на 125% выше, наиболее предпочтительно, на 150% выше и, в особенности, на 200% выше по сравнению с применением конструкции нуклеиновой кислоты, не содержащей интронную последовательность, такую как кДНК последовательность. В качестве альтернативы уровень экспрессии дефенсина может быть, по меньшей мере, 150%, предпочтительно, 200%, более предпочтительно, 250% и наиболее предпочтительно, 300% от уровня экспрессии, полученного с применением конструкции нуклеиновой кислоты без интронной последовательности, такой как кДНК последовательность. Уровень экспрессии дефенсина измеряют в граммах белка на литр ферментативной жидкости.

В одном воплощении конструкция нуклеиновой кислоты по изобретению содержит 1-4 или 5 интронных последовательностей, предпочтительно 1-3 или 4 интронных последовательности, более предпочтительно 1, 2 или 3 интронных последовательности, еще более предпочтительно 1 или 2 интронных последовательности и наиболее предпочтительно одну интронную последовательность.

В другом воплощении конструкция нуклеиновой кислоты по изобретению включает последовательность нуклеиновой кислоты, кодирующую пептид дефенсина и, по меньшей мере, одну, предпочтительно, по меньшей мере, две, более предпочтительно, по меньшей мере, три и, наиболее предпочтительно, по меньшей мере, четыре интронных последовательности.

Интронная последовательность(и) может быть локализована в сигнальном пептиде, пропептиде или в зрелом пептиде, кодируя часть конструкции нуклеиновой кислоты по изобретению. Когда конструкция нуклеиновой кислоты содержит более чем один интрон, интроны могут быть локализованы в различных частях конструкции.

Интронная последовательность(и) может быть фактически локализована в любой части гена дефенсина, который транскрибируется в мРНК.

Фармацевтические составы

Дефенсины этого изобретения могут быть включены во множество фармацевтических составов для терапевтического применения. Более подробно, дефенсины по настоящему изобретению могут быть включены в фармацевтические композиции путем комбинации с подходящими фармацевтически приемлемыми носителями или растворителями и могут быть включены в лекарственные формы в твердой, полутвердой, жидкой или газообразной форме, такие как таблетки, капсулы, порошки, гранулы, мази, кремы, пенки, растворы, суппозитории, инъекции, ингаляторы, гели, микросферы, лосьоны и аэрозоли. По существу введение дефенсинов можно осуществить различными путями, включая пероральное, буккальное, ректальное, парентеральное, внутрибрюшинное, интрадермальное, трансдермальное, внутритрахейное введение и т.д. Согласно изобретению дефенсины оказывают системное действие после введения.

Дефенсины по изобретению могут быть введены отдельно или в комбинации друг с другом либо они могут быть использованы в комбинации с другими известными соединениями (например, с перфорином, противовоспалительными агентами, антибиотиками и т.д.). При использовании в фармацевтических дозированных формах дефенсины могут быть введены в форме их фармацевтически приемлемых солей. Следующие методы и их содержание являются только иллюстрирующими и не имеют ограничений.

Для лекарственных форм с пероральным введением дефенсины могут быть использованы отдельно или в комбинации с подходящими добавками для получения таблеток, порошков, гранул или капсул, например, с обычными добавками, такими как лактоза, маннит, кукурузный крахмал или картофельный крахмал; со связующими веществами, такими как кристаллическая целлюлоза, производные целлюлозы, акация, кукурузный крахмал или желатины; с дезинтеграторами, такими как кукурузный крахмал, картофельный крахмал или натриевая соль карбоксиметилцеллюлозы; со смазывающими веществами, такими как тальк или стеарат магния; и, если желательно, с разбавителями, буферными агентами, увлажняющими агентами, консервантами и вкусовыми агентами.

Дефенсины могут быть включены в состав лекарственных форм для инъекций путем их растворения, суспендирования или эмульгирования в водных или неводных растворителях, таких как растительные или другие подобные масла, синтетические глицериды алифатических кислот, эфиры и высшие алифатические кислоты или пропиленгликоль; и, если желательно, с обычными добавками, такими как солюбилизаторы, изотонические агенты, суспендирующие агенты, эмульгирующие агенты и консерванты.

Дефенсины по изобретению могут быть использованы в составе аэрозолей, чтобы вводиться посредством ингаляции. Дефенсины могут быть включены в состав приемлемых герметических сжатых жидкостей в аэрозольном баллончике, таких как дихлордифторметан, пропан, азот и подобных.

Кроме того, дефенсины могут быть выполнены в форме суппозиториев путем смешивания с различными основаниями, такими как эмульгирующие основания или воднорастворимые основания. Дефенсины могут быть введены ректально посредством суппозитория. Суппозиторий может включать средства доставки, такие как масло какао, карбоваксы и полиэтиленгликоли, которые плавятся при температуре тела, но еще остаются твердыми при комнатной температуре.

Могут быть получены стандартные лекарственные формы для перорального или ректального введения, такие как сиропы, эликсиры и суспензии, где каждая единица дозы, например чайная ложка, столовая ложка, таблетка или суппозиторий, содержит определенное количество композиции, содержащей один или более дефенсинов по настоящему изобретению. Подобным образом стандартные лекарственные формы для инъекций или внутривенного введения могут включать дефенсины по настоящему изобретению в композиции в виде раствора в стерильной воде, нормальном солевом растворе или в другом фармацевтически приемлемом носителе.

Термин «стандартные лекарственные формы», использованный здесь, имеет отношение к физически дискретным единицам, подходящим в качестве единичной дозы для человека и животных, причем каждая единица содержит определенное рассчитанное количество дефенсина по изобретению, достаточное, чтобы получить желаемый эффект совместно с фармацевтически приемлемым растворителем, носителем или средством доставки. Спецификации для форм единицы дозы настоящего изобретения зависят от специфического применяемого дефенсина и от эффекта, который должен быть достигнут, и от фармакодинамики, связанной с поведением дефенсина у реципиента.

Используют общедоступные фармацевтически приемлемые наполнители, такие как средства доставки, вспомогательные средства, носители и растворители. Более того, используют общедоступные фармацевтически приемлемые вспомогательные вещества, такие как обеспечивающие рН и буферные агенты, агенты для регулирования тоничности, стабилизаторы, увлажняющие агенты и подобные.

Типичные дозы для системного введения находятся в пределах от 0,1 пг до 100 мг на кг веса субъекта для введения. Типичной дозой может быть одна таблетка, принимаемая от двух до шести раз в день, или одна капсула с регулируемым высвобождением, или таблетка, принимаемая один раз в день и содержащая пропорционально большее содержание активного ингредиента. Эффект регулируемого высвобождения может быть получен с помощью материалов капсулы, которые растворяются при различных величинах рН, с помощью капсул, которые высвобождаются медленно при осмотическом давлении или с помощью других известных способов контролируемого высвобождения.

Специалисты легко оценят, что уровни дозы могут варьироваться в зависимости от функции специфического дефенсина, от серьезности симптомов и от чувствительности субъекта к побочным эффектам. Некоторые из специфических дефенсинов являются более сильнодействующими, чем другие. Предпочтительные дозы для данного дефенсина легко определяют специалисты в данной области с помощью различных способов. Предпочтительным способом является измерение физиологического действия данного дефенсина.

Применение липосом как средства доставки является одним из интересных способов. Липосомы объединяются с клетками мишенями и доставляют содержимое липосом внутриклеточно. Липосомы сохраняют контакт с клетками в течение достаточного для объединения времени, используя различные способы для сохранения контакта, такие как изоляция, использование связывающих агентов и подобные. В одном аспекте изобретения липосомы разрабатывают в виде аэрозоля для легочного введения. Липосомы могут быть приготовлены с очищенными белками или пептидами, такими как вируса Sendai или вируса influenza и т.д., которые содействуют объединению мембран. Липиды могут представлять собой любую приемлемую комбинацию известных образующих липосомы липидов, включая катионные или цвиттерионные липиды, такие как фосфатидилхолин. Оставшиеся липиды в нормальных условиях будут представлять собой нейтральные или кислые липиды, такие как холестерол, фосфатидил серин, фосфатидил глицерол и подобные.

Для приготовления липосом может быть использована процедура, описанная КАТО, Экспрессия поверхностных антигенов вируса гепатита В в печени взрослой крысы. Совместное введение ДНК и ядерного белка посредством упрощенного липосомного метода. J. biol. chem., February vol. 266, p. 3361-3364 ISSN 0021-9258. Коротко, липиды и композицию люмена, содержащую пептиды, объединяют в подходящей водной среде, обычно в солевой среде, где общее количество сухого вещества будет находиться в пределах от 1 до 10 процентов от веса. После интенсивного смешивания в течение коротких периодов времени, примерно 5-60 сек, пробирку помещают в теплую водяную баню с температурой примерно 25-40°С, и цикл повторяют, примерно 5-10 раз. Композицию затем обрабатывают ультразвуком в течение подходящего периода времени, в основном примерно 1-10 сек, и затем могут смешать или встряхнуть. Объем затем увеличивают путем добавления водной среды, в основном увеличивая объем примерно в 1-2 раза, с последующим перемешиванием и охлаждением. Этот способ позволяет вводить в люмен молекулы с высоким молекулярным весом.

Составы с другими активными агентами

Для применения в определенных методах дефенсины по изобретению могут быть включены в состав с другими фармацевтически активными агентами (такими как стероиды), хорошо известными из уровня техники, в особенности, с другими противомикробными агентами. Другие интересующие агенты включают широкое разнообразие антибиотиков, известных из уровня техники. Классы антибиотиков включают пенициллины, например, пенициллин G, пенициллин V, метициллин, оксациллин, карбенициллин, нафциллин, ампициллин и т.д.; пенициллины в комбинации с бета-лактамазными ингибиторами, цефалоспоринами, например, цефаклором, цефазолином, цефуроксимом, моксолактамом и т.д.; карбапенемы; монобактамы; аминогликозиды; тетрациклины; макролиды; линкомицины; полимиксины; сульфонамиды; хинолоны; хлорамфеникол; метронидазол; спектиномицин; триметоприм; ванкомицин и т.д.

Также используют противогрибковые агенты, включая полиены, например амфотерицин В, нистатин; 5-флюкозин; и азолы, например миконазол, кетоконазол, итраконазол и флюконазол. Противотуберкулезные лекарственные средства включают изониазид, етамбутол, стрептомицин и рифампин. Цитокины также могут быть включены в лекарственный состав дефенсинов по изобретению, например интерферон гамма, фактор некроза опухолей альфа, интерлейкин 12 и т.д.

Настоящее изобретение затем описывают следующими примерами, которые не должны быть истолкованы как ограничивающие рамки изобретения.

Примеры

Химические вещества, использованные в качестве буферов и субстратов, являлись коммерческими продуктами, по меньшей мере, класса реактивов.

Пример 1

Экспрессия содержащей интрон последовательности, кодирующей дефенсин в Aspergillus oryzae

Гидролизованный по BamH1-Xho1 ПЦР продукт длиной 361 п.о., амплифицированный из P. nigrella кДНК библиотеки (SEQ ID NO:6 из WO 03044049 (NOVOZYMES A/S) 2003-05-30) клонировали в Aspergillus экспрессирующий вектор, как ранее описано в WO 03/044049, чтобы получить плазмиду pMT2549. Последовательность интрона в последовательности pMT2549, кодирующей Плектазин, модифицировали с использованием стандартного in vitro мутагенеза и SOE, чтобы ввести еще одно основание, таким образом, создав рестрикционный сайт внутри интрона. Полученная интронсодержащая (59 п.о.) последовательность, кодирующая Плектазин, показана в виде SEQ ID NO: 17. Соответствующую экспрессирующую плазмиду назвали pMT2647.

pMT2647 трансформировали в Aspergillus oryzae BECh2, как ранее описано в WO 03/044049. Во-первых, 14 индивидуальных трансформантов дважды выделяли, растили в среде YPM (1% дрожжевой экстракт, 2% бактопептон и 2% мальтоза) и в конце анализировали по 10 мкл образцов на SDS геле, как ранее описано в WO 03/044049. Оказалось, что для некоторых из трансформантов количество Плектазина, полученного на основании интенсивностей окрашивания, значительно превышает предполагаемый максимальный уровень 50 мг/л, ранее полученный при этих условиях роста для трансформантов A. oryzae с экспрессирующей плазмидой, которая кодирует не содержащую интронов кДНК, кодирующую Плектазин (см. WO 03/044049).

В то время, как оказалось, что для некоторых из 14 трансформантов в pMT2549 получают уровень Плектазина высший, чем лучший, полученный для 30 ранее анализированных в WO 03/044049 трансформантов, не содержащих интронов, следует принять во внимание, что каждый селектированный на ацетамиде трансформант представляет индивидуальное событие трансформации и интеграции, приводящее к значительным различиям в выходе между индивидуальными трансформантами. Хорошо известно, что такие различия в выходе встречаются в системах, базирующихся на негомологичной рекомбинации, и предполагают, что обычно такие различия являются следствием случайных интеграционных локусов и следствием количества интегрированных экспрессирующих плазмид. Таким образом, было решено сравнить также экспрессию единичной копии экспрессирующего вектора, интегрированного в определенный локус (см. Пример 2).

Пример 2

Экспрессия дефенсина в Aspergillus oryzae из определенной единичной интегрированной копии

Чтобы сравнить непосредственно экспрессию в A. оryzae Плектазина из лишенной интронов кДНК с экспрессией Плектазина из кодирующей интронсодержащей последовательности, их BamH1-Xba1 фрагменты длиной примерно 1,1 т.п.о. перенесли из pMT2548 (см. WO 03/044049) и pMT2549 (см. выше), соответственно, на место BamH1-Xba1 фрагмента вектора, базирующегося на pJaL485 (8,3 т.п.о.). (см. Пример 3 в WO 03008575 (NOVOZYMES A/S). 2003-01-30.). pJaL485 содержит для селекции только часть гена niaD A. oryzae, кодирующую С-концевую часть нитрат редуктазы. При использовании линии хозяйских клеток, такой как JaL507, производной от JaL294 (см. Пример 8 в WO 03/008575), содержащей делецию части гена niaD, функциональной нитрат редуктазы, способность к росту с использованием нитрата в качестве источника азота может быть восстановлена только путем гомологичной рекомбинации. Было обнаружено, что большинство трансформантов, селектированных таким образом, на самом деле являются единичными интегрированными копиями, полученными в результате единичного гомологичного кроссинговера. Интегрированные тандемы по сайту niaD гена действительно встречаются с низкой степенью частоты. Лишенную интронов и интронсодержащую экспрессирующие плазмиды, полученные из pJaL485, назвали pMT2777 и pMT2836, соответственно. Для каждой из этих плазмид выбрали четыре трансформанта в A. oryzae JaL507 и показали с помощью анализа по Саузерну, что они содержат единичную копию трансформированной плазмиды, гомологично интегрированную в niaD локус. Полученные трансформанты из pMT2777 A. oryzae назвали MT2882-2885, и полученные из pMT2836 назвали MT2886-2889. Каждый из трансформантов MT2882-2889 растили на среде YPM, как описано выше, и после наращивания в течение 3 и в течение 7 дней анализировали по 10 мкл из образцов супернатантов клеточных культур с помощью анализа на PAGE SDS геле, как описано выше. Результат ясно показывает очень маленький разброс среди трансформантов в каждой из плазмид (как и ожидалось, поскольку они должны представлять независимые, но идентичные линии). С другой стороны, очевидно, что уровень экспрессии в MT2886-2889 (интронсодержащих) выше, чем в MT2882-2885 (лишенных интронов).

Относительный уровень Плектазина в образцах MT2882-2889 также определяли на 7-й день экспрессии с помощью анализа ELISA (см. Пример 4).

Пример 3

Увеличенная экспрессия дефенсина в образцах с генами, содержащими интрон в различных положениях и/или различные интроны

Чтобы облегчить перенос последовательностей, кодирующих варианты Плектазина из, например, E. coli и S. cerevisiae векторов в Aspergillus экспрессирующие векторы, решили поменять локализацию интрона Плектазина из первоначального расположения в последовательности, кодирующей зрелый Плектазин на положение в последовательности, кодирующей препропептид. Чтобы это сделать, в кодирующую Плектазин последовательность, лишенную интрона, ввели мутации путем in vitro мутагенеза, получив в результате сайт MluN1, локализованный в последовательности, кодирующей сигнальный пептид. Это был единственно возможный способ ввести сайт MluN1 при разрешенной аминокислотной замене в сигнальном пептиде (Leu17 заменяется на Ala). Согласно программам, обычно используемым для прогноза сигнального пептида, дают прогноз, что эта аминокислотная замена не ослабляет функцию сигнального пептида. Лишенная интрона последовательность, кодирующая Плектазин и содержащая MluN1, показана в виде SEQ ID NO:18; соответствующую Aspergillus экспрессирующую плазмиду назвали pMT2898.

Интрон, полученный из второго интрона A. niger глюкоамилазы и сконструированный так, чтобы он мог быть удален из плазмиды pMT2374 в виде SnaB1-Pvu2 фрагмента длиной 55 п.о. (см. Пример 1 в WO 03104457 (NOVOZYMES A/S). 2003-12-18.) и вставлен в pMT2898 по сайту MluN1, чтобы получить MT2899, для которой подтверждено, что интрон вставили в правильной ориентации. Интронсодержащая последовательность pMT2899, кодирующая Плектазин, показана в виде SEQ ID NO: 19.

Также интрон, обычно присутствующий в последовательности, кодирующей зрелый Плектазин, сконструировали синтетически таким образом, чтобы его можно было удалить также как SnaB1-Pvu2 фрагмент. Это было возможно только путем замены последних двух оснований интрона с Т на С. Этот интрон также перенесли в pMT2898 по сайту MluN1, чтобы получить pMT2900, в которой правильную ориентацию интрона подтвердили путем секвенирования. Интронсодержащая последовательность pMT2900, кодирующая Плектазин, показана в виде SEQ ID NO:20.

Плазмиды pMT2898, 2899 и 2900 трансформировали в A. oryzae BECh 2, селектируя для роста на ацетамиде. Приблизительно 20 трансформантов с каждой плазмидой дважды выделяли и растили на YPM среде, как описано выше. На основании анализа супернатантов в SDS PAGE гелях было очевидно, что средний уровень экспрессии Плектазина был значительно выше для трансформантов с интронсодержащими конструкциями pMT2899 и pMT2900, по сравнению с лишенной интрона конструкцией pMT2898. Кроме того, поскольку уровень экспрессии между индивидуальными селектированными на ацетамиде трансформантами широко варьируется, решили перенести экспрессирующую кассету из MT2898-2900 в базирующийся на niaD экспрессирующий вектор, полученный из pJaL485, как описано выше в Примере 2. Полученные в результате экспрессирующие плазмиды представляли собой pMT2901, pMT2902 и pMT2903, соответствующие pMT2898, pMT2899 и pMT2900, соответственно. pMT2901-2903 трансформировали в линию хозяйских клеток JaL507, дефицитную по niaD, как описано выше в Примере 2. Некоторое количество трансформантов было еще раз выделено для каждого из трансформантов. Трансформанты растили в среде YPM и анализировали супернатанты на SDS page гелях, как описано выше. Также в этом случае очевидно, что уровень экспрессии выше для интронсодержащих конструкций pMT2902 и pMT2903, чем для трансформантов с конструкцией pMT2901. Остается доказать с помощью анализа по Саузерну, какие трансформанты на самом деле являются единичными интегрированными копиями, но исходя из опыта может быть продемонстрировано, что большинство селектированных на нитрате трансформантов в данном случае являются единичными интегрированными копиями, даже если встречается тандемная интеграция. Два трансформанта селектировали в качестве характерных линий для каждой из pMT2901 (линии MT2946 и MT2947), pMT2902 (линии MT2948 и MT2949), и pMT2903 (линии MT2952 и MT2953).

С помощью ELISA также проводили количественную оценку Плектазина для MT2946-2949 (см. Пример 4).

Пример 4

Конкурентный анализ ELISA - Оценка выхода Плектазина в Aspergillus oryzae ферментационных системах

Чтобы оценить выходы в Aspergillus oryzae ферментационных бульонах, применяли непрямой конкурентный анализ ELISA с использованием кроличьих поликлональных антител, генерированных против очищенного Плектазина. Этот тип анализа является стандартной процедурой, обычно применяемой, чтобы оценить количество данного белка/пептида, генерированного иммунной сывороткой.

Использовали следующие материалы и буферы:

- Plectasin - дефенсин, описанный в PCT заявке WO 03/044049;

- F96 MaxiSorp Платы (Nunc, Cat. no.: 439454);

- F96 Microwell Платы (Nunc, Cat. no.: 269787);

- Порошок сухого обезжиренного молока (MERCK, Cat. no.: 1.15363.0500);

- Tween 20 (MERCK, Cat. no.: 8.22184.0500);

- Специфические к Плектазину кроличьи поликлональные антитела (Novozymes);

- Свиные Анти-Кроличьи Иммуноглобулины/HRP (DAKO, P0448) ;

- TMB Plus, Ready-to-Go (KemEnTek, Cat. no.: 4390);

- Серная кислота (MERCK, Cat. no.: 1.00731.1000).

- PBS, pH 7,2, 1 Л:

8,00 г NaCl,

0,20 г KCl,

1,04 г K2HPO4,

0,32 г KH2PO4;

- Буфер для блокирования: PBS, 2% Обезжиренное молоко;

- Буфер для отмывания: PBS, 0,05% Tween 20;

- Буфер для разведения: PBS, 0,5% Обезжиренное молоко, 0,05% Tween 20.

Коротко, не разведенные культуральные бульоны и серию их 2-кратных разведений преинкубировали с поликлональным антителом 1:1000 в буфере для разведения. После предварительной инкубации в течение 2 часов при комнатной температуре образцы переносили в платы, предварительно покрытые Плектазином (покрытые Плектазином с концентрацией 0,1 мкг/мл, и остаточное связывание блокировали, используя буфер для блокирования). После инкубации в течение 1 часа при комнатной температуре связанное антитело детектировали, используя вторичное антитело (Свиное или кроличье - HRP), и после этого использовали хромоген (TMB Plus). Детекцию антитела, связанного с Плектазином, измеряли посредством поглощения при 450 нм, которое получается в результате кривой титрования связывания антитела.

Во время анализа платы промывали, используя буфер для отмывания, и разведения вещества проводили, как описано у производителя (DAKO & KemEnTek).

Интерпретации: Отсутствие детекции связывания антитела с лункой платы обозначает, что встречается полное связывание (ингибирование) антитела с неизвестным ферментационным бульоном; тогда как измеренный максимум поглощения равносилен отсутствию конкурентного ингибирования (неизвестным ферментационным бульоном). Таким путем мы смогли оценить количества (разведенных бульонов), которые необходимы, чтобы ингибировать 50% связывания с платами. Результаты показаны в Таблице. Результаты рассчитывали по отношению к выходам, измеренным для лишенных интрона ферментационных бульонов (MT2882, MT2883, MT2884 и MT2885). Результаты также показаны в Таблице.

Результаты показывают, что при применении интронсодержащих генных конструкций уровень экспрессии увеличивается примерно на 330% по сравнению с уровнем экспрессии, полученным при применении лишенных интрона генных конструкций.

Интрон ID Культуры Относительный выход Средний выход
- МТ2882, день 7 106 100
- МТ2883, день 7 108
- МТ2884, день 7 96
- МТ2885, день 7 91
+ МТ2886, день 7 335 330
+ МТ2887, день 7 368
+ МТ2888, день 7 310
+ МТ2889, день 7 320
- МТ2946 77 89
- МТ2947 100
+ МТ2948 268 331
+ МТ2949 394

Пример 5

Увеличенная экспрессия дефенсина из Eurotium Amstelodami

Дефенсин, кодирующий кДНК из Eurotium amstelodami, ранее идентифицировали и назвали Eurocin (см. Примеры из DK 2005/000725 (NOVOZYMES A/S); или SEQ ID NO:3). кДНК экспрессировали в A. oryzae, чтобы получить активный пептид дефенсина Eurocin. Для того чтобы увеличить уровень экспрессии, сделали экспрессирующую конструкцию, содержащую последовательность геномной ДНК (включая два интрона).

Геномную ДНК из E. amstelodami получали, используя стандартный метод для получения геномной ДНК грибов. Приблизительно 50 нг геномной ДНК использовали в качестве матрицы в реакции ПЦР со следующими праймерами.

Праймер A:

TCTTGGATCCACCATGCACTTCACCAAGGTCTCC (SEQ ID NO:21)

Праймер B:

TCTTCTCGAGTTAGAAAGAACAGGTGCAGGTAC (SEQ ID NO:22)

По 10 пмоль каждого праймера использовали в реакционном объеме 50 мкл. Температура отжига - 55 градусов по Цельсию и протяжка - 72 градуса по Цельсию в течение 1 минуты. Всего проводили 35 циклов с использованием Расширенной Высоко Точной ПЦР Системы (Roche). ПЦР продукт гидролизовали с помощью BamH1 и Xho1, которые разрезают в выступающих последовательностях, введенных с помощью ПЦР праймеров. Гидролизат анализировали на 2% агарозном геле и выделяли фрагмент размером приблизительно 400 п.о. Выделенный фрагмент лигировали с гидролизованной BamH1 -Xho1 плазмидой pMT2786 (см. Пример 2 из PCT/DK2005/000725) и трансформировали в E. coli MT173, селектируя на прототрофность к лейцину. BamH1-Xho1 вставку отсеквенировали и показали, что она кодирует последовательность препро-Eurocin, соответствующую кДНК, охарактеризованной ранее (см. PCT/DK2005/000725 или SEQ ID NO:3), но также содержит две интронные последовательности размером 45 и 53 п.о., соответственно. Последовательность и структура BamH1-Xho1 вставки показаны в SEQ ID NO:23. Aspergillus, экспрессирующую плазмиду, содержащую вставку, назвали pMT2945.

pMT2945 трансформировали в A. oryzae BECh2, как описано в Примере 1, и 20 трансформантов выделяли еще раз и обрабатывали ферментами, как описано в Примере 1. Супернатанты анализировали на SDS гелях, как описано выше. Как и ранее, параллельные эксперименты также проводили, используя трансформанты с Eurocin кДНК, базирующейся на экспрессирующей плазмиде pMT2935 (см. Пример 2 из PCT/DK2005/000725).

Все трансформанты, базирующиеся на кДНК конструкции pMT2935 и на интронсодержащей конструкции pMT2945, дают выход индивидуальным фрагментам, соответствующим по размеру на SDS геле Eurocin.

Оценили, что трансформанты, базирующиеся на интронсодержащей геномной конструкции pMT2945, дают выход 300-400% от уровня экспрессии, полученного с трансформантами, базирующимися на кДНК конструкции pMT2935.

Пример 6

Использование HMM файлов из базы данных PFAM, чтобы идентифицировать дефенсин

Анализ последовательности с использованием скрытых модельных профайлов Маркова (HMM профайлы) может быть проведен как on line с помощью Интернета, так и локально на компьютере с использованием хорошо известного, коммерчески доступного пакета программного обеспечения HMMER. Текущая версия представляет собой HMMER 2.3.2 от Октября 2003.

HMM профайлы могут быть получены из хорошо известной базы данных PFAM. Текущая версия представляет собой PFAM 16.0 от Ноября 2004. Обе программы HMMER и PFAM доступны для всех компъютерных платформ от, например, Washington University in St. Louis (USA), School of Medicine (http://pfam.wustl.edu и http://hmmer.wustl.edu).

Если интересующая аминокислотная последовательность или ее фрагмент принадлежит к одному из следующих пяти семейств PFAM, то аминокислотная последовательность является дефенсином согласно настоящему изобретению:

- Дефенсин_бета или "Бета Дефенсин", accession number: PF00711 ;

- Дефенсин_пропеп или "Дефенсин пропептид", accession number: PF00879;

- Дефенсин_1 или "Дефенсин Млекопитающих", accession number: PF00323;

- Дефенсин_2 или "Дефенсин Членистоногих", accession number: PF01097;

- Гамма-тионин или "семейство Гамма-тионинов", accession number: PF00304.

Используя базу данных PFAM on line или используя программу hmmpfam локально (из пакета программного обеспечения HMMER), определяют, что аминокислотная последовательность принадлежит семейству PFAM, согласно настоящему изобретению, если она генерирует E-величину большую, чем 0,1, и коэффициент, больший или равный нулю.

Когда проводят анализ последовательности локально с использованием программы "hmmpfam", то необходимо получить (установить) HMM профайлы из базы данных PFAM. Два профайла существуют для каждого семейства; "xxx_ls.hmm" для глобальных поисков и "xxx_fs.hmm" для локальных поисков ("xxx" - название семейства). В целом получается десять профайлов для пяти вышеупомянутых семейств.

Эти десять профайлов могут быть использованы индивидуально или могут быть объединены (приложены) в один профайл (используя текстовый редактор - профайлы представляют собой ASCII файлы), которые могут быть названы, например, "Дефенсин.hmm". Аминокислотную последовательность можно затем оценить, используя следующую командную линию:

hmmpfam -E 0,1 Дефенсин.hmm последовательность_файл

- где " последовательность_файл " представляет собой файл с интересующей аминокислотной последовательностью, представленной в любом формате, распознаваемом с помощью пакета программного обеспечения HMMER.

Если коэффициент больше или равен нулю (0,0), и E-величина больше, чем 0,1, то интересующая аминокислотная последовательность является Дефенсином согласно настоящему изобретению.

База данных PFAM описана далее в BATEMAN, The Pfam Protein Families Database. Nucleic acids res., January vol. 32, p. D138-D141 ISSN 0305-1048.

1. Рекомбинантная клетка-хозяин Aspergillus, содержащая конструкцию нуклеиновой кислоты, которая содержит чужеродную последовательность нуклеиновой кислоты, кодирующую дефенсин насекомых, и одну или несколько интронных последовательностей.

2. Клетка-хозяин Aspergillus по п.1, которая является клеткой-хозяином Aspergillus niger или Aspergillus oryzae.

3. Способ рекомбинантной продукции дефенсина насекомых в клетке-хозяине Aspergillus, который включает культивирование клетки-хозяина Aspergillus, содержащей конструкцию нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, кодирующую пептид дефенсина насекомых, и одну или несколько интронных последовательностей; и получение пептида дефенсина насекомых.

4. Способ по п.3, где клетка-хозяин Aspergillus является клеткой-хозяином Aspergillus niger или Aspergillus oryzae.

5. Способ рекомбинантной экспрессии дефенсина с использованием конструкции нуклеиновой кислоты, которая содержит последовательность нуклеиновой кислоты, кодирующую пептид дефенсина насекомых и одну или несколько интронных последовательностей для улучшения уровня рекомбинантной экспрессии дефенсина в клетке-хозяине Aspergillus.

6. Способ по п.5, где клетка-хозяин Aspergillus является клеткой-хозяином Aspergillus niger или Aspergillus oryzae.



 

Похожие патенты:

Изобретение относится к области генетической инженерии и может быть использовано в медико-биологической промышленности для получения рекомбинантного гетерокарпина - антагониста человеческого рилизинг-фактора гормона роста (GHRH).

Изобретение относится к области биотехнологии и касается варианта ДНК, связанного с гиполактазией взрослого типа. .

Изобретение относится к биотехнологии. .

Изобретение относится к области микробиологии и молекулярной генетики и может быть использовано при производстве вакцин против Streptococcus pyogenes - стрептококков группы А (СГА) и Streptococcus agalactiae - стрептококков группы В (СГВ).

Изобретение относится к области медицины и касается лечения пролиферативных заболеваний с использованием антисмыслового олигомера IAP и химиотерапевтического препарата.

Изобретение относится к генетической инженерии, в частности к идентификации генов, участвующих в адаптации организма в среде его обитания, и может быть использовано для создания рекомбинантной бактерии с пониженной адаптацией к конкретной окружающей среде.

Изобретение относится к сельскому хозяйству и биотехнологии и может быть использовано в селекции однодольных растений при создании новых сортов и гибридов с помощью генной инженерии, в работах по инсерционному мутагенезу, выделению и клонированию генов растений.

Изобретение относится к биотехнологии. .
Наверх