Наборы и способ детектирования папилломавируса человека с помощью набора олигонуклеотидных гранул



Наборы и способ детектирования папилломавируса человека с помощью набора олигонуклеотидных гранул
Наборы и способ детектирования папилломавируса человека с помощью набора олигонуклеотидных гранул
Наборы и способ детектирования папилломавируса человека с помощью набора олигонуклеотидных гранул
Наборы и способ детектирования папилломавируса человека с помощью набора олигонуклеотидных гранул
Наборы и способ детектирования папилломавируса человека с помощью набора олигонуклеотидных гранул
Наборы и способ детектирования папилломавируса человека с помощью набора олигонуклеотидных гранул
Наборы и способ детектирования папилломавируса человека с помощью набора олигонуклеотидных гранул
Наборы и способ детектирования папилломавируса человека с помощью набора олигонуклеотидных гранул
Наборы и способ детектирования папилломавируса человека с помощью набора олигонуклеотидных гранул
Наборы и способ детектирования папилломавируса человека с помощью набора олигонуклеотидных гранул
Наборы и способ детектирования папилломавируса человека с помощью набора олигонуклеотидных гранул
Наборы и способ детектирования папилломавируса человека с помощью набора олигонуклеотидных гранул
Наборы и способ детектирования папилломавируса человека с помощью набора олигонуклеотидных гранул

 


Владельцы патента RU 2410441:

ДЖИНГЕН БИО КО., ЛТД. (KR)
ХАН Биоунг-Дон (KR)

Изобретение относится к области биотехнологии, в частности к набору праймеров для амплификации гена L1 папилломавируса человека (HPV), набору для детектирования генотипа папилломавируса человека (HPV) и к способам детектирования генотипов папилломавируса человека (HPV). Способ включает осуществление первичной ПЦР-амплификации гена HPV L1 в анализируемом образце с использованием набора из прямого и обратного праймеров, специфичных для участка гена L1. После чего осуществляют вторичную ПЦР-амплификацию продукта первичной ПЦР-амплификации гена L1 с использованием обратного праймера, с получением меченого биотином одноцепочечного гена L1. Затем проводят реакцию гибридизации продукта вторичной ПЦР-амплификации, меченого биотином одноцепочечного гена L1 с одним или более зондов для детектирования HPV-генотипа или зонда для детектирования HPV-генотипа. Далее осуществляют проведение реакции продукта реакции гибридизации с фикоэритрином, связанным со стрептавидином. Затем проводят измерение уровня флуоресцентного вещества и идентификацию зондов в продукте реакции гибридизации для идентификации HPV-генотипа. После чего осуществляют определение генотипа HPV и уровня его присутствия в соответствии с зондами и уровнем флуоресцентного вещества. Предложенное изобретение позволяет разработать способ детектирования HPV в образце с высокой чувствительностью, достаточной для детектирования крайне малого количества HPV в образце. 4 н. и 4 з.п. ф-лы, 2 ил., 1 табл.

 

Область техники

Настоящее изобретение относится к набору и способу генотипирования папилломавируса человека (HPV), имеющему высокую чувствительность и специфичность.

Уровень техники

Известно, что папилломавирусы человека (HPV) представляют собой ДНК-вирусы размером приблизительно 8 т.п.о. и тесно связаны с различными злокачественными опухолями, вызывающими рак шейки матки у женщин (Godfroid et al., J. Virol. Method 75:69-81, 1998).

Предполагается, что рак шейки матки тесно связан с половым контактом и HPV-инфекцией, которая является одним из наиболее широко распространенных передаваемых половым путем заболеваний, и вовлечена в случаи канцерогенеза рака шейки матки. К настоящему времени идентифицировано приблизительно 100 генотипов HPV; приблизительно для 30 типов было доказано, что они тесно связаны с раком шейки матки, которые подразделялись на группу HPV-типа с "высоким риском" (например, тип 16, 18, 31, 33, или тип 35) и группу HPV-типа с "низким риском" (например, тип 6, 11, 42, 43, или тип 44) (De Villiers, J. Virol. 63:4898-4903, 1989; Jacobs et al., J. Clin. Microbiol. 33:901-905, 1995).

Рак шейки матки в настоящее время диагностируют с помощью сочетания нескольких диагностических тестов. Среди них наиболее широко используемым для диагностики рака шейки матки является тест-мазок Папаниколау (Pap). Однако тест-мазок Pap, прежде всего, зависит от квалификации специалиста, и часто случаются ложные или неточные результаты теста (Menezes et al., Acta Cytol. 45:919-926, 2001). Кольпоскопическое исследование дает возможность детектировать HPV-инфекции относительно точно, так что степень детектирования составляет до 70%. Однако кольпоскопическое исследование также является проблематичным из-за его неспособности определять генотипы HPV для классификации на генотипы с высоким и низким риском. С другой стороны, это дорогостоящая процедура и требует высококвалифицированного специалиста и дорогостоящего оборудования (Reid et al., Clin Obstet Gynecol. 32:157-179, 1989).

Метод PCR-RFLP, в котором используются ферменты рестрикции после выполнения ПЦР (полимеразная цепная реакция) амплификации участка гена L1 из HPV, дает возможность получать результаты детекции легко и просто. Однако, согласно этому методу, если варианты не идентифицируются с помощью используемых рестрикционных ферментов, то высокочувствительный анализ является недоступным (Lungu et al., JAMA 267:2493-2496, 1992). Кроме того, эффективность ПЦР-амплификации может варьироваться согласно особенностям генотипов HPV, которые могут приводить к нежелательному снижению точности анализа (Qu et al., J. Clin. Microbiol. 35:1304-1310, 1997; Karksen et al., J. Clin. Microbiol. 34:2095-2100, 1996; Gravitt et al., J. Clin. Microbiol. 38:357-361). Кроме того, коммерчески доступный набор реактивов с захватом гибрида (hybrid capture kit) (Digene, Inc., USA) способен к идентификации без ПЦР-амплификации, и может классифицировать группы HPV с высоким и низким риском. Однако, набор реактивов с захватом гибрида не способен различать генотипы HPV 16 и 18, которые являются очень тесно связанными с раком шейки матки, и другие генотипы HPV с высоким риском (Clavel et al., J. Clin. Pathol. 51:737-740, 1998). Недавно разработанные наборы для анализа генотипов HPV (BioMedLab., Co., Korea), использующие ДНК-чипы HPV, подвергаются 2-мерной гибридизации на слайдах, с тремя последующими стадиями промывки, что является трудоемким процессом.

Подобным образом, в настоящее время доступны наборы для детектирования HPV, использующие суспензионные биочипы. Однако набор для HPV демонстрирует очень низкие значения сигналов для детектирования, что предполагает существование ограничений при реальном детектировании низких концентраций инфекционных вирусов, в особенности когда имеет место ко-инфекция двумя или более вирусами. Кроме того, для подтверждения того, существуют ли любые другие генотипы HPV без гибридизации зонда на биочипе или грануле, или для контроля корректного проведения ПЦР-реакции, существует методика детектирования, использующая наборы с микрочипами, которая требует ряда дополнительных стадий после проведения ПЦР, таких как электрофорез ПЦР-продуктов, которые являются достаточно трудоемкими для осуществления задачи.

Соответственно, было бы очень желательно разработать способы детектирования HPV-типа, имеющие высокую чувствительность, которые способны к точному детектированию крайне низких концентраций HPV-типов, содержащихся в реагенте.

При этих обстоятельствах авторы настоящего изобретения попытались детектировать HPV-типы способами с высокой чувствительностью посредством улучшения способов детектирования, в особенности посредством улучшения зондов для HPV-генотипа. Авторы настоящего изобретения получили зонды для детектирования, имеющие последовательности нуклеиновой кислоты, способные к детектированию HPV-типов из участка гена L1 с высокой гетерогенностью между различными HPV-типами. Затем участок подвергали первичной ПЦР-амплификации с последующим мечением зондом для детектирования HPV-типа с получением в результате меченых биотином одноцепочечных молекул-мишеней. С помощью этого способа мечения авторы настоящего изобретения подтвердили, что интенсивность сигнала с помощью данных способов мечения приблизительно в 10 раз выше, чем интенсивность сигнала, полученная традиционным способом. Кроме того, как описано выше, авторы настоящего изобретения разработали зонд для гибридизации, вступающий в реакцию со всеми HPV-генотипами, что дает возможность детектирования даже редких HPV-инфекций без проведения электрофореза в отличие от традиционного зонда для детектирования. Кроме того, с целью определения того, была ли ПЦР-реакция проведена успешно, в качестве положительного контроля использовали ген GAPDH, который одновременно присутствовал в образце, проводили его амплификацию и реакцию с зондом для гибридизации.

Описание изобретения

В настоящем изобретении предлагается зонд для детектирования одного или нескольких генотипов папилломавируса человека (HPV), выбранных из последовательностей нуклеиновых кислот SEQ ID NO: 1-24.

В настоящем изобретении также предлагается зонд для детектирования генотипа папилломавируса человека (HPV), имеющего последовательность нуклеиновой кислоты SEQ ID NO: 25, взаимодействующий с любыми редкими HPV-генотипами.

В настоящем изобретении дополнительно предлагается набор праймеров для амплификации участка гена L1 папилломавируса человека (HPV), имеющих последовательности нуклеиновых кислот SEQ ID NO: 27 и 28.

Дополнительно в настоящем изобретении дополнительно предлагается набор праймеров для амплификации гена GAPDH (глицеральдегид-фосфат-дегидрогеназы), имеющих последовательности нуклеиновых кислот SEQ ID NO: 29 и 30.

В настоящем изобретении также предлагается основная последовательность зонда для гена GAPDH, имеющая последовательность нуклеиновой кислоты SEQ ID NO: 26, которая специфично гибридизуется с геном GAPDH, амплифицированным с помощью праймеров, имеющих последовательности нуклеиновых кислот SEQ ID NO: 29 и 30.

В настоящем изобретении также предлагается зонд для детектирования генотипов папилломавируса человека (HPV), включающий зонд и/или набор праймеров.

В настоящем изобретении также предлагается способ определения генотипов папилломавируса человека (HPV), имеющий высокую чувствительность, включающий:

(1) осуществление первичной ПЦР-амплификации участка гена HPV L1 в образце с использованием набора из прямого и обратного праймеров, специфичных к последовательности-мишени;

(2) осуществление вторичной ПЦР-амплификации первичных ПЦР-ампликонов с использованием прямого или обратного праймера, с получением меченого биотином одноцепочечного участка гена L1;

(3) гибридизация меченого биотином одноцепочечного продукта вторичной ПЦР-амплификации с зондом для детектирования генотипа HPV;

(4) мечение продукта реакции гибридизации флуоресцентным веществом, связанным со стрептавидином;

(5) измерение уровня флуоресцентного вещества для идентификации генотипа HPV.

Краткое описание чертежей

На фиг.1 показан результат анализа образца пациента с применением биочипа на грануле. Как подтверждается с помощью фиг.1, образец инфицирован HPV-типом 16, и присутствует сигнал гена GAPDH, в качестве положительного контроля, и сигнал любого зонда, имеющего последовательность нуклеиновой кислоты SEQ ID NO: 25, взаимодействующего с любыми HPV-типами для анализа редких HPV-типов, чьи зонды не предлагаются в биочипе на грануле.

Фиг.2 представляет собой результат анализа образца, который имеет множество инфекций с HPV-типами 35, 39 и 67, и сигнал положительного контроля гена GAPDH, и сигнал любого зонда.

Лучший способ осуществления изобретения

В одном аспекте изобретение относится к зонду для детектирования генотипа папилломавируса человека (HPV).

В одном аспекте изобретение относится к зонду для детектирования одного или нескольких генотипов папилломавируса человека (HPV), выбранных из последовательностей нуклеиновых кислот SEQ ID NO: 1-24.

В другом аспекте изобретение относится к зонду для детектирования одного или нескольких генотипов папилломавируса человека (HPV), имеющему последовательность нуклеиновой кислоты SEQ ID NO: 25, взаимодействующему с любыми редкими генотипами HPV.

Согласно настоящему изобретению термин "зонд" обозначает относительно короткие последовательности нуклеиновых кислот, способные к специфичному определению HPV-типов. Предпочтительно, зонд представляет собой молекулу нуклеиновой кислоты длиной примерно от нескольких оснований до нескольких десятков оснований. В Таблице 1 продемонстрированы последовательности зондов, специфичных для L1 генотипа, для разнообразных HPV-типов, представленных в настоящем изобретении, причем зонды имеют последовательности нуклеиновых кислот SEQ ID NO: 1-24. Зонды, имеющие последовательности нуклеиновой кислоты SEQ ID NO: 1-24, проявляют слабую перекрестную реактивность с другими полученными HPV-типами, принимая во внимание последовательности гена HPV L1, специфичные для каждого типа. Когда образец гибридизуется с использованием зондов, имеющих последовательности нуклеиновых кислот SEQ ID NO: 1-24, зонды позволяют точно детектировать и ставить диагноз, специфичный для HPV-субтипа благодаря высокой специфичности и чувствительности. Кроме того, зонд, имеющий последовательность нуклеиновой кислоты SEQ ID NO: 25, который предлагается в настоящем изобретении, имеет специфичную последовательность, взаимодействующую с любыми HPV-генотипами независимо от HPV-типа. Когда образец гибридизуется с использованием зонда, имеющего последовательность нуклеиновой кислоты SEQ ID NO: 25, гибридизации проводят с обоими HPV-типами, способными гибридизоваться с зондами, имеющими последовательности нуклеиновых кислот SEQ ID NO: 1-24, и HPV-типами, не способными гибридизоваться с такими зондами, посредством чего специфично детектируются и диагностируются редкие HPV-типы. Кроме того, с целью упростить определение HPV-инфекции, в настоящем изобретении предлагается способ детектирования зонда, имеющего последовательность нуклеиновой кислоты SEQ ID NO: 25, использующий анализатор биочипа на грануле вместо традиционного способа анализа, в котором ПЦР-продукт подвергается электрофорезу перед HPV-субтипированием. Согласно настоящему изобретению редкие HPV-типы (которые не включены в специфичные зонды) могут определяться путем детектирования зонда, имеющего последовательность нуклеиновой кислоты SEQ ID NO: 25, без осуществления электрофореза. Кроме того, даже если HPV-инфекция не детектируется с помощью электрофореза благодаря низкой концентрации вируса, HPV-инфекция может быть идентифицирована, что предполагает повышение удобства и точности детектирования и диагностики.

Соответствующие зонды, которые предлагаются в настоящем изобретении, модифицированы следующим образом. Один типичный зонд по настоящему изобретению может включать последовательность из 5-20 тиминов (dTTP) на 5'-конце. Кроме того, зонд может включать 5'-концевую аминогруппу, ковалентно связанную с карбоксильной группы гранулы. Аминогруппа предпочтительно связана через цепь (CH2)n. Здесь n представляет собой число от 5 до 10, предпочтительно от 5 до 7. В конкретном примере настоящего изобретения каждый зонд создан так, что содержит 15 тиминовых групп (dTTP), цепь (CH2)6 и аминогруппу. Многочисленные вариации последовательностей нуклеиновой кислоты зонда могут быть осуществлены специалистом в данной области.

Другой аспект настоящего изобретения заключается в предложении набора праймеров для амплификации генотипов папилломавируса человека (HPV), имеющих последовательности нуклеиновых кислот SEQ ID NO: 27 и 28.

Выражение "набор праймеров" по настоящему изобретению обозначает короткие последовательности нуклеиновой кислоты, способные к получению пар оснований с комплементарными матрицами и способными действовать в качестве точки инициации синтеза копии матричной цепи. Набор праймеров, предлагаемый в настоящем изобретении, включает прямой и обратный праймеры, сконструированные для амплификации всех типов конкретного участка генов HPV L1, независимо от HPV-типа. В конкретном примере настоящего изобретения набор праймеров имеет последовательности нуклеиновых кислот SEQ ID NO: 27 и 28.

Другой аспект настоящего изобретения относится к набору праймеров для амплификации гена GAPDH, имеющих последовательности нуклеиновых кислот SEQ ID NO: 29 и 30 для подтверждения того, успешно или нет была проведена реакция ПЦР.

Набор праймеров для GAPDH, предлагаемых в настоящем изобретении, сконструирован для специфичной амплификации гена GAPDH, экспрессирующегося все время в качестве гена внутреннего контроля в образце. В конкретном примере настоящего изобретения набор праймеров для GAPDH представляет собой набор праймеров, имеющих последовательности нуклеиновых кислот SEQ ID NO: 29 и 30.

Еще в одном аспекте настоящего изобретения предлагается зонд, имеющий последовательность нуклеиновой кислоты SEQ ID NO: 26, специфичная последовательность зонда для гена GAPDH для детектирования амплифицированного гена GAPDH. Этот зонд гибридизуется одновременно с другими HPV-специфичными зондами во время гибридизации с ампликонами в образце. Таким образом, поскольку успешное проведение реакции ПЦР немедленно определяется с помощью анализатора биочипа на грануле, количество недетектируемых случаев, возникающих из-за ошибок ПЦР, существенно уменьшается.

В следующем аспекте настоящего изобретения предлагается набор для детектирования генотипа папилломавируса человека (HPV), включающий набор зондов.

Набор зондов может быть предложен в разнообразных типах согласно целям эксперимента. Предпочтительно, набор для зонда представляет собой биочип на грануле, который связывает зонд для HPV-генотипирования с гранулой.

Кроме зонда для детектирования HPV-типа, набор для детектирования согласно настоящему изобретению может дополнительно включать последовательность праймера для амплификации участка гена HPV L1. Кроме того, набор для детектирования согласно настоящему изобретению может дополнительно включать последовательность праймера для амплификации гена GAPDH. Кроме того, набор для детектирования согласно настоящему изобретению может дополнительно включать зонд, имеющий последовательность, специфичную для гена GAPDH.

Кроме указанного выше, набор для детектирования согласно настоящему изобретению может дополнительно включать следующие компоненты: пробирку для амплификации или другой подходящий контейнер, раствор реакционного буфера; дезоксирибонуклеотиды (dNTP); биотинилированные dNTP; ДНК-полимеразу; стерильную воду; и так далее. Далее, набор для детектирования согласно настоящему изобретению может дополнительно включать группы положительного и отрицательного контроля.

В другом аспекте настоящего изобретения предлагается способ определения генотипов папилломавируса человека (HPV), имеющий высокую чувствительность, причем способ включает: (1) осуществление первичной ПЦР-амплификации участка гена HPV L1 в образце с использованием набора из прямого и обратного праймеров, специфичных к последовательности-мишени; (2) осуществление вторичной ПЦР-амплификации первичных ПЦР-ампликонов с использованием прямого или обратного праймера, с получением меченого биотином одноцепочечного участка гена L1; (3) гибридизация меченого биотином одноцепочечного продукта вторичной ПЦР-амплификации с зондом для детектирования генотипа HPV; (4) мечение продукта реакции гибридизации флуоресцентным веществом, связанным со стрептавидином; и (5) измерение уровня флуоресцентного вещества для идентификации генотипа HPV.

Конкретно, в настоящем изобретении предлагается способ определения генотипов папилломавируса человека (HPV), имеющий высокую чувствительность, причем способ включает: (1) осуществление первичной ПЦР-амплификации участка гена HPV L1 и гена GAPDH в образце с использованием набора из прямого и обратного праймеров, специфичных для участка гена L1 и гена GAPDH; (2) осуществление вторичной ПЦР-амплификации продуктов, полученных с помощью первичной ПЦР-амплификации гена L1 и гена GAPDH с использованием прямого или обратного праймера, с получением меченого биотином одноцепочечного гена L1; (3) одновременное осуществление реакций гибридизации обоих продуктов вторичной ПЦР-амплификации, меченых биотином одноцепочечных генов L1 и GAPDH с зондом для детектирования генотипа HPV и GAPDH-специфичным зондом, соответственно; (4) мечение продуктов реакции гибридизации флуоресцентным веществом, связанным со стрептавидином; и (5) измерение уровня флуоресцентного вещества для идентификации генотипа HPV.

Настоящее изобретение характеризуется последовательным проведением в реакциях ПЦР стадии (1) и (2). Посредством последовательных реакций ПЦР ген HPV L1 в анализируемом образце амплифицируют и получают в виде меченого биотином одноцепочечного гена L1, что дает возможность высокочувствительного детектирования. Кроме того, ген GAPDH также амплифицируют и получают в виде меченого биотином одноцепочечного гена. На стадии (1) осуществляют ПЦР-амплификацию гена HPV L1 с использованием набора из прямого и обратного праймеров, специфичных для гена L1, выделенного из образца ДНК. На этой стадии ген L1 экспоненциально амплифицируется. В конкретном примере настоящего изобретения для достижения одноцепочечной амплификации используется набор праймеров, имеющих последовательности нуклеиновых кислот SEQ ID NO: 27 и 28. На основе такого же принципа, как указано выше, в конкретном примере настоящего изобретения, амплифицировали ген GAPDH и получали в виде амплифицированного гена, имеющего последовательности нуклеиновых кислот SEQ ID NO: 29 и 30.

На стадии (2) осуществляют линейную ПЦР-амплификацию гена HPV L1 и/или гена GAPDH, амплифицированных на стадии (1) с использованием меченых биотином нуклеотидов. На этой стадии ген L1 (меченый с помощью биотинилированных нуклеотидов) линейно амплифицируется. В конкретном примере настоящего изобретения для достижения одноцепочечной амплификации используют прямой и обратный праймеры. Когда гибридизационный зонд представлен антисмысловой цепью, смысловая цепь амплифицируется с использованием прямого праймера. С другой стороны, когда гибридизационный зонд представлен смысловой цепью, антисмысловая цепь амплифицируется с использованием обратного праймера. Мечение биотином гена L1 и гена GAPDH может быть осуществлено с использованием меченого биотином праймера или с помощью осуществления ПЦР в присутствии меченых биотином dNTP. В конкретном эксперименте настоящего изобретения ПЦР осуществляют с использованием обратного праймера, имеющего последовательность нуклеиновой кислоты SEQ ID NO: 28, и обратного праймера, имеющего последовательность нуклеиновой кислоты SEQ ID NO: 30 в присутствии меченых биотином dCTP, посредством чего получают меченые биотином одноцепочечные гены.

Другими словами, экспоненциально амплифицированные гены получают с помощью ПЦР на стадии (1) и только цепь, комплементарную зонду, (метят) амплифицируют с помощью ПЦР на стадии (2), посредством чего увеличивается эффективность гибридизации между зондом и продуктами меченых биотином генов. Во время ПЦР на стадии (1) или (2), время, температура и циклы денатурации, конденсации, и вся комбинация могут быть подобраны подходящим образом.

На стадии (3), меченые биотином одноцепочечные генные продукты, полученные на стадии (1) и (2), гибридизуются с зондом для определения HPV-типа согласно настоящему изобретению. Здесь, предпочтительно, используются в качестве зондов для детектирования на стадии (3) HPV-специфичные зонды, имеющие последовательности нуклеиновых кислот SEQ ID NO: 1-24, зонд, имеющий последовательность нуклеиновой кислоты SEQ ID NO: 30, только для подтверждения присутствия или отсутствия HPV, и GAPDH-специфичный зонд, последовательности нуклеиновых кислот SEQ ID NO: 29.

Зонд по настоящему изобретению может быть предложен в виде биочипа на грануле. Тип гранулы, связываемой с зондом, не является конкретным ограничением, и биочип на грануле может быть получен с помощью общепринятых методов, хорошо известных из уровня техники.

Во время реакции гибридизации вид используемого буфера, время и температура могут быть подобраны подходящим образом. В конкретном примере настоящего изобретения реакцию гибридизации осуществляют а течение 5 минут при 95°C с использованием буфера 2×Hybrisol (YeBT., Co. LTD.), с последующей дополнительной реакцией первоначально гибридизовавшегося продукта в течение 3 минут при 40°C. На этом этапе, стадию промывки осуществляют с использованием гибридизационного буфера (0,2 M NaCl, 0,1 M Tris(pH 8,0), 0,08% Triton X-100).

На стадиях (4) и (5) реактивность между зондом и образцом, полученным вышеописанным способом, идентифицируют на основе флуоресценции с использованием флуоресцентного вещества, связанного со стрептавидином. Поскольку стрептавидин специфично связывают с биотином, уровень гена-мишени, присутствующего в образце, может быть измерен по флуоресценции.

Примеры флуоресцентного вещества включают, но не ограничены ими, флуоресцеин, изотиоцианат, родамин, фикоэритрин, пикоцианин, аллофикоцианин, о-фтальдегид и флуорескармин. В настоящем изобретении в качестве примера применяют фикоэритрин.

В случае где HPV-ген, выделенный из образца по настоящему изобретению, получают в виде меченого биотином одноцепочечного участка гена L1, величина сигнала будет примерно в 10 раз выше, чем величина сигнала, полученного в традиционном случае, где двухцепочечный ПЦР-продукт непосредственно помечен флуоресцентным веществом. Соответственно, в настоящем изобретении предлагается способ детектирования HPV-генотипов, имеющий высокую чувствительность, с помощью которого даже незначительное количество HPV-генотипов может быть диагностировано точно и просто на ранней стадии перед амплификацией HPV-генотипов.

Изменения и дополнительные применения изобретения, проиллюстрированного здесь, учитываются в пределах изобретения. Изобретение дополнительно описано с помощью ссылки на следующие примеры, и, тем не менее, следует понимать, что они не подразумевают ограничение границ изобретения.

Пример 1: Получение зондов и биочипа на грануле

1-1. Получение зондов

20-27-мерные олигонуклеотидные зонды, включающие 15 тиминов (dTTP), 6 цепей (CH2) и аминогруппу, включающие на 5'-конце ген HPV L1, иммобилизуют на биочип на грануле, включенный в набор для детектирования.

В Таблице 1 показаны разнообразные зонды, используемые для детектирования HPV-генотипов.

Таблица 1
Зонд 1 тип 16 5'-TGTGCTGCCATATCTACTTCAGA-3' (SEQ ID NO: 1)
Зонд 2 тип 18 5'- AGTCTCCTGTACCTGGGCAA-3' (SEQ ID NO: 2)
Зонд 3 тип 31 5'-GTGCTGCAATTGCAAACAGT-3' (SEQ ID NO: 3)
Зонд 4 тип 33 5'-TGCACACAAGTAACTAGTGACAGTACA-3' (SEQ ID NO:4)
Зонд 5 тип 35 5'-CTGTGTGTTCTGCTGTGTCTTCT-3' (SEQ ID NO: 5)
Зонд 6 тип 39 5'-TTCCATACCTTCTACATATGATCCTTC-3' (SEQ ID NO:6)
Зонд 7 тип 52 5'-GCTGAGGTTAAAAAGGAAAGCA-3' (SEQ ID NO: 7)
Зонд 8 тип 45 5'-CACAAAATCCTGTGCCAAGT-3' (SEQ ID NO: 8)
Зонд 9 тип 51 5'-ATTAGCACTGCCACTGCTGC-3' (SEQ ID NO: 9)
Зонд 10 тип 59 5'-TTCTGTGTGTGCTTCTACTACTTCTTC-3' (SEQ ID NO: 10)
Зонд 11 тип 53 5'-CCGCAACCACACAGTCTATG-3' (SEQ ID NO: 11)
Зонд 12 тип 54 5'-CATCCACGCAGGATAGCTTT-3' (SEQ ID NO: 12)
Зонд 13 тип 56 5'-CAGTTAAGTAAATATGATGCACGAAAA-3' (SEQ ID NO: 13)
Зонд 14 тип 58 5'-TGCACTGAAGTAACTAAGGAAGG-3' (SEQ ID NO: 14)
Зонд 15 тип 66 5'-AACTAAATATGATGCCCGTGAAA-3' (SEQ ID NO: 15)
Зонд 16 тип 68 5'-TCAGCTGTACCAAATATTTATGATCC-3' (SEQ ID NO: 16)
Зонд 17 тип 06 5'-GCATCCGTAACTACATCTTCCA-3' (SEQ ID NO: 17)
Зонд 18 тип 11 5'-TGTGCATCTGTGTCTAAATCTGC-3 ' (SEQ ID NO: 18)
Зонд 19 тип 34 5'-TCCACAAGTACAACTGCACCA-3' (SEQ ID NO: 19)
Зонд 20 тип 40 5'-CCCACACCAACCCCATATAA-3' (SEQ ID NO: 20)
Зонд 21 тип 42 5'-CCACTGCAACATCTGGTGAT-3' (SEQ ID NO: 21)
Зонд 22 тип 43 5'-CTGACCCTACTGTGCCCAGT-3' (SEQ ID NO: 22)
Зонд 23 тип 44 5'-CACTACACAGTCCCCTCCGT-3' (SEQ ID NO: 23)
Зонд 24 тип 70 5'-TGCACCGAAACGGCCATAC-3' (SEQ ID NO: 24)
Зонд 25 любой 5'-TTTGTTACTGTTGTAGATACTACCCGTAGCAC-3' (SEQ ID NO: 25)
Зонд 26 GAPDH 5'-AATCCCATCACCATCTTCCA-3' (SEQ ID NO: 26)

1-2. Получение биочипа на грануле

Биочип на грануле получают с помощью прикрепления к гранулам (xMAP карбоксилированных микросфер, доступных от фирмы Luminex Corporation, Austin, TX) соответствующих праймеров.

1. Каждый из зондов, полученных в Примере 1-1, растворяют в воде до концентрации 100 мкМ.

2. Гранулы хорошо смешивают до гомогенного состояния и каждые 40 мкл переносят в свежую пробирку.

3. 2 мкл праймера, полученного и смешанного с 20 мкл буфера 0,1M MES (pH 4,5), смешивают с определенной гранулой, в зависимости от типа зонда.

4. 1 мкл свежеприготовленного раствора 1-этил-3-(3-диметиламинопропил)-карбодиимид гидрохлорида (EDC) (Pierce, Rockford, IL) в концентрации 10 мг/мл добавляют к смеси микросферы и зонда.

5. Пробирку с полученной в результате смесью активно перемешивают в течение примерно 30 минут в темноте для активации реакции.

6. Следом за активацией реакции 1 мкл свежеприготовленного раствора EDC в концентрации 10 мг/мл дополнительно добавляют в пробирку с полученной в результате смесью, с последующей реакцией в течение примерно 20 минут.

7. Затем 500 мкл 0,02% раствора Tween-20 добавляли в каждую пробирку и хорошо смешивали.

8. Гранулу в каждой пробирке центрифугировали для удаления супернатанта из пробирки, и дополнительно добавляли в пробирку 500 мкл 0,1% раствора додецилсульфата натрия (SDS) с последующим хорошим перемешиванием.

9. Гранулу в каждой пробирке центрифугировали снова для удаления супернатанта из пробирки.

10. Полученную в результате гранулу растворяли в 150 мкл буфера TE (pH 8,0) и хранили при 4°C в темноте.

Пример 2: Анализ HPV-генотипов с применением биочипа на грануле

2.1. Выделение ДНК из образцов

С целью выделения ДНК из образцов, клетки шейки матки, полученные из образцов с использование ватного валика, растворяли в 400 мкл лизирующего буфера и инкубировали в 10 мкл протеиназы К (20 мг/мл), с последующей дополнительной реакцией в течение примерно 15 минут в кипящей воде.

2.2. ПЦР-Амплификация гена HPV L1 и гена GAPDH в образце ДНК

С целью детектирования и анализа HPV-генотипов, 5 мкл ДНК, полученной в Примере 2-1, использовали в качестве матрицы. Первую ПЦР-амплификацию гена HPV осуществляли в присутствии набора праймеров для HPV в количестве 0,4 мкM, набора праймеров для GAPDH в количестве 0,1 мкM, в присутствии 0,1 мM dNTP-микса, 75 мM Tris HCl (pH 9,0), 20 мM MgCl2, 50 мM KCl, 20 мM (NH4)2SO4, и 1,5 единицы Taq-полимеразы (Ultratools, Spain). Праймеры, которые здесь использовались, имеют следующие основные последовательности:

Набор праймеров для HPV

YBT L1 F: 5'- gcmcagggwcayaayaatgg - 3' (SEQ ID NO: 27)

GP6-1: 5'- aataaactgtaaatcatattcctc - 3' (SEQ ID NO: 28)

Набор праймеров для GAPDH

GAPDH F: 5'- gagtcaacggatttggtcgt -3' (SEQ ID NO: 29)

GAPDH R: 5'- ttgattttggagggatctcg -3' (SEQ ID NO: 30)

Применяли следующие условия для реакции ПЦР.

Следует заметить, что за стадией денатурации, которая продолжалась 5 минут при 95°C, следовали 40 циклов амплификации в ПЦР-термоциклере (Master Cycler; Eppendorf, Hamburg Germany). Каждый цикл включал стадию денатурации при 95°C в течение 30 секунд, стадию отжига при 50°C в течение 30 секунд и стадию элонгации при 72°C в течение 30 секунд. Конечная стадия элонгации продолжалась в течение дополнительных 7 минут.

2-3. Мечение посредством 2-го одноцепочечного ПЦР

Для идентификации HPV-типа, ПЦР-продукт, полученный в Примере 2-2, в настоящем изобретении, продукты амплификации метят посредством 2-го одноцепочечного ПЦР мечения. С целью мечения продукта амплификации, использовали 2 мкл ПЦР-продукта и одноцепочечную линейную ПЦР-амплификацию осуществляли в присутствии 0,5 мкM обратного праймера для HPV (SEQ ID NO: 28), 0,5 мкM обратного праймера для GAPDH (SEQ ID NO: 30), 50 мкM микса dATP, dGTP и dTTP, 20 мкM биотин-dCTP (Invitrogen), 75 мM Tris HCl (pH 9,0), 20 мM MgCl2, 50 мM KCl, 20 мM (NH4)2SO4, 1 единицы Taq-полимеразы (Ultratools, Spain).

Применяли следующие условия для реакции ПЦР.

Следует заметить, что за стадией денатурации, которая продолжалась 5 минут при 95°C, следовали 35 циклов амплификации в ПЦР-термоциклере (Master Cycler; Eppendorf, Hamburg Germany). Каждый цикл включал стадию денатурации при 94°C в течение 30 секунд, стадию отжига при 60°C в течение 30 секунд и стадию элонгации при 72°C в течение 1 минуты.

2-4. Гибридизация с применением биочипа на грануле

Каждый из образцов, полученных в Примерах 2-1, 2-2 и 2-3, растворяли в 2X PnE гибридизационном буфере (YeBT, Co.) и гибридизовали с применением биочипа на грануле, полученного в Примере 1-2. После гибридизации давали время пройти реакции в течение 5 минут при 95°C и 30 минут при 40°C. После проведения реакций каждый образец переносили в 96-луночный фильтровальный планшет вместе с гранулой с последующей промывкой 3 раза с использованием гибридизационного буфера TM. После промывки образец перемешивали в 100 мкл разведенного в 500 раз раствора флуоресцентного конъюгата стрептавидин-фикоэритрин (SAPE) (SigmaAldirich, S3402) в течение 15 минут в темноте.

2-5. Детектирование сигнала на биочипе на грануле

Интенсивность сигнала гибридизовавшегося ампликона для каждой лунки измеряли с помощью прибора Luminex 100. Прибор Luminex 100, использующий два лазера, один показывает номер гранулы, и другой показывает количество фикоэритрина, вступившего в реакцию. Во время сканирования 2 6 типов гранул в целом каждый HPV-генотип может быть определен как значение индекса средней флуоресценции (MFI).

Пример 3: Результаты анализа HPV-генотипов с использованием образцов пациентов

Гибридизационную смесь, которую получили путем смешивания гранул и гибридизационного раствора, добавляли к каждому меченому продукту образца. После гибридизации и стадии промывки гибридизовавшиеся образцы и стрептавидин-фикоэритрин вместе вступали в реакцию. Это количество сигнала флуоресценции (фикоэритрин) рассчитывали с помощью прибора для биочипа на грануле.

Как подтверждалось с помощью результата анализа, образец пациента был инфицирован HPV-типом 16. Также подтверждалось, что амплификация GAPDH была проведена успешно, что предполагает отсутствие ошибок ПЦР. Как показано на фиг.1, также детектировался любой зонд для идентификации HPV-инфекции.

Пример 4: Результаты анализа HPV-генотипа со множеством инфекций

Результаты анализа, показанные на фиг.2, подтверждали, что образец пациента был ассоциирован со множеством инфекций HPV-генотипа типов 35, 39 и 67.

Применимость в промышленности

Как описано выше, зонды для детектирования и способ согласно настоящему изобретению могут определять тип папилломавируса человека (HPV) с высокой чувствительностью и точностью. Кроме того, настоящее изобретение дает возможность детектирования редкой(их) HPV-инфекции(й) в отсутствии специфичного зонда, но в присутствии любого (ANY) зонда упрощенным способом. Более того, согласно настоящему изобретению, возможно подтвердить, являются ли отрицательные результаты точными или нет с помощью сигнала GAPDH.

1. Набор праймеров для амплификации гена L1 папилломавируса человека (HPV), имеющих последовательности нуклеиновой кислоты SEQ ID NO:27 и 28.

2. Набор для детектирования генотипа папилломавируса человека (HPV), включающий:
набор праймеров по п.1;
один или более зондов для детектирования HPV-генотипа, выбранные из последовательностей нуклеиновой кислоты SEQ ID NO:1-24, или зонда для детектирования HPV-генотипа, имеющего последовательность нуклеиновой кислоты SEQ ID NO:25; и
фикоэритрин, связанный со стрептавидином.

3. Способ детектирования генотипов папилломавируса человека (HPV), включающий:
(1) осуществление первичной ПЦР-амплификации гена HPV L1 в анализируемом образце с использованием набора из прямого и обратного праймеров, специфичных для участка гена L1, имеющих последовательности нуклеиновых кислот SEQ ID NO:27 и 28;
(2) осуществление вторичной ПЦР-амплификации продукта первичной ПЦР-амплификации гена L1 с использованием обратного праймера, имеющего последовательность нуклеиновой кислоты SEQ ID NO:28, с получением меченого биотином одноцепочечного гена L1;
(3) осуществление реакции гибридизации продукта вторичной ПЦР-амплификации, меченого биотином одноцепочечного гена L1 с одним или более зондов для детектирования HPV-генотипа, выбранных из последовательностей нуклеиновой кислоты SEQ ID NO:1-24 или зонда для детектирования HPV-генотипа, имеющего последовательность нуклеиновой кислоты SEQ ID NO:25;
(4) проведение реакции продукта реакции гибридизации с фикоэритрином, связанным со стрептавидином; и
(5) измерение уровня флуоресцентного вещества;
(6) идентификацию зондов в продукте реакции гибридизации для идентификации HPV-генотипа; и
(7) определение генотипа HPV и уровня его присутствия в соответствии с зондами и уровнем флуоресцентного вещества.

4. Способ по п.3, в котором для получения меченого биотином одноцепочечного гена L1, осуществляют вторичную ПЦР-амплификацию в присутствии меченых биотином dNTP.

5. Способ по п.3, в котором зонд связан с карбоксилированной микросферой.

6. Способ детектирования генотипов папилломавируса человека (HPV), включающий:
(1) осуществление первичной ПЦР-амплификации гена HPV L1 и гена GAPDH в анализируемом образце с использованием набора из прямого и обратного праймеров, специфичных для гена L1, имеющих последовательности нуклеиновой кислоты SEQ ID NO:27 и 28, и набора из прямого и обратного праймеров, специфичных для гена GAPDH, имеющих последовательности нуклеиновой кислоты SEQ ID NO:29 и 30;
(2) осуществление вторичной ПЦР-амплификации продуктов первичной ПЦР-амплификации гена L1 с использованием обратного праймера, имеющего последовательность нуклеиновой кислоты SEQ ID NO:28, и гена GAPDH с использованием обратного праймера, имеющего последовательность нуклеиновой кислоты SEQ ID NO:30, с получением меченого биотином одноцепочечного гена L1;
(3) одновременное осуществление реакций гибридизации обоих продуктов вторичной ПЦР-амплификации, меченых биотином одноцепочечных гена L1 с одним или более зондов для детектирования HPV-генотипа, выбранных из последовательностей нуклеиновой кислоты SEQ ID NO:1-24, и зонда для детектирования HPV-генотипа, имеющего последовательность нуклеиновой кислоты SEQ ID NO:25, и гена GAPDH с GAPDH-специфичным зондом, имеющим последовательность нуклеиновой кислоты SEQ ID NO:26 соответственно;
(4) осуществление реакции продуктов реакции гибридизации с фикоэритрином, связанным со стрептавидином; и
(5) измерение уровня флуоресцентного вещества;
(6) идентификацию зондов в продукте реакции гибридизации для идентификации HPV-генотипа; и
(7) определение генотипа HPV и уровня его присутствия в соответствии с зондами и уровнем флуоресцентного вещества.

7. Способ по п.6, в котором для получения меченого биотином одноцепочечного гена L1 осуществляют вторичную ПЦР-амплификацию в присутствии меченых биотином dNTP.

8. Способ по п.6, в котором зонд связан с карбоксилированной микросферой.



 

Похожие патенты:
Изобретение относится к биотехнологии и может быть использовано для прогнозирования возможности эпидемий. .

Изобретение относится к области медицины и касается новых мутаций, комбинаций мутаций или мутационных профилей генов обратной транскриптазы ВИЧ-1 и/или протеазы, коррелирующих с фенотипической резистентностью к лекарственным средствам против ВИЧ.
Изобретение относится к области медицины, медицинской токсикологии, микробиологии, биологии. .

Изобретение относится к микробиологии. .

Изобретение относится к биотехнологии, лазерной технике и медицине. .

Изобретение относится к биотехнологии. .

Изобретение относится к области биотехнологии, в частности к синтетическим олигонуклеотидным праймерам для выявления субгенотипов 1а и 1b вируса вирусной диареи болезни слизистых оболочек крупного рогатого скота (ВД-БС КРС) и к способу применения синтетических олигонуклеотидных праймеров для выявления субгенотипов 1а и 1b вируса вирусной диареи болезни слизистых оболочек крупного рогатого скота.

Изобретение относится к биотехнологии. .

Изобретение относится к медицине, в частности к терапии и фармакологии, в частности к фармакогенетическому анализу, и касается выявления генетических полиморфизмов, являющихся маркерами эффективности алискирена в качестве антигипертензивного агента.

Изобретение относится к биоинформационным методам идентификации белков и пептидов по геномным базам данных. .
Изобретение относится к ветеринарной медицине, в частности к способам контроля инфицированности сельскохозяйственной птицы бактериальными инфекциями. .
Изобретение относится к биотехнологии, а именно к способу получения плазмидной ДНК из бактериальных клеток. .
Наверх