Дезоксирибозим для ингибирования репродукции вируса гриппа а



Дезоксирибозим для ингибирования репродукции вируса гриппа а
Дезоксирибозим для ингибирования репродукции вируса гриппа а
Дезоксирибозим для ингибирования репродукции вируса гриппа а

 

C12N15 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2412248:

Федеральное государственное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (ФГУН ГНЦ ВБ "Вектор" Роспотребнадзора) (RU)

Изобретение относится к области биотехнологии, а именно к противовирусным средствам на основе ген-направленных каталитически активных нуклеиновых кислот. Изобретение предназначено для ингибирования репродукции вирусов гриппа А в инфицированных эукариотических клетках при помощи вирусспецифического каталитически активного олигодезоксирибонуклеотида (дезоксирибозима). Техническим результатом предлагаемого изобретения является расширение спектра противовирусного действия дезоксирибозимов и повышение их противовирусной активности. Указанный технический результат достигается получением дезоксирибозима, состоящего из нуклеотидной последовательности:

5'-GAAATAAGAGGCTAGCTACAACGACCTTCATTA, который предназначен для ингибирования репродукции вирусов гриппа А. 3 ил., 1 табл.

 

Изобретение относится к областям молекулярной биологии, медицины и ветеринарии, а именно к противовирусным средствам на основе ген-направленных каталитически активных нуклеиновых кислот. Изобретение предназначено для ингибирования репродукции вирусов гриппа А в инфицированных эукариотических клетках при помощи вирусспецифического каталитически активного олигодезоксирибонуклеотида (дезоксирибозима).

В настоящее время известно, что наиболее эффективными противогриппозными препаратами считаются Тамифлю (озельтамивир) производства Hoffman-La Roche Inc. (Швейцария) и Реленза (занамивир) производства GlaxoSmithKline Inc. (Великобритания). Данные препараты относятся к низкомолекулярным ингибиторам вирусных нейраминидаз. Нужно отметить, что до сих пор трудно сделать окончательные выводы о степени их лечебной и профилактической активности. Известно, например, что данные препараты малоэффективны спустя двое суток после инфицирования организма. Более того, уже в 2004-2006 гг. у ряда больных гриппом птиц подтипа H5N1 в Юго-Восточной Азии были зафиксированы случаи устойчивости к Тамифлю и Релензе [Hurt A.C., Selleck P., Komadina N., Shaw R., Brown L., Barr I.G. Susceptibility of highly pathogenic A(H5N1) avian influenza viruses to the neuraminidase inhibitors and adamantanes // Antivir. Res. - 2007. - V.73. - P.228-231]. Важно также отметить, что заявляемый ген-направленный препарат может быть быстро реориентирован на любой вновь возникший штамм вируса гриппа (включая мутантные лекарственно устойчивые формы), в то время как поиск новых эффективных низкомолекулярных химических соединений занимает, как правило, годы.

В последние годы значительное развитие получили работы по созданию новых терапевтических средств, в том числе противовирусных, основанных на применении адресованных молекул нуклеиновых кислот (как нативных, так и химически модифицированных) - антисмысловых олигонуклеотидов, рибозимов (РНКзимов), дезоксирибозимов (ДНКзимов), аптамеров и малых интерферирующих РНК (siPHK), способных селективно подавлять экспрессию определенных генов, ингибировать активность определенных ферментов, либо выполнять другие специфические функции. Многочисленные исследования на различных модельных системах подтвердили перспективность этого принципа, а два олигонуклеотидных препарата уже вышли на фармацевтический рынок - фосфотиилированный антисмысловой олигонуклеотид Vitravene® (ISIS Pharmaceuticals Inc.) для лечения ретинитов, вызванных цитомегаловирусной инфекцией, и фосфотиилированный аптамер Macugen® (OSI Pharmaceuticals Inc.) для лечения влажной формы сенильной макулодистрофии за счет блокирования действия фактора роста сосудистого эндотелия (VEGF-фактора).

Как известно, принцип действия антисмысловых олигонуклеотидов состоит в образовании ДНК/РНК-гибридов с комплементарными участками целевой мРНК, что приводит или к расщеплению мРНК клеточной РНКазой Н или к блокированию трансляции мРНК. Преимуществом РНК- и ДНКзимов (нуклеозимов) над обычными антисмысловыми олигонуклеотидами является то, что они представляют собой молекулы РНК или ДНК с характерной вторичной структурой, обладающие той или иной собственной каталитической активностью, в том числе способностью расщеплять комплементарные последовательности РНК. В отличие от существующих в природе РНКзимов, природные ДНКзимы пока не известны. В то же время искусственные как РНК-, так и ДНКзимы могут быть получены путем селекции in vitro [Wilson D.S., Szostak J.W. In vitro selection of functional nucleic acids // Annu. Rev. Biochem. - 1999. - V.68. - P.611-647; Joyce G.F. Directed evolution of nucleic acids enzymes // Annu. Rev. Biochem. - 2004. - V.73. - P.791-836]. В последние 10 лет было идентифицировано много РНК-расщепляющих нуклеозимов, некоторые из которых отличаются высокой каталитической скоростью, большим числом оборотов и способностью расщеплять широкий набор РНК-субстратов. [Feldman A.R., Sen D. A new and efficient DNA enzyme for the sequence-specific cleavage of RNA // J. Mol. Biol. - 2001. - V.313. - P.283-294; Silverman S.K. Nucleic acid enzymes (ribozymes and deoxyribozymes): in vitro selection and application / In: Wiley encyclopedia of chemical biology, 2008, John Wiley & Sons, Inc.].

В сравнении с РНКзимами, несомненным преимуществом ДНКзимов является их существенно более высокая устойчивость к действию сывороточных и клеточных нуклеаз in vivo. Наиболее эффективным из известных является ДНКзим типа «10-23», полученный методом SELEX [Santoro S.W., Joyce G.F. A general purpose RNA-cleaving DNA enzyme. (1997) Proc. Nat. Acad. Sci. USA, 94, 4262-4266]. ДНКзим представляет собой дезоксирибонуклеотидную последовательность Nn-RGGCTAGCTACAACGA-Nn, состоящую из центрального 15-звенного каталитически активного мотива «10-23», фланкированного двумя РНК-узнающими последовательностями. Катализируемая ДНКзимом типа «10-23» реакция не требует ионов металлов или иных дополнительных кофакторов и заключается в расщеплении фосфодиэфирной связи в РНК с образованием 2',3'-циклофосфата и 5'-гидроксильной группы. Авторы отмечают, что скорость реакции (kcat) для ДНКзима «10-23» в 104 раз меньше по сравнению с природными белковыми рибонуклеазами (например, РНКазой А), однако величина константы Михаэлиса (Km) также меньше в 105 раз. Таким образом, по стандартному критерию коэффициента специфичности реакции (kcat/Km) данный ДНКзим - даже более эффективный реагент для расщепления РНК, чем белковая РНКаза. Субстратная РНК может расщепляться по минимальному сайту Nn-R↓Y-Nn, где R - А или G, a Y - U или С, однако существенно более эффективно расщепляются дуплеты А↓U и G↓U [Cairns M.J., King A., Sun L.-Q. Optimisation of the 10-23 DNAzyme-substrate pairing interactions enhanced RNA cleavage activity at purine-cytosine target sites. (2003) Nucleic Acids Research, 31, 2883-2889]. От РНК-узнающих последовательностей ДНКзима зависят как специфичность и стабильность комплексов ДНКзим-РНК, так и скорость «освобождения» дезоксирибозима из комплекса с продуктами расщепления РНК. Следовательно, их длины и состав должны обеспечивать оптимальный баланс этих параметров и, в зависимости от решаемой задачи, могут варьировать от 6 до 10 и более нуклеотидов. Каталитическая активность ДНКзима in vivo диктуется также вторичной и третичной структурой целевой высокомолекулярной природной РНК, а именно стерической доступностью мишенных РНК-последовательностей, что, как правило, определяется экспериментально методом скрининга активности большого набора ДНКзимов [Caims M.J., Lun-Quan Sun L.-Q. Target-site selection for the 10-23 DNAzyme // Methods Mol. Biol. - 2004. - V.252. - P.267-277].

Растущее число публикаций описывает эффективное подавление нуклеозимами экспрессии генов, вызывающих инфекционные и онкологические заболевания, заболевания нервной и сердечно-сосудистой систем [Silverman S.K. In vitro selection, characterization, and application of deoxyribozymes that cleave RNA // Nucleic Acids Res. - 2005. - V.33. - P. 6151-6163; Bhindi R., Fahmy R.G., Lowe H.C. et al. DNA Enzymes, short interfering RNA, and emerging wave of small-molecule nucleic acid-based gene-silencing strategies // Am. J. Path. - 2007. - V.171. - P.1079-1088; Zhang G. Dass C.R. Sumithran E., Di Girolamo N., Sun L.Q., Khachigian L.M. Effect of deoxyribozymes targeting c-Jun on solid tumor growth and angiogenesis in rodents // J. Natl. Cancer Inst. - 2004. - V.96. - P.683-696]. Следует отметить также отсутствие токсичности в клеточных культурах и побочных эффектов у животных [Dass C.R. Preclinical anticancer activity of DNA-based cleavage molecules // Drug Dev. Ind. Pharm. - 2006. - V.32. - P.1-5.].

Наиболее близкими аналогами к заявляемому объекту изобретения являются работа японских исследователей [Toyoda Т., Imamura Y., Takaku H., Kashiwagi Т., Hara K., Iwahashi J., Ohtsu Y., Tsumura N., Kato H., Hamada N. Inhibition of influenza virus replication in cultured cells by RNA-cleaving DNA ezyme // FEBS Lett. - 2000. - V.481. - P.113-116] и их соотечественников (прототип) [Takahashi H., Hamazaki H., Habu Y., Hayashi M., Abe Т., Miyano-Kurosaki N., Takaku H. A new modified DNA enzyme that targets influenza virus A mRNA inhibits viral infection in cultured cells // FEBS Lett. - 2004. - V.560. - P.69-74]. Авторы разработали ДНКзим (PB2Dz), содержащий каталитический мотив «10-23» и адресованный к участку инициации трансляции мРНК гена РВ2 штамма вируса гриппа человека A/Puerto Rico/8/34(H1N1), и его производные варианты, включающие укороченные РНК-узнающие последовательности или концевые N3'-P5' фосфорамидатные и 2'-O-метильные модификации. Авторы изучили активность ДНКзима PB2Dz и его модифицированных вариантов на модельной РНК-мишени in vitro, изучили их устойчивость к воздействию сывороточных нуклеаз в присутствии 10% фетальной сыворотки крупного рогатого скота, а также их противовирусный эффект в отношении вируса гриппа A/Puerto Rico/8/34(H1N1) на модели инфицированных клеток MDCK. В качестве реагента для трансфекции клеток использовали реактивы липофектин (Lifetech Oriental) или DOTAP (Roche). Титр вируса определяли методом БОЕ. При множественности заражения в диапазоне 0.01-0.1 авторам в своих экспериментах удавалось за счет трансфекции ДНКзимом инфицированных клеток получить ~100-150 кратное снижения титра вируса. На основании полученных результатов авторы заключили, что ДНКзимы потенциально полезны как реагенты для контроля репликации вируса гриппа А.

К недостаткам ДНКзима PB2Dz в качестве потенциального противогриппозного препарата относится следующее.

1) Узкий спектр противовирусного действия ДНКзима, адресованного к неконсервативному участку инициации трансляции мРНК гена РВ2 конкретного штамма вируса гриппа (A/Puerto Rico/8/34(H1N1)). При использовании других штаммов гриппа А РНК-узнающие последовательности ДНКзима, как правило, необходимо корректировать.

2) ДНКзим проявляет относительно невысокую противовирусную активность, снижая титр целевого вируса A/Puerto Rico/8/34(H1N1) не более чем на два порядка. При использовании других штаммов гриппа А данный показатель может только ухудшиться.

Техническим результатом предлагаемого изобретения является расширение спектра противовирусного действия дезоксирибозимов и повышение их противовирусной активности.

Указанный технический результат достигается получением дезоксирибозима, состоящего из нуклеотидной последовательности:

5'-GAAATAAGAGGCTAGCTACAACGACCTTCATTA, который предназначен для ингибирования репродукции вирусов гриппа А.

На фиг.1 представлена структура нуклеотидной последовательности заявляемого дезоксирибозима (dzNP-1500+). На фиг.2 представлена структура ДНКзима типа «10-23» в комплексе с РНК-субстратом. На фиг.3 приведена схема катализируемой дезоксирибозимом реакции расщепления РНК с образованием 2',3'-циклофосфата и 5'-гидроксильной группы.

Пример 1. Методика получения заявляемого дезоксирибозима

В результате исследований проведен сравнительный анализ геномных последовательностей ряда штаммов вирусов гриппа А подтипов H5N1, H3N2 и H1N1. Были выявлены консервативные нуклеотидные фрагменты в пяти наиболее консервативных и функционально значимых для вирусной репликации сегментах вирусных РНК (РВ2, РВ1, PA, NP и М) и определены потенциальные сайты их расщепления высокоэффективными ДНКзимами типа «10-23». Структура ДНКзимов этого типа приведена на фиг.2, а на фиг.3 - схема катализируемой ими реакции расщепления РНК. В результате был сконструирован и синтезирован по стандартной схеме с использованием фосфорамидитов заявляемый вирусспецифический ДНКзим длиной 33 нуклеотидных звена со следующей структурой (фиг.1):

5'-GAAATAAGAGGCTAGCTACAACGACCTTCATTA

Заявляемый дезоксирибозим представляет собой 33-звенный ДНКзим (обозначаемый далее как dzNP-1500+) и предназначен для расщепления гриппспецифических 19-звенных РНК-последовательностей:

5'-UAAUGAAGGA↓UCUUAUUUC и

5'-UAAUGAAGGG↓UCUUAUUUC.

Заявляемый ДНКзим (dzNP-1500+) состоит из центрального 15-звенного каталитического мотива «10-23», фланкированного двумя 9-звенными РНК-узнающими последовательностями. Вирусспецифические РНК-узнающие последовательности ДНКзима dzNP-1500+адресованы к наиболее протяженному консервативному участку пятого сегмента генома вирусов гриппа А, кодирующего нуклеопротеин NP. В ассоциации с сегментами РНК этот высококопийный белок формирует вирусные рибонуклеопротеиды является структурным компонентом вирусной РНК-зависимой РНК-полимеразы, играет центральную роль в процессе внедрения генетической информации вируса в ядро инфицированной клетки и необходим для последующей сборки новых вирионов. Выбранный в качестве мишени для расщепления консервативный участок 5-го сегмента почти инвариантен для большинства штаммов вирусов гриппа А, включая штаммы актуальных подтипов H3N2 человека, H1N1 человека, H5N1 птиц и H1N1 свиней. Это определяет потенциально широкий спектр противогриппозного действия dzNP-1500+, который катализирует расщепление образующихся в ходе репликации вируса комплементарной (+)РНК и мРНК 5-го сегмента генома вирусов гриппа А. Расщепление фосфодиэфирной связи происходит по 3'-концу рибонуклеотида (А или G) в позиции 1500 комплементарной (+)РНК и по 3'-концу соответствующего рибонуклеотида в мРНК.

В предлагаемом изобретении, как и в ближайшем аналоге (прототипе), также представляющем собой ДНКзим, описанные недостатки прототипа устранены следующим образом. Задача расширения спектра противовирусного действия решалась при помощи сравнительного анализа геномных последовательностей ряда штаммов вирусов гриппа А птиц, человека и свиней подтипов H5N1, H3N2 и H1N1 (включая грипп свиней 2009 г.). Были определены консервативные нуклеотидные фрагменты необходимой длины (не менее 19 нуклеотидов) в пяти наиболее консервативных и функционально значимых для вирусной репликации сегментах РНК вирусов гриппа А (РВ2, РВ1, PA, NP и М) и определены возможные сайты их расщепления ДНКзимами типа «10-23». Задача повышения противовирусного действия решалась методом отбора наиболее активных вариантов по результатам скрининга противовирусной активности более сорока ДНКзимов, адресованных к различным выявленным консервативным участкам генома вирусов гриппа А.

Пример 2. Исследование противовирусной активности дезоксирибозимов

Для оценки противовирусной активности использовали культуру клеток MDCK из коллекции культур клеток ФГУН ГНЦ ВБ «Вектор» Роспотребнадзора и штамм вируса гриппа птиц A/chicken/Kurgan/05/2005 (H5N1) из коллекции микроорганизмов ФГУН ГНЦ ВБ «Вектор» Роспотребнадзора. При работе с вирусом гриппа А соблюдались требования по технике безопасности для работ с микроорганизмами 3-4 групп патогенности согласно СП 1.3.2322-08.

Клетки MDCK выращивали в 96-луночных планшетах 1-1,5 сут до образования монослоя на среде RPMI-1640 (Биолот, Россия) в присутствии 5% фетальной сыворотки крупного рогатого скота с добавлением пенициллина (100 МЕ/мл) и стрептомицина (100 мкг/мл). Наработку и титрование вируса производили на 10-суточных развивающихся куриных эмбрионах. Концентрация вируса в вирусаллантоисной жидкости (ВАЖ) составляла 8,0 lgЭИД50/мл (50% эмбриональных инфицирующих доз в мл). Готовили разведения ВАЖ от 1 до 6 с 10-кратным шагом с использованием среды RPMI-1640, содержащей 2 мкг/мл трипсина. Разведения вируса вносили на культуру клеток в объеме 100 мкл/лунку. Через 12-14 ч на клетки вносили 100 мкл питательной среды RPMI-1640/лунку, содержащей исследуемый препарат: ДНКзим, связанный с трансфецирующим агентом (липофектин, Invitrogen, США), с конечной концентрацией 10 мкМ. Затем клетки инкубировали 3 сут при температуре +37°C в атмосфере 5% СО2. Через 3 сут в каждой лунке с помощью инвертированного микроскопа регистрировали ЦПД в монослое клеток, после чего определяли наличие вируса в среде культивирования по реакции гемагглютинации с 0,5% эритроцитами петуха.

Скрининг противовирусной активности проводился на модели клеток MDCK, инфицированных высокопатогенным штаммом вируса гриппа птиц A/chicken/Kurgan/05/2005(H5N1), с использованием липофектина (Invitrogen, США) в качестве трансфецирующего агента для доставки ДНКзимов в культуру эукариотических клеток. В качестве контроля использовали вариант ДНКзима PB2Dz (прототип) японских авторов, где РНК-узнающие последовательности заменой двух нуклеотидов были скорректированы под используемый штамм вируса гриппа птиц A/chicken/Kurgan/05/2005(H5N1). В наших экспериментах контрольный вариант ДНКзима PB2Dz также проявил противовирусную активность. В зависимости от условий эксперимента достигалось 50-100-кратное снижение титра вируса.

Таблица 1
Результаты оценки противовирусной активности ДНКзимов (10 мкМ) на модели клеток MDCK, инфицированных вирусом гриппа птиц A/chicken/Kurgan/05/2005 (H5N1), в присутствии липофектина.
Образец 5'-последовательность-3' ДНКзима Титр вируса,
lg ТЦД50/мл
Контроль вируса - 6.50
1. dzNP-1500+(заявляемый) GAAATAAGAGGCTAGCTACAACGACCTTCATTA 3.25
2. dzPB2-28+(прототип) TTCTCTCCAGGCTAGCTACAACGAATTGAATAT 4.75
3. dzPB2-2287+(аналог) CCATCCGAAGGCTAGCTACAACGATCTTTTGGT 4.00
4. dzPA-2092+(аналог) ACTCCTCAAGGCTAGCTACAACGATGCTTCATA 5.00
5. dzPB1-19+(аналог) CCATTCAAAGGCTAGCTACAACGAGGTTTGCCT 5.50
Примечание. Обозначение ДНКзимов: dz - ДНКзим; РВ2, РВ1, PA, NP и M обозначают мишенный сегмент РНК вируса гриппа А; цифра обозначает номер нуклеотида в полноразмерной (+)РНК сегмента вирусного генома (или комплементарного ему нуклеотида в (-)РНК сегмента), по 3'-концу которого происходит расщепление РНК ДНКзимом; (+/-) обозначают мишенную (+) или (-) цепь вирусной РНК, расщепляемой ДНКзимом; под номером 1 указан заявляемый ДНКзим (dzNP-1500+), под номером 2 указан вариант ДНКзима PB2Dz японских исследователей (прототип), а остальные с №3 по №.5 являются сравниваемыми аналогами.

Как видно из таблицы 1, большая часть ДНКзимов в той или иной мере проявляет противовирусную активность. В условиях эксперимента падение титра вируса составляет от 10 и более раз. Причем ДНКзим, являющийся предметом заявляемого изобретения, вызывал в тех же условиях не менее чем 1000-кратное снижение титра вируса.

Следует отметить, что наиболее активный заявляемый ДНКзим (dzNP-1500+) специфичен к (+)РНК 5-го сегмента вирусного генома, кодирующего нуклеопротеин NP. Данный белок играет центральную роль в процессе внедрения генетической информации вируса в ядро инфицированной клетки и необходим для его последующей репликации и сборки.

На основе заявляемого ДНКзима dzNP-1500+ может быть приготовлена противогриппозная композиция, которая включает фармацевтический носитель и/или средство для внутриклеточной доставки.

Дезоксирибозим, представляющий собой нуклеотидную последовательность
5'-GAAATAAGAGGCTAGCTACAACGACCTTCATTA, который предназначен для ингибирования репродукции вируса гриппа А.



 

Похожие патенты:

Изобретение относится к области химии и медицины и касается новых соединений, являющихся производными N-замещенного 1,4-диазабицикло[2.2.2.]октана. .

Изобретение относится к области ветеринарии и касается мутантного вируса бычьей диареи. .

Изобретение относится к области биотехнологии и вирусологии. .

Изобретение относится к биотехнологии и может быть использовано для блокирования хронических интеграционных инфекций, вызываемых вирусом иммунодефицита человека (ВИЧ), вирусом лейкоза крупного рогатого скота (BLV), вирусом иммунодефицита крупного рогатого скота (BIV), вирусом лейкоза мышей (MuLV), вирусом инфекционной анемии лошадей (EIA) и вирусом гепатита В.

Изобретение относится к области биотехнологии и медицины. .

Изобретение относится к медицинской микробиологии и может быть использовано для идентификации возбудителей болезни легионеров, выделяемых из организма больного и инфицированных объектов внешней среды.

Изобретение относится к области медицинской вирусологии. .

Изобретение относится к новым вирусным векторам. .

Изобретение относится к области диагностической медицины, а именно к молекулярной биологии. .

Изобретение относится к биотехнологии и представляет собой новые эндо-(1-4)- -D-ксиланазы мицелиального гриба Penicillium canescens. .

Изобретение относится к биотехнологии и представляет собой новые эндо-(1-4)- -D-ксиланазы мицелиального гриба Penicillium canescens. .

Изобретение относится к области биотехнологии и микробной промышленности. .

Изобретение относится к выделенному вирусу растений, названному вирус томата торрадо (ToTV), и его компонентам, а также к способам получения устойчивых к ToTV растений. .

Изобретение относится к выделенному вирусу растений, названному вирус томата торрадо (ToTV), и его компонентам, а также к способам получения устойчивых к ToTV растений. .

Изобретение относится к выделенному вирусу растений, названному вирус томата торрадо (ToTV), и его компонентам, а также к способам получения устойчивых к ToTV растений. .

Изобретение относится к области биотехнологии, в частности к набору праймеров для амплификации гена L1 папилломавируса человека (HPV), набору для детектирования генотипа папилломавируса человека (HPV) и к способам детектирования генотипов папилломавируса человека (HPV).
Наверх