Применение цитокина из семейства интерлейкина-6 для получения композиции для комбинированного введения с интерфероном-альфа



Применение цитокина из семейства интерлейкина-6 для получения композиции для комбинированного введения с интерфероном-альфа
Применение цитокина из семейства интерлейкина-6 для получения композиции для комбинированного введения с интерфероном-альфа
Применение цитокина из семейства интерлейкина-6 для получения композиции для комбинированного введения с интерфероном-альфа
Применение цитокина из семейства интерлейкина-6 для получения композиции для комбинированного введения с интерфероном-альфа
Применение цитокина из семейства интерлейкина-6 для получения композиции для комбинированного введения с интерфероном-альфа
Применение цитокина из семейства интерлейкина-6 для получения композиции для комбинированного введения с интерфероном-альфа
Применение цитокина из семейства интерлейкина-6 для получения композиции для комбинированного введения с интерфероном-альфа

 


Владельцы патента RU 2413529:

ПРОЙЕКТО ДЕ БИОМЕДИСИНА СИМА, С.Л. (ES)

Изобретение относится к медицине и фармакологии и представляет собой применение по меньшей мере одного цитокина семейства ИЛ-6, для получения фармацевтической композиции, предназначенной для комбинированного введения по меньшей мере с одним ИФН-α для лечения вирусных заболеваний, при этом указанный цитокин выбран из онкостатина М, кардиотрофина-1 и их комбинаций. Изобретение обеспечивает преодоление ингибирующего действия ВГС на фосфорилирование STAT3, которое происходит, когда клетки инкубируют только с одним ИНФ-α или с одним цитокином семейства ИЛ-6 (например, КТ-1 или ОСМ), повышение индукции интерферон чувствительных генов (ИЧГ), например, 2'-5'-олигоаденилатсинтазы (2'-5'ОАС), и повышение уровней STAT1 и STAT3, по сравнению с клетками, которые инкубируются с одним цитокином, и более эффективное ингибирование репликации вируса, чем при использовании одного цитокина, а так же проявление сильного синергетического взаимодействия ИФН-α и КТ-1, или ИФН-α и ОСМ. 4 н. и 34 з.п. ф-лы, 3 табл., 5 ил.

 

Настоящее изобретение относится к применению цитокина в комбинации с интерфероном для получения композиций, предназначенных для лечения вирусных заболеваний.

Уровень техники

Система интерферона (ИФН) является первой линией защиты против вирусных заболеваний у млекопитающих. Интерфероны I типа (которые включают несколько подтипов ИФН-α и ИФН-β) являются молекулами, обладающими противовирусной активностью, которые индуцируются в клетках млекопитающих в ответ на вирусные инфекции. Действие ИФН-α опосредовано взаимодействием с рецепторной мультисубъединицей на поверхности клетки, которая состоит из двух рецепторных субъединиц, рецептора 1 (IFNAR1) и рецептора 2 (IFNAR2) к ИФН-α. Идентифицирована только одна цепочечная форма IFNAR1 и обнаружены три варианта субъединицы IFNAR2: одна полноразмерная форма, IFNAR2c, и две усеченные изоформы, IFNAR2b и IFNAR2a. Вариант IFNAR2c участвует в связывании с лигандами и трансдукции сигналов, а две усеченные формы, IFNAR2b и IFNAR2a, у которых отсутствуют внутриклеточные домены, подавляют сигнал ИФН-α, вследствие конкуренции с IFNAR2c за связывание с ИФН-α.

Сигнальный каскад ИФН-α инициируется при связывании ИФН-α с рецептором. Связывание ИФН-α с рецептором приводит к активации связанных с IFNAR тирозинкиназ (Янус-киназа 1 (Jak1) и тирозинкиназа 2 (Tyk2)), которые фосфорилируют обе субъединицы, IFNAR1 и IFNAR2. После фосфорилирования посредством Tyk2 или Jak1, фосфорилированный IFNAR1 предоставляет место связывания для сигнального трансдуктора и активатора транскрипции 2 (STAT2), который содержит домен Src гомолог 2. В результате другие STAT, включая STAT1, STAT3 и STAT5, рекрутируются к рецептору для фосфорилирования и активации. Затем активированные мономеры STAT1 и STAT2 вновь высвобождаются в цитозоль, где они образуют гетеродимеры и связываются с интерферон-регулирующим фактором 9/белком р48 с образованием активного комплекса транскрипционных факторов, известного в качестве интерферон-стимулируемого генного фактора 3 (ISGF3). Этот комплекс перемещается к ядру и связывается с ИФН-стимулируемым отвечающим элементом (ISRE) с тем, чтобы инициировать транскрипцию целевых генов, включая некоторые противовирусные и иммунорегуляторные белки. ИФН-α также индуцирует образование других комплексов STAT, включая STAT1/STAT1, STAT1/STAT3 и STAT3/STAT3, которые связываются с активированной γ-последовательностью в промоторных участках чувствительных генов. В первичных гепатоцитах человека ИФН-α активирует STAT1, STAT2, STAT3 и STAT5 с последующей индукцией широкого ряда противовирусных и проапоптических генов, которые могут вносить вклад в противоопухолевую и противовирусную активность ИФН-α в печени человека.

В противоположность ИФН-α, который активирует STAT1, STAT2 и STAT3, в случае ИФН II типа (ИФН-γ) связывание с рецептором приводит к исключительному фосфорилированию STAT1 посредством Jak1 и Jak2, сопровождаемому гомодимеризацией STAT1 и ядерной транслокацией гомодимера.

Вирусные инфекции представляют большую опасность для здоровья по всему миру. Среди вирусов, которые вызывают хронические инфекции, вирусы, вызывающие гепатит В (ВГВ) и гепатит С (ВГС), важны в качестве основных этиологических факторов хронического вирусного гепатита и цирроза печени. Этими нарушениями поражены свыше 500 миллионов человек по всему миру (примерно 300 миллионов поражены ВГВ и 200 миллионов - ВГС). ВГВ вызывает хроническую инфекцию главным образом в случае наследственной передачи и у лиц с подавленным иммунитетом. С другой стороны, инфекция ВГС примечательна тенденцией перехода в большинстве случаев в хроническую форму, которая означает, что у этого вируса развиты очень эффективные механизмы, позволяющие ему избегать систему интерферона. Пациенты с хронической инфекцией ВГС и пациенты с хроническим гепатитом В не отвечают на терапию интерфероном. При хроническом гепатите В устойчивый противовирусный ответ наблюдается менее чем в 40% случаев [1]. В случае хронического гепатита С, хотя большинство пациентов, инфицированных генотипами вируса ВГС 2 или 3, проявляют устойчивый вирусологический ответ (УВО) после 24 или 28 недель комбинированной терапии с использованием пэгилированного ИФН-α и рибавирина [2], только 50% пациентов, инфицированных вирусом с генотипом 1, достигали УВО при этом терапевтическом режиме [2]. Поскольку на Западе и в Азии свыше 80% больных, инфицированных ВГС, инфицировано генотипом 1, крайне необходимы более действенные средства повышения противовирусной эффективности ИФН-α. Механизмы, обусловливающие устойчивость к ИФН-α, наблюдаемые в случае ВГС и других хронических вирусных заболеваний, еще не полностью установлены, и существует огромная потребность в разработке стратегий лечения для преодоления устойчивости к терапии с применением ИФН-α при этих заболеваниях.

Ответ на интерферон-α клеток, инфицированных вирусом, зависит от нескольких решающих факторов, включая факторы, относящиеся к вирусу, и специфические факторы, относящиеся к хозяину. Показано, что различные генные продукты ВГС модулируют ответ хозяина на терапию ИФН и оказывают влияние на тяжесть вирусного заболевания, особенно в случае гепатита. Установлено, что неструктурные (NS5A) и структурные (Е2) белки ВГС взаимодействуют с PKR, одной из ключевых молекул, вовлеченных в развитие противовирусного состояния в ответ на ИФН [3, 4]. Это может блокировать PKR, приводя к ингибированию активности ИФН в ВГС-инфицированных клетках. С другой стороны, некоторые исследования показали, что и у трансгенных мышей с ВГС и в биоптатах печени пациентов с хронической инфекцией ВГС, затрагивается сигнал STAT1, индуцируемый ИФН-α [5, 6].

Установлено, что в образцах печени, инфицированной ВГС, и в клетках печени, несущих геномный репликон ВГС (полноразмерный), наблюдается заметное снижение количества и РНК IFNAR2 и STAT3. Существенно, что активация STAT1, STAT2 и STAT3 посредством ИФН-α блокируется в клетках печени, содержащих полноразмерный репликон ВГС, что подтверждает тот факт, что репликация ВГС может блокировать сигнализацию ИФН-α в инфицированных клетках. Также интересно отметить, что активация STAT1 в этих клетках не затрагивается при их инкубировании с провоспалительной молекулой ИФН-γ, что означает, что блокирование активации STAT1, индуцируемое ВГС, специфично для сигнального каскада ИФН 1 типа и не влияет на сигнальный путь ИФН II типа.

Существуют другие цитокины, которые активируют Jak-STAT сигнальный путь, особенно члены семейства ИЛ-6, которое включает ИЛ-6, ИЛ-11, фактор, ингибирующий лейкоз (ФИЛ), онкостатин (OSM), кардиотрофин-1 (КТ-1), цилиарный нейротрофический фактор (ЦНТФ) и кардиотрофин-подобный цитокин (КТПЦ) [7]. Эти цитокины связываются с рецепторными комплексами плазматической мембраны, которые включают общую рецепторную цепь трансдукции сигнала gp130 [7]. Трансдукция сигналов вызывает активацию членов семейства тирозинкиназ Jak, приводящую к активации факторов транскрипции STAT1 и STAT3. Эти цитокины интенсивно активируют STAT3 и, в меньшей степени, STAT1 через общую рецепторную субъединицу gp130. Однако хоть и показано, что ИЛ-6 индуцирует некоторые противовирусные эффекты [8], это противовирусное действие цитокина является гораздо слабее действия интерферона-α.

Настоящее изобретение относится к применению интерлейкина семейства ИЛ-6, предпочтительно кардиотрофина-1 (КТ-1) или онкостатина М (ОСМ):

(1) для повышения противовирусной активности интерферона-альфа (ИФН-α),

(2) для преодоления устойчивости к интерферону, наблюдаемой у пациентов с хронической вирусной инфекцией, которые не отвечают на терапию с применением ИФН-α (самого по себе или в комбинации с другими противовирусными компонентами),

(3) для проведения комбинированного лечения с применением интерлейкина семейства ИЛ-6, предпочтительно КТ-1 или ОСМ, вместе с ИФН-α, в качестве улучшенной противовирусной терапии какого-либо типа вирусной инфекции, и особенно инфекции вирусом гепатита С (ВГС), при которой доказано, что предпочтительная комбинация КТ-1-ИФН-α или ОСМ-ИФН-α является особенно эффективной для ингибирования репликации ВГС.

Цель настоящего изобретения заключается в следующем:

(1) показать, что комбинация ИФН-α с интерлейкином семейства ИЛ-6, предпочтительно с КТ-1 и ОСМ, оказывает более сильное противовирусное действие по сравнению с действием, вызываемым одним цитокином (ИФН или цитокином семейства ИЛ-6), и

(2) показать, что ИФН-α, связанный с цитокином семейства ИЛ-6, особенно с КТ-1 или онкостатином М, способен преодолевать блокирование сигнального каскада ИФН-α (и, следовательно, ослабление эффекта ИФН-α, индуцируемого при репликации вируса, предпочтительно ВГС, в инфицированной клетке).

Описание изобретения

Настоящее изобретение относится, в первую очередь, к применению, по меньшей мере одного цитокина семейства ИЛ-6, семейства gp130, или последовательности ДНК, которая его кодирует, для получения фармацевтической композиции для совместного введения по меньшей мере с одним ИФН-α или последовательностью ДНК, которая его кодирует, при лечении вирусных заболеваний, при этом указанный цитокин выбран из кардиотрофина-1, ИЛ-11, фактора, ингибирующего лейкемию, онкостатина М, цилиарного нейротрофического фактора, кардиотрофиноподобного цитокина, и их комбинаций, и, даже еще более предпочтительно, когда указанный цитокин является кардиотрофином-1 или онкостатином М.

В контексте настоящего изобретения цитокин «семейства ИЛ-6», например КТ-1,относится к:

- полной нативной форме указанного цитокина,

- какой-либо активной фракции указанного цитокина, то есть какой-либо частичной полипептидной последовательности указанного цитокина, которая сохраняет физиологическое действие полного цитокина, заявленного в настоящем изобретении, и

- какому-либо производному указанного цитокина, то есть какой-либо полипептидной последовательности, которая обладает более чем 80% гомологией с указанным нативным цитокином и сохраняет физиологические эффекты полного цитокина, заявленного в настоящем изобретении.

Цитокин семейства ИЛ-6 (полная форма, активная фракция или полипептидное производное) может происходить из обеих форм, нативной формы и какой-либо формы рекомбинантного цитокина, исходя из какой-либо формы полинуклеотида, которая кодирует полный цитокин, активную фракцию или полипептидное производное.

Кроме того, в белке семейства ИЛ-6, в полной форме или в активной фракции, или в рекомбинантном цитокине каким-либо указанным способом можно удалить, заменить или добавить одну или нескольких аминокислот, при условии, что сохраняется их предполагаемая активность по настоящему изобретению.

С другой стороны, согласно настоящему изобретению, ИФН-α по настоящему изобретению является каким-либо типом ИФН-α. В конкретном варианте осуществления изобретения, указанный ИФН-α выбран из ИФН-α-2а, ИФН-α-2b, ИФН-α-5, консенсусного интерферона, очищенного ИФН-α, пэгилированного ИФН-α и их комбинаций. В другом конкретном варианте осуществления изобретения ИФН-α выбран из пэгилированного ИФН-α-2b, пэгилированного ИФН-α-2а, пэгилированного ИФН-α-5 и их комбинаций.

Комбинированное применение ИФН-α и цитокина семейства ИЛ-6 предназначено для лечения предпочтительно вирусного заболевания. В качестве примера вирусных заболеваний, которые можно лечить посредством комбинированного применения интерферона и цитокина семейства ИЛ-6, среди других можно упомянуть следующие: заболевания, вызываемые вирусом энцефаломиокардита, гепатит В и С, ВИЧ, кожные вирусные инфекции (ветряная оспа, опоясывающий лишай, корь), респираторные вирусные инфекции, вирусные инфекции центральной нервной системы, вирусные инфекции печени, вирусные инфекции слюнных желез, инфекционный мононуклеоз и генитальные бородавки.

Предпочтительно, вирусным заболеванием является гепатит С.

Более того, согласно настоящему изобретению, цитокин семейства ИЛ-6, или цитокины, и ИФН-α можно вводить раздельно, в разных фармацевтических композициях, или их можно вводить совместно, в одной и той же фармацевтической композиции.

Таким образом, дополнительным объектом настоящего изобретения является фармацевтическая композиция, которая включает фармацевтически приемлемое количество по меньшей мере одного цитокина семейства ИЛ-6, семейства gp130, или последовательность ДНК, которая его кодирует, и фармацевтически приемлемое количество по меньшей мере одного ИФН-α, или последовательность ДНК, которая его кодирует.

В указанной фармацевтической композиции, которая включает по меньшей мере один ИФН-α или последовательность ДНК, которая его кодирует, и по меньшей мере один цитокин семейства ИЛ-6 или последовательность ДНК, которая его кодирует, цитокин семейства ИЛ-6 предпочтительно выбран из ИЛ-6, ИЛ-11, фактора, ингибирующего лейкоз, онкостатина М, кардиотрофина-1, цилиарного нейротрофического фактора, кардиотрофиноподобного цитокина, и их комбинаций, и даже более предпочтительно, если указанный цитокин является кардиотрофином-1 или онкостатином М.

В фармацевтической композиции настоящего изобретения ИФН-α является каким-либо типом ИФН-α. В предпочтительном варианте осуществления изобретения ИФН-α выбран из ИФН-α-2а, ИФН-α-2b, ИФН-α-5, консенсусного интерферона, очищенного ИФН-α, пэгилированного ИФН-α и их комбинаций. В другом дополнительном предпочтительном варианте осуществления изобретения ИФН-α выбран из пэгилированного ИФН-α-2b, пэгилированного ИФН-α-2а, пэгилированного ИФН-α-5 и их комбинаций.

В специфическом варианте осуществления настоящего изобретения, последовательность ДНК, которая кодирует цитокин семейства ИЛ-6 (который может быть представлен полной формой, активной фракцией или полипептидным производным) или ИФН-α, включена в вектор экспрессии, например, плазмидный или вирусный вектор, который предпочтительно оперативно связан с управляющей последовательностью, которая регулирует экспрессию цитокина или ИФН-α. Конструкцию указанного вектора экспрессии с последовательностью ДНК можно выполнить традиционными методами генной инженерии, приведенными в руководствах, например, «Molecular Cloning: A Laboratory Manual», под ред. J. Sambrook, D.W.Russel, Cold Spring Harbor, 2001, 3-е изд., Нью-Йорк. Эти варианты осуществления фармацевтической композиции представляют интерес для терапий, в которых применяют перенос генов (генная терапия).

Фармацевтическая композиция настоящего изобретения, кроме того, может включать по меньшей мере один эксципиент, который фармацевтически совместим с цитокином семейства ИЛ-6 или последовательностью ДНК, которая его кодирует, и фармацевтически совместим с ИФН-α или последовательностью ДНК, которая его кодирует.

Кроме того, в фармацевтической композиции цитокин семейства ИЛ-6, или последовательность ДНК, которая его кодирует, и ИФН-α, или последовательность ДНК, которая его кодирует, можно вводить в соответствующие носители.

Адекватные примеры фармацевтической композиции настоящего изобретения включают, но ими не ограничиваются, какую-либо твердую композицию (например, таблетки, капсулы, гранулы и т.д.) или жидкую композицию (например, растворы, суспензии, эмульсии и т.д.) для введения каким-либо подходящим способом, например пероральным, назальным, парентеральным, местным, трансдермальным, ректальным и т.д.

В конкретном варианте осуществления настоящего изобретения указанная композиция может быть в фармацевтической форме для перорального введения, либо твердой, либо жидкой. Наглядные примеры фармацевтических форм для перорального введения включают таблетки, капсулы, гранулы, растворы, суспензии и т.д. и могут содержать обычные эксципиенты, например связующий агент, разбавитель, разрыхлитель, смазывающий агент, увлажнитель и др. эксципиенты, и могут быть получены обычными способами. Фармацевтическая композиция также может быть адаптирована для парентерального введения, в форме, например, стерильных растворов, суспензий или лиофилизированных продуктов в соответствующей дозированной форме. В этом случае указанная фармацевтическая композиция будет включать соответствующие эксципиенты, например буферы, поверхностно-активные вспомогательные вещества и т.д. В любом случае эксципиенты выбирают исходя из выбранной фармацевтической формы введения. Обзор различных фармацевтических форм для введения лекарств, для этих и других потенциальных способов введения, и их получение можно найти, например, в кн.: «Tecnologia farmaceutica» [«Pharmaceutical Technology»], под ред. J.L.Vila Jato, Sintesis, Мадрид, 1997, т.I и II, или в «Handbook of Pharmaceutical Manufacturing Formulations», под ред. S.K.Niazi, CRC Press, Бока Ратон, 2004, т.I-VI.

В конкретном варианте осуществления настоящего изобретения фармацевтическая композиция предназначена для парентерального введения, предпочтительно подкожного, внутривенного, внутримышечного или внутрибрюшинного.

В конкретном варианте осуществления фармацевтической композиции по настоящему изобретению ИФН-α представлен в пэгилированной форме. Примеры получения композиций с пэгилированными формами можно найти в US 5762923 и US 5766582. Также возможно коммерческое приобретение некоторых из этих пэгилированных форм, например, таких как PEG-Intron (пэгилированный ИФН-α-2b) фирмы Schering Corporation (Кенилворс, Нью-Джерси, США) и PEGASYS (ИФН-α-2а) фирмы Hoffmann La Roche (Натли, Нью-Джерси, США).

Для применения в терапии и цитокин семейства ИЛ-6, и ИФН-α предпочтительно должны быть в фармацевтически приемлемой форме или в значительной степени чистой форме, т.е. они должны иметь фармацевтически приемлемую степень чистоты, исключая фармацевтически приемлемые эксципиенты, и не должны включать вещество, которое считается токсичным при нормальных дозах введения. Степень чистоты для цитокина семейства ИЛ-6 и ИФН-α предпочтительно превышает 50%, более предпочтительно, превышает 70% и еще более предпочтительно, превышает 90%. В предпочтительном варианте осуществления, степень чистоты превышает 95%.

В общем, подлежащее введению терапевтически эффективное количество цитокина семейства ИЛ-6 и ИФН-α зависит, среди других факторов, от индивидуума, подвергающегося лечению, серьезности заболевания указанного индивидуума, выбранной формы введения и т.д. По этой причине дозы, указанные в настоящем изобретении, должны рассматриваться исключительно в качестве ориентиров для специалистов в данной области, которые должны проводить корректировку этих доз на основе указанных переменных. Однако цитокин семейства ИЛ-6 и ИФН-α можно вводить один или несколько раз в сутки, например, 1,2,3 или 4 раза в сутки.

В качестве наглядного примера, не ограничивающего область охвата настоящего изобретения, в конкретном варианте осуществления, в котором комбинируются кардиотрофин-1 и ИФН-α-2а (или 2b), типичное общее суточное количество кардиотрофина-1 может составлять 1-10 мг/кг массы тела, и обычное общее суточное количество ИФН-α-2а составляет 1,5-10 мМЕ в сутки или от 40 до 300 мкг в неделю пэгилированного ИФН-α. Обычно, уровень доз должен быть выше в течение первых недель лечения с понижением доз в последующие периоды. Более того, введение может осуществляться ежесуточно, три раза в неделю, а также раз в неделю. С другой стороны, кардиотрофин-1 и ИФН-α можно вводить, следуя разным схемам введения (например, разными путями введения или с различной частотой).

Дополнительным объектом настоящего изобретения является фармацевтический набор для лечения вирусных заболеваний, который включает, по меньшей мере:

- первый компонент, который включает по меньшей мере один цитокин семейства ИЛ-6, семейства gp130, (либо полный, либо активную фракцию, либо полипептидное производное, указанные выше) или последовательность ДНК, которая кодирует указанный цитокин, и

- второй компонент, который включает по меньшей мере один ИФН-α или последовательность ДНК, которая кодирует указанный ИФН-α.

Набор по настоящему изобретению предпочтительно включает цитокин семейства ИЛ-6, выбранный из ИЛ-6, ИЛ-11, фактора, ингибирующего лейкоз, онкостатина М, кардиотрофина-1, цилиарного нейротрофического фактора, кардиотрофиноподобного цитокина и их комбинаций, и, даже более предпочтительно, цитокин семейства ИЛ-6 является кардиотрофином-1 или онкостатином М.

Набор по настоящему изобретению включает ИФН-α какого-либо типа, предпочтительно выбранный из ИФН-α-2а, ИФН-α-2b, ИФН-α-5, консенсусного интерферона, очищенного ИФН-α, пэгилированного ИФН-α и их комбинаций. В другом дополнительном предпочтительном варианте осуществления настоящего изобретения ИФН-α выбран из пэгилированного ИФН-α-2b, пэгилированного ИФН-α-2а, пэгилированного ИФН-α-5 и их комбинаций.

В конкретном варианте осуществления настоящего изобретения последовательность ДНК, которая кодирует цитокин семейства ИЛ-6 (либо полный, либо активную фракцию, либо полипептидное производное) или ИФН-α, в наборе включена в состав вектора экспрессии.

В наборе настоящего изобретения, первый компонент и второй компонент могут включать, дополнительно по меньшей мере один фармацевтически приемлемый эксципиент, который совместим с цитокином семейства ИЛ-6, или последовательностью ДНК, которая его кодирует, и с ИФН-α, или последовательностью ДНК, которая его кодирует.

Согласно настоящему изобретению набор, указанный выше, может включать первый и второй компоненты в раздельных фармацевтических композициях, или же первый и второй компоненты могут присутствовать в наборе в одной и той же фармацевтической композиции.

Этот набор также может включить третий компонент, который включает один или несколько эксципиентов, которые фармацевтически совместимы с цитокином семейства ИЛ-6, или последовательностью ДНК, которая его кодирует, и с ИФН-α, или последовательностью ДНК, которая его кодирует.

Указанный третий компонент может включать, дополнительно, один или несколько носителей, которые фармацевтически совместимы с цитокином семейства ИЛ-6, или последовательностью ДНК, которая его кодирует, и с ИФН-α, или последовательностью ДНК, которая его кодирует.

Дополнительным объектом настоящего изобретения является способ лечения вирусного заболевания, который включает введение комбинированным способом терапевтически эффективного количества по меньшей мере одного цитокина семейства ИЛ-6, семейства gp130 (либо полной формы, либо активной фракции, либо полипептидного производного, указанных выше), или последовательности ДНК, которая его кодирует, и терапевтически эффективного количества по меньшей мере одного ИФН-α, или последовательности ДНК, которая его кодирует.

В конкретном варианте осуществления настоящего изобретения последовательность ДНК, которая кодирует цитокин семейства ИЛ-6 или ИФН-α по способу настоящего изобретения включена в вектор экспрессии.

В указанном выше способе вирусное заболевание может вызываться вирусом энцефаломиокардита, может являться гепатитом В и С, вызываться ВИЧ, представлять кожные вирусные инфекции (ветряная оспа, опоясывающий лишай, корь), респираторные вирусные инфекции, вирусные инфекции центральной нервной системы, вирусные инфекции печени, вирусные инфекции слюнных желез, инфекционный мононуклеоз и генитальные бородавки.

Согласно предпочтительному варианту осуществления способа по настоящему изобретению вирусным заболеванием является гепатит С.

По способу настоящего изобретения цитокин семейства ИЛ-6 предпочтительно выбран из ИЛ-6, ИЛ-11, фактора, ингибирующего лейкоз, онкостатина М, кардиотрофина-1, цилиарного нейротрофического фактора, кардиотрофиноподобного цитокина и их комбинаций, и, даже более предпочтительно, цитокин семейства ИЛ-6 является кардиотрофином-1 или онкостатином М.

В указанном способе по настоящему изобретению ИФН-α является каким-либо типом ИФН-α. В предпочтительном варианте осуществления настоящего изобретения он выбран из ИФН-α-2а, ИФН-α-2b, ИФН-α-5, консенсусного интерферона, очищенного ИФН-α, пэгилированного ИФН-α и их комбинаций. В другом дополнительном предпочтительном варианте осуществления настоящего изобретения ИФН-α выбран из пэгилированного ИФН-α-2b, пэгилированного ИФН-α-2а, пэгилированного ИФН-α-5 и их комбинаций.

Кроме того, способ настоящего изобретения может предусматривать комбинированное и одновременное введение цитокина семейства интерлейкинов, предпочтительно кардиотрофина-1, и ИФН-α.

В этом способе цитокин семейства ИЛ-6 (либо полная форма, либо активная фракция, либо полипептидное производное) и ИФН-α могут присутствовать в одной и той же фармацевтической композиции, которая вводится пациенту, или же цитокин семейства ИЛ-6 и ИФН-α могут вводиться в раздельных фармацевтических композициях.

Настоящее изобретение показывает, что если клетки печени, которые содержат полный репликон ВГС, стимулируются ИФН-α и интерлейкином семейства ИЛ-6, особенно кардиотрофином-1 или онкостатином М:

(1) преодолевается ингибирующее действие ВГС на фосфорилирование STAT3, которое происходит, когда клетки инкубируют только с одним ИНФ-α или с одним цитокином семейства ИЛ-6 (например, КТ-1 или ОСМ),

(2) повышается индукция интерферон чувствительных генов (ИЧГ), например, 2'-5'-олигоаденилатсинтазы (2'-5'ОАС), и повышаются уровни STAT1 и STAT3, по сравнению с клетками, которые инкубируются с одним цитокином,и

(3) более эффективно ингибируется репликация вируса, чем при использовании одного цитокина.

(4) проявляется сильное синергетическое взаимодействие ИФН-α и КТ-1, или ИФН-α и ОСМ.

Краткое описание чертежей:

Фиг.1 показывает результаты анализа фосфорилирования STAT1, STAT2 и STAT3. Клетки Huh7 (Huh7) и клетки Huh7, содержащие полный геномный репликон ВГС (Соге-3'), обрабатывали в течение 15, 60 и 120 мин 50 МЕ/мл ИФН-α-2 (ИФН-α) или 20 нг/мл кардиотрофина-1 (КТ-1), или комбинацией ИФН-α-2 и КТ-1, и в клеточных экстрактах с помощью вестерн-блоттинга анализировали количества фосфорилированных STAT1, STAT2 и STAT3.

Фиг.2 показывает результаты количественного ОТПЦР-анализа в реальном времени иРНК STAT1, STAT3 и 2'-5'ОАС в клетках Huh7, содержащих полный репликон ВГС, обрабатываемых в течение 3 суток 5 или 50 МЕ/мл ИФН-α-2 (ИФН 5, ИФН 50), одного (- КТ) или в комбинации с 20 нг/мл КТ-1 (+ КТ), и 5 или 50 МЕ/мл ИФН-α-2, одного (- ОСМ) или в комбинации с 20 нг/мл ОСМ (+ ОСМ). Контроль: необработанные клетки.

Фиг.3 показывает количественный ОТПЦР-анализ в реальном времени РНК ВГС в клетках Huh7, содержащих полный репликон ВГС, обрабатываемых в течение 3 суток 5 или 50 МЕ/мл ИФН-α-2 или ИФН-α-5, и 20 нг/мл КТ-1 или ОСМ или ИЛ-6.

Фиг.4 показывает сравнительный противовирусный эффект комбинации ИФН-α-2 или ИФН-α-5 (5 Е/мл) в сочетании с КТ-1 или ОСМ или ИЛ-6 (20 нг/мл), путем ОТПЦР-анализа в реальном времени, РНК ВГС в клетках Huh7, содержащих полный репликон ВГС, обрабатываемых в течение 3 суток указанными цитокинами.

Фиг.5 показывает процент клеток Huh7, защищенных от заражения вирусом энцефаломиокардита. Клетки Huh7 предварительно обрабатывали в течение 24 ч 5 нг/мл или 50 нг/мл КТ-1 и различными количествами ИФН-α-2, и заражали 105 БОЕ вируса энцефаломиокардита (ВЭМК), и, спустя 24 ч, клетки окрашивали кристаллическим фиолетовым, чтобы оценить количество жизнеспособных клеток.

Варианты осуществления изобретения

Эксперимент 1

Исследование эффекта комбинации ИФН-α-2 и КТ-1 на сигнальный каскад в клетках, сохраняющих репликацию ВГС (фиг.1).

В нетрансфецированных клетках Huh7 (клеточная линия гепатомы), добавление 50 МЕ/мл ИФН-α-2 (ИФН-α-2) индуцирует фосфорилирование STAT1, STAT2 и STAT3, с максимальной активацией STAT1 и STAT2 на 1-ый и 2-ой ч, и STAT3 на 1-ый ч (см. фиг.1А). Однако в клетках Huh7, трансфецированных полноразмерным репликоном ВГС, наблюдается заметное ингибирование фосфорилирования STAT1, STAT2 и STAT3 после инкубации с ИФН-α-2. Таким образом, отмечается полное отсутствие активированных STAT3 и STAT1 и заметное ингибирование активации STAT2 (см. фиг.1А).

С другой стороны, в нетрансфецированных клетках Huh7 обнаружено, что добавление 20 нг/мл КТ-1 приводит к активации и STAT3, и STAT1 (более сильной в случае STAT3), с максимальным значением через 15 мин и 1 ч, и значительным снижением через 2 ч (фиг.1Б). Подтверждено, что КТ-1 не индуцирует какой-либо активации STAT2. В клетках Huh7, трансфецированных полным репликоном ВГС, активация STAT3 посредством КТ-1 существенно ниже, а фосфорилирование STAT1 изменяется только незначительно (фиг.1Б).

При инкубировании нетрансфецированных клеток Huh7 со смесью 50 МЕ/мл ИФН-α-2 и 20 нг/мл КТ-1 обнаруживается более интенсивное и длительное фосфорилирование STAT3 и STAT1 по сравнению с клетками, инкубированными с каждым из цитокинов в отдельности. Активация STAT2 близка таковой, обнаруженной только с одним ИФН-α-2. Существенно, что если клетки Huh7, трансфецированные полным репликоном ВГС, инкубируют со смесью ИФН-α-2 (50 МЕ/мл) с КТ-1 (20 нг/мл), происходит фосфорилирование STAT3 без какого-либо нарушения, не только с более интенсивной активацией STAT3, но также более длительной, по сравнению с таковой в случае инкубации нетрансфецированных клеток с одним ИФН-α-2 (фиг.1 В). Этот факт заслуживает внимания, поскольку согласно указанному (и показанному на фиг.1А и 1Б), репликация ВГС в клетках Huh7 значительно понижает активацию STAT3 обоими ИФН-α-2 и КТ-1 пол-отдельности, и остается неясным, почему эта блокировка исчезает при инкубации клеток с двумя цитокинами одновременно. Это открывает новую перспективу для перспективной стратегии лечения вирусных заболеваний. Следует также отметить, что комбинирование ИФН-α-2 и КТ-1 при обработке клеток с репликацией ВГС не только вызывает сильную устойчивую активацию STAT3, но также активацию STAT1, близкую активации, которая обнаружена при инкубации нетрансфецированных клеток с одним КТ-1 и более сильную активацию, чем при инкубации нетрансфецированных клеток с одним ИФН-α-2 (сравните фиг.1А и 1Б). Важно отметить, что ИФН-α-2 не способен активировать STAT1 в клетках с устойчивой репликацией ВГС, тогда как комбинация КТ-1 с ИФН-α-2 может очень эффективно активировать этот важный противовирусный фактор в клетках с репликацией ВГС. Это ясно показывает, что комбинирование ИФН-α-2 и КТ-1 приводит к улучшению противовирусной активности, давая возможность фосфорилированию STAT2, хотя и на уровнях, которые, безусловно, ниже, чем при использовании клеток без репликации ВГС (см. фиг.1В).

Таким образом, если клетки с устойчивой репликацией ВГС отдельно обрабатывают ИФН-α-2, активация STAT1 и STAT3 отсутствует, и наблюдаются только низкие уровни STAT2. Отсутствие активированных STAT1 и STAT3, двух важных индукторов клеточного противовирусного статуса, возможно, предотвращает образование гетеродимеров STAT1-STAT2, гетеродимеров STAT1-STAT3 и гомодимеров STAT1 и STAT3, таким образом, понижая противовирусную защитную реакцию клетки. Применение КТ-1 в комбинации с ИФН-α-2 дает возможность образованию высоких уровней активированных STAT1 и STAT3, таким образом, восстанавливая механизм устойчивости клеток к вирусам.

В экспериментах, показанных на фиг.1, можно видеть, что инфекция ВГС не только приводит к дефектной активации STAT1, но также к редукции уровней белков STAT3 и STAT2. Исследования, представленные на фиг.1, показывают кратковременные эффекты инкубации либо с ИФН-α-2, либо с КТ-1, либо с комбинацией обоих. Эксперименты, описанные ниже, показывают, что при инкубации в течение 72 ч, можно заметить, что обработка комбинацией КТ-1 и ИФН-α-2, или ОСМ и ИФН-α-2 приводит к повышенной экспрессии STAT3, таким образом, противодействуя эффекту ВГС в инфицированных клетках (см. фиг.2).

Экспериментальный метод 1

Создание клеточных линий, несущих полноразмерный репликон ВГС.

Клетки Huh7, которые экспрессируют полноразмерный репликон ВГС, получают согласно описанию [9]. Вкратце, pI389/Core-3'/5.1 линеаризируют с помощью ScaI (фирма New England Biolabs, США) и используют в качестве матриц для синтеза РНК, используя РНК-полимеразу (фирма Promega, США). 20 мкг синтезированной РНК используют для электрофореза 107 клеток Huh7 и спустя 24 ч добавляют 500 мкг/мл G418 (фирма Gibco, США). Два раза в неделю добавленную культуральную среду заменяют G418 и спустя 4 недели после трансфекции отбирают смешанные колонии, резистентные к G418, и используют для последующего анализа.

Вестерн-блот анализ. Клетки Huh7, либо экспрессирующие, либо не экспрессирующие полноразмерный репликон ВГС, засевают при плотности 200000/лунку в 6-луночные планшеты в среду D-MEM (фирма Gibco) с 10% ФТС (фетальная сыворотка теленка) (фирма Gibco). Через различные промежутки времени: 15 мин, 1 ч и 2 ч, добавляют 50 МЕ/мл ИФН-α-2 (фирма Intron A, Schering-Plough), или 20 нг/мл КТ-1 (фирма R&D Systems, Великобритания), или комбинацию ИФН-α-2 (50 МЕ/мл) с КТ-1 (20 нг/мл). Впоследствии клетки Huh7 лизируют в лизирующем буфере (60 мМ Tris-HCl, рН 6,8, 2% ДСН (додецилсульфат натрия), 2,5% глицерина, 0,7 М 2-меркаптоэтанола и 0,02% бромфенола синего). Образцы разделяют в ДСН-полиакриламидных гелях (фирма Bio-Rad Laboratories, Калифорния) при 7,5% в восстанавливающих условиях. После электрофореза их переносят на нитроцеллюлозные мембраны (фирма Bio-Rad Laboratories) и окрашивают раствором пунцового красного (фирма Sigma-Aldrich, Германия), чтобы проконтролировать равную нагрузку белков. Мембраны инкубируют в TBS-T (50 мМ Трис-HCl (рН 7,6), 200 мМ NaCl и 0,1% Твин-20) с 5% сухого молока. Белки выявляют путем инкубации со специфическим первичным антителом в TBS-T в течение 1 ч. Затем мембраны промывают в TBS-T и на 1 ч добавляют конъюгированное с пероксидазой вторичное антитело. Мембраны тщательно промывают в TBS-T и просматривают специфические полосы белков с применением хемилюминесцентной системы детекции "Western Lightning Chemiluminescence Reagent Plus" (фирма Perkin Elmer, США), следуя инструкциям производителя. После этого мембраны подвергают радиоавтографии и проводят количественный анализ полос посредством денситометрического анализа с использованием программы Molecular Analyst/PC (фирма Bio-Rad Laboratories).

Антитела. Антитела против фосфо-STAT1tyr701 и против фосфо-STAT3tyr705, и антитело против IgG кролика, конъюгированные с ПОХ (пероксидазой хрена), приобретены в фирме Cell Signaling Technology (США). Антитела против STAT3, против фосфо-STAT1tyr727, против STAT2 и против фосфо-STAT2tyr689 получены от фирмы Upstate Biotechnology (США). Антитело против STAT1 получено от фирмы Santa Cruz Biotechnology (Санта-Круз, Калифорния). Антитело к актину получено от фирмы Sigma-Aldrich (Германия).

Чтобы установить, приводит ли комбинация цитокина семейства ИЛ-6 с ИФН-α к усилению противовирусного состояния клетки, проводят дополнительные эксперименты по следующему плану: а) проводят оценку, может ли комбинированная терапия с использованием ИФН-α в сочетании с цитокином семейства ИЛ-6 более сильно повышать экспрессию интерферон-чувствительных генов по сравнению с каким-либо из цитокинов самим по себе, б) устанавливают, обладает ли комбинированная терапия с использованием ИФН-α в сочетании с цитокином семейства ИЛ-6 более сильным действием в отношении ингибирования репликации ВГС по сравнению с каждым цитокином по отдельности, в) оценивают, является ли комбинированная терапия с использованием ИФН-α в сочетании с КТ-1 более действенной для защиты клеток против цитопатических эффектов вируса, не относящегося к ВГС, и г) определяют характер взаимодействия между ИФН-α и цитокином семейства ИЛ-6.

Эксперимент 2

Оценка влияния комбинированной терапии ИФН-α-2 в сочетании с КТ-1, или ИФН-α-2 в сочетании с ОСМ, на индукцию интерферон-чувствительных генов (ISG) (Фиг.2)

Исследуют экспрессию ISG 2'-5'ОАС, STAT1 и STAT3 на клетках Huh7, несущих репликон ВГС, после инкубации в течение 72 ч с ИФН-α-2 (5 или 50 МЕ/мл) или КТ-1 (20 нг/мл), или ОСМ (20 нг/мл), или с комбинацией ИФН-α-2 с ОСМ (см. фиг.2А-2Е). Обнаружено, что, хотя КТ-1 или ОСМ сами по себе не способны повышать или слабо повышают экспрессию этих ISG, добавление КТ-1 или ОСМ к низким или высоким дозам ИФН-α-2 приводит к заметному повышению экспрессии ISG, которая указывает, что КТ-1 или ОСМ могут значительно усиливать способность IFN-α-2 в большой степени регулировать противовирусные гены в клетках, поддерживающих репликацию вируса. Хотя три из проанализированных в настоящем изобретении ISG обладают значительным противовирусным действием, увеличение экспрессии STAT3 путем комбинирования КТ-1 или ОСМ и ИФН-α-2 является особенно существенным, поскольку этот фактор не только обладает противовирусными свойствами, но также проявляет сильное цитопротекторное и противовоспалительное действие.

Экспериментальный метод 2

ОТПЦР-анализ в реальном времени экспрессии иРНК ISG. Клетки, экспрессирующие полноразмерный репликон ВГС, засевают при плотности 100000/лунку в 6-луночные планшеты в среду D-MEM (фирма Gibco) с 10% ФТС (фирма Gibco). Добавляют 50 или 5 МЕ/мл одного ИФН-α-2 или в комбинации с 20 нг/мл КТ-1, или с 20 нг/мл ОСМ. Клеточную культуру поддерживают в течение 3-х суток. Пополняемую культуральную среду каждые сутки дополняют указанными цитокинами. Общую РНК получают, следуя протоколу "Ultraspec RNA Isolation System" (фирма Biotech, США), который основан на методе, описанном Chomczynski и Sacchi [10]. Перед обратной транскрипцией с использованием обратной транскриптазы M-MLV (фирма Gibco-BRL) в присутствии RNaseOUT (фирма Gibco-BRL), два мкг общей РНК обрабатывают ДНК-азой (фирма Gibco-BRL, Великобритания). Экспрессию STAT, 2 - 5OAC и β-актина оценивают посредством ПЦР в реальном времени с использованием прибора Icycler и IQ SYBR Green Supermix (фирма Bio-Rad Laboratories, Калифорния). Для каждой ПЦР используют 2 мкл аликвоты пула кДНК, содержащие специфические прямые и обратные праймеры для каждого гена (таблица 1) в конечном объеме 20 мкл. Для определения специфичности полученных продуктов ПЦР анализируют температуру их диссоциации. Результаты нормируют на основании определения количества β-актина в том же образце. Количество каждого транскрипта выражают посредством формулы 2ct(актин)-ct(ген), где ct является точкой, при которой флюоресценция значительно превышает базовую флюоресценцию.

Таблица 1
Праймеры, используемые в этом исследовании
Ген Прямой праймер (5'-3') Обратный праймер (5'-3')
2'-5'ОАС SEQ. ID. NO: 1 TTAAGAGGCAACTCCGATGG SEQ. ID. NO: 2 AGCAGACTGCAAACTCACCA
STAT1 SEQ. ID. NO: 3 GCTATTCACAACCACTCATTCA SEQ. ID. NO: 4 ACAAGATACAGCCACATAGACA
STAT3α SEQ. ID. NO: 5 GTCCGTGGAACCATACACAA SEQ. ID. NO: 6 CAATGGTATTGCTGCAGGTG
β-актин SEQ. ID. NO: 7 AGCCTCGCCTTTGCCGA SEQ. ID. NO: 8 CTGGTGCCTGGGGCG
ВГС SEQ. ID. NO: 9 CCTGTGAGGAACTACTGTCT SEQ. ID. NO: 10 CTATCAGGCAGTACCACAAG

Эксперимент 3. Исследование эффектов комбинации ИФН-α-2 с цитокином семейства ИЛ-6 на репликацию ВГС в клетках Huh7, трансфецированных полноразмерным репликоном ВГС (фиг.3)

Из-за более сильной индукции ISG, наблюдаемой в ответ на комбинацию ИФН-α-2 с КТ-1 или ОСМ, желательно проанализировать, превосходит ли эта комбинация действие одного ИФН-α-2 или одного цитокина семейства ИЛ-6 в редукции вирусной нагрузки в клетках с полноразмерным репликоном ВГС. Соответственно, клетки Huh7, несущие репликон ВГС, инкубируют с ИФН-α (ИФН-α-2 или ИФН-α-5, при 5 или 50 МЕ/мл) с или без цитокина семейства ИЛ-6 (ИЛ-6, КТ-1, ОСМ, при 20 нг/мл), или только с цитокинами семейства ИЛ-6. Количество РНК ВГС оценивают после 72 ч культивирования (фиг.3А, 3Б, 3В). На фиг.3 показано, что цитокины семейства ИЛ-6: ИЛ-6, КТ-1 и ОСМ, сами по себе обладают умеренным противовирусным действием. Однако КТ-1 и ОСМ в значительной степени повышают противовирусное действие обоих ИФН-α-2 и ИФН-α-5 при использовании этих цитокинов в низких (5 МЕ/мл) или высоких (50 МЕ/мл) дозах (фиг.3А и 3Б). ИЛ-6 повышает в более слабой степени противовирусное действие обоих ИФН-α-2 и ИФН-α-5 (фиг.3В). Так, комбинированная терапия с использованием ИФН-α-2 или ИФН-α-5 в сочетании с КТ-1 или ОСМ увеличивает противовирусный эффект ИФН-α приблизительно в 5 и 10 раз, соответственно. Кроме того, комбинированная терапия с использованием ИФН-α-2 или ИФН-α-5 в сочетании с ИЛ-6 повышает противовирусное действие ИФН-α приблизительно в 2 раза.

На фиг.4 представлен сравнительный усиливающий эффект ИЛ-6, КТ-1 и ОСМ (20 нг/мл) на противовирусное действие ИФН-α-2 (5 Е/мл) (фиг.4А) или ИФН-α-5 (фиг.4Б). Четко прослеживается более высокое усиливающее действие комбинации ИФН-α/КТ-1 и ИФН-α/ОСМ по сравнению с комбинацией ИФН-α/ИЛ-6.

Экспериментальный метод 3

Количественный ПЦР-анализ в реальном времени РНК ВГС. Клетки Huh7, экспрессирующие полноразмерный репликон ВГС, засевают при плотности 100000/лунку в 6-луночные планшеты в среду D-MEM с 10% ФТС. Добавляют 50 или 5 МЕ/мл одного ИФН-α-2 или одного ИФН-α-5, или в комбинации с 20 нг/мл КТ-1 или ОСМ или ИЛ-6. Клеточную культуру поддерживают в течение 3-х суток. Обогащенную культуральную среду каждые сутки замещают указанными цитокинами.

Общую РНК клеток Huh7, трансфецированных полноразмерным репликоном ВГС, получают, следуя протоколу "Ultraspec RNA Isolation System" (фирма Biotech, США), который основан на методе, описанном Chomczynski и Sacchi [10]. Перед обратной транскрипцией с использованием обратной транскриптазы M-MLV (фирма Gibco-BRL) в присутствии RNaseOUT (фирма Gibco-BRL), два мкг общей РНК обрабатывают ДНК-азой (фирма Gibco-BRL). Экспрессию РНК ВГС и иРНК β-актина оценивают посредством количественной ПЦР в реальном времени с использованием прибора Icycler и IQ SYBR Green Supermix (фирма Bio-Rad Laboratories). Для каждой ПЦР используют 2-х мкл аликвоты пула кДНК, содержащие специфические прямые и обратные праймеры для 5 нетранслируемого участка ВГС или гена β-актина (таблица 1) в конечном объеме 20 мкл. Для определения специфичности полученных продуктов ПЦР, анализируют температуру их диссоциации. Результаты нормируют на основании определения количества β-актина в том же образце. Количество РНК ВГС выражают посредством формулы 2ct(актин)-ct(ВГС), где ct является точкой, при которой флюоресценция значительно превышает базовую флюоресценцию.

Эксперимент 4

Исследование эффектов комбинации ИФН-α-2 в сочетании с КТ-1 в защите против цитопатического действия вируса энцефаломиокардита (ВЭМК) (фиг.5).

Чтобы определить, вызывает ли комбинированная терапия синергетическое действие при других вирусных инфекциях, отличных от ВГС, анализируют защитное действие, получаемое при этой обработке, против цитопатического действия ВЭМК в клетках Huh7. Клетки Huh7 инкубируют с понижающимися дозами ИФН-α-2, от 250 до 1 МЕ/мл, в присутствии или отсутствии низкой (5 нг/мл) или высокой (50 нг/мл) дозы КТ-1 и спустя 24 ч инфицируют ВЭМК. Видно, что сам КТ-1 (в низкой или высокой дозе) обладает слабым цитопротекторным действием на ВЭМК-инфицированных клетках, поскольку добавление этого цитокина при очень низких дозах ИФН-α-2 не улучшает жизнеспособность клеток. Однако КТ-1, при обеих низкой и высокой дозах, явно повышает защитное действие, индуцируемое ИФН-α-2, против цитопатического действия ВЭМК. Этот синергизм наблюдается при использовании ИФН-α-2 в дозах 250-28 МЕ/мл и наиболее ярко выражен при дозах ИФН-α-2 83 и 28 МЕ/мл. Эти данные показывают, что противовирусный синергизм ИФН-α-2 и КТ-1 не ограничивается ВГС, а направлен на широкий диапазон вирусных заболеваний.

Экспериментальный метод 4

Анализ цитопротекторного действия ИФН-α-2 и КТ-1 против ВЭМК в клетках Huh7. Цитопротекторное действие ИФН-α-2 и КТ-1 устанавливают путем оценки способности этих цитокинов защищать клетки Huh7 от цитопатического действия вируса энцефаломиокардита. Анализ проводят в 96-луночных планшетах для микротитрования. Сначала засевают 2×104 клеток Huh7 в лунку с 150 мкл среды, содержащей серийные разведения одного ИФН-α-2 (от 250 до 1 МЕ/мл), или среды, содержащей эти серийные разведения ИФН-α-2 в сочетании с 50 или 5 нг/мл КТ-1, и инкубируют в течение 24 ч. Добавляют 105 БОЕ вируса ЭМК на лунку и на 24 ч оценивают цитопатическое действие следующим образом: после удаления среды, лунки дважды промывают раствором ФСБ и окрашивают раствором кристаллического фиолетового (0,5% в системе метанол-вода, 1:4 об/об). Измеряют оптическую плотность при длине волны 540 нм. Результаты выражают в процентном отношении клеток, защищенных от цитопатического действия ВЭМК.

Эксперимент 5

Исследование воздействия ИФН-α в сочетании с различными цитокинами семейства интерлейкина 6 на репликацию ВГС в клетках Huh7, трансфецированных полноразмерным репликоном ВГС.

По причине повышенного противовирусного действия, показанного при использовании комбинации ИФН-α и цитокина семейства ИЛ-6, желательно установить характер взаимодействия, устанавливаемый в комбинации ИФН-α-2 или ИФН-α-5 с цитокинами семейства ИЛ-6: ИЛ-6, ОСМ и КТ-1.

Проводят несколько исследований противовирусного действия комбинаций ИФН-α-2 и ИФН-α-5 в фиксированных концентрациях (5 или 50 МЕ/мл) в сочетании с или без ИЛ-6, ОСМ и КТ-1 (20 нг/мл), на клетках Huh7, трансфецированных полноразмерным репликоном ВГС. Математический анализ характера взаимодействия, устанавливаемого между ИФН-α и цитокинами семейства ИЛ-6, проводят путем многовариантного анализа в соответствии с методом, описанным T.C.Chou [11]. Характер взаимодействия между двумя веществами оценивают по коэффициенту, называемому индексом взаимодействия "I", где I=d1/D1+d2/D2, при этом d1, d2 представляют дозы ингибиторов по комбинации, и D1, D2 дозы каждого ингибитора, которые вызывали бы тот же эффект, что и комбинация. Тогда, "I", равный 1, означает, что оба вещества не взаимодействуют друг с другом (аддитивный эффект), "I" меньше 1 означает, что комбинация является синергетической, и значение "I" большее 1 означает, что комбинация является антагонистической. Таблица 2 показывает стандартные синергетические показатели в отношении значения "I".

Таблица 2
ИНДЕКС ВЗАИМОДЕЙСТВИЯ (I) ВИД СИНЕРГИЗМА
0,1-0,3 СИЛЬНЫЙ СИНЕРГИЗМ
0,3-0,7 СИНЕРГИЗМ
0,7-0,85 УМЕРЕННЫЙ СИНЕРГИЗМ
0,85-0,89 СЛАБЫЙ СИНЕРГИЗМ
0,90-1,10 АДДИТИВНЫЙ ЭФФЕКТ

Индексы взаимодействия, полученные для различных комбинаций ИФН-α с ранее описанными цитокинами семейства ИЛ-6, во всех случаях были ниже 1, таким образом, комбинации ИФН-α (2 или 5) и цитокинов ИЛ-6, ОСМ и КТ-1 являются синергетическими (таблица 3). Более того, полученные данные показывают, что синергетическое действие всегда значительно выше при комбинациях ИФН-α/ОСМ и ИФН-α/КТ-1 (I<0,3 сильный синергизм), чем при комбинации ИФН-α/ИЛ-6 (10,7 синергизм).

Таблица 3
КОМБИНАЦИЯ ЦИТОКИНОВ ИНДЕКС ВЗАИМОДЕЙСТВИЯ (I)
ИФН-α-2 (5 Ед/мл)+ОСМ (20нг/мл) 0,29
ИФН-α-2 (50 Ед/мл)+ОСМ (20нг/мл) 0,11
ИФН-α-5 (5 Ед/мл)+ОСМ (20нг/мл) 0,26
ИФН-α-5 (50 Ед/мл)+ОСМ (20нг/мл) 0,17
КОМБИНАЦИЯ ЦИТОКИНОВ ИНДЕКС ВЗАИМОДЕЙСТВИЯ (I)
ИФН-α-2 (5 Ед/мл)+КТ-1 (20нг/мл) 0,22
ИФН-α-2 (50 Ед/мл)+КТ-1 (20нг/мл) 0,25
ИФН-α-5 (5 Ед/мл)+КТ-1 (20 нг/мл) 0,25
ИФН-α-5 (50 Ед/мл)+КТ-1 (20 нг/мл) 0,13
КОМБИНАЦИЯ ЦИТОКИНОВ ИНДЕКС ВЗАИМОДЕЙСТВИЯ (I)
ИФН-α-2 (5 Ед/мл)+ИЛ-6 (20 нг/мл) 0,44
ИФН-α-2 (50 Ед/мл)+ИЛ - 6 (20 нг/мл) 0,45
ИФН-α-5 (5 Ед/мл)+ИЛ - 6 (20 нг/мл) 0,40
ИФН-α-5 (50 Ед/мл)+ИЛ - 6 (20 нг/мл) 0,29

Экспериментальный метод 5

Количественный ПНР-анализ в реальном времени РНК ВГС.

Клетки Huh7, экспрессирующие полноразмерный репликон ВГС, засевают при плотности 20000/лунку в 24-луночные планшеты в среду D-MEM с 10% ФТС. Проводят различные эксперименты: добавляют 50 или 5 МЕ/мл ИФН-α-2 или ИФН-α-5, в комбинации с или без 20 нг/мл КТ-1, ОСМ или ИЛ-6 (фирма R&D Systems, Великобритания). Клеточную культуру поддерживают в течение 3-х суток. Культуральную среду каждые сутки заменяют новой средой с указанными цитокинами.

Общую РНК клеток Huh7, трансфецированных полноразмерным репликоном ВГС, получают, используя Kit Nucleic Acid Purification Lysis Solution (фирма Applied BioSystems, Фостер-Сити, Калифорния) и полуавтоматическую систему ABI PRISM 6100 Nucleic Acid PrepStation (фирма Applied BioSystems). Перед обратной транскрипцией с использованием обратной транскриптазы M-MLV (фирма Gibco-BRL) в присутствии RNaseOUT (фирма Gibco-BRL), два мкг общей РНК обрабатывают ДНК-азой (фирма Gibco-BRL). Экспрессию РНК ВГС и иРНК р-актина оценивают посредством количественного ПНР-анализа в реальном времени с использованием прибора Icycler и IQ SYBR Green Supermix (фирма Bio-Rad Laboratories). Для каждой ПЦР используют 2-х мкл аликвоты пула кДНК, содержащие специфические прямые и обратные праймеры для 5 нетранслируемого участка ВГС или гена β-актина (таблица 1) в конечном объеме 20 мкл. Для определения специфичности полученных продуктов ПЦР анализируют температуру их диссоциации. Результаты нормируют на основании определения количества β-актина в том же образце. Количество РНК ВГС выражают посредством формулы 2ct(актин)-ct(ВГС), где ct является точкой, при которой флюоресценция значительно превышает базовую флюоресценцию.

Для вычисления индекса взаимодействия применяют следующее уравнение:

I=d1/D1+d2/D2

Литература

1. Применение по меньшей мере одного цитокина семейства ИЛ-6 для получения фармацевтической композиции, предназначенной для комбинированного введения по меньшей мере с одним ИФН-α для лечения вирусных заболеваний, при этом указанный цитокин выбран из онкостатина М, кардиотрофина-1 и их комбинаций.

2. Применение по п.1, отличающееся тем, что ИФН-α выбран из ИФН-α-2а, ИФН-α-2b, ИФН-α-5, консенсусного интерферона, очищенного ИФН-α, пэгилированного ИФН-α и их комбинаций.

3. Применение по п.1, отличающееся тем, что ИФН-α выбран из пэгилированного ИФН-α-2b, пэгилированного ИФН-α-2а, пэгилированного ИФН-α-5 и их комбинаций.

4. Применение по п.1, отличающееся тем, что цитокин семейства ИЛ-6 выбран из полномерного нативного белка.

5. Применение по п.1, отличающееся тем, что вирусное заболевание является гепатитом С.

6. Применение по п.1, отличающееся тем, что цитокин семейства ИЛ-6 и ИФН-α вводятся раздельно в различных фармацевтических композициях.

7. Применение по п.1, отличающееся тем, что цитокин семейства ИЛ-6 и ИФН-α вводятся совместно в одной и той же фармацевтической композиции.

8. Фармацевтическая композиция, отличающаяся тем, что она включает фармацевтически приемлемое количество по меньшей мере одного цитокина семейства ИЛ-6 и фармацевтически приемлемое количество по меньшей мере одного ИФН-α, при этом указанный цитокин выбран из онкостатина М, кардиотрофина-1 и их комбинаций.

9. Фармацевтическая композиция по п.8, отличающаяся тем, что ИФН-α выбран из ИФН-α-2а, ИФН-α-2b, ИФН-α-5, консенсусного интерферона, очищенного ИФН-α, пэгилированного ИФН-α и их комбинаций.

10. Фармацевтическая композиция по п.8, отличающаяся тем, что ИФН-α выбран из пэгилированного ИФН-α-2b, пэгилированного ИФН-α-2а, пэгилированного ИФН-α-5 и их комбинаций.

11. Фармацевтическая композиция по п.8, отличающаяся тем, что цитокин семейства ИЛ-6 выбран из полномерного нативного белка.

12. Фармацевтическая композиция по п.8, отличающаяся тем, что она содержит дополнительно по меньшей мере один эксципиент, который фармацевтически совместим с цитокином семейства ИЛ-6 и с ИФН-α.

13. Фармацевтическая композиция по п.8, отличающаяся тем, что цитокин семейства ИЛ-6 и ИФН-α нанесены на соответствующие носители.

14. Фармацевтический набор для лечения вирусного заболевания, отличающийся тем, что он содержит по меньшей мере:
первый компонент, который включает по меньшей мере один цитокин семейства ИЛ-6, при этом упомянутый цитокин выбран из онкостатина М, кардиотрофина-1 и их комбинаций,
второй компонент, который включает по меньшей мере один ИФН-α.

15. Набор по п.14, отличающийся тем, что ИФН-α выбран из ИФН-α-2а, ИФН-α-2b, ИФН-α-5, консенсусного интерферона, очищенного ИФН-α, пэгилированного ИФН-α и их комбинаций.

16. Набор по п.14, отличающийся тем, что ИФН-α выбран из пэгилированного ИФН-α-2b, пэгилированного ИФН-α-2а, пэгилированного ИФН-α-5 и их комбинаций.

17. Набор по п.14, отличающийся тем, что цитокин семейства ИЛ-6 выбран из полного нативного белка.

18. Набор по п.14, отличающийся тем, что цитокин семейства ИЛ-6 выбран из полного нативного белка, и ИФН-α выбран из ИФН-α-2а, ИФН-α-2b, ИФН-α-5, консенсусного интерферона, очищенного ИФН-α, пэгилированного ИФН-α и их комбинаций.

19. Набор по п.14, отличающийся тем, что цитокин семейства ИЛ-6 выбран из полного нативного белка, и ИФН-α выбран из пэгилированного ИФН-α-2b, пэгилированного ИФН-α-2а, пэгилированного ИФН-α-5 и их комбинаций.

20. Набор по п.14, отличающийся тем, что цитокин семейства ИЛ-6 выбран из полного нативного белка и дополнительно включает третий компонент, который включает один или несколько эксципиентов, которые фармацевтически совместимы с цитокином семейства ИЛ-6 и с ИФН-α.

21. Набор по п.14, отличающийся тем, что цитокин семейства ИЛ-6 выбран из полного нативного белка и дополнительно включает третий компонент, который представляет один или несколько носителей, которые фармацевтически совместимы с цитокином семейства ИЛ-6 и с ИФН-α.

22. Набор по п.14, отличающийся тем, что цитокин семейства ИЛ-6 выбран из полного нативного белка, и первый компонент дополнительно включает по меньшей мере один эксципиент, который фармацевтически приемлем и совместим с цитокином семейства ИЛ-6 и с ИФН-α.

23. Набор по п.14, отличающийся тем, что цитокин семейства ИЛ-6 выбран из полного нативного белка, и второй компонент дополнительно включает один или несколько эксципиентов, которые фармацевтически приемлемы и совместимы с цитокином семейства ИЛ-6 и с ИФН-α.

24. Набор по п.14, отличающийся тем, что первый и второй компоненты присутствуют в одной и той же фармацевтической композиции.

25. Набор по п.14, отличающийся тем, что цитокин семейства ИЛ-6 выбран из полного нативного белка, и первый и второй компоненты присутствуют в одной и той же фармацевтической композиции.

26. Набор по п.14, отличающийся тем, что первый и второй компоненты присутствуют в раздельных фармацевтических композициях.

27. Набор по п.14, отличающийся тем, что цитокин семейства ИЛ-6 выбран из полного нативного белка, и первый и второй компоненты присутствуют в раздельных фармацевтических композициях.

28. Способ, предназначенный для лечения вирусного заболевания, который включает комбинированное введение терапевтически эффективного количества по меньшей мере одного цитокина семейства ИЛ-6, выбранного из онкостатина М, кардиотрофина-1 и их комбинаций, а также терапевтически эффективного количества по меньшей мере одного ИФН-α.

29. Способ по п.28, в котором ИФН-α выбран из ИФН-α-2а, ИФН-α-2b, ИФН-α-5, консенсусного интерферона, очищенного ИФН-α, пэгилированного ИФН-α и их комбинаций.

30. Способ по п.28, в котором ИФН-α выбран из пэгилированного ИФН-α-2b, пэгилированного ИФН-α-2а, пэгилированного ИФН-α-5 и их комбинаций.

31. Способ по п.28, отличающийся тем, что цитокин семейства ИЛ-6 выбран из полномерного нативного белка.

32. Способ по п.28, в котором вирусным заболеванием является гепатит С.

33. Способ по п.28, который включает комбинированное введение кардиотрофина-1 и ИФН-α.

34. Способ по п.28, который включает комбинированное введение онкостатина М и ИФН-α.

35. Способ по п.28, который включает комбинированное и одновременное введение кардиотрофина-1 и ИФН-α.

36. Способ по п.28, который включает комбинированное и одновременное введение онкостатина М и ИФН-α.

37. Способ по п.28, в котором цитокин семейства ИЛ-6 и ИФН-α присутствуют в одной и той же фармацевтической композиции, вводимой пациенту.

38. Способ по п.28, в котором цитокин семейства ИЛ-6 и ИФН-α вводятся в отдельных фармацевтических композициях.



 

Похожие патенты:

Изобретение относится к новому трициклическому соединению, конкретно 7-[N'-(4-тpифтopмeтилбeнзoил)-гидpaзинoкapбoнил]-тpициклo[3.2.2.0 2,4]нoн-8-ен-6-карбоновой кислоте формулы I, обладающей противовирусной активностью по отношению к ортопоксвирусам, которая может найти применение в медицине.
Изобретение относится к области фармакологии и медицины. .

Изобретение относится к новым химическим соединениям класса лупановых 2,3-секо-тритерпеноидов. .

Изобретение относится к области ветеринарной вирусологии и биотехнологии. .

Изобретение относится к соединениям формулы (Ia) или их фармацевтически приемлемым солям, таутомерам, или N-оксидам, для применения в профилактике или лечении болезненных состояний или заболеваний, опосредуемых циклин-зависимой киназой и гликоген синтаз киназой-3, таких, как раковые заболевания.
Изобретение относится к области ветеринарии. .
Изобретение относится к области фармакологии и медицины. .
Изобретение относится к области медицины, а именно к аэрозольным препаратам интерферона, которые могут использоваться для лечения вирусных и онкологических заболеваний.
Изобретение относится к медицине, а именно к урологии, и может быть использовано для лечения хронического бактериального простатита нехламидийной этиологии. .
Изобретение относится к ветеринарии и представляет собой композицию, обладающую пролонгированным противовирусным, иммуномодулирующим и антибактериальным действием, содержащую комплекс человеческого рекомбинантного интерферона альфа-2b, сорбированного на двух полимерах - декстране и метилцеллюлозе, антибиотик и солевой буфер для стабилизации рН в районе 5,0-7,5, а также лекарственное средство пролонгированного действия для ветеринарии в виде стерильного раствора для инъекций, содержащее вышеуказанную композицию.

Изобретение относится к ветеринарии и представляет собой композицию для ветеринарии, обладающую пролонгированным противовирусным и иммуномодулирующим действием, содержащую комплекс человеческого рекомбинантного интерферона альфа-2b, сорбированного на двух полимерах - декстране и метилцеллюлозе, и солевой буфер для стабилизации рН в районе 5,0-7,5, а также лекарственное средство пролонгированного действия для ветеринарии в виде стерильного раствора для инъекций или стерильного лиофилизата для приготовления раствора для инъекций, содержащее вышеуказанную композицию.
Изобретение относится к медицине и медицинской промышленности, а именно к технологии лекарственных средств, и представляет собой противовирусное средство в виде геля, содержащее интерферон человеческий лейкоцитарный, основу, консервант нипагин, отличающееся тем, что оно дополнительно содержит физиологический раствор, а в качестве основы хитозана сукцинат, при определенном соотношении компонентов в 1 мл смеси.

Изобретение относится к медицине и фармакологии и представляет собой стабильный фармацевтический состав для парентерального применения, который содержат в одном резервуаре фиксированные дозы рекомбинантных интерферонов гамма и альфа 2b для лечения патологических явлений, характеризующихся доброкачественным нефизиологическим или злокачественным клеточным ростом тканей или органов, и который дополнительно содержат фармацевтически приемлемые наполнители или носители.

Изобретение относится к медицине, а именно к онкологии, и может быть использовано при лечении местно-распространенного и диссеминированного почечно-клеточного рака.

Изобретение относится к новым вариантам пептидов ИЛ-21, где аминокислоты делегированы и/или заменены в области, состоящей из аминокислот 83-96, а также их применению для изготовления лекарственного средства для лечения рака.
Наверх