Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения



Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения
Устойчивые к гербицидам растения подсолнечника, полинуклеотиды, кодирующие устойчивые к гербицидам белки большой субъединицы ацетогидроксиацидсинтазы, и способы применения

 

C12N15 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2415566:

ЭДВАНТА СИДЗ, Б.В. (NL)
БАСФ АГРОКЕМИКАЛ ПРОДАКТС Б.В. (NL)

Растительный материал обрабатывают мутагеном или трансформируют полинуклеотидной конструкцией, содержащей последовательность нуклеиновой кислоты, кодирующей мутантный полипептид большой субъединицы ацетогидроксиацидсинтазы (AHASL). В результате растения приобретают толерантность к широкому ряду гербицидов. 25 н. и 49 з.п. ф-лы, 2 ил., 6 табл.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Изобретение относится к области сельскохозяйственной биотехнологии, в частности к устойчивым к гербицидам растениям подсолнечника и новым полинуклеотидным последовательностям, кодирующим белки большой субъединицы ацетогидроксиацидсинтазы подсолнечника дикого типа, устойчивые к имидазолинонам.

ОБЛАСТЬ ТЕХНИКИ

Ацетогидроксиацидсинтаза (AHAS; EC 4.1.3.18, также известная как ацетолактатсинтаза или ALS) представляет собой первый фермент, катализирующий биохимический синтез аминокислот с разветвленной цепью, таких как валин, лейцин и изолейцин (Singh (1999) "Biosynthesis of valine, leucine and isoleucine", в Plant Amino Acid, Singh, B.K., ed., Marcel Dekker Inc. New York, New York, pp.227-247). AHAS является объектом действия пяти структурно различных семейств гербицидов, включающих в себя сульфонилкарбамиды (Tan et al. (2005) Pest Manag. Sci. 61:246-57; Mallory-Smith и Retzinger (2003) Weed Technology 17:620-626; 'LaRossa и Falco (1984) Trends Biotechnol. 2:158-161), имидазолиноны (Shaner et al. (1984) Plant Physiol. 76:545-546), триазолопиримидины (Subramanian и Gerwick (1989) "Inhibition of acetolactate synthase by triazolopyrimidines", в Biocatalysis in Agricultural Biotechnology, Whitaker, J.R. и Sonnet, P.E. eds., ACS Symposium Series, American Chemical Society, Washington, D.C., pp. 277-288), Tan et al. (2005) Pest Manag. Sci. 61:246-57; Mallory-Smith и Retzinger (2003) Weed Technology 17:620-626), сульфониламинокарбонилтриазолиноны (Tan et al. (2005) Pest Manag. Sci. 61:246-57; Mallory-Smith и Retzinger (2003) Weed Technology 17:620-626). Имидазолиноновые и сульфонилкарбамидные гербициды широко применяют в современном сельском хозяйстве вследствие их эффективности при очень низких нормах внесения и относительной нетоксичности для животных. Ингибируя активность AHAS, эти семейства гербицидов препятствуют дальнейшему росту и развитию чувствительных растений, включая многие виды сорняков. Некоторые примеры коммерчески доступных имидазолиноновых гербицидов представляют собой PURSUIT® (имазетапир), SCEPTER® (имазаквин) и ARSENAL® (имазапир). Примеры сульфонилкарбамидных гербицидов представляют собой хлорсульфурон, метсульфуронметил, сульфометуронметил, хлоримуронэтил, тифенсульфуронметил, трибенуронметил, бенсульфуронметил, никосульфурон, этаметсульфуронметил, римсульфурон, трифлусульфуронметил, триасульфурон, примисульфуронметил, циносульфурон, амидосульфурон, флузасульфурон, имазосульфурон, пиразосульфуронэтил и галогенсульфурон.

Вследствие своей высокой эффективности и низкой токсичности имидазолиноновые гербициды являются предпочтительными для применения посредством распыления над обширными областями роста растений. Возможность распылять гербицид над широким диапазоном растений уменьшает издержки, связанные с разработкой и поддержанием плантации, и уменьшает необходимость в подготовке участка до применения таких химических веществ. Распыление над желательными устойчивыми видами также дает возможность получения максимально возможного выхода урожая желательных видов вследствие отсутствия конкурентных видов. Однако возможность применения таких способов распыления зависит от наличия устойчивых к имидазолинонам видов желательных растений в области распыления.

Среди основных сельскохозяйственных зерновых некоторые виды бобовых, такие как соя, имеют природную устойчивость к имидазолиноновым гербицидам вследствие их способности быстро метаболизировать гербицидные соединения (Shaner и Robinson (1985) Weed Sci. 33:469-471). Другие зерновые, такие как кукуруза (Newhouse et al. (1992) Plant Physiol. 100:882886) и рис (Barrett et al. (1989) Crop Safeners for Herbicides, Academic Press, New York, pp.195-220), в некоторой степени чувствительны к имидазолиноновым гербицидам. Неодинаковая чувствительность к имидазолиноновым гербицидам зависит от химической природы конкретного гербицида и различного метаболизма соединения от токсической до нетоксической формы в каждом растении (Shaner et al. (1984) Plant Physiol. 76:545-546; Brown et al. (1987) Pestic. Biochem. Physiol. 27:24-29). Важную роль в чувствительности также играют другие физиологические различия растений, такие как всасывание и передвижение веществ (Shaner и Robinson (1985), Weed Sci. 33:469-471).

Устойчивые к имидазолинонам, сульфонилкарбамидам и триазолопиримидинам растения были с успехом получены с применением мутагенеза семян, микроспор, пыльцы и каллюса у Zea mays, Arabidopsis thaliana, Brassica napus (т.е. канола), Glycine max, Nicotiana tabacum и Oryza sativa (Sebastian et al. (1989) Crop Sci. 29:1403-1408; Swanson et al. 1989 Theor. Appl. Genet. 78:525-530; Newhouse et al. (1991) Theor. Appl Genet. 83:65-70; Sathasivan et al. (1991) Plant Physiol. 97:1044-1050; Mourand et al. (1993) J. Heredity 84:91-96; патент США № 5545822). Во всех случаях устойчивость придавал конкретный доминантный ядерный ген. Ранее также выделили четыре устойчивых к имидазолинонам растения пшеницы после мутагенеза семян Triticum aestivum L. cv. Fidel (Newhouse et al. (1992) Plant Physiol. 100:882-886). Исследования наследственности подтвердили, что устойчивость обуславливается конкретным частично-доминантным геном. Основываясь на изучении аллелей, авторы заключили, что мутации в четырех идентифицированных линиях располагались в одном и том же локусе. Один из генов устойчивости сортов Fidel обозначили как FS-4 (Newhouse et al. (1992) Plant Physiol. 100:882-886).

Природные популяции растений, для которых было обнаружено, что они устойчивы к имидазолиноновым и/или сульфонилкарбамидным гербицидам, также использовали для получения устойчивых к гербицидам селекционных линий подсолнечника. Недавно были созданы две линии, устойчивые к сульфонилкарбамидному гербициду, с применением в качестве источника признака устойчивости к гербициду генетического материала, происходящего из популяции подсолнечника обыкновенного дикого типа (Helianthus annuus) (Miller и Al-Khatib (2004), Crop Sci. 44:1037-1038). Ранее White et al. ((2002) Weed Sci. 50:432-437) сообщили, что отдельные представители из популяции подсолнечника обыкновенного дикого типа из Южной Дакоты, США, были перекрестно-устойчивыми к имидазолиноновому и сульфонилкарбамидному гербициду. Анализ части кодирующей области генов большой субъединицы ацетогидроксиацидсинтазы (AHASL) отдельных представителей указанной популяции выявил точечную мутацию, приводящую к замене в белке AHASL подсолнечника аминокислоты Ala, которая соответствует Ala205 в белке AHASL Arabidopsis thaliana дикого типа, на Val (White et al. (2003) Weed Sci. 51:845-853).

С помощью компьютерного моделирования трехмерной конформации комплекса AHAS-ингибитор предсказано несколько аминокислот в предполагаемом связывающем ингибитор кармане в качестве участков, где индуцированные мутации, вероятно, могли бы придавать избирательную устойчивость к имидазолинонам (Ott et al. (1996) J. Mol. Biol. 263:359-368). Растения пшеницы, полученные с некоторыми мутациями, созданными на основании этих умозаключений в предполагаемых связывающих участках фермента AHAS, действительно проявляли избирательную устойчивость к одному из классов гербицидов (Ott et al. (1996) J. Mol. Biol. 263:359-368).

Об устойчивости растений к имидазолиноновым гербицидам также сообщалось в ряде патентов. В патентах США №№ 4761373, 5331107, 5304732, 6211438, 6211439 и 6222100, в общем, описано применение измененного гена AHAS для получения у растений устойчивости к гербицидам, и, в частности, описаны устойчивые к некоторым имидазолинонам линии кукурузы. В патенте США № 5013659 описаны растения, проявляющие устойчивость к гербицидам вследствие мутаций по меньшей мере одной аминокислоты в одной или нескольких консервативных областях. Описанные в этих документах мутации кодируют либо перекрестную устойчивость к имидазолинонам и сульфонилкарбамидам, либо устойчивость, специфичную по отношению к сульфонилкарбамидам, но устойчивость, специфичная по отношению к имидазолинонам, не была описана. В патенте США № 5731180 и патенте США № 5767361 описан выделенный ген с одной аминокислотной заменой в аминокислотной последовательности AHAS однодольных дикого типа, приводящей к специфичной по отношению к имидазолинонам устойчивости. Кроме того, посредством мутационной селекции, а также посредством отбора устойчивых к гербицидам растений из группы растений риса, полученных посредством культуры пыльников, были созданы растения риса, устойчивые к гербицидам, которые препятствуют AHAS (см. патенты США №№ 5545822, 5736629, 5773703, 5773704, 5952553 и 6274796).

У растений, как и у всех других исследованных организмов, фермент AHAS состоит из двух субъединиц: большой субъединицы (каталитическая функция) и малой субъединицы (регуляторная функция) (Duggleby и Pang (2000) J. Biochem. Mol. Biol. 33:1-36). Большая субъединица AHAS (также обозначаемая в настоящем документе как AHASL) может кодироваться одним геном, как в случае Arabidopsis и риса, или несколькими представителями семейства генов, как у кукурузы, канолы и хлопка. Специфические однонуклеотидные замены в большой субъединице придают ферменту определенную степень устойчивости к одному или нескольким классам гербицидов (Chang и Duggleby (1998), Biochem J. 333:765-777).

Например, пшеница мягкая, Triticum aestivum L., содержит три гомологичных гена большой субъединицы ацетогидроксиацидсинтазы. Каждый из указанных генов демонстрирует значительную экспрессию, основываясь на ответе на гербициды и биохимических данных о мутантах по каждому из трех генов (Ascenzi et al. (2003) International Society of Plant Molecular Biologists Congress, Barcelona, Spain, Ref. No. S10-17). Кодирующие последовательности всех трех генов обладают большой гомологией на нуклеотидном уровне (WO 03/014357). С помощью секвенирования генов AHASL нескольких сортов Triticum aestivum было обнаружено, что в основе молекулярной устойчивости к гербицидам у большинства толерантных к IMI (толерантных к имидазолинонам) линий лежит мутация S653(At)N, обозначающая замену серина на аспарагин в положении, эквивалентном серину в положении аминокислоты 653 у Arabidopsis thaliana (WO 03/01436; WO 03/014357). Эта мутация является следствием однонуклеотидного полиморфизма (SNP) в последовательности ДНК, кодирующей белок AHASL.

Учитывая высокую эффективность и низкую токсичность имидазолиноновых гербицидов, они являются предпочтительными для применения в сельском хозяйстве. Однако возможность использовать имидазолиноновые гербициды в конкретной области растениеводства зависит от доступности устойчивых к имидазолинонам сортов представляющих интерес сельскохозяйственных культур. Для получения таких устойчивых к имидазолинонам сортов селекционерам необходимо получить селекционные линии со свойством устойчивости к имидазолинонам. Таким образом, необходимы дополнительные устойчивые к имидазолинонам селекционные линии и сорта сельскохозяйственных культур, а также способы и композиции для получения и применения устойчивых к имидазолинонам селекционных линий и сортов.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к растениям подсолнечника с повышенной по сравнению с растением подсолнечника дикого типа устойчивостью к гербицидам. В частности, растения подсолнечника по изобретению обладают повышенной по сравнению с растением подсолнечника дикого типа устойчивостью по меньшей мере к одному гербициду, препятствующему активности фермента AHAS. Устойчивые к гербицидам растения подсолнечника по изобретению содержат по меньшей мере одну копию гена или полинуклеотида, которая кодирует устойчивую к гербицидам большую субъединицу ацетогидроксиацидсинтазы 1 (AHASL1). Такой устойчивый к гербицидам белок AHASL1 содержит в положении аминокислоты 182 или эквивалентном положении лейцин, аланин, треонин, гистидин, аргинин или изолейцин. Устойчивое к гербицидам растение подсолнечника по изобретению может содержать одну, две, три, четыре или более копий гена или полинуклеотида, кодирующего устойчивый к гербицидам белок AHASL1 по изобретению. Растения подсолнечника по изобретению также включают в себя семена и потомство, которые содержат по меньшей мере одну копию гена или полинуклеотида, кодирующего устойчивый к гербицидам белок AHASL1 по изобретению.

В одном из вариантов осуществления настоящее изобретение относится к устойчивым к гербицидам растениям подсолнечника, происходящим из линии подсолнечника, которая обозначена как MUT28. Образец семян линии MUT28 депонирован в American Type Culture Collection (ATCC) с номером патентного депонирования ATCC № PTA-6084. Такие растения подсолнечника MUT28 содержат ген AHASL1, содержащий нуклеотидную последовательность SEQ ID NO: 1, и кодирующий белок AHASL1, содержащий аминокислотную последовательность SEQ ID NO: 2. По сравнению с аминокислотной последовательностью белка AHASL1 (SEQ ID NO: 4), кодируемой геном AHASL1 (SEQ ID NO: 3) растения подсолнечника дикого типа, аминокислотная последовательность SEQ ID NO: 2 отличается от аминокислотной последовательности дикого типа одной аминокислотой. В аминокислотной последовательности SEQ ID NO: 2 аминокислота в положении 182 представляет собой лейцин. В аминокислотной последовательности дикого типа SEQ ID NO: 4 аминокислота в этом положении представляет собой пролин.

Настоящее изобретение также относится к выделенным полинуклеотидам и выделенным полипептидам белков AHASL1 подсолнечника (Helianthus annuus). Полинуклеотиды по изобретению включают в себя нуклеотидные последовательности, кодирующие устойчивые к гербицидам белки AHASL1 и белки AHASL1 дикого типа. Устойчивые к гербицидам белки AHASL1 по изобретению представляют собой устойчивые к гербицидам белки AHASL1, несущие по сравнению с соответствующей аминокислотной последовательностью дикого типа в положении 128 в их соответствующих аминокислотных последовательностях замену пролина на лейцин. Полинуклеотиды по изобретению включают в себя нуклеотидные последовательности SEQ ID NO: 1 и 3, нуклеотидные последовательности, кодирующие аминокислотные последовательности SEQ ID NO: 2 и 4, и фрагменты и варианты указанных нуклеотидных последовательностей, кодирующие белки, обладающие активностью AHAS. Полинуклеотиды по изобретению дополнительно включают нуклеотидные последовательности, кодирующие зрелые формы описанных выше белков AHASL1, в частности нуклеотидные последовательности SEQ ID NO: 5 и 7, нуклеотидные последовательности, кодирующие аминокислотные последовательности SEQ ID NO: 6 и 8, и фрагменты и варианты указанных нуклеотидных последовательностей, кодирующие белки, обладающие активностью AHAS. У таких зрелых форм белков AHASL1 отсутствует транзитный пептид хлоропластов, являющийся частью полноразмерных белков AHASL1.

Настоящее изобретение относится к экспрессирующим кассетам для экспрессии полинуклеотидов по изобретению в растениях, клетках растений и других клетках-хозяевах, не являющихся клетками человека. Экспрессирующие кассеты содержат промотор, экспрессирующийся в растении, клетке растения или других представляющих интерес клетках-хозяевах, функционально связанный с полинуклеотидом по изобретению, кодирующим либо белок AHASL1 дикого типа, либо устойчивый к гербицидам белок AHASL1. Если необходимо для направленной экспрессии в хлоропластах, экспрессирующая кассета также может содержать функционально связанную последовательность для направленного транспорта в хлоропласты, кодирующую транзитный пептид хлоропластов для направления экспрессируемого белка AHASL1 в хлоропласт. Экспрессирующие кассеты по изобретению можно использовать в способе повышения толерантности растения и клетки-хозяина к гербицидам. Способ предусматривает трансформирование растения или клетки-хозяина экспрессирующей кассетой по изобретению, где экспрессирующая кассета содержит промотор, способный экспрессироваться в представляющих интерес растении или клетке-хозяине, и указанный промотор функционально связан с полинуклеотидом по изобретению, кодирующим устойчивый к гербицидам белок AHASL1 по изобретению. Способ также включает в себя регенерацию трансформированного растения из трансформированной растительной клетки.

Настоящее изобретение относится к способу повышения активности AHAS в растении, включающему в себя трансформацию растительной клетки полинуклеотидной конструкцией, содержащей нуклеотидную последовательность, функционально связанную с промотором, направляющим экспрессию в растительной клетке, и регенерацию растения из трансформированной растительной клетки. Нуклеотидную последовательность выбирают из тех нуклеотидных последовательностей, которые кодируют устойчивые к гербицидам белки AHASL1 или белки AHASL1 дикого типа по изобретению, в частности нуклеотидных последовательностей SEQ ID NO: 1, 3, 5 и 7, нуклеотидных последовательностей, кодирующих аминокислотные последовательности SEQ ID NO: 2, 4, 6 и 8, и их фрагментов и вариантов. Полученное этим способом растение обладает повышенной по сравнению с нетрансформированным растением активностью AHAS.

Настоящее изобретение относится к способу получения устойчивого к гербицидам растения, который включает в себя трансформацию растительной клетки полинуклеотидной конструкцией, содержащей нуклеотидную последовательность, функционально связанную с промотором, направляющим экспрессию в растительной клетке, и регенерацию трансформированного растения из указанной трансформированной растительной клетки. Нуклеотидную последовательность выбирают из тех нуклеотидных последовательностей, которые кодируют устойчивые к гербицидам белки AHASL1 по изобретению, в частности нуклеотидных последовательностей SEQ ID NO: 1 и 5, нуклеотидных последовательностей, кодирующих аминокислотные последовательности SEQ ID NO: 2 и 6, и их фрагментов и вариантов, включая в качестве неограничивающих примеров зрелые формы устойчивых к гербицидам белков AHASL1 по изобретению. Полученное указанным способом устойчивое к гербицидам растение обладает по сравнению с нетрансформированным растением повышенной устойчивостью по меньшей мере к одному гербициду, в частности к гербициду, препятствующему активности фермента AHAS, к такому, например, как имидазолиноновый гербицид или сульфонилкарбамидный гербицид.

Настоящее изобретение относится к способу повышения толерантности к гербицидам у толерантного к гербицидам растения. Этот способ можно использовать для повышения устойчивости растения, которое уже устойчиво к уровню гербицида, который мог бы уничтожить или оказать значительный вред растению дикого типа. Такое толерантное к гербицидам растение может представлять собой толерантное к гербицидам растение, которое для придания толерантности к гербицидам изменили методами генетической инженерии, или устойчивое к гербицидам растение, полученное способами, не затрагивающими рекомбинантную ДНК, например, такими как растения подсолнечника MUT28 по настоящему изобретению. Способ предусматривает трансформацию толерантного к гербицидам растения полинуклеотидной конструкцией, содержащей нуклеотидную последовательность, функционально связанную с промотором, направляющим экспрессию в растительной клетке, и регенерацию трансформированного растения из трансформированной растительной клетки. Нуклеотидную последовательность выбирают из тех нуклеотидных последовательностей, которые кодируют устойчивые к гербицидам белки AHASL1 по изобретению, в частности, нуклеотидных последовательностей SEQ ID NO: 1 и 5, нуклеотидных последовательностей, кодирующих аминокислотные последовательности SEQ ID NO: 2 и 6, и их фрагментов и вариантов.

Настоящее изобретение относится к трансформирующим векторам, содержащим ген селективного маркера по изобретению. Ген селективного маркера содержит промотор, направляющий экспрессию в клетке-хозяине, функционально связанный с полинуклеотидом, содержащим нуклеотидную последовательность, кодирующую устойчивый к гербицидам белок AHASL1 по изобретению. Трансформирующий вектор может также содержать представляющий интерес ген для экспрессии в клетке-хозяине и также может, если желательно, включать в себя последовательность для направленного транспорта в хлоропласты, функционально связанную с полинуклеотидом по изобретению.

Настоящее изобретение также относится к способам применения трансформирующих векторов по изобретению для отбора клеток, трансформированных представляющим интерес геном. Такие способы предусматривают трансформацию клетки-хозяина трансформирующим вектором, воздействие на клетку таким уровнем имидазолинонового или сульфонилкарбамидного гербицида, который мог бы уничтожить нетрансформированную клетку-хозяина или ингибировать ее рост, и идентификацию трансформированной клетки-хозяина по ее способности расти в присутствии гербицида. В одном из вариантов осуществления изобретения клетка-хозяин представляет собой растительную клетку, а ген селективного маркера содержит промотор, направляющий экспрессию в растительной клетке.

Настоящее изобретение относится к способу контроля за сорняками вблизи от устойчивых к гербицидам растений по изобретению, включая описанные выше устойчивые к гербицидам растения подсолнечника и растения, трансформированные полинуклеотидами устойчивых к гербицидам AHASL1 по изобретению. Такие трансформированные растения содержат в геноме по меньшей мере одну экспрессирующую кассету, содержащую промотор, направляющий экспрессию гена в растительной клетке, где промотор функционально связан с полинуклеотидом AHASL1 по изобретению. Способ предусматривает нанесение эффективного количества гербицида на сорняки и на устойчивое к гербициду растение, где устойчивое к гербицидам растение по сравнению с растением дикого типа или нетрансформированным растением обладает повышенной устойчивостью по меньшей мере к одному гербициду, в частности к имидазолиноновому или сульфонилкарбамидному гербициду.

Растения по настоящему изобретению могут быть трансгенными или нетрансгенными. Пример нетрансгенного растения подсолнечника с повышенной устойчивостью к имидазолиноновым и/или сульфонилкарбамидным гербицидам включает в себя растение подсолнечника (MUT28) с номером патентного депонирования ATCC PTA-6084; или мутантное, рекомбинантное или генетически сконструированное производное растения с номером патентного депонирования ATCC PTA-6084; или растение, являющееся потомком любого из указанных растений; или растение, обладающее свойствами устойчивости к гербицидам растения с номером патентного депонирования ATCC PTA-6084.

Настоящее изобретение также относится к растениям, органам растений, тканям растений, растительным клеткам, семенам и клеткам-хозяевам, не являющимся клетками человека, трансформированным по меньшей мере одним полинуклеотидом, одной экспрессирующей кассетой или одним трансформирующим вектором по изобретению. Такие трансформированные растения, органы растений, ткани растений, растительные клетки, семена и клетки-хозяева, не являющиеся клетками человека, обладают повышенной толерантностью или устойчивостью по меньшей мере к одному гербициду при уровнях гербицида, которые соответственно уничтожают нетрансформированное растение, ткани растения, растительную клетку или клетку-хозяина, не являющуюся клеткой человека, или ингибируют их рост. Предпочтительно, трансформированные растения, ткани растений, растительные клетки и семена по изобретению представляют собой Arabidopsis thaliana и сельскохозяйственные культуры.

Настоящее изобретение также относится к выделенным полипептидам, включающим в себя устойчивые к имидазолинонам белки AHASL1 подсолнечника и белки AHASL1 подсолнечника дикого типа. Выделенные полипептиды содержат аминокислотные последовательности SEQ ID NO: 2 и 4, аминокислотные последовательности, кодируемые нуклеотидными последовательностями SEQ ID NO: 1 и 3, и фрагменты и варианты указанных аминокислотных последовательностей, в которых закодированы белки, обладающие активностью AHAS, включая в качестве неограничивающих примеров зрелые формы белков AHASL1 по изобретению, представляющие собой белки SEQ ID NO: 6 и 8 и белки, кодируемые нуклеотидными последовательностями SEQ ID NO: 5 и 7.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

Фиг. 1 представляет собой выравнивание нуклеотидных последовательностей полных кодирующих последовательностей устойчивого к гербицидам гена AHASL1 подсолнечника (SEQ ID NO: 1), гена AHASL1 подсолнечника дикого типа (SEQ ID NO: 3) и устойчивого к гербицидам гена AHASL1 Xanthium sp. (SEQ ID NO: 9, номер доступа GenBank U16280). На чертеже 1248-3, HA89 и Xanthium соответствуют SEQ ID NO: 1, 3 и 9 соответственно. Звездочка указывает участок единичной мутации, обнаруженный в кодирующей последовательности устойчивого к гербицидам AHASL1 подсолнечника. Мутация представляет собой транзицию C на T по нуклеотиду 545 (кодон 182) в SEQ ID NO: 1. Светлые затемненные области указывают на то, что нуклеотид в этом положении является консервативным для трех выравниваемых последовательностей. Темные области указывают на то, что нуклеотид в этом положении консервативен для двух из трех последовательностей.

Фиг. 2 представляет собой выравнивание аминокислотных последовательностей устойчивого к гербицидам белка AHASL1 подсолнечника (SEQ ID NO: 2), белка AHASL1 подсолнечника дикого типа (SEQ ID NO: 4) и устойчивого к гербицидам белка AHASL1 Xanthium sp. (SEQ ID NO: 10, номер доступа в GenBank U16280). На чертеже 1248-3, HA89 и Xanthium соответствуют SEQ ID NO: 2, 4 и 10 соответственно. Звездочка указывает на участок единичной аминокислотной замены, обнаруженный в устойчивом к гербицидам белке AHASL1 подсолнечника. В устойчивом к гербицидам белке (SEQ ID NO: 2) пролин в положении аминокислоты 182 белка дикого типа (SEQ ID NO: 4) заменен лейцином. Светлые затемненные области указывают на то, что аминокислота в этом положении является консервативной для трех выравниваемых последовательностей. Темные области указывают на то, что аминокислота в этом положении консервативна для двух из трех последовательностей. Аминокислоты, представленные полужирным шрифтом, являются консервативными аминокислотными заменами.

СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ

Нуклеотидные и аминокислотные последовательности, перечисленные в приложенном списке последовательностей, приведены с использованием стандартных буквенных сокращений для нуклеиновых оснований и трехбуквенного кода для аминокислот. Нуклеотидные последовательности расположены в стандартном порядке, начиная с 5'-конца последовательности, и продолжаются (т.е. слева направо в каждой строке) до 3'-конца. Приведена только одна цепь каждой последовательности нуклеиновой кислоты, но подразумевается включение комплементарной цепи при любом указании приведенной цепи. Аминокислотные последовательности расположены в стандартном порядке, начиная с N-конца последовательности, и продолжаются (т.е. слева направо в каждой строке) до C-конца.

В SEQ ID NO: 1 приведена нуклеотидная последовательность, кодирующая устойчивый к гербицидам белок AHASL1 подсолнечника. При сравнении с последовательностью с номером доступа в GenBank U16280 зрелая форма белка AHASL1 кодируется нуклеотидной последовательностью, которая соответствует нуклеотидам 253-1965 SEQ ID NO: 1, а транзитный пептид кодируется нуклеотидами 1-252.

В SEQ ID NO: 2 приведена аминокислотная последовательность устойчивого к гербицидам белка AHASL1 подсолнечника. При сравнении с последовательностью с номером доступа в GenBank U16280 аминокислотная последовательность зрелой формы белка AHASL1 соответствует аминокислотам 85-655 SEQ ID NO: 2, а транзитный пептид соответствует аминокислотам 1-84.

В SEQ ID NO: 3 приведена нуклеотидная последовательность, кодирующая белок AHASL1 подсолнечника. При сравнении с последовательностью с номером доступа в GenBank U16280 зрелая форма белка AHASL1 кодируется нуклеотидной последовательностью, которая соответствует нуклеотидам 253-1965 SEQ ID NO: 3, а транзитный пептид кодируется нуклеотидами 1-252.

В SEQ ID NO: 4 приведена аминокислотная последовательность белка AHASL1 подсолнечника. При сравнении с последовательностью с номером доступа в GenBank U16280 аминокислотная последовательность зрелой формы белка AHASL1 соответствует аминокислотам 85-655 SEQ ID NO: 4, а транзитный пептид соответствует аминокислотам 1-84.

В SEQ ID NO: 5 приведена нуклеотидная последовательность, кодирующая зрелый устойчивый к гербицидам белок AHASL1 подсолнечника. Эта нуклеотидная последовательность соответствует нуклеотидам 253-1965 SEQ ID NO: 1.

В SEQ ID NO: 6 приведена аминокислотная последовательность зрелого устойчивого к гербицидам белка AHASL1 подсолнечника. Эта аминокислотная последовательность соответствует аминокислотам 85-655 SEQ ID NO: 2.

В SEQ ID NO: 7 приведена нуклеотидная последовательность, кодирующая зрелый белок AHASL1 подсолнечника. Эта нуклеотидная последовательность соответствует нуклеотидам 253-1965 SEQ ID NO: 3.

В SEQ ID NO: 8 приведена аминокислотная последовательность зрелого белка AHASL1 подсолнечника. Эта аминокислотная последовательность соответствует аминокислотам 85-655 SEQ ID NO: 4.

В SEQ ID NO: 9 приведена нуклеотидная последовательность, депонированная под номером доступа в GenBank U16280.

В SEQ ID NO: 10 приведена аминокислотная последовательность, депонированная под номером доступа в GenBank U16280.

В SEQ ID NO: 11 приведена нуклеотидная последовательность праймера ALS1-1F, описанного в примере 2.

В SEQ ID NO: 12 приведена нуклеотидная последовательность праймера ALS1-1R, описанного в примере 2.

В SEQ ID NO: 13 приведена нуклеотидная последовательность праймера ALS1-2F, описанного в примере 2.

В SEQ ID NO: 14 приведена нуклеотидная последовательность праймера ALS1-2R, описанного в примере 2.

В SEQ ID NO: 15 приведена нуклеотидная последовательность праймера ALS1-3F, описанного в примере 2.

В SEQ ID NO: 16 приведена нуклеотидная последовательность праймера ALS1-3R, описанного в примере 2.

В SEQ ID NO: 17 приведена нуклеотидная последовательность праймера ALS-3F, описанного в примере 2.

В SEQ ID NO: 18 приведена нуклеотидная последовательность праймера SUNALS1F, описанного в примере 2.

В SEQ ID NO: 19 приведена нуклеотидная последовательность праймера ALS-6R, описанного в примере 2.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к растениям подсолнечника с повышенной по сравнению с растением подсолнечника дикого типа устойчивостью к гербицидам. Устойчивые к гербицидам растения подсолнечника получали, как описано в данном документе ниже, путем воздействия на растения подсолнечника дикого типа (в отношении устойчивости к гербицидам) мутагеном, позволения растениям созревать и репродуцироваться и отбора растений-потомков, демонстрирующих повышенную устойчивость к имидазолиноновому гербициду по сравнению с устойчивостью растения подсолнечника дикого типа. Изобретение относится к устойчивой к гербицидам линии подсолнечника, которая в настоящем документе обозначена как MUT28.

Из устойчивых к гербицидам растений подсолнечника MUT28 и растений подсолнечника дикого типа выделяли путем амплификации с помощью полимеразной цепной реакции (ПЦР) и секвенировали кодирующую область гена большой субъединицы ацетогидроксиацидсинтазы (обозначенной как AHASL1). При сравнении полинуклеотидных последовательностей устойчивых к гербицидам растений подсолнечника и растений подсолнечника дикого типа было обнаружено, что кодирующая область полинуклеотидной последовательности AHASL1 устойчивого к гербицидам растения подсолнечника отличается от полинуклеотидной последовательности AHASL1 растения дикого типа на один нуклеотид, транзиция C на T в нуклеотиде 545 (фиг. 1). Эта транзиция C на T в полинуклеотидной последовательности AHASL1 приводит к замене Pro на Leu по аминокислоте 182 в консервативной области предсказанной аминокислотной последовательности белка AHASL1 по сравнению с аминокислотной последовательностью белка AHASL1 дикого типа (фиг. 2). Установлено, что ряд замен пролина на другую аминокислоту, включая замену Pro на Leu, в указанной консервативной области растительных белков AHASL придают растению, содержащему такой белок AHASL, устойчивость к имидазолиноновым и/или сульфонилкарбамидным гербицидам (см. Boutsalis et al. (1999) Pestic. Sci. 55:507-516; Guttieri et al. (1992) Weed Sci. 40:670-678; Guttieri et al. (1995) Weed Sci. 43:143-178 и патент США № 5141870; каждая из указанных публикаций включена в настоящий документ в качестве ссылки. См. также пример 3 ниже).

Используемый в настоящем документе, если не указано иначе или не очевидно из контекста, термин "растение" включает в себя в качестве неограничивающих примеров растительные клетки, протопласты растений, тканевые культуры растительных клеток, из которых можно регенерировать растения, каллюсы растений, группу растений с общей корневой системой, растительные клетки, являющиеся интактными в растениях, или части растений, такие как зародыши, пыльца, семяпочка, семена, семядоли, листья, стебли, цветы, ветви, черешки листьев, плоды, корни, кончики корней, пыльники и т.п.

Изобретение также относится к выделенным молекулам полинуклеотидов, содержащих нуклеотидные последовательности, кодирующие белки большой субъединицы ацетогидроксиацидсинтазы (AHASL), и к таким белкам AHASL. Изобретение относится к выделению и нуклеотидной последовательности полинуклеотида, кодирующего устойчивый к гербицидам белок AHASL1 подсолнечника из устойчивого к гербицидам растения подсолнечника, полученного путем химического мутагенеза растений подсолнечника дикого типа. Устойчивые к гербицидам белки AHASL1 по изобретению несут по сравнению с соответствующей аминокислотной последовательностью дикого типа в соответствующих аминокислотных последовательностях замену пролина на лейцин в положении 182. Изобретение также относится к выделению и нуклеотидной последовательности молекулы полинуклеотида, кодирующей белок AHASL1 подсолнечника дикого типа.

Настоящее изобретение относится к выделенным молекулам полинуклеотидов, кодирующим белки AHASL1 подсолнечника (Helianthus annuus L.). В частности, изобретение относится к выделенным молекулам полинуклеотидов, содержащим нуклеотидные последовательности SEQ ID NO: 1 и 3, нуклеотидные последовательности, кодирующие белки AHASL1, содержащие аминокислотные последовательности SEQ ID NO: 2 и 4, и фрагментам и вариантам таких нуклеотидных последовательностей, которые кодируют функциональные белки AHASL1.

Кроме того, настоящее изобретение относится к выделенным полинуклеотидам, кодирующим зрелые белки AHASL1. У зрелых белков AHASL1 по изобретению отсутствует транзитный пептид хлоропластов, находящийся на N-конце каждого белка AHASL1, но сохраняется активность AHAS. В частности, полинуклеотиды по изобретению содержат нуклеотидную последовательность, выбранную из группы, состоящей из нуклеотидных последовательностей SEQ ID NO: 5 и 7, нуклеотидных последовательностей, кодирующих аминокислотные последовательности SEQ ID NO: 6 и 8, и фрагментов и вариантов указанных нуклеотидных последовательностей, которые кодируют зрелый полипептид AHASL1, обладающий активностью AHAS.

Выделенные молекулы полинуклеотида устойчивого к гербицидам AHASL1 по изобретению содержат нуклеотидные последовательности, которые кодируют устойчивые к гербицидам белки AHASL1. Такие полинуклеотидные молекулы можно применять в полинуклеотидных конструкциях для трансформации растений, в частности сельскохозяйственных культур, с целью повышения устойчивости растений к гербицидам, в частности к гербицидам, для которых установлено, что они ингибируют активность AHAS, более конкретно к имидазолиноновым гербицидам. Такие полинуклеотидные конструкции можно использовать в экспрессирующих кассетах, экспрессирующих векторах, трансформирующих векторах, плазмидах и т.п. Трансгенные растения, полученные после трансформации такими полинуклеотидными конструкциями, демонстрируют повышенную устойчивость к ингибирующим AHAS гербицидам, например, таким как имидазолиноновые и сульфонилкарбамидные гербициды.

Композиции по изобретению включают в себя нуклеотидные последовательности, кодирующие белки AHASL1. В частности, настоящее изобретение относится к выделенным полинуклеотидным молекулам, содержащим нуклеотидные последовательности, кодирующие аминокислотные последовательности SEQ ID NO: 2, 4, 6 и 8, и их фрагментам и вариантам, кодирующим полипептиды, обладающие активностью AHAS. Также предоставляются полипептиды с аминокислотной последовательностью, кодируемой полинуклеотидной молекулой, описанной в данном документе, например полинуклеодитами SEQ ID NO: 1, 3, 5 и 7 и их фрагментами и вариантами, кодирующими полипептиды, обладающие активностью AHAS.

Настоящее изобретение относится к выделенным или по существу очищенным композициям нуклеиновой кислоты или белка. "Выделенные" или "очищенные" полинуклеотидная молекула, или белок, или их биологически активная часть в значительной степени или по существу свободны от компонентов, которые обычно сопутствуют полинуклеотидной молекуле или белку, находящихся в их природном окружении, или взаимодействуют с ними. Таким образом, выделенные или очищенные полинуклеотидная молекула или белок по существу свободны от других клеточных компонентов или среды для культивирования при их получении рекомбинантными способами или по существу свободны от химических предшественников или других химических веществ при их химическом синтезе. Предпочтительно, "выделенная" нуклеиновая кислота свободна от последовательностей (предпочтительно, кодирующих белок последовательностей), которые в природных условиях фланкируют нуклеиновую кислоту (т.е. последовательностей, расположенных на 5'- и 3'-концах нуклеиновой кислоты) в геномной ДНК организма, из которого получена нуклеиновая кислота. Например, в различных вариантах осуществления выделенная полинуклеотидная молекула может содержать менее приблизительно 5 т.п.н., 4 т.п.н., 3 т.п.н., 2 т.п.н., 1 т.п.н., 0,5 т.п.н. или 0,1 т.п.н. нуклеотидных последовательностей, которые в природе фланкируют полинуклеотидную молекулу в геномной ДНК клетки, из которой получена нуклеиновая кислота. Белок, который по существу свободен от клеточных компонентов, включает в себя препараты белка, содержащего менее приблизительно 30%, 20%, 10%, 5% или 1% (по сухому весу) загрязняющего белка. Когда белок по изобретению или его биологически активную часть получают рекомбинантным способом, предпочтительно, в среде для культивирования представлено менее приблизительно 30%, 20%, 10%, 5% или 1% (по сухому весу) химических предшественников или химических веществ, не являющихся представляющим интерес белком.

Настоящее изобретение относится к выделенным полипептидам, содержащим белки AHASL1. Выделенные полипептиды содержат аминокислотную последовательность, выбранную из группы, состоящей из аминокислотных последовательностей SEQ ID NO: 2 и 4, аминокислотных последовательностей, кодируемых нуклеотидными последовательностями SEQ ID NO: 1 и 3, и функциональных фрагментов и вариантов указанных аминокислотных последовательностей, которые кодируют полипептид AHASL1, обладающий активностью AHAS. Под "функциональными фрагментами и вариантами" подразумевают фрагменты и варианты приведенных в качестве примера полипептидов, которые обладают активностью AHAS.

Дополнительно предоставляются выделенные полипептиды, содержащие зрелые формы белков AHASL1 по изобретению. Такие выделенные полипептиды содержат аминокислотную последовательность, выбранную из группы, состоящей из аминокислотных последовательностей SEQ ID NO: 6 и 8, аминокислотных последовательностей, кодируемых нуклеотидными последовательностями SEQ ID NO: 5 и 7, и функциональных фрагментов и вариантов указанных аминокислотных последовательностей, которые кодируют полипептиды, обладающие активностью AHAS.

В конкретных вариантах осуществления изобретения способы предусматривают применение толерантных к гербицидам или устойчивых к гербицидам растений. Под "толерантным к гербицидам" или "устойчивым к гербицидам" растением подразумевают растение, которое является толерантным или устойчивым по меньшей мере к одному гербициду на уровне, который обычно может уничтожить или ингибировать рост нормального растения или растения дикого типа. В одном из вариантов осуществления изобретения толерантные к гербицидам растения по изобретению содержат толерантный к гербицидам или устойчивый к гербицидам белок AHASL. Под "толерантным к гербицидам белком AHASL" или "устойчивым к гербицидам белком AHASL" подразумевают белок AHASL, который демонстрирует более высокую активность AHAS по сравнению с активностью AHAS белка AHASL дикого типа в присутствии по меньшей мере одного гербицида, для которого установлено, что он препятствует активности AHAS, и при концентрации или уровне гербицида, для которых установлено, что они ингибируют активность AHAS белка AHASL дикого типа. Кроме того, активность AHAS такого толерантного к гербицидам или устойчивого к гербицидам белка AHASL может упоминаться в данном документе как "толерантная к гербицидам" или "устойчивая к гербицидам" активность AHAS.

В настоящем изобретении термин "толерантный к гербицидам" и "устойчивый к гербицидам" используются взаимозаменяемо, и подразумевается, что они обладают эквивалентным значением и эквивалентным объемом. Аналогично, термины "толерантность к гербицидам" и "устойчивость к гербицидам" применяют взаимозаменяемо и подразумевают, что они обладают эквивалентным значением и эквивалентным объемом. Подобным образом, "устойчивый к имидазолинонам" и "устойчивость к имидазолинонам" применяют взаимозаменяемо и подразумевают, что их значение и объем эквивалентны значению и объему терминов "толерантный к имидазолинонам" и "толерантность к имидазолинонам" соответственно.

Настоящее изобретение относится к полинуклеотидам устойчивого к гербицидам AHASL1 и устойчивым к гербицидам белкам AHASL1. Под термином "полинуклеотид устойчивого к гербицидам AHASL1" подразумевают полинуклеотид, кодирующий белок, обладающий устойчивой к гербицидам активностью AHAS. Под термином "устойчивый к гербицидам белок AHASL1" подразумевают белок или полипептид, обладающие устойчивой к гербицидам активностью AHAS.

Кроме того, очевидно, что толерантный к гербицидам или устойчивый к гербицидам белок AHASL может быть введен в растение путем трансформации растения или его предшественника нуклеотидной последовательностью, кодирующей толерантный к гербицидам или устойчивый к гербицидам белок AHASL. Такие толерантные к гербицидам или устойчивые к гербицидам белки AHASL кодируются полинуклеотидами толерантных к гербицидам или устойчивых к гербицидам AHASL. Альтернативно, толерантный к гербицидам или устойчивый к гербицидам белок AHASL может оказаться в растении как результат природной или индуцированной мутации в эндогенном гене AHASL в геноме растения или его предшественника.

Настоящее изобретение относится к растениям, тканям растений, растительным клеткам и клеткам-хозяевам с повышенной устойчивостью или толерантностью по меньшей мере к одному гербициду, в частности гербициду, препятствующему активности фермента AHAS, более конкретно имидазолиноновому или сульфонилкарбамидному гербициду. Предпочтительное количество или концентрация гербицида представляет собой "эффективное количество" или "эффективную концентрацию". Под "эффективным количеством" и "эффективной концентрацией" подразумевают соответственно количество или концентрацию, которое достаточно для уничтожения или ингибирования роста подобного растения дикого типа, растительной ткани, растительной клетки или клетки-хозяина, но которое не уничтожает устойчивые к гербицидам растения, ткани растений, растительные клетки и клетки-хозяева по настоящему изобретению или не так сильно ингибирует их рост. Как правило, эффективное количество гербицида представляет собой количество, обычно используемое в системах сельскохозяйственного производства для уничтожения представляющих интерес сорняков. Такое количество известно специалистам в данной области.

Гербициды по настоящему изобретению представляют собой гербициды, препятствующие активности фермента AHAS таким образом, что активность AHAS в присутствии гербицидов снижается. Такие гербициды в данном документе также называют "ингибирующими AHAS гербицидами" или просто "ингибиторами AHAS". Используемые в настоящем документе термины "ингибирующий AHAS гербицид" или "ингибитор AHAS" не подразумевают ограничение одним гербицидом, препятствующим активности фермента AHAS. Таким образом, если не указано иначе или не очевидно из контекста, "ингибирующий AHAS гербицид" или "ингибитор AHAS" могут представлять собой один гербицид или смесь из двух, трех, четырех или более гербицидов, каждый из которых препятствует активности фермента AHAS.

Под "подобным растением дикого типа, тканью растения, растительной клеткой или клеткой-хозяином" подразумевают растение, ткань растения, растительную клетку или клетку-хозяина соответственно, у которых отсутствуют свойства устойчивости к гербицидам, и/или конкретный полинуклеотид по изобретению, что описано в настоящем документе. Таким образом, применение термина "дикий тип" не предназначено для обозначения того, что в геноме растения, ткани растения, растительной клетке или другой клетке-хозяине отсутствует рекомбинантная ДНК и/или они не обладают свойствами устойчивости к гербицидам, отличными от описанных в данном документе свойств.

Как применяется в настоящем документе, если явно не указано иначе, термин "растение" предназначен для обозначения растения на любой стадии развития, а также любой части или частей растения, которые могут быть присоединены к целому интактному растению или отделены от него. Такие части растения включают в себя в качестве неограничивающих примеров органы, ткани и клетки растения. Примеры конкретных частей растения включают в себя стебель, лист, корень, соцветие, цветок, цветок соцветия, плод, плодоножку, тычинку, пыльник, рыльце пестика, пестик, завязь, лепесток, чашелистик, плодолистик, кончик корня, корневой чехлик, корневой волосок, волосок листа, бородку зерна, пыльцевое зерно, микроспору, семядолю, гипокотиль, эпикотиль, ксилему, луб, паренхиматозную ткань, эндосперм, клетку-спутника, замыкающую клетку и любые другие известные органы, ткани и клетки растения. Кроме того, понятно, что семя является растением.

Растения по настоящему изобретению включают в себя как нетрансгенные, так и трансгенные растения. Под "нетрансгенным растением" подразумевают растение, у которого в геноме отсутствует рекомбинантная ДНК. Под "трансгенным растением" подразумевают растение, содержащее в геноме рекомбинантную ДНК. Такое трансгенное растение можно получать с помощью введения в геном растения рекомбинантной ДНК. Когда такую рекомбинантную ДНК вводят в геном трансгенного растения, потомство растения также может содержать рекомбинантную ДНК. Растение-потомок, содержащее по меньшей мере часть рекомбинантной ДНК по меньшей мере одного трансгенного растения-предшественника, также является трансгенным растением.

Настоящее изобретение относится к устойчивой к гербицидам линии подсолнечника, которую в настоящем документе обозначают как MUT28. Было осуществлено депонирование по меньшей мере 650 семян подсолнечника линии MUT28 в патентный депозитарий American Type Culture Collection (ATCC), Mansassas, VA 20110, USA, 18 июня 2004 года и присвоен номер патентного депонирования ATCC PTA-6084. Были депонированы в ATCC 15 июля 2005 года дополнительные семена линии MUT28 с получением более 2500 семян с номером патентного депонирования ATCC PTA-6084. Депозит сохраняют в соответствии с правилами Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. Депозит линии подсолнечника MUT28 осуществлен на срок по меньшей мере 30 лет, и по меньшей мере через 5 лет самый последний запрос на поставку образца депозита принят ATCC. Кроме того, заявители выполнили все требования §§ 1.801-1.809 37 C.F.R., включая предоставление данных о жизнеспособности образца.

Настоящее изобретение относится к устойчивым к гербицидам растениям подсолнечника линии MUT28, полученным посредством мутационной селекции. Растения подсолнечника дикого типа подвергали мутагенезу посредством воздействия на растения мутагена, в частности химического мутагена, более конкретно этилметансульфоната (EMS). Однако настоящее изобретение не ограничено устойчивыми к гербицидам растениями подсолнечника, полученными способом мутагенеза с применением химического мутагена EMS. Для получения устойчивых к гербицидам растений подсолнечника по настоящему изобретению можно применять любой известный в данной области способ мутагенеза. Например, такие способы мутагенеза могут включать в себя применение любого, одного или нескольких, из следующих мутагенов: радиация, такая как рентгеновское излучение, гамма-излучение (например, кобальт 60 или цезий 137), нейтроны (например, продукт слияния ядер урана 235 в атомном реакторе), бета-излучение (например, испускаемое радиоактивными изотопами, такими как фосфор 32 или углерод 14), ультрафиолетовое излучение (предпочтительно, от 2500 до 2900 нм) и химические мутагены, такие как аналоги нуклеотидов (например, 5-бромурацил), родственные соединения (например, 8-этоксикофеин), антибиотики (например, стрептонигрин), алкилирующие средства (например, сернистые иприты, азотистые иприты, эпоксиды, этиленамины, сульфаты, сульфонаты, сульфоны, лактоны), азид, гидроксиламин, азотистая кислота или акридины. Устойчивые к гербицидам растения также можно получать способами с применением культуры тканей для отбора растительных клеток, содержащих мутации устойчивости к гербицидам, а затем регенерации из них устойчивых к гербицидам растений (см., например, патенты США №№ 5773702 и 5859348, которые включены в настоящий документ в качестве ссылки в полном объеме). Дополнительные подробности о мутационной селекции можно найти в публикации "Principals of Cultivar Development", Fehr, 1993, Macmillan Publishing Company, описание которой включено в настоящий документ в качестве ссылки.

При анализе гена AHASL1 растения подсолнечника линии MUT28 было обнаружено, что мутация приводит к замене пролина, находящегося в положении аминокислоты 182 в аминокислотной последовательности AHASL1 дикого типа SEQ ID NO: 4, на лейцин. Таким образом, в настоящем изобретении раскрывается, что замена пролина в положении 182 на другую аминокислоту может вызвать у растения подсолнечника повышенную устойчивость к гербицидам, в частности к имидазолиноновому и/или сульфонилкарбамидному гербициду. Как описано в примере 3 ниже, пролин 182 находится в консервативной области белков AHASL и были описаны другие аминокислотные замены, которые, как было установлено, придают растению, содержащему такой белок AHASL, устойчивость к гербицидам. Таким образом, устойчивые к гербицидам растения подсолнечника по изобретению включают в себя в качестве неограничивающих примеров такие растения подсолнечника, которые содержат в геноме по меньшей мере одну копию полинуклеотида AHASL1, кодирующего устойчивый к гербицидам белок AHASL1, содержащий лейцин, аланин, треонин, гистидин, аргинин или изолейцин в положении аминокислоты 182 или эквивалентном положении.

Растения подсолнечника по изобретению также включают в себя растения, содержащие по сравнению с белком AHASL1 дикого типа лейцин, аланин, треонин, гистидин, аргинин или изолейцин в положении аминокислоты 182 или в эквивалентном положении и одну или несколько дополнительных аминокислотных замен в белке AHASL1 по сравнению с белком AHASL1 дикого типа, где также растение подсолнечника обладает по сравнению с растением подсолнечника дикого типа повышенной устойчивостью по меньшей мере к одному гербициду. Такие растения подсолнечника содержат белки AHASL1, содержащие по меньшей мере одного представителя, выбранного из группы, состоящей из треонина в положении аминокислоты 107 или эквивалентном положении; аспартат или валин в положении аминокислоты 190 или эквивалентном положении; лейцин в положении аминокислоты 559 или эквивалентном положении и аспарагин, треонин, фенилаланин или валин в положении аминокислоты 638 или эквивалентном положении.

Настоящее изобретение относится к белкам AHASL1 с аминокислотными заменами в конкретных положениях аминокислот в консервативных областях белков AHASL1 подсолнечника, описанных в настоящем документе. Если не указано иначе в настоящем описании, каждое конкретное положение аминокислоты соответствуют положению аминокислоты в полноразмерных аминокислотных последовательностях AHASL1 подсолнечника SEQ ID NO: 2 и 4. Кроме того, специалистам будет понятно, что такие положения аминокислот могут варьировать в зависимости от того, добавлены или удалены аминокислоты, например, на N-конце аминокислотной последовательности. Таким образом, настоящее изобретение относится к заменам аминокислот в указанном положении или эквивалентном положении (например, "положение аминокислоты 182 или эквивалентное положение"). Под "эквивалентным положением" подразумевают положение, которое находится в той же консервативной области, что и приведенное в качестве примера положение аминокислоты. Например, эквивалентное положение для пролина, находящегося в положении аминокислоты 182 в SEQ ID NO: 4, в SEQ ID NO: 8 представляет собой аминокислота 98.

Кроме того, настоящее изобретение относится к полипептидам AHASL1, содержащим аминокислотные замены, для которых установлено, что они придают устойчивость растению по меньшей мере к одному гербициду, в частности ингибирующему AHAS гербициду, более конкретно имидазолиноновому гербициду и/или сульфонилкарбамидному гербициду. Например, такие полипептиды AHASL1 включают в себя полипептиды, которые содержат по меньшей мере одного представителя выбранного из группы, состоящей из: лейцина, аланина, треонина, гистидина, аргинина или изолейцина в положении аминокислоты 182 или эквивалентном положении; треонина в положении аминокислоты 107 или эквивалентном положении; аспартата или валина в положении аминокислоты 190 или эквивалентном положении; лейцина в положении аминокислоты 559 или эквивалентном положении и аспарагина, треонина, фенилаланина или валина в положении аминокислоты 638 или эквивалентном положении. Изобретение также относится к выделенным полинуклеотидам, кодирующим полипептиды AHASL1, а также экспрессирующим кассетам, трансформирующим векторам, трансформированным клеткам-хозяевам, трансформированным растениям и способам, включающим в себя такие полинуклеотиды.

Настоящее изобретение относится к способам повышения толерантности или устойчивости растения, ткани растения, растительной клетки или другой клетки-хозяина по меньшей мере к одному гербициду, препятствующему активности фермента AHAS. Предпочтительно, такой ингибирующий AHAS гербицид представляет собой имидазолиноновый гербицид, сульфонилкарбамидный гербицид, триазолопиримидиновый гербицид, пиримидинилоксибензоатный гербицид, сульфониламинокарбонилтриазолиноновый гербицид или их смесь. Более предпочтительно, такой гербицид представляет собой имидазолиноновый гербицид, сульфонилкарбамидный гербицид или их смесь. В соответствии с настоящим изобретением имидазолиноновые гербициды включают в себя в качестве неограничивающих примеров PURSUIT® (имазетапир), CADRE® (имазапик), RAPTOR® (имазамокс), SCEPTER® (имазаквин), ASSERT® (имазетабенц), ARSENAL® (имазапир), производное любого из указанных выше гербицидов и смесь двух или более из указанных выше гербицидов, например имазапир/имазамокс (ODYSSEY®). Более конкретно, имидазолиноновый гербицид можно выбрать из, но ими не ограничиваясь, 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)никотиновой кислоты, [2-(4-изопропил)-4-][метил-5-оксо-2-имидазолин-2-ил)-3-хинолинкарбоновой]кислоты, [5-этил-2-(4-изопропил-]4-метил-5-оксо-2-имидазолин-2-ил)никотиновой кислоты, 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-5-(метоксиметил)никотиновой кислоты, [2-(4-изопропил-4-метил-5-оксо-2-]имидазолин-2-ил)-5-метилникотиновой кислоты и смеси метилового эфира [6-(4-изопропил-4-]метил-5-оксо-2-имидазолин-2-ил)-м-толуоловой кислоты и метилового эфира [2-(4-изопропил-4-метил-5-]оксо-2-имидазолин-2-ил)-п-толуоловой кислоты. Предпочтительно применение 5-этил-2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)никотиновой кислоты и [2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-]ил)-5-(метоксиметил)никотиновой кислоты. Особенно предпочтительно применение [2-(4-изопропил-4-]метил-5-оксо-2-имидазолин-2-ил)-5-(метоксиметил)никотиновой кислоты.

В соответствии с настоящим изобретением сульфонилкарбамидные гербициды включают в себя в качестве неограничивающих примеров хлорсульфурон, метсульфуронметил, сульфометуронметил, хлоримуронэтил, тифенсульфуронметил, трибенуронметил, бенсульфуронметил, никосульфурон, этаметсульфуронметил, римсульфурон, трифлусульфуронметил, триасульфурон, примисульфуронметил, циносульфурон, амидосульфурон, флузасульфурон, имазосульфурон, пиразосульфуронэтил, галогенсульфурон, азимсульфурон, циклосульфурон, этоксисульфурон, флазасульфурон, флупирсульфуронметил, форамсульфурон, иодосульфурон, оксасульфурон, мезосульфурон, просульфурон, сульфосульфурон, трифлоксисульфурон, тритосульфурон, производное любого из указанных выше гербицидов и смесь двух или более указанных выше гербицидов. Триазолопиримидиновые гербициды по изобретению включают в себя в качестве неограничивающих примеров хлорансулам, диклосулам, флорасулам, флуметсулам, метосулам и пенокссулам. Пиримидинилоксибензоатные гербициды по изобретению включают в себя в качестве неограничивающих примеров биспирибак, пиритиобак, пириминобак, пирибензоксим и пирифталид. Сульфониламинокарбонилтриазолиноновые гербициды включают в себя в качестве неограничивающих примеров флукарбазон и пропоксикарбазон.

Установлено, что пиримидинилоксибензоатные гербициды тесно связаны с пиримидинилтиобензоатными гербицидами, поэтому в Weed Science Society of America их обобщают под последним названием. Таким образом, гербициды по настоящему изобретению также включают в себя пиримидинилтиобензоатные гербициды, включая в качестве неограничивающих примеров описанные выше пиримидинилоксибензоатные гербициды.

Настоящее изобретение относится к способам повышения активности AHAS у растения, включая трансформацию растения полинуклеотидной конструкцией, содержащей промотор, функционально связанный с нуклеотидной последовательностью AHASL1 по изобретению. Способы предусматривают введение полинуклеотидной конструкции по изобретению по меньшей мере в одну растительную клетку и регенерацию из нее трансформированного растения. Способы предусматривают применение промотора, который способен направлять генную экспрессию в растительной клетке. Предпочтительно, такой промотор представляет собой конститутивный промотор или тканеспецифический промотор. Способы применяются для усиления или повышения устойчивости растения по меньшей мере к одному гербициду, препятствующему каталитической активности фермента AHAS, в частности к имидазолиноновому гербициду.

Настоящее изобретение относится к экспрессирующим кассетам для экспрессии полинуклеотидов по изобретению в растениях, тканях растений, растительных клетках и других клетках-хозяевах. Экспрессирующие кассеты содержат промотор, экспрессирующийся в растении, ткани растения, растительной клетке или других представляющих интерес клетках-хозяевах, функционально связанный с полинуклеотидом по изобретению, содержащим нуклеотидную последовательность, кодирующую либо полноразмерный (т.е. включающий в себя транзитный пептид хлоропластов), либо зрелый белок AHASL1 (т.е. не содержащий транзитный пептид хлоропластов). Если экспрессия желательна в пластидах или хлоропластах растений или растительных клеток, экспрессирующая кассета также может содержать функционально связанную последовательность для направленного транспорта в хлоропласты, кодирующую транзитный пептид хлоропластов.

Экспрессирующие кассеты по изобретению можно использовать в способе повышения толерантности растения или клетки-хозяина к гербициду. Способ предусматривает трансформацию растения или клетки-хозяина экспрессирующей кассетой по изобретению, где экспрессирующая кассета содержит промотор, экспрессирующийся в растении или представляющей интерес клетке-хозяине, и промотор функционально связан с полинуклеотидом по изобретению, содержащим нуклеотидную последовательность, кодирующую устойчивый к имидазолинонам белок AHASL1 по изобретению.

Использование термина "полинуклеотидные конструкции" в настоящем изобретении не предназначено для ограничения настоящего изобретения полинуклеотидными конструкциями, содержащими ДНК. Специалистам в данной области понятно, что полинуклеотидные конструкции, в частности полинуклеотиды и олигонуклеотиды, содержащие рибонуклеотиды и сочетания рибонуклеотидов и дезоксирибонуклеотидов, также можно использовать в описанных здесь способах. Таким образом, полинуклеотидные конструкции по настоящему изобретению включают в себя все полинуклеотидные конструкции, которые можно применять в способах по настоящему изобретению для трансформации растений, включая в качестве неограничивающих примеров полинуклеотидные конструкции, содержащие дезоксирибонуклеотиды, рибонуклеотиды и их сочетания. Такие дезоксирибонуклеотиды и рибонуклеотиды включают в себя как природные молекулы, так и синтетические аналоги. Полинуклеотидные конструкции по изобретению также включают в себя все формы полинуклеотидных конструкций, включая в качестве неограничивающих примеров одноцепочечные формы, двухцепочечные формы, шпильки, структуры стебля и петли и т.п. Кроме того, специалистам в данной области понятно, что каждая описанная в настоящем документе нуклеотидная последовательность также включает в себя последовательность, комплементарную указанной приведенной в качестве примера нуклеотидной последовательности.

Кроме того, установлено, что в способах по изобретению можно применять полинуклеотидную конструкцию, способную направлять в трансформированном растении экспрессию по меньшей мере одного белка или по меньшей мере одной РНК, например, такой как антисмысловая РНК, комплементарная по меньшей мере части мРНК. Как правило, такая полинуклеотидная конструкция состоит из кодирующей последовательности для части белка или РНК, функционально связанной с регулирующими транскрипцию 5'- и 3'-областями. Альтернативно, также известно, что в способах по изобретению можно применять полинуклеотидную конструкцию, не способную направлять в трансформированном растении экспрессию белка или РНК.

Кроме того, известно, что для экспрессии полинуклеотидов по изобретению в представляющей интерес клетке-хозяине полинуклеотид, как правило, функционально связан с промотором, способным направлять генную экспрессию в представляющей интерес клетке-хозяине. Способы по изобретению для экспрессии полинуклеотидов в клетках-хозяевах не зависят от конкретного промотора. Способы предусматривают применение любого известного в данной области промотора, способного направлять генную экспрессию в представляющей интерес клетке-хозяине.

Настоящее изобретение относится к полинуклеотидным молекулам AHASL1 и их фрагментам и вариантам. Полинуклеотидные молекулы, представляющие собой фрагменты указанных нуклеотидных последовательностей, также включены в настоящее изобретение. Под "фрагментом" подразумевают часть нуклеотидной последовательности, кодирующую белок AHASL1 по изобретению. Фрагмент нуклеотидной последовательности AHASL1 по изобретению может кодировать биологически активную часть белка AHASL1, или он может представлять собой фрагмент, который можно применять в качестве зонда для гибридизации или праймера ПЦР с применением описанных ниже способов. Биологически активную часть белка AHASL1 можно получать путем выделения части одной из нуклеотидных последовательностей AHASL1 по изобретению, осуществления экспрессии кодируемой части белка AHASL1 (например, путем рекомбинантной экспрессии in vitro) и оценки активности кодируемой части белка AHASL1. Полинуклеотидные молекулы, являющиеся фрагментами нуклеотидной последовательности AHASL1, содержат по меньшей мере приблизительно 15, 20, 50, 75, 100, 200, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1500, 1600, 1700, 1800, 1900 или 1950 нуклеотидов или вплоть до количества нуклеотидов, представленных в описанной здесь полноразмерной нуклеотидной последовательности (например, 1968, 1968, 1716 и 1716 нуклеотидов в случае SEQ ID NO: 1, 3, 5 и 7 соответственно), в зависимости от предполагаемого применения.

Фрагмент нуклеотидной последовательности AHASL1, кодирующий биологически активную часть белка AHASL1 по изобретению, кодирует по меньшей мере приблизительно 15, 25, 30, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600 или 650 смежных аминокислот или вплоть до общего количества аминокислот, находящихся в полноразмерном белке AHASL1 по изобретению (например, 655, 655, 571 и 571 аминокислоты для SEQ ID NO: 2, 4, 6 и 8 соответственно). Фрагменты нуклеотидной последовательности AHASL1, которые могут использоваться в качестве зондов для гибридизации или праймеров ПЦР, как правило, не должны кодировать биологически активную часть белка AHASL1.

Настоящее изобретение также относится к полинуклеотидным молекулам, представляющим собой варианты описанных в настоящем документе нуклеотидных последовательностей. "Варианты" нуклеотидных последовательностей AHASL1 по изобретению включают в себя такие последовательности, которые кодируют описанные в настоящем документе белки AHASL1, но которые консервативно различаются вследствие вырожденности генетического кода. Указанные природные аллельные варианты можно идентифицировать с помощью хорошо известных способов молекулярной биологии, таких как полимеразная цепная реакция (ПЦР) и методы гибридизации, как изложено ниже. Варианты нуклеотидных последовательностей также включают в себя синтетически полученные нуклеотидные последовательности, которые получены, например, с помощью сайт-специфического мутагенеза, но которые все еще кодируют белок AHASL1, описанный в настоящем изобретении, как обсуждается ниже. Как правило, варианты нуклеотидной последовательности по изобретению по меньшей мере на приблизительно 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичны конкретной описанной здесь нуклеотидной последовательности. Вариант нуклеотидной последовательности AHASL1 будет кодировать белок AHASL1 соответственно, который имеет аминокислотную последовательность по меньшей мере на приблизительно 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичную описанной в настоящем документе аминокислотной последовательности белка AHASL1.

Кроме того, специалистам в данной области будет далее понятно, что изменения можно вносить путем мутации в нуклеотидных последовательностях по изобретению, что тем самым приведет к изменениям в аминокислотной последовательности кодируемых белков AHASL1 без изменения биологической активности белков AHASL1. Таким образом, выделенную полинуклеотидную молекулу, кодирующую белок AHASL1 с последовательностью, отличающейся от последовательности SEQ ID NO: 1, 3, 5 или 7 соответственно, можно получать путем осуществления одной или нескольких замен, вставок или делеций нуклеотидов в соответствующую описанную в настоящем документе нуклеотидную последовательность, так что в кодируемом белке будет осуществляться одна или несколько аминокислотных замен, вставок или делеций. Мутации можно вносить стандартными способами, такими как сайт-специфический мутагенез и опосредованный ПЦР мутагенез. Такие варианты нуклеотидных последовательностей также охватываются настоящим изобретением.

Например, консервативные аминокислотные замены, предпочтительно, могут быть осуществлены в случае одного или нескольких предсказанных, предпочтительно, несущественных аминокислотных остатков. "Несущественный" аминокислотный остаток представляет собой остаток, который можно изменять в последовательности белка AHASL1 дикого типа (например, последовательности SEQ ID NO: 2, 4, 6 и 8 соответственно) без изменения биологической активности, тогда как "существенный" аминокислотный остаток необходим для биологической активности. "Консервативная аминокислотная замена" представляет собой замену, в которой аминокислотный остаток заменен аминокислотным остатком с подобной боковой цепью. Семейства аминокислотных остатков с подобными боковыми цепями определены в данной области. Эти семейства включают в себя аминокислоты с основными боковыми цепями (например, лизин, аргинин, гистидин), кислыми боковыми цепями (например, аспарагиновая кислота, глутаминовая кислота), незаряженными полярными боковыми цепями (например, глицин, аспарагин, глутамин, серин, треонин, тирозин, цистеин), неполярными боковыми цепями (например, аланин, валин, лейцин, изолейцин, пролин, фенилаланин, метионин, триптофан), разветвленными в бета-положении боковыми цепями (например, треонин, валин, изолейцин) и ароматическими боковыми цепями (например, тирозин, фенилаланин, триптофан, гистидин). Такие замены нельзя сделать для консервативных аминокислотных остатков или для аминокислотных остатков, находящихся в консервативных мотивах.

Белки по изобретению можно изменять различными способами, включающими в себя аминокислотные замены, делеции, укорочения и вставки. Способы для таких манипуляций, как правило, известны в данной области. Например, аминокислотную последовательность вариантов белков AHASL1 можно получать с помощью мутаций в ДНК. Способы мутагенеза и изменения нуклеотидных последовательностей хорошо известны в данной области. (см., например, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382; патент США № 4873192; Walker и Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) и цитируемые в них ссылки). Руководство по проведению аминокислотных замен так, чтобы не изменить биологическую активность представляющего интерес белка, можно найти в модели Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), включенной в настоящий документ в качестве ссылки. Предпочтительными могут являться консервативные замены, такие как замена одной кислоты на другую с подобными свойствами.

Альтернативно, варианты нуклеотидных последовательностей AHASL1 можно получать путем внесения случайных мутаций во всей или в части кодирующей последовательности AHASL1, например, с помощью насыщающего мутагенеза, и полученные мутанты можно подвергать скринингу на активность AHAS для идентификации мутантов, сохраняющих активность AHAS, включая устойчивую к гербицидам активность AHAS. После мутагенеза кодируемый белок можно экспрессировать рекомбинантным способом и определять активность белка с помощью стандартных методов анализа.

Таким образом, нуклеотидные последовательности по изобретению включают в себя последовательности, описанные в настоящем документе, а также их фрагменты и варианты. Нуклеотидные последовательности AHASL1 по изобретению и их фрагменты и варианты можно применять в качестве зондов и/или праймеров для идентификации и/или клонирования гомологов AHASL в других растениях. Такие зонды можно использовать для детекции транскриптов или геномных последовательностей, кодирующих такие же или идентичные белки.

Таким образом, для идентификации таких последовательностей, в большой степени идентичных последовательностям по изобретению, можно применять такие способы, как ПЦР, гибридизация и т.п. (см., например, Sambrook et al. (1989) Molecular Cloning: Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, NY) и Innis et al. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, NY)). Нуклеотидные последовательности AHASL, выделенные, основываясь на идентичности их последовательности указанным в настоящем описании нуклеотидным последовательностям AHASL1 или их фрагментам и вариантам, входят в объем настоящего изобретения.

В способе гибридизации всю или часть известной нуклеотидной последовательности AHASL1 можно использовать для скрининга библиотек кДНК или геномных библиотек. Способы конструирования таких библиотек кДНК и геномных библиотек, как правило, известны в данной области и описаны у Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, NY). Так называемые зонды для гибридизации могут представлять собой фрагменты геномной ДНК, фрагменты кДНК, фрагменты РНК или другие олигонуклеотиды, и они могут быть меченными детектируемой группой, такой как 32P, или любым другим детектируемым маркером, таким как другие радиоактивные изотопы, флуоресцентное соединение, фермент или кофактор фермента. Зонды для гибридизации можно получать посредством мечения синтетических олигонуклеотидов, полученных, основываясь на известной нуклеотидной последовательности AHASL1, описанной в настоящем документе. Дополнительно можно использовать вырожденные праймеры, сконструированные на основе консервативных нуклеотидов или аминокислотных остатков в известной нуклеотидной последовательности AHASL1 или кодируемой аминокислотной последовательности. Зонд, как правило, содержит область нуклеотидной последовательности, которая гибридизуется в строгих условиях по меньшей мере с приблизительно 12, предпочтительно приблизительно 25, более предпочтительно приблизительно 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600 или 1800 последовательными нуклеотидами нуклеотидной последовательности AHASL1 по изобретению или ее фрагмента или варианта. Способы получения зондов для гибридизации, как правило, известны в данной области и описаны в Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York), включенном в настоящий документ в качестве ссылки.

Например, в качестве зонда, способного специфически гибридизоваться с соответствующими последовательностями AHASL1 и матричными РНК, можно использовать описанную в настоящем документе полную последовательность AHASL1 или одну или несколько ее частей. Способы гибридизации включают в себя гибридизационный скрининг нанесенных на покрытие библиотек ДНК в виде пятен или колоний; см., например, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York).

Гибридизацию указанных последовательностей можно проводить в строгих условиях. Под "строгими условиями" или "строгими условиями гибридизации" подразумевают условия, в которых зонд будет гибридизоваться с его последовательностью-мишенью в заметно большей степени, чем с другими последовательностями (например, по меньшей мере в 2 раза по сравнению с фоновым уровнем). Строгие условия зависят от последовательности и будут различными при различных обстоятельствах.

Как правило, строгие условия представляют собой условия, при которых концентрация солей составляет менее приблизительно 1,5 М ионов Na, как правило, концентрация ионов Na (или других солей) составляет приблизительно от 0,01 до 1,0 M при pH 7,0-8,3, а температура составляет по меньшей мере приблизительно 30°C для коротких зондов (например, 10-50 нуклеотидов) и по меньшей мере приблизительно 60°C для длинных зондов (например, более 50 нуклеотидов). Строгих условий также можно достигнуть путем добавления дестабилизирующих веществ, таких как формамид. Иллюстративные условия с низкой строгостью включают в себя гибридизацию в буферном растворе с содержанием 30-35% формамида, 1 M NaCl, 1% SDS (додецилсульфат натрия) при 37°C и отмывку в растворе с содержанием от 1× до 2× SSC (20× SSC = 3,0 M NaCl/0,3 M тринатрий цитрата) при температуре 50-55°C. Иллюстративные условия со средней строгостью включают в себя гибридизацию в растворе с содержанием 40-45% формамида, 1,0 M NaCl, 1% SDS при 37°C и отмывку в растворе с содержанием от 0,5× до 1× SSC при температуре 55-60°C. Иллюстративные условия с высокой строгостью включают в себя гибридизацию в растворе с содержанием от 50% формамида, 1 M NaCl, 1% SDS при 37°C и отмывку в растворе с содержанием 0,1× SSC при температуре 60-65°C. Необязательно, отмывочный буфер может содержать от приблизительно 0,1% до приблизительно 1% SDS. Длительность гибридизации, как правило, составляет менее приблизительно 24 часов, как правило, от приблизительно 4 до приблизительно 12 часов.

Специфичность, как правило, представляет собой функцию отмывки после гибридизации, где решающими факторами являются ионная сила и температура конечного раствора для отмывки. Для гибридов ДНК-ДНК Tm можно приближенно вычислить с помощью уравнения Meinkoth и Wahl (1984), Anal. Biochem. 138:267-284: Tm = 81,5°C + 16,6(log M) + 0,41 (%GC) - 0,61 (% форм) - 500/L; где M представляет собой молярность моновалентных катионов, %GC представляет собой процент гуанозиновых и цитозиновых нуклеотидов в ДНК, % форм представляет собой процент формамида в растворе для гибридизации и L представляет собой длину гибрида в парах оснований. Tm представляет собой температуру (при определенной ионной силе и pH), при которой 50% комплементарной последовательности-мишени гибридизуется с точно соответствующим зондом. Tm снижается приблизительно на 1°C для каждого 1% несоответствия; таким образом, Tm, условия гибридизации и/или отмывки можно отрегулировать так, чтобы гибридизовались последовательности с желательной степенью идентичности. Например, если желательны последовательности с ≥90% идентичностью, Tm можно уменьшить на 10°C. Как правило, строгие условия выбирают так, чтобы они были на приблизительно 5°C ниже точки температуры плавления (Tm) для конкретной последовательности и комплементарной ей последовательности при определенной ионной силе и pH. Однако при очень строгих условиях можно использовать гибридизацию и/или отмывку при температуре на 1, 2, 3 или 4°C ниже точки температуры плавления (Tm); в умеренно строгих условиях можно использовать гибридизацию и/или отмывку при температуре на 6, 7, 8, 9 или 10°C ниже точки температуры плавления (Tm); в условиях с низкой строгостью можно использовать гибридизацию и/или отмывку при температуре на 11, 12, 13, 14, 15 или 20°C ниже, чем точка температуры плавления (Tm). При использовании уравнения, составов для гибридизации и отмывки и желательной Tm специалистам будет понятно, что изменения строгости гибридизации и/или растворов для отмывки являются по существу описанными. Если желательная степень несоответствия приводит к Tm менее 45°C (водный раствор) или 32°C (раствор с формамидом), предпочтительно увеличить концентрацию SSC так, чтобы можно было использовать более высокую температуру. Подробное руководство по гибридизации нуклеиновых кислот находится в Tijssen (1993), Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, New York), и Ausubel et al, eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York), (см. Sambrook (1989), Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York).

Установлено, что полинуклеотидные молекулы и белки по изобретению включают в себя полинуклеотидные молекулы и белки, содержащие нуклеотидную или аминокислотную последовательность, которая в значительной степени идентична нуклеотидной последовательности SEQ ID NO: 1, 3, 5 и/или 7 или аминокислотной последовательности SEQ ID NO: 2, 4, 6 и/или 8. Термин "в значительной степени идентична" в настоящем документе применяют для обозначения первой аминокислотной или нуклеотидной последовательности, содержащей достаточное или максимальное количество идентичных или эквивалентных (например, с подобной боковой цепью) аминокислотных остатков или нуклеотидов со второй аминокислотной или нуклеотидной последовательностью так, что первая и вторая аминокислотные или нуклеотидные последовательности обладают общими структурным доменом и/или функциональной активностью. Например, аминокислотные или нуклеотидные последовательности, содержащие общий структурный домен, обладающий идентичностью по меньшей мере приблизительно 45%, 55% или 65%, предпочтительно идентичностью 75%, более предпочтительно идентичностью 85%, 95% или 98%, определены в настоящем документе как идентичные в значительной степени.

Для определения процента идентичности двух аминокислотных последовательностей или двух нуклеиновых кислот последовательности выравнивают с целью наилучшего сравнения. Процент идентичности двух последовательностей представляет собой функцию количества идентичных положений в последовательностях (т.е. процент идентичности = количество идентичных положений/общее количество положений (например, перекрывающихся - положений) × 100). В одном из вариантов осуществления две последовательности представляют собой последовательности одинаковой длины. Процент идентичности двух последовательностей можно определять с применением способов, подобных описанным ниже способам с допуском пробелов или без. При расчете процента идентичности, как правило, считают точные совпадения.

Определение процента идентичности двух последовательностей можно проводить с применением математического алгоритма. Предпочтительный неограничивающий пример математического алгоритма, применяемого для сравнения двух последовательностей, представляет собой алгоритм Karlin и Altschul (1990), Proc. Natl. Acad. Sci. USA 87:2264, модифицированный по Karlin и Altschul (1993), Proc. Natl. Acad. Sci. USA 90:5873-5877. Такой алгоритм включен в алгоритмы программ NBLAST и XBLAST Altschul et al. (1990) J. Mol. Biol. 215:403. Поиск нуклеотидов в BLAST можно проводить с применением программы NBLAST, показатель = 100, длина слова = 12, с получением нуклеотидных последовательностей, гомологичных полинуклеотидным молекулам по изобретению. Поиск белков в BLAST можно проводить с применением программы XBLAST, показатель = 50, длина слова = 3, с получением аминокислотных последовательностей, гомологичных белковым молекулам по изобретению. Для получения выравниваний с пробелами с целью сравнения можно использовать Gapped BLAST, как описано в Altschul et al. (1997) Nucleic Acids Res. 25:3389. Альтернативно, для проведения итерационного поиска, обнаруживающего далекое родство молекул, можно использовать PSI-Blast (см. Altschul et al. (1997) выше). При использовании программ BLAST, Gapped BLAST и PSI-Blast можно использовать параметры соответствующих программ (например, XBLAST и NBLAST) по-умолчанию (см. http://www.ncbi.nlm.nih.gov). Другой предпочтительный неограничивающий пример математического алгоритма, используемого для сравнения последовательностей, представляет собой алгоритм Myers и Miller (1988), CABIOS 4:11-17. Такой алгоритм включен в программу ALIGN (версия 2.0), которая является частью пакета программного обеспечения для выравнивания последовательностей GCG. При использовании программы ALIGN для сравнения аминокислотных последовательностей можно использовать таблицу весов остатков PAM120, штраф на длину пробела 12 и штраф за пробел 4. Выравнивание также можно проводить вручную при осмотре.

Если не указано иначе, предоставленные в настоящем документе значения идентичности/сходства последовательностей соответствуют значению, полученному с использованием полноразмерных последовательностей по изобретению и с применением множественного выравнивания посредством алгоритма Clustal W. (Nucleic Acid Research, 22(22):4673-4680, 1994) с применением программы AlignX, включенной в пакет программного обеспечения Vector NTI Suite Version 7 (InforMax, Inc., Bethesda, MD, USA), с применением параметров по умолчанию или любой эквивалентной ей программы. Под "эквивалентной программой" подразумевают любую программу сравнения последовательностей, которая для любых двух рассматриваемых последовательностей, создает выравнивание с совпадениями идентичных нуклеотидных и аминокислотных остатков и одинаковым процентом идентичности последовательностей при сравнении с соответствующим выравниванием, создаваемым посредством AlignX в пакете программного обеспечения Vector NTI Suite Version 7.

Нуклеотидные последовательности AHASL1 по изобретению включают в себя природные последовательности, а также мутантные формы, в частности мутантные формы, кодирующие белки AHASL1, обладающие устойчивой к гербицидам активностью AHAS. Подобным образом, белки по изобретению включают в себя природные белки, а также их варианты и модифицированные формы. Такие варианты продолжают обладать желательной активностью AHAS. Очевидно, мутации, которые производят в ДНК, кодирующей вариант, не должны помещать последовательность вне рамки считывания и, предпочтительно, не создают комплементарных областей, которые могли бы образовывать вторичную структуру мРНК (см. публикацию заявки на патент EP № 75444).

Предполагают, что делеции, вставки и замены в белковых последовательностях, охватываемые настоящим описанием, не приводят к радикальным изменениям в свойствах белка. Однако когда сложно предсказать точный эффект замены, делеции или вставки до их осуществления, специалисту в данной области будет понятно, что эффект следует оценивать с помощью обычных скрининговых исследований (см., например, публикацию Singh et al. (1988) Anal. Biochem. 171:173-179, включенную в данное описание в качестве ссылки).

Варианты нуклеотидных последовательностей и белков также включают в себя последовательности и белки, полученные с помощью мутагенеза и рекомбинантного способа, такого как перестановка ДНК. Применяя такой способ создания нового белка AHASL, обладающего желательными свойствами, можно манипулировать одной или несколькими различными кодирующими последовательностями AHASL. Таким образом, из группы полинуклеотидов со сходными последовательностями, которые содержат области последовательностей со значительной степенью идентичности последовательностей и которые можно подвергать гомологичной рекомбинации in vitro или in vivo, получают библиотеки рекомбинантных полинуклеотидов. Например, при таком подходе мотивы последовательностей, кодирующие представляющий интерес домен, можно переставлять между геном AHASL1 по изобретению и другими известными генами AHASL с получением нового гена, кодирующего белок с улучшенным представляющим интерес свойством, таким как повышенная Km в случае фермента. Стратегии для такой перестановки ДНК известны в данной области (см., например, Stemmer (1994) Proc. Natl. Acad. Sci. USA 91:10747-10751; Stemmer (1994) Nature 370:389-391; Crameri et al. (1997) Nature Biotech. 15:436-438; Moore et al. (1997) J Mol. Biol. 272:336-347; Zhang et al. (1997) Proc. Natl. Acad. Sci. USA 94:4504-4509; Crameri et al. (1998) Nature 391:288-291 и патенты США №№ 5605793 и 5837458).

Нуклеотидные последовательности по изобретению можно использовать для выделения соответствующих последовательностей из других организмов, в частности из других растений, более конкретно из других двудольных растений. Таким образом, для идентификации таких последовательностей, основываясь на гомологии указанных последовательностей с предоставленными по настоящему документу последовательностями, можно применять такие способы, как ПЦР, гибридизация и т.п. Последовательности, выделенные с учетом идентичности указанных последовательностей полноразмерным последовательностям AHASL1 по изобретению или их фрагментам, входят в объем настоящего изобретения. Таким образом, выделенные последовательности, кодирующие белок AHASL и гибридизующиеся в строгих условиях с описанной в настоящем документе последовательностью или ее фрагментами, входят в объем настоящего изобретения.

При подходе с применением ПЦР можно конструировать олигонуклеотидные праймеры для применения в реакциях ПЦР для амплификации соответствующей последовательности ДНК с кДНК или геномной ДНК, выделенной из представляющего интерес растения. Способы конструирования праймеров для ПЦР и клонирования с применением ПЦР в широко известны в данной области и описаны в Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York), (также см. Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis и Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); и Innis и Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York)). Известные способы ПЦР включают в себя в качестве неограничивающих примеров способы с применением парных праймеров, вложенных праймеров, одного специфического праймера, вырожденных праймеров, геноспецифических праймеров, специфичных для вектора праймеров, частично несоответствующих праймеров и т.п.

Полинуклеотидные последовательности AHASL1 по изобретению могут быть включены в экспрессирующие кассеты для экспрессии в представляющем интерес растении. Кассета включает в себя 5' и 3' регуляторные последовательности, функционально связанные с полинуклеотидной последовательностью AHASL1 по изобретению. Под "функционально связанной" подразумевают функциональную связь между промоторной последовательностью и второй последовательностью, где промоторная последовательность инициирует и опосредует транскрипцию последовательности ДНК, соответствующей второй последовательности. Как правило, функционально связанные означает, что связанные последовательности нуклеиновой кислоты являются смежными и, когда необходимо связать две кодирующих белки области, являются смежными и находятся в одной рамке считывания. Кассета может дополнительно содержать по меньшей мере один дополнительный ген для совместной трансформации в организм. Альтернативно, дополнительный ген(ы) можно включать в несколько экспрессирующих кассет.

Такая экспрессирующая кассета содержит несколько участков рестрикции для вставки полинуклеотидной последовательности AHASL1 для регуляции транскрипции регулирующими областями. Экспрессирующая кассета может дополнительно содержать гены селективных маркеров.

Экспрессирующая кассета включает в себя в направлении транскрипции 5'-3' области инициации транскрипции и трансляции (т.е. промотор), полинуклеотидную последовательность AHASL1 по изобретению и область терминации транскрипции и трансляции (т.е. область терминации), функционирующие в растениях. Промотор для растения-хозяина и/или для полинуклеотидной последовательности AHASL1 по изобретению может быть собственным или аналогичным или чужеродным или гетерологичным. Кроме того, промотор может являться природной последовательностью или, альтернативно, синтетической последовательностью. Когда промотор является "чужеродным" или "гетерологичным" для растения-хозяина, подразумевают, что этого промотора нет в природном растении, в которое вводят этот промотор. Когда промотор является "чужеродным" или "гетерологичным" для полинуклеотидной последовательности AHASL1 по изобретению, подразумевают, что этот промотор не является собственным или природным промотором для функционально связанной полинуклеотидной последовательности AHASL1 по изобретению. Как применяется в настоящем документе, химерный ген содержит кодирующую последовательность, функционально связанную с областью инициации транскрипции, являющейся гетерологичной для кодирующей последовательности.

Хотя предпочтительной может являться экспрессия полинуклеотидов AHASL1 по изобретению с применением гетерологичных промоторов, можно использовать собственные промоторные последовательности. Такие конструкции могут изменять уровни экспрессии белка AHASL1 в растении или растительной клетке. Таким образом, фенотип растения или растительной клетки изменяется.

Область терминации может являться собственной для области инициации транскрипции, может являться собственной для функционально связанной представляющей интерес последовательности AHASL1, может являться свойственной растению-хозяину или может быть получена из другого источника (т.е. чужеродной или гетерологичной для промотора, представляющей интерес полинуклеотидной последовательности AHASL1, растения-хозяина или любого их сочетания). Подходящие области терминации доступны из Ti-плазмиды A. tumefaciens, такие как области терминации октопинсинтазы и нопалинсинтазы (также см. Guerineau et al. (1991) Mol. Gen. Genet. 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev. 5:141-149; Mogen et al. (1990) Plant Cell 2:1261-1272; Munroe et al. (1990) Gene 91:151-158; Ballas et al. (1989) Nucleic Acids Res. 17:7891-7903 и Joshi et al. (1987) Nucleic Acids Res. 15:9627-9639).

Если целесообразно, ген(ы) можно оптимизировать для повышенной экспрессии в трансформированном растении. Это значит, что гены для повышенной экспрессии можно синтезировать с применением предпочтительных для растения кодонов. Обсуждение применения предпочтительных для хозяина кодонов смотрите, например, у Campbell и Gowri (1990), Plant Physiol. 92:1-11. Для синтеза предпочтительных для растений генов в данной области есть доступные способы, (см., например, патенты США №№ 5380831 и 5436391 и Murray et al. (1989) Nucleic Acids Res. 17:477-498, включенные в настоящий документ в качестве ссылки).

Известны дополнительные модификации последовательностей, увеличивающие генную экспрессию в клетке-хозяине. Они затрагивают удаление последовательностей, кодирующих ложные сигналы полиаденилирования, сигналы сплайсинга экзонов-интронов, подобные транспозонам повторы и другие хорошо исследованные последовательности, которые могут снижать генную экспрессию. Содержание G-C в последовательности можно довести до уровней, средних для данной клетки-хозяина, что рассчитывается на основании известных генов, экспрессирующихся в клетке-хозяине. Если возможно, последовательность модифицируют так, чтобы избежать теоретически ожидаемых вторичных структур мРНК в виде шпилек.

В экспрессирующих векторах растений также можно применять нуклеотидные последовательности для повышенной генной экспрессии. Они включают в себя интроны кукурузы AdhI, ген intron1 (Callis et al. (1987) Genes and Development 1:1183-1200) и лидерные последовательности (W-последовательность) вируса табачной мозаики (TMV), вируса бледной крапчатости кукурузы и мозаичного вируса люцерны (Gallie et al. (1987) Nucleic Acids Res. 15:8693-8711 и Skuzeski et al. (1990) Plant Mol. Biol. 15:65-79). Показано, что первый интрон локуса морщинистости-1 кукурузы увеличивает экспрессию генов в конструкциях химерных генов. В патентах США №№ 5424412 и 5593874 описано применение конкретных интронов в генетических экспрессирующих конструкциях, а у Gallie et al. (Plant Physiol. 106:929-939, 1994) также показано, что интроны можно использовать для регуляции генной экспрессии, основываясь на тканевой специфичности. Для дополнительного повышения или для оптимизации экспрессии малой субъединицы гена AHAS экспрессирующие векторы растений по изобретению также могут содержать последовательности ДНК, включающие в себя области прикрепления к матриксу (MAR). Затем растительные клетки, трансформированные такими модифицированными экспрессирующими системами, могут демонстрировать сверхэкспрессию или конститутивную экспрессию нуклеотидной последовательности по изобретению.

Экспрессирующие кассеты могут также содержать 5'-лидерные последовательности в конструкции экспрессирующей кассеты. Такие лидерные последовательности могут действовать в направлении усиления трансляции. Трансляционные лидерные последовательности известны в данной области и включают в себя лидерные последовательности пикорнавирусов, например лидерную последовательность EMCV (5'-некодирующая область вируса энцефаломиокардита) (Elroy-Stein et al. (1989) Proc. Natl. Acad. Sci. USA 86:6126-6130); лидерные последовательности потивирусов, например лидерная последовательность TEV (вирус гравировки табака) (Gallie et al. (1995) Gene 165(2):233-238), лидерную последовательность MDMV (вирус мозаичной карликовости кукурузы) (Virology 154:9-20) и связывающий тяжелые цепи человеческого иммуноглобулина белок (BiP) (Macejak et al. (1991) Nature 353:90-94); нетранслируемую лидерную последовательность мРНК белка оболочки вируса мозаичности люцерны (AMV РНК 4) (Jobling et al. (1987) Nature 325:622-625); лидерную последовательность вируса табачной мозаики (TMV) (Gallie et al. (1989) в Molecular Biology of RNA, ed. Cech (Liss, New York), pp. 237-256) и лидерную последовательность вируса бледной крапчатости кукурузы (MCMV) (Lommel et al. (1991) Virology 81:382-385) (также см. Della-Cioppa et al. (1987) Plant Physiol. 84:965-968). Также можно использовать другие известные способы усиления трансляции, например интроны и т.п.

При получении экспрессирующей кассеты можно манипулировать различными фрагментами ДНК так, чтобы получить последовательности ДНК в правильной ориентации и в соответствующих случаях в правильной рамке считывания. Для этой цели можно применять адаптеры или линкеры для связывания фрагментов ДНК или можно применять другие манипуляции для получения подходящих участков рестрикции, удаления избыточной ДНК, удаления участков рестрикции и т.п. С этой целью можно применять мутагенез in vitro, восстановление праймерами, рестрикцию, отжиг, обратные замены, например транзиции и трансверзии.

В практическом осуществлении изобретения можно использовать ряд промоторов. Промоторы можно выбрать на основе желательного результата. Нуклеиновые кислоты можно объединять с конститутивными, тканеспецифическими или другими промоторами для экспрессии в растениях.

Такие конститутивные промоторы включают в себя, например, коровый промотор промотора Rsyn7 и другие конститутивные промоторы, описанные в WO 99/43838 и патенте США № 6072050; коровый промотор 35S CaMV (Odell et al. (1985) Nature 313:810-812); промотор актина риса (McElroy et al. (1990) Plant Cell 2:163-171); промотор убиквитина (Christensen et al. (1989) Plant Mol. Biol. 12:619-632 и Christensen et al. (1992) Plant Mol. Biol. 18:675-689); промотор pEMU (Last et al. (1991) Theor. Appl. Genet. 81:581-588); промотор MAS (Velten et al. (1984) EMBO J. 3:2723-2730); промотор ALS (патент США № 5659026) и т.п. Другие конститутивные промоторы включают в себя промоторы, описанные, например, в патентах США №№ 5608149; 5608144; 5604121; 5569597; 5466785; 5399680; 5268463; 5608142 и 6177611.

Тканеспецифические промоторы можно использовать для повышения экспрессии AHASL1 в конкретной ткани растения. Такие тканеспецифические промоторы включают в себя в качестве неограничивающих примеров специфические для листьев промоторы, специфические для корней промоторы, специфические для семян промоторы и специфические для стеблей промоторы. Тканеспецифические промоторы включают в себя промоторы, описанные у Yamamoto et al. (1997) Plant J. 12(2):255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997) Mol. Gen Genet. 254(3):337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al. (1996) Plant Physiol. 112(3):1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2): 525-535; Canevascini et al. (1996) Plant Physiol. 112(2):513-524; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Lam (1994) Results Probl. Cell Differ. 20:181-196; Orozco et al. (1993) Plant Mol. Biol. 23(6): 1129-1138; Matsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590 и Guevara-Garcia et al. (1993) Plant J. 4(3):495-505. Такие промоторы, если необходимо, можно модифицировать для слабой экспрессии.

В одном из вариантов осуществления представляющие интерес нуклеиновые кислоты направляются для экспрессии в хлоропласты. Таким образом, когда представляющую интерес нуклеиновую кислоту не вводят сразу в хлоропласт, экспрессирующая кассета будет также содержать последовательность для направленного транспорта в хлоропласты, содержащую нуклеотидную последовательность, кодирующую транзитный пептид хлоропластов для направления продукта представляющего интерес гена в хлоропласты. Такие транзитные пептиды известны в данной области. В случае последовательностей для направленного транспорта в хлоропласты "функционально связанная" означает, что последовательность нуклеиновой кислоты, кодирующая транзитный пептид (т.е. последовательность для направленного транспорта в хлоропласты), связана с полинуклеотидом AHASL по изобретению так, что две последовательности являются смежными и находятся в одной рамке считывания (см., например, Von Heijne et al. (1991) Plant Mol. Biol. Rep. 9:104-126; Clark et al. (1989) J. Biol. Chem. 264:17544-17550; Della-Cioppa et al. (1987) Plant Physiol. 84:965-968; Romer et al. (1993) Biochem. Biophys. Res. Commun. 196:1414-1421 и Shah et al. (1986) Science 233:478-481). Хотя белки AHASL1 по изобретению включают в себя собственный транзитный пептид хлоропластов, с аминокислотной последовательностью зрелого белка AHASL1 по изобретению можно сливать любой известный в данной области транзитный пептид хлоропластов посредством функционального связывания направляющей в хлоропласты последовательности с 5'-концом нуклеотидной последовательности, кодирующей зрелый белок AHASL1 по изобретению.

Последовательности для направленного транспорта в хлоропласты известны в данной области и включают в себя малую единицу рибулозо-1,5-бисфосфаткарбоксилазы хлоропластов (Rubisco) (de Castro Silva Filho et al. (1996) Plant Mol. Biol. 30:769-780; Schnell et al. (1991) J. Biol. Chem. 266(5):3335-3342); 5-(енолпирувил)шикимат-3-фосфатсинтазу (EPSPS) (Archer et al. (199O) J. Bioenerg. Biomemb. 22(6):789-810); триптофансинтазу (Zhao et al. (1995) J. Biol. Chem. 270(11):6081-6087); пластоцианин (Lawrence et al. (1997) J. Biol. Chem. 272(33):20357-20363); хоризматсинтазу (Schmidt et al. (1993) J. Biol. Chem. 268(36):27447-27457) и связывающий поглощающий свет хлорофилл a/b белок (LHCP) (Lamppa et al. (1988) J. Biol. Chem. 263:14996-14999), (см. также Von Heijne et al. (1991) Plant Mol. Biol Rep. 9:104-126; Clark et al. (1989) J. Biol. Chem. 264:17544-17550; Della-Cioppa et al. (1987) Plant Physiol. 84:965-968; Romer et al. (1993) Biochem. Biophys. Res. Commun. 196:1414-1421 и Shah et al. (1986) Science 233:478-481).

Способы трансформации хлоропластов известны в данной области (см., например, Svab et al. (1990) Proc. Natl. Acad. Sci. USA 87:8526-8530; Svab и Maliga (1993) Proc. Natl. Acad. Sci. USA 90:913-917; Svab и Maliga (1993) EMBO J. 12:601-606). Способ основан на доставке ДНК, содержащей селективный маркер, с помощью бомбардировки частицами и встраивании ДНК в геном пластиды посредством гомологичной рекомбинации. Кроме того, трансформацию пластид можно сопровождать трансактивацией происходящего из пластиды молчащего трансгена посредством тканеспецифической экспрессии кодируемой в ядре и направляемой в пластиды РНК-полимеразы. Такая система опубликована у McBride et al. (1994) Proc. Natl. Acad. Sci. USA 91:7301-7305.

Представляющие интерес нуклеиновые кислоты для направленного транспорта в хлоропласты можно оптимизировать для экспрессии в хлоропластах с учетом различий в использовании кодонов между ядром растения и указанными органеллами. Таким образом, представляющие интерес нуклеиновые кислоты можно синтезировать с применением предпочтительных для хлоропластов кодонов (см., например, патент США № 5380831, включенный в настоящий документ в качестве ссылки).

Как описано в настоящем документе, нуклеотидные последовательности AHASL1 по изобретению находят применение в повышении толерантности к гербициду растений, содержащих в геномах ген, кодирующий толерантный к гербицидам белок AHASL1. Такой ген может являться эндогенным геном или трансгеном. Кроме того, в конкретных вариантах осуществления последовательности нуклеиновой кислоты по настоящему изобретению можно объединять с любым сочетанием представляющих интерес полинуклеотидных последовательностей для получения растений с желательным фенотипом. Например, полинуклеотиды по настоящему изобретению можно объединять с любыми другими полинуклеотидами, кодирующими полипептиды с пестицидной и/или инсектицидной активностью, например, с такими как токсические белки Bacillus thuringiensis (описанные в патентах США №№ 5366892; 5747450; 5737514; 5723756; 5593881 и Geiser et al. (1986) Gene 48:109). Полученные сочетания также могут включать в себя несколько копий любого из представляющих интерес полинуклеотидов.

Известно, что на основе указанных нуклеотидных последовательностей можно конструировать антисмысловые конструкции, комплементарные по меньшей мере части матричной РНК (мРНК) полинуклеотидных последовательностей AHASL1. Антисмысловые нуклеотиды конструируют для гибридизации с соответствующей мРНК. Модификации антисмысловых последовательностей можно проводить до тех пор, пока последовательности гибридизуются с соответствующей мРНК и препятствуют ее экспрессии. Таким образом, можно использовать антисмысловые конструкции с последовательностью, идентичной на 70%, предпочтительно 80%, более предпочтительно 85%, соответствующим антисмысловым последовательностям. Кроме того, можно использовать части антисмысловых нуклеотидов для нарушения экспрессии гена-мишени. Как правило, можно использовать последовательности из по меньшей мере 50 нуклеотидов, 100 нуклеотидов, 200 нуклеотидов или более.

Нуклеотидные последовательности по настоящему изобретению также можно использовать в смысловой ориентации для подавления экспрессии в растениях эндогенных генов. Способы подавления генной экспрессии в растениях с применением нуклеотидных последовательностей в смысловой ориентации известны в данной области. Способы, как правило, включают в себя трансформацию растений конструкциями ДНК, содержащими промотор, направляющий экспрессию в растении, функционально связанный по меньшей мере с частью нуклеотидной последовательности, соответствующей транскрипту эндогенного гена. Как правило, такая нуклеотидная последовательность обладает значительной степенью идентичности последовательности с последовательностью транскрипта эндогенного гена, предпочтительно степенью идентичности последовательности более приблизительно 65%, более предпочтительно степенью идентичности последовательности более приблизительно 85%, наиболее предпочтительно степенью идентичности последовательности более приблизительно 95% (см. патенты США №№ 5283184 и 5034323, включенные в настоящий документ в качестве ссылки).

Хотя полинуклеотиды устойчивых к гербицидам AHASL1 по изобретению могут использоваться в качестве генов селективных маркеров для трансформации растений, экспрессирующие кассеты по изобретению могут включать другой ген селективного маркера для отбора трансформированных клеток. Гены селективных маркеров, включая гены селективных маркеров по настоящему изобретению, используют для отбора трансформированных клеток или тканей. Маркерные гены включают в себя в качестве неограничивающих примеров гены, кодирующие устойчивость к антибиотикам, такие как гены, кодирующие неомицинфосфотрансферазу II (NEO) и гигромицинфосфотрансферазу (HPT), а также гены, придающие устойчивость к гербицидным соединениям, таким как глуфосинат аммония, бромоксинил, имидазолиноны и 2,4-дихлорфеноксиацетат (2,4-D) (в основном см. Yarranton (1992) Curr. Opin. Biotech. 3:506-511; Christopherson et al. (1992) Proc. Natl. Acad. Sci. USA 89:6314-6318; Yao et al. (1992) Cell 71:63-72; Reznikoff (1992) Mol. Microbiol. 6:2419-2422; Barkley et al. (1980) в The Operon, рp.177-220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987) Cell 49:603-612; Figge et al. (1988) Cell 52:713-722; Deuschle et al. (1989) Proc. Natl. Acad. Sci. USA 86:5400-5404; Fuerst et al. (1989) Proc. Natl. Acad. Sci. USA 86:2549-2553; Deuschle et al. (1990) Science 248:480-483; Gossen (1993) Ph.D. Thesis, University of Heidelberg; Reines et al. (1993) Proc. Natl. Acad. Sci. USA 90:1917-1921; Labow et al. (1990) Mol. Cell. Biol. 10:3343-3356; Zambretti et al. (1992) Proc. Natl. Acad. Sci. USA 89:3952-3956; Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88:5072-5076; Wyborski et al. (1991) Nucleic Acids Res. 19:4647-4653; Hillenand-Wissman (1989) Topics Mol. Struc. Biol. 10:143-162; Degenkolb et al. (1991) Antimicrob. Agents Chemother. 35:1591-1595; Kleinschnidt et al. (1988) Biochemistry 27:1094-1104; Bonin (1993) Ph.D. Thesis, University of Heidelberg; Gossen et al. (1992) Proc. Natl. Acad. Sci. USA 89:5547-5551; Oliva et al. (1992) Antimicrob. Agents Chemother. 36:913-919; Hlavka et al. (1985) Handbook of Experimental Pharmacology, Vol. 78 (Springer-Verlag, Berlin); Gill et al. (1988) Nature 334:721-724, которые включены в настоящий документ в качестве ссылки).

Указанный выше перечень генов селективных маркеров не является ограничением. Можно использовать любой ген селективного маркера в настоящем изобретении.

Выделенные молекулы полинуклеотидов, содержащие нуклеотидную последовательность, кодирующую белки AHASL1 по изобретению, можно использовать в векторах для трансформации растений, чтобы полученные растения обладали повышенной устойчивостью к гербицидам, в частности к имидазолиноновым гербицидам. При придании растениям устойчивости к гербицидам выделенные полинуклеотидные молекулы AHASL1 по изобретению можно использовать в векторах отдельно или в сочетании с нуклеотидной последовательностью, кодирующей малую субъединицу фермента AHAS (AHASS) (см. патент США № 6348643, который включен в настоящий документ в качестве ссылки).

Изобретение также относится к экспрессирующему вектору растений, содержащему промотор, направляющий экспрессию в растении, функционально связанный с выделенной полинуклеотидной молекулой по изобретению. Выделенная полинуклеотидная молекула содержит нуклеотидную последовательность, кодирующую белок AHASL1, в частности белок AHASL1, содержащий аминокислотную последовательность SEQ ID NO: 2, 4, 6 или 8 или ее функциональный фрагмент и вариант. Экспрессирующий вектор растений по изобретению не зависит от конкретного промотора за исключением того, что такой промотор способен направлять генную экспрессию в растительной клетке. Предпочтительные промоторы включают в себя конститутивные промоторы и тканеспецифические промоторы.

Трансформирующие векторы по изобретению можно использовать для получения растений, трансформированных представляющим интерес геном. Трансформирующий вектор содержит ген селективного маркера по изобретению и представляющий интерес ген для введения в трансформированное растение и, как правило, для экспрессии в нем. Такой ген селективного маркера содержит полинуклеотид устойчивого к гербицидам AHASL1 по изобретению, функционально связанный с промотором, направляющим экспрессию в клетке-хозяине. Для применения в растениях и растительных клетках трансформирующий вектор содержит ген селективного маркера, содержащий полинуклеотид устойчивого к гербицидам AHASL1 по изобретению, функционально связанный с промотором, направляющим экспрессию в растительной клетке.

Представляющие интерес гены по изобретению варьируют в зависимости от желательного результата. Например, интерес могут представлять различные изменения фенотипа, включая модификацию содержания в растении жирных кислот, изменение содержания в растении аминокислот, изменение защитных механизмов растения от насекомых и/или патогенных микроорганизмов и т.п. Данных результатов можно достичь при условии экспрессии гетерологичных продуктов или повышенной экспрессии эндогенных продуктов в растениях. Альтернативно, данных результатов можно достичь при условии уменьшения экспрессии в растении одного или нескольких эндогенных продуктов, особенно ферментов или кофакторов. Эти изменения приводят к изменению фенотипа трансформированного растения.

В одном из вариантов осуществления изобретения представляющие интерес гены включают в себя гены устойчивости к насекомым, например, такие как гены токсических белков Bacillus thuringiensis (патенты США №№ 5366892; 5747450; 5736514; 5723756; 5593881 и Geiser et al. (1986) Gene 48:109).

Белки AHASL1 или полипептиды по изобретению можно выделять, например, из растений подсолнечника и можно применять в композициях. Также выделенную полинуклеотидную молекулу, кодирующую белок AHASL1 по изобретению, можно использовать для экспрессии белка AHASL1 по изобретению в микроорганизме, таком как E. coli или дрожжи. Экспрессируемый белок AHASL1 можно выделять из экстрактов E. coli или дрожжей любым известным специалистам в данной области способом.

Изобретение также относится к способу получения устойчивого к гербицидам трансгенного растения, предусматривающему трансформацию растения экспрессирующим вектором растений, содержащим промотор, направляющий экспрессию в растении, функционально связанный с выделенной полинуклеотидной молекулой по изобретению. Выделенная полинуклеотидная молекула содержит нуклеотидную последовательность, кодирующую белок AHASL1 по изобретению, в частности белок AHASL1, содержащий аминокислотную последовательность SEQ ID NO: 2 или 6, аминокислотную последовательность, кодируемую SEQ ID NO: 1 или 5, или функциональный фрагмент и вариант указанных аминокислотных последовательностей.

Изобретение также относится к нетрансгенным растениям подсолнечника, трансгенным растениям, полученным способами по изобретению, и потомству и другим родственникам таких нетрансгенных и трансгенных растений, где растения демонстрируют повышенную устойчивость к гербицидам, препятствующим ферменту AHAS, в частности к имидазолиноновым и сульфонилкарбамидным гербицидам.

Полинуклеотиды AHASL1 по изобретению, в частности полинуклеотиды, кодирующие устойчивые к гербицидам белки AHASL1, находят применение в способах повышения устойчивости толерантных к гербицидам растений. В одном из вариантов осуществления изобретения толерантные к гербицидам растения содержат толерантный к гербицидам или устойчивый к гербицидам белок AHASL. Толерантные к гербицидам растения включают в себя как растения, трансформированные нуклеотидными последовательностями толерантных к гербицидам AHASL, так и растения, содержащие в геномах эндогенный ген, кодирующий толерантный к гербицидам белок AHASL. Нуклеотидные последовательности, кодирующие толерантные к гербицидам белки AHASL, и устойчивые к гербициду растения, содержащие эндогенный ген, кодирующий толерантный к гербицидам белок AHASL, включают в себя полинуклеотиды и растения по настоящему изобретению и полинуклеотиды и растения, которые известны в данной области (см., например, патенты США №№ 5013659, 5731180, 5767361, 5545822, 5736629, 5773703, 5773704, 5952553 и 6274796; каждый из которых включен в настоящий документ в качестве ссылки). Такие способы повышения устойчивости толерантных к гербицидам растений включают в себя трансформацию толерантного к гербицидам растения по меньшей мере одной полинуклеотидной конструкцией, содержащей промотор, направляющий экспрессию в растительной клетке, функционально связанный с полинуклеотидом устойчивого к гербицидам AHASL1 по изобретению, в частности с полинуклеотидом, кодирующим устойчивый к гербицидам белок AHASL1 SEQ ID NO: 1 или 5, с полинуклеотидами, кодирующими аминокислотную последовательность SEQ ID NO: 2 или 6, и фрагментами и вариантами указанных полинуклеотидов, которые кодируют полипептиды, обладающие устойчивой к гербицидам активностью AHAS.

Доступно множество трансформирующих векторов растений и способов трансформации растений (см., например, An G. et al. (1986) Plant Pysiol. 81:301-305; Fry J. et al. (1987) Plant Cell Rep. 6:321-325; Block M. (1988) Theor. Appl Genet. 76:767-774; Hinchee et al. (1990) Stadler. Genet. Symp. 203212. 203-212; Cousins et al. (1991) Aust. J. Plant Physiol. 18:481-494; Chee P.P. и Slightom J.L. (1992) Gene. 118:255-260; Christou et al. (1992) Trends. Biotechnol. 10:239-246; D'Halluin et al. (1992) Bio/Technol. 10:309-314; Dhir et al. (1992) Plant Physiol. 99:81-88; Casas et al. (1993) Proc. Natl. Acad. Sci. USA 90:11212-11216; Christou P. (1993) In Vitro Cell. Dev. Biol.-Plant, 29P:119-124; Davies et al. (1993) Plant Cell Rep. 12:180-183; Dong J.A. и Mchughen A. (1993) Plant Sci. 91:139-148; Franklin C.I. и Trieu T.N. (1993) Plant. Physiol. 102:167; Golovkin et al. (1993) Plant Sci. 90:41-52; Guo Chin Sci. Bull. 38:2072-2078; Asano et al. (1994) Plant Cell Rep. 13; Ayeres N.M. и Park W.D. (1994) Crit. Rev. Plant. Sci. 13:219-239; Barcelo et al. (1994) Plant. J. 5:583-592; Becker et al. (1994) Plant. J. 5:299-307; Borkowska et al. (1994) Acta. Physiol. Plant. 16:225-230; Christou P. (1994) Agro. Food. Ind. Hi Tech. 5: 17-27; Eapen et al. (1994) Plant Cell Rep. 13:582-586; Hartman et al. (1994) Bio-Technology 12: 919923; Ritala et al. (1994) Plant. Mol. Biol. 24:317-325 и Wan Y.C. и Lemaux P.G. (1994) Plant Physiol. 104:3748).

Способы по изобретению включают в себя введение полинуклеотидной конструкции в растение. Под "введением" подразумевают презентацию растению полинуклеотидной конструкции таким способом, что конструкция получает доступ внутрь клетки растения. Способы по изобретению не зависят от конкретного способа введения полинуклеотидной конструкции в растения за исключением того, что полинуклеотидная конструкция получает доступ внутрь по меньшей мере одной клетки растения. Способы введения полинуклеотидных конструкций в растения известны в данной области, включая в качестве неограничивающих примеров способы стабильной трансформации, способы транзиторной трансформации и опосредованные вирусами способы.

Под "стабильной трансформацией" подразумевают, что вводимая в растение полинуклеотидная конструкция интегрируется в геном растения и способна наследоваться его потомством. Под "транзиторной трансформацией" подразумевают, что вводимая в растение полинуклеотидная конструкция не интегрируется в геном растения.

Для трансформации растений и растительных клеток нуклеотидные последовательности по изобретению вставляют с применением стандартных способов в любой известный в данной области вектор, подходящий для экспрессии нуклеотидных последовательностей в растении или растительной клетке. Выбор вектора зависит от предпочтительного способа трансформации и вида растения-мишени для трансформации. В одном из вариантов осуществления изобретения нуклеотидная последовательность AHASL1 функционально связана с промотором растения, который известен как промотор, обеспечивающий высокий уровень экспрессии в растительной клетке, а затем эту конструкцию вводят в растение, чувствительное к имидазолиноновому гербициду, и трансформированное растение регенерируют. Трансформированное растение толерантно к воздействию такого уровня имидазолинонового гербицида, который может уничтожить или оказать значительный вред нетрансформированному растению. Этот способ можно применять для любого вида растений; однако наиболее выгодно, когда его применяют для сельскохозяйственных культур, в частности для сельскохозяйственных культур, которые, как правило, выращивают в присутствии по меньшей мере одного гербицида, в частности имидазолинонового гербицида.

Способы конструирования экспрессирующих кассет растений и введения чужеродных нуклеиновых кислот в растения широко известны в данной области и описаны ранее. Например, чужеродную ДНК можно вводить в растения с применением индуцирующих опухоли (Ti) плазмидных векторов. Другие способы, используемые для доставки чужеродной ДНК, включают в себя применение опосредованной PEG трансформации протопластов, электропорацию, микроинъекционные волоски и биолистику или бомбардировку микрочастицами для прямого захвата ДНК. Такие способы известны в данной области (патент США № 5405765, выданный Vasil et al.; Bilang et al. (1991) Gene 100:247-250; Scheid et al. (1991) Mol. Gen. Genet. 228:104-112; Guerche et al. (1987) Plant Science 52:111-116; Neuhause et al. (1987) Theor. Appl Genet. 75:30-36; Klein et al. (1987) Nature 327:70-73; Howell et al. (1980) Science 208:1265; Horsch et al. (1985) Science 227:1229-1231; DeBlock et al. (1989) Plant Physiology 91: 694-701; Methods for Plant Molecular Biology (Weissbach и Weissbach, eds.) Academic Press, Inc. (1988) и Methods in Plant Molecular Biology (Schuler и Zielinski, eds.) Academic Press, Inc. (1989)). Способ трансформации зависит от трансформируемой растительной клетки, стабильности применяемого вектора, уровня экспрессии генных продуктов и других параметров.

Другие подходящие способы введения нуклеотидных последовательностей в растительные клетки и последующей вставки в геном растений включают в себя микроинъекцию в соответствии с Crossway et al. (1986) Biotechniques 4:320-334, электропорацию, как описано у Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606, опосредованную Agrobacterium трансформацию, как описано у Townsend et al., патент США № 5563055, Zhao et al., патент США № 5981840, прямой перенос генов, как описано у Paszkowski et al. (1984) EMBO J. 3:2717-2722, и баллистическое ускорение частиц, например, как описано у Sanford et al., патент США № 4945050; Tomes et al. патент США № 5879918; Tomes et al., патент США № 5886244; Bidney et al., патент США № 5932782; Tomes et al. (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment", в Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg и Phillips (Springer-Verlag, Berlin); McCabe et al. (1988) Biotechnology 6:923-926); и трансформацию Lec1 (WO 00/2808) (также см. публикации Weissinger et al. (1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Science and Technology 5:27-37 (лук); Christou et al. (1988) Plant Physiol. 87:671-614 (соя); McCabe et al. (1988) Bio/Technology 6:923-926 (соя); Finer и McMullen (1991) In Vitro Cell Dev. Biol. 27P:175-182 (соя); Singh et al. (1998) Theor. Appl. Genet. 96:319-324 (соя); Datta et al. (1990) Biotechnology 8:736-740 (рис); Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309 (кукуруза); Klein et al. (1988) Biotechnology 6:559-563 (кукуруза); Tomes, патент США № 5240855; Buising et al., патенты США №№ 5322783 и 5324646; Tomes et al. (1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment", в Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg (Springer-Verlag, Berlin) (кукуруза); Klein et al. (1988) Plant Physiol. 91:440-444 (кукуруза); Fromm et al. (1990) Biotechnology 8:833-839 (кукуруза); Hooykaas-Van Slogteren et al. (1984) Nature (London) 311:763-764; Bowen et al., патент США № 5736369 (хлебные злаки); Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet et al. (1985) в The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New York), рp.197-209 (пыльца); Kaeppler et al. (1990) Plant Cell Reports 9:415-418 и Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566 (опосредованная волосками трансформация); D'Halluin et al. (1992) Plant Cell 4:1495-1505 (электропорация); Li et al. (1993) Plant Cell Reports 12:250-255 и Christou и Ford (1995), Annals of Botany 75:407-413 (рис); Osjoda et al. (1996) Nature Biotechnology 14:745-750 (кукуруза с помощью Agrobacterium tumefaciens); каждая из которых включена в настоящий документ в качестве ссылки).

Полинуклеотиды по изобретению можно вводить в растения при контакте растений с вирусом или вирусными нуклеиновыми кислотами. Обычно такие способы предусматривают введение полинуклеотидной конструкции по изобретению в молекулу вирусной ДНК или РНК. Установлено, что белок AHASL1 по изобретению можно сначала получить в виде части вирусного полипротеина, который позже может быть процессирован путем протеолиза in vivo или in vitro с получением желательного рекомбинантного белка. Кроме того, установлено, что промоторы по изобретению также включают в себя промоторы, применяемые для транскрипции с помощью вирусных РНК-полимераз. Способы введения полинуклеотидных конструкций в растения и экспрессии кодируемых им белков, включая молекулы вирусной ДНК и РНК, известны в данной области (см., например, патенты США №№ 5889191, 5889190, 5866785, 5589367 и 5316931, включенные в настоящий документ в качестве ссылки).

Трансформированные клетки можно растить в растениях традиционными способами (см., например, McCormick et al. (1986) Plant Cell Reports 5:81-84). Такие растения можно затем выращивать и опылять либо пыльцой той же трансформированной линии, либо других линий и идентифицировать полученный гибрид с конститутивной экспрессией желательной фенотипической характеристики. Можно вырастить два или более поколений для подтверждения того, что экспрессия желательной фенотипической характеристики стабильно поддерживается и наследуется, а затем собрать семена для подтверждения того, что достигнута экспрессия желательной фенотипической характеристики. Таким образом, настоящее изобретение относится к трансформированным семенам (также обозначаемым как "трансгенные семена") с полинуклеотидной конструкцией по изобретению, например экспрессирующей кассетой по изобретению, стабильно встроенной в геном.

Настоящее изобретение можно применять для трансформации любых видов растений, включая в качестве неограничивающих примеров однодольные и двудольные. Примеры представляющих интерес видов растений включают в себя в качестве неограничивающих примеров кукурузу (Zea mays), Brassica spp. (например, B. napus, B. rapa, B. juncea), особенно те виды Brassica, которые пригодны в качестве источника масла из семян, люцерну (Medicago sativa), рис (Oryza sativa), рожь (Secale cereale), сорго (Sorghum bicolor, Sorghum vulgare), просо (например, просо африканское (Pennisetum glaucum), просо обыкновенное (Panicum miliaceum), просо итальянское (Setaria italica), просо пальчатое (Eleusine coracana)), подсолнечник (Helianthus annuus), сафлор (Carthamus tinctorins), пшеницу (Triticum aestivum, виды твердой T. Turgidum), сою (Glycine max), табак (Nicotiana tabacum), картофель (Solanum tuberosum), арахис (Arachis hypogaea), хлопок (Gossypium barbadense, Gossypium hirsutum), батат (Ipomoea batatus), маниоку (Manihot esculenta), кофе (виды Coffea), кокос (Cocos nucifera), ананас (Ananas comosus), цитрусовые (виды Citrus), какао (Theobroma cacao), чай (Camellia sinensis), банан (виды Musa), авокадо (Persea americana), инжир (Ficus casica), гуаву (Psidium guajava), манго (Mangifera indica), оливки (Olea europaea), папайю (Carica papaya), кешью (Anacardium occidentale), макадамию (Macadamia integrifolia), миндаль (Prunus amygdalus), свеклу сахарную (Beta vulgaris), сахарный тростник (виды Saccharum), овес, ячмень, овощи, декоративные растения и хвойные. Предпочтительно, растения по настоящему изобретению представляют собой сельскохозяйственные культуры (например, подсолнечник, Brassica spp., хлопок, сахарная свекла, соя, арахис, люцерна, сафлор, табак, кукуруза, рис, пшеница, рожь, ячмень, тритикале, сорго, просо и т.д.).

Устойчивые к гербицидам растения по изобретению можно использовать в способах контроля сорняков. Таким образом, настоящее изобретение также относится к способу контроля сорняков вблизи от устойчивого к гербицидам растения по изобретению. Способ предусматривает нанесение эффективного количества гербицида на сорняки и на устойчивое к гербицидам растение, где растение по сравнению с растением дикого типа обладает повышенной устойчивостью по меньшей мере к одному гербициду, в частности имидазолиноновому или сульфонилкарбамидному гербициду. В таком способе контроля сорняков устойчивые к гербицидам растения по изобретению, предпочтительно, представляют собой сельскохозяйственные культуры, включая в качестве неограничивающих примеров подсолнечник, люцерну, Brassica spp., сою, хлопок, сафлор, арахис, табак, томат, картофель, пшеницу, рис, кукурузу, ячмень, рожь, просо и сорго.

При получении растений с повышенной устойчивостью к гербицидам, в частности имидазолиноновым и сульфонилкарбамидным гербицидам, можно применять широкий спектр составов для защиты растений от сорняков так, чтобы усилить рост растений и уменьшить конкуренцию за питательные вещества. Гербицид можно применять самостоятельно для контроля сорняков до всхода, после всхода, перед посевом и контроля сорняков при посеве в областях, окружающих описанные в настоящем документе растения, или можно применять состав имидазолинонового гербицида, содержащий другие добавки. Гербицид также можно применять для обработки семян. Таким образом, эффективную концентрацию или эффективное количество гербицида или композицию, содержащую эффективную концентрацию или эффективное количество гербицида, можно применять непосредственно для семян перед посевом или в течение посева семян. Находящиеся в составе с имидазолиноновым или сульфонилкарбамидным гербицидом добавки включают в себя другие гербициды, детергенты, адъюванты, лиофилизирующие средства, склеивающие средства, стабилизаторы и т.п. Гербицидный состав может представлять собой влажный или сухой препарат и может включать в себя в качестве неограничивающих примеров сыпучие порошки, эмульгируемые концентраты и жидкие концентраты. Гербицид и гербицидные составы можно применять в соответствии с традиционными способами, например посредством распыления, полива, обсыпания, покрытия и т.п.

Настоящее изобретение относится к нетрансгенным и трансгенным семенам с повышенной устойчивостью по меньшей мере к одному гербициду, в частности ингибирующему AHAS гербициду. Такие семена включают в себя, например, нетрансгенные семена подсолнечника, обладающие свойствами устойчивости к гербицидам растения с номером патентного депонирования ATCC PTA-6084, и трансгенные семена, содержащие полинуклеотидную молекулу по изобретению, кодирующую устойчивый к гербицидам белок AHASL1.

Настоящее изобретение относится к способам получения устойчивого к гербицидам растения, в частности устойчивого к гербицидам растения подсолнечника, с помощью традиционной селекции растений, включая половое размножение. Способы предусматривают скрещивание первого устойчивого к гербицидам растения со вторым растением, неустойчивым к гербицидам. Первое растение может представлять собой любое из устойчивых к гербицидам растений по настоящему изобретению, включая, например, трансгенные растения, содержащие по меньшей мере один из полинуклеотидов по настоящему изобретению, кодирующих устойчивые к гербицидам AHASL, и нетрансгенные растения подсолнечника, обладающие свойствами устойчивости к гербицидам растения подсолнечника с номером патентного депонирования ATCC PTA-6084. Второе растение может представлять собой любое растение, способное давать жизнеспособные растения-потомки (т.е. семена) при скрещивании с первым растением. Как правило, но не обязательно, первое и второе растения принадлежат к одному виду. Способы по изобретению также относятся к одному или нескольким поколениям обратного скрещивания растений-потомков первого скрещивания с растением той же линии или генотипа, как и первое или второе растения. Альтернативно, потомство первого скрещивания или любого последующего скрещивания можно скрещивать с третьим растением, которое является растением другой линии или генотипа в отличие от первого или второго растения. Способы по изобретению могут также включать в себя отбор растений, обладающих свойствами устойчивости к гербицидам первого растения.

Настоящее изобретение также относится к способам повышения устойчивости растений к гербицидам, в частности устойчивых к гербицидам растений подсолнечника, с помощью традиционной селекции растений, включая половое размножение. Способы предусматривают скрещивание первого устойчивого к гербицидам растения со вторым растением, которое может быть устойчивым к гербицидам, или может не быть устойчивым к гербицидам, или может быть устойчивым к другому гербициду или гербицидам, чем первое растение. Первое растение может представлять собой любое из устойчивых к гербицидам растений по настоящему изобретению, включая, например, трансгенные растения, содержащие по меньшей мере один из полинуклеотидов по настоящему изобретению, кодирующих устойчивые к гербицидам AHASL, и нетрансгенные растения подсолнечника, обладающие свойствами устойчивости к гербицидам растения подсолнечника с номером патентного депонирования ATCC PTA-6084. Второе растение может представлять собой любое растение, способное давать жизнеспособные растения-потомки (т.е. семена) при скрещивании с первым растением. Как правило, но не обязательно, первое и второе растения принадлежат к одному виду. Полученные данным способом по настоящему изобретению растения-потомки обладают повышенной по сравнению с первым или вторым растением или с обоими устойчивостью к гербицидам. Когда первое и второе растения устойчивы к различным гербицидам, растения-потомки обладают свойствами сочетанной устойчивости к гербицидам первого и второго растений. Способы по изобретению также относятся к одному или нескольким поколениям обратного скрещивания растений-потомков первого скрещивания с растением той же линии или генотипа, как и первое или второе растения. Альтернативно, потомство первого скрещивания или любого последующего скрещивания можно скрещивать с третьим растением, которое является растением другой линии или генотипа, чем первое или второе растение. Способы по изобретению могут также предусматривать отбор растений, обладающих свойствами устойчивости к гербицидам первого растения, второго растения или как первого, так и второго растения.

Настоящее изобретение относится к способам, предусматривающим применение ингибирующего AHAS гербицида. В указанных способах ингибирующий AHAS гербицид можно применять любым известным в данной области способом, включая в качестве неограничивающих примеров обработку семян, обработку почвы и обработку листьев.

Перед использованием ингибирующий AHAS гербицид можно получить в виде привычных составов, например растворов, эмульсий, суспензий, пудр, порошков, паст и гранул. Применение зависит от конкретной цели; в каждом случае необходимо обеспечить наилучшее и равномерное распределение соединения по изобретению.

Составы получают известным способом (например, см. для обзора US 3060084, EP-A 707445 (для жидких концентратов), Browning, "Agglomeration", Chemical Engineering, Dec. 4, 1967, 147-48, Perry's Chemical Engineer's Handbook, 4th Ed., McGraw-Hill, New York, 1963, страницы 8-57, и следующее: WO 91/13546, US 4172714, US 4144050, US 3920442, US 5180587, US 5232701, US 5208030, GB 2095558, US 3299566, Klingman, Weed Control as a Science, John Wiley and Sons, Inc., New York, 1961, Hance et al., Weed Control Handbook, 8th Ed., Blackwell Scientific Publications, Oxford, 1989, и Mollet, H., Grubemann, A., Formulation technology, Wiley VCH Verlag GmbH, Weinheim (Germany), 2001, 2. D. A. Knowles, Chemistry и Technology of Agrochemical Formulations, Kluwer Academic Publishers, Dordrecht, 1998 (ISBN 0-7514-0443-8)), в качестве примера при добавлении к активному соединению добавок, подходящих для состава химического удобрения, таких как растворители и/или носители, если желательно, эмульгаторы, поверхностно-активные вещества и диспергирующие средства, консерванты, противовспенивающие средства, средства против замерзания, для состава для обработки семян также необязательно красители, и/или связывающие вещества, и/или гелеобразующие средства.

Примеры подходящих растворителей включают в себя воду, ароматические растворители (например, продукты ароматических фракций нефти, ксилен), предельные углеводороды (например, фракции нефтепродуктов), спирты (например, метанол, бутанол, пентанол, бензиловый спирт), кетоны (например, циклогексанон, гамма-бутиролактон), пирролидоны (NMP, NOP), ацетаты (гликольдиацетат), гликоли, диметиламиды жирных кислот, жирные кислоты и сложные эфиры жирных кислот. В принципе, также можно использовать смеси растворителей.

Примеры подходящих носителей представляют собой почвенные природные минералы (например, каолины, глины, слюда, мел) и почвенные синтетические минералы (например, высокодиспергированный оксид кремния, силикаты).

Подходящие эмульгаторы представляют собой неионные и анионные эмульгаторы (например, полиоксиэтиленовые эфиры жирных спиртов, алкилсульфонаты и арилсульфонаты).

Примеры диспергирующих средств представляют собой лигниносульфитные щелока и метилцеллюлозу.

Подходящие используемые поверхностно-активные вещества представляют собой соли щелочных металлов, щелочно-земельных металлов и аммонийные соли лигносульфоновой кислоты, нафталинсульфоновой кислоты, фенолсульфоновой кислоты, дибутилнафталинсульфоновой кислоты, алкиларилсульфонаты, алкилсульфаты, алкилсульфонаты, сульфаты жирных спиртов, гликолевые эфиры жирных кислот и сульфатированных жирных спиртов, кроме того, конденсаты сульфированного нафталина и производных нафталина с формальдегидом, конденсаты нафталина или нафталинсульфоновой кислоты с фенолом и формальдегидом, полиоксиэтиленоктилфеноловый простой эфир, этоксилированный изооктилфенол, октилфенол, нонилфенол, алкилфенолполигликолевые простые эфиры, трибутилфенилполигликолевый простой эфир, тристеарилфенилполигликолевый простой эфир, алкиларилполиэфирные спирты, продукты конденсации спиртов и жирных спиртов с этиленоксидом, этоксилированное касторовое масло, полиоксиэтиленалкиловые эфиры, этоксилированный полиоксипропилен, ацеталь лаурилалкогольполигликолевого эфира, сложные эфиры сорбита, лигниносульфитные щелока и метилцеллюлозу.

Вещества, подходящие для получения непосредственно распыляемых растворов, эмульсий, паст или масляных дисперсий, представляют собой нефтяные фракции от средней до высокой температуры кипения, такие как керосин или дизельное топливо, кроме того, каменноугольные смолы и смолы растительного или животного происхождения, алифатические, циклические и ароматические углеводороды, например толуол, ксилол, парафин, тетрагидронафталин, алкилированные нафталины или их производные, метанол, этанол, пропанол, бутанол, циклогексанол, циклогексанон, изофорон, высокополярные растворители, например диметилсульфоксид, N-метилпирролидон или воду.

Также в состав можно добавлять средства против замерзания, такие как глицерин, этиленгликоль, пропиленгликоль и бактерициды.

Подходящие противовспенивающие средства, например, представляют собой противовспенивающие средства на основе кремния или стеарата магния.

Подходящие консерванты, например, представляют собой дихлорофен и энзилалкогольполуформаль.

Составы для обработки семян могут также содержать связывающие вещества и необязательно красители.

Связывающие вещества можно добавлять для улучшения адгезии активных веществ к семенам после обработки. Подходящие связывающие вещества представляют собой блоксополимеры EO/PO поверхностно-активных веществ, а также поливиниловые спирты, поливинилпирролидоны, полиакрилаты, полиметакрилаты, полибутены, полиизобутилены, полистиролы, полиэтиленамины, полиэтиленамиды, полиэтиленимиды (Lupasol®, Polymin®), простые полиэфиры, полиуретаны, поливинилацетат, тилозу и сополимеры, получаемые из указанных полимеров.

Необязательно в состав можно включать красители. Подходящие красители или красящие вещества для составов для обработки семян представляют собой родамин B, C.I. Pigment Red 112, C.I. Solvent Red 1, синий пигмент 15:4, синий пигмент 15:3, синий пигмент 15:2, синий пигмент 15:1, синий пигмент 80, желтый пигмент 1, желтый пигмент 13, красный пигмент 112, красный пигмент 48:2, красный пигмент 48:1, красный пигмент 57:1, красный пигмент 53:1, оранжевый пигмент 43, оранжевый пигмент 34, оранжевый пигмент 5, зеленый пигмент 36, зеленый пигмент 7, белый пигмент 6, коричневый пигмент 25, основной фиолетовый 10, основной фиолетовый 49, кислый красный 51, кислый красный 52, кислый красный 14, кислый синий 9, кислый желтый 23, основной красный 10, основной красный 108.

Примеры подходящих гелеобразующих средств представляют собой карраген (Satiagel®).

Порошки, вещества для рассыпания и распыляемые продукты можно получать путем смешивания или сопутствующего размельчения активных веществ с твердым носителем.

Гранулы, например покрытые гранулы, импрегнированные гранулы и гомогенные гранулы, можно получать посредством связывания активных соединений с твердыми носителями. Примеры твердых носителей представляют собой минеральные вещества, такие как силикагели, силикаты, слюда, каолин, AttaClay, известняк, известь, мел, известковая глина, лессовый грунт, глина, доломит, диатомитовый грунт, сульфат кальция, сульфат магния, оксид магния, почвенные синтетические вещества, удобрения, такие как сульфат аммония, фосфат аммония, нитрат аммония, мочевины и продукты растительного происхождения, такие как овсяная мука, мука древесной коры, древесная мука и мука из скорлупы ореха, порошки целлюлозы и другие твердые носители.

В основном составы содержат от 0,01 до 95 мас.%, предпочтительно от 0,1 до 90 мас.% ингибирующего AHAS гербицида. В этом случае применяют ингибирующие AHAS гербициды с чистотой от 90 до 100 мас.%, предпочтительно от 95 до 100 мас.% (в соответствии со спектром ЯМР). Для обработки семян соответствующие составы можно разбавлять в 2-10 раз, доводя до концентраций в готовых для применения препаратах от 0,01 до 60 мас.% активного соединения, предпочтительно от 0,1 до 40 мас.%.

Ингибирующий AHAS гербицид можно использовать как таковой, в виде его составов или использовать в формах, полученных из них, например в форме непосредственно распыляемых растворов, порошков, суспензий или дисперсий, эмульсий, масляных дисперсий, паст, распыляемых продуктов, веществ для распыления или гранул, посредством распыления, пульверизации, опыления, разбрасывания или полива. Формы применения полностью зависят от предназначения; одни предназначены для обеспечения в каждом случае наилучшего распределения ингибирующего AHAS гербицида по изобретению.

Водные формы для использования можно получать из концентратов эмульсий, паст или смачивающихся порошков (распыляемые порошки, масляные дисперсии) посредством добавления воды. Для получения эмульсий, паст или масляных дисперсий вещества, сами по себе или растворенные в масле или растворителе, можно гомогенизировать в воде посредством смачивающего средства, придающего клейкость средства, диспергирующего средства или эмульгатора. Однако также можно получать концентраты, состоящие из активного вещества, смачивающего средства, придающего клейкость средства, диспергирующего средства или эмульгатора и, если целесообразно, растворителя или масла, и такие концентраты пригодны для разведения водой.

Концентрации активных соединений в готовых к применению препаратах могут варьировать в относительно широких пределах. В основном они составляют от 0,0001 до 10 мас.%, предпочтительно от 0,01 до 1 мас.%.

Ингибирующий AHAS гербицид также можно успешно применять в способе со сверхнизким объемом (ULV), при котором возможно применять составы, содержащие более 95 мас.% активного соединения, или даже применять активное соединение без добавок.

Далее следуют примеры составов.

1. Продукты для разбавления водой для применения на листьях. Для обработки семян такие продукты можно использовать разбавленными или неразбавленными.

A) Водорастворимые концентраты (SL, LS)

Десять массовых частей ингибирующего AHAS гербицида растворяют в 90 массовых частях воды или водорастворимого растворителя. В качестве альтернативы добавляют смачивающие средства или другие вспомогательные средства. Ингибирующий AHAS гербицид при разведении растворяется в воде с образованием состава, содержащего 10% (мас./мас.) ингибирующего AHAS гербицида.

B) Диспергируемые концентраты (DC)

Двадцать массовых частей ингибирующего AHAS гербицида растворяют в 70 массовых частях циклогексанона с добавлением 10 массовых частей диспергирующего средства, например поливинилпирролидона. При разведении водой получают дисперсию, тем самым получая состав с 20% (мас./мас.) ингибирующего AHAS гербицида.

C) Эмульгируемые концентраты (EC)

Пятнадцать массовых частей ингибирующего AHAS гербицида растворяют в 7 массовых частях ксилола с добавлением додецилбензолсульфоната кальция и этоксилата касторового масла (по 5 массовых частей в каждом случае). При разведении водой получают эмульсию, тем самым получая состав с 15% (мас./мас.) ингибирующего AHAS гербицида.

D) Эмульсии (EW, EO, ES)

Двадцать пять массовых частей ингибирующего AHAS гербицида растворяют в 35 массовых частях ксилола с добавлением додецилбензолсульфоната кальция и этоксилата касторового масла (по 5 массовых частей в каждом случае). Эту смесь добавляют в 30 массовых частей воды, используя устройство для эмульгирования (например, Ultraturrax), и превращают в гомогенную эмульсию. При разведении водой получают эмульсию, тем самым получая состав с 25% (мас./мас.) ингибирующего AHAS гербицида.

E) Суспензии (SC, OD, FS)

В грануляторе при перемешивании измельчают 20 массовых частей ингибирующего AHAS гербицида с добавлением 10 массовых частей диспергирующих средств, смачивающих средств и 70 массовых частей воды или органического растворителя, получая тонкодисперсную суспензию ингибирующего AHAS гербицида. При разведении водой получают суспензию, тем самым получая состав с 20% (мас./мас.) ингибирующего AHAS гербицида.

F) Диспергируемые в воде гранулы и водорастворимые гранулы (WG, SG)

Пятьдесят массовых частей ингибирующего AHAS гербицида тонко измельчают с добавлением 50 массовых частей диспергирующих средств и смачивающих средств и формируют в виде диспергируемых или растворимых в воде гранул посредством технических устройств (например, экструзии, оросительной колонки, псевдоожиженного слоя). При разведении водой получают стабильную дисперсию или раствор ингибирующего AHAS гербицида, тем самым получая состав с 50% (мас./мас.) ингибирующего AHAS гербицида.

G) Диспергируемые в воде порошки и водорастворимые порошки (WP, SP, SS, WS)

Семьдесят пять массовых частей ингибирующего AHAS гербицида измельчают в дробилке с ротором и статором с добавлением 25 массовых частей диспергирующих средств, смачивающих средств и силикагеля. При разведении водой получают стабильную дисперсию или раствор ингибирующего AHAS гербицида, тем самым получая состав с 75% (мас./мас.) ингибирующего AHAS гербицида.

I) Гелевый состав (GF)

В перемешиваемом грануляторе измельчают 20 массовых частей ингибирующего AHAS гербицида с добавлением 10 массовых частей диспергирующих средств, 1 массовой части смачивающих средств с гелеобразующим средством и 70 массовых частей воды или органического растворителя с получением тонкоизмельченной суспензии ингибирующего AHAS гербицида. Разведение водой дает стабильную суспензию ингибирующего AHAS гербицида с образованием состава с 20% (мас./мас.) ингибирующего AHAS гербицида. Этот гелевый состав подходит для обработки семян.

2. Продукты для применения в неразведенном виде на листьях. Для обработки семян такие продукты можно применять в разведенном виде.

A) Распыляемые порошки (DP, DS)

Пять массовых частей ингибирующего AHAS гербицида тонко измельчают и тщательно смешивают с 95 массовыми частями тонкоизмельченного каолина. Это дает распыляемый продукт с 5% (мас./мас.) ингибирующего AHAS гербицида.

B) Гранулы (GR, FG, GG, MG)

Половину массовой части ингибирующего AHAS гербицида тонко измельчают и смешивают с 95,5 массовыми частями носителей с образованием состава, содержащего 0,5% (мас./мас.) ингибирующего AHAS гербицида. Применяемые для этого способы представляют собой экструзию, сушку распылением или использование псевдоожиженного слоя. В результате получаются гранулы, которые применяют в неразведенном виде для листьев.

Традиционные составы для обработки семян включают в себя, например, сыпучие концентраты FS, растворы LS, порошки для сухой обработки DS, диспергируемые в воде порошки для обработки взвесью WS, водорастворимые порошки SS и эмульсию ES и EC и гелевый состав GF. Эти составы можно применять для семян разведенными или неразведенными. Обработку в случае семян проводят перед посевом или обрабатывают непосредственно семена.

В предпочтительном варианте осуществления для обработки семян используют состав FS. Как правило, состав FS может содержать 1-800 г/л активного ингредиента, 1-200 г/л поверхностно-активного средства, от 0 до 200 г/л средства против замерзания, от 0 до 400 г/л связывающего средства, от 0 до 200 г/л красителя и до 1 литра растворителя, предпочтительно воды.

Настоящее изобретение относится к нетрансгенным и трансгенным семенам устойчивых к гербицидам растений по настоящему изобретению. Например, такие семена включают в себя нетрансгенные семена подсолнечника, обладающие свойствами устойчивости к гербицидам растения с номером патентного депонирования ATCC PTA-6084, и трансгенные семена, содержащие полинуклеотидную молекулу по изобретению, кодирующую устойчивый к гербицидам белок AHASL1.

В случае обработки семян семена устойчивых к гербицидам растений по настоящему изобретению обрабатывают гербицидами, предпочтительно гербицидами, выбранными из группы, состоящей из ингибирующих AHAS гербицидов, таких как амидосульфурон, азимсульфурон, бенсульфурон, хлоримурон, хлорсульфурон, циносульфурон, циклосульфамурон, этаметсульфурон, этоксисульфурон, флазасульфурон, флупирсульфурон, форамсульфурон, галогенсульфурон, имазосульфурон, иодосульфурон, мезосульфурон, метсульфурон, никосульфурон, оксасульфурон, примисульфурон, просульфурон, пиразосульфурон, римсульфурон, сульфометурон, сульфосульфурон, тифенсульфурон, триасульфурон, трибенурон, трифлоксисульфурон, трифлусульфурон, тритосульфурон, имазаметабенц, имазамокс, имазапик, имазапир, имазаквин, имазетапир, хлорансулам, диклосулам, флорасулам, флуметсулам, метосулам, пенокссулам, биспирибак, пириминобак, пропоксикарбазон, флукарбазон, пирибензоксим, пирифталид, пиритиобак, и их смесей, или составом, содержащим ингибирующий AHAS гербицид.

Термин «обработка семян» включает в себя все подходящие способы обработки семян, известные в данной области, такие как дезинфекция семян, дражирование семян, опудривание семян, пропитывание семян и удобрение семян.

По одному из вариантов настоящего изобретения дополнительным объектом изобретения является способ обработки почвы посредством внесения, в частности, в рядовую сеялку, гранулярного состава, содержащего ингибирующий AHAS гербицид в виде композиции/состава (например, гранулярный состав необязательно с одним или несколькими твердыми или жидкими применимыми для сельского хозяйства носителями и/или необязательно с одним или несколькими применимыми для сельского хозяйства поверхностно-активными веществами). Этот способ успешно применяют, например, для почв, подготовленных для посева злаков, кукурузы, хлопка и подсолнечника.

Настоящее изобретение также относится к семенам, покрытым составом для обработки семян или содержащим его, где состав содержит по меньшей мере один ингибитор ALS, выбранный из группы, состоящей из амидосульфурона, азимсульфурона, бенсульфурона, хлоримурона, хлорсульфурона, циносульфурона, циклосульфамурона, этаметсульфурона, этоксисульфурона, флазасульфурона, флупирсульфурона, форамсульфурона, галогенсульфурона, имазосульфурона, иодосульфурона, мезосульфурона, метсульфурона, никосульфурона, оксасульфурона, примисульфурона, просульфурона, пиразосульфурона, римсульфурона, сульфометурона, сульфосульфурона, тифенсульфурона, триасульфурона, трибенурона, трифлоксисульфурона, трифлусульфурона, тритосульфурона, имазаметабенца, имазамокса, имазапика, имазапира, имазаквина, имазетапира, хлорансулама, диклосулама, флорасулама, флуметсулама, метосулама, пенокссулама, биспирибака, пириминобака, пропоксикарбазона, флукарбазона, пирибензоксима, пиривталида и пиритиобака.

Термин «семя» охватывает семена и побеги растений всех типов, включая в качестве неограничивающих примеров истинные семена, части семян, отростки, клубнелуковицы, луковицы, плоды, клубни, зерна, отводки, срезы и т.п., и в предпочтительном варианте осуществления означает истинные семена.

Термин "покрытый и/или содержащий" обычно означает, что активный ингредиент во время применения находится преимущественно на поверхности культивируемого продукта, хотя в зависимости от способа применения большая или меньшая часть ингредиента может проникать в культивируемый продукт. Когда указанный культивируемый продукт (пере)высаживают, он может абсорбировать активный ингредиент.

Применение обработки семян ингибирующим AHAS гербицидом или содержащим ингибирующий AHAS гербицид составом проводят с помощью опрыскивания или опыления семян перед посевом растений и перед всходом растений.

При обработке семян соответствующие составы применяют путем обработки семян эффективным количеством ингибирующего AHAS гербицида или состава, содержащего ингибирующий AHAS гербицид. В соответствии с данной заявкой нормы внесения составляют, как правило, от 0,1 г до 10 кг а.и. (или смеси а.и. или состава) на 100 кг семян, предпочтительно, от 1 г до 5 кг на 100 кг семян, более предпочтительно, от 1 г до 2,5 кг на 100 кг семян. Для конкретных культур, таких как салат, количество может быть большим.

Настоящее изобретение относится к способу борьбы с нежелательной растительностью или к способу контроля сорняков, включающему в себя приведение семян устойчивых растений по настоящему изобретению перед посевом и/или после предварительного проращивания в контакт с ингибирующим AHAS гербицидом. Способ может также включать в себя посев семян, например, в почву на поле или в почву в теплице. Способ находит конкретное применение для борьбы с нежелательным ростом или для контроля сорняков в непосредственной близости от семян.

Подразумевается, что контроль нежелательного роста означает уничтожение сорняков и/или другое торможение или ингибирование нормального роста сорняков. Подразумевается, что сорняки в самом широком смысле означают все растения, которые растут на тех участках, где они нежелательны.

Сорняки по настоящему изобретению включают в себя, например, двудольные и однодольные сорняки. Двудольные сорняки включают в себя в качестве неограничивающих примеров сорняки родов: Sinapis, Lepidium, Galium, Stellaria, Matricaria, Anthemis, Galinsoga, Chenopodium, Urtica, Senecio, Amaranthus, Portulaca, Xanthium, Convolvulus, Ipomoea, Polygonum, Sesbania, Ambrosia, Cirsium, Carduus, Sonchus, Solanum, Rorippa, Rotala, Lindernia, Lamium, Veronica, Abutilon, Emex, Datura, Viola, Galeopsis, Papaver, Centaurea, Trifolium, Ranunculus и Taraxacum. Однодольные сорняки включают в себя в качестве неограничивающих примеров сорняки родов: Echinochloa, Setaria, Panicum, Digitaria, Phleum, Poa, Festuca, Eleusine, Brachiaria, Lolium, Bromus, Avena, Cyperus, Sorghum, Agropyron, Cynodon, Monochoria, Fimbristyslis, Sagittaria, Eleocharis, Scirpus, Paspalum, Ischaemum, Sphenoclea, Dactyloctenium, Agrostis, Alopecurus, Apera.

Кроме того, сорняки по настоящему изобретению могут включать в себя, например, сельскохозяйственные культуры, растущие в нежелательном месте. Например, самосевное растение кукурузы, находящееся на поле, которое преимущественно содержит растения сои, можно рассматривать как сорняк, если растение кукурузы нежелательно на поле с растениями сои.

Как применяют в настоящем документе, обозначение "включающий в себя" или вариации, такие как "включает в себя" или "содержащий", следует понимать как выражение включения куда-либо указанного элемента, числа или стадии или группы элементов, чисел или стадий, но не исключения любого другого элемента, числа или стадии или группы элементов, чисел или стадий.

Следующие ниже примеры предложены с целью иллюстрации и не ограничивают объем данного изобретения.

ПРИМЕР 1: Мутагенез линии Helianthus annuus HA89 и отбор устойчивых к имидазолинону растений

При окончании вегетационного периода 1 растения подсолнечника (Helianthus annuus) поддерживающей линии HA89 обрабатывали этилметансульфонатом (EMS, также называющимся этиловым эфиром метансульфоновой кислоты). EMS является известным мутагеном, который обычно индуцирует в ДНК транзиции G-C в A-T (Jander et al. (2003) Plant Physiol. 131:139-146). Проводили два отдельных эксперимента. В первом эксперименте использовали три концентрации EMS. Растения обрабатывали раствором, содержащим 0,1%, 1% или 10% (мас./об.) EMS. Для каждой обработки EMS засевали 14 рядов на открытом грунте исследовательской станции Advanta Semillas Biotech Research Station в Balcarce, BsAs, Argentina.

Во втором эксперименте в открытом грунте в Advanta Winter Nursery в Oran, Salta, Argentina, засевали 25 рядов семян линии подсолнечника HA89. Из указанных 25 рядов 8 рядов обрабатывали 5% EMS, как описано выше. Остальные 17 рядов оставались необработанными.

В каждом эксперименте для гарантии того, что образовавшиеся семена M1 являются продуктом самоопыления, все растения M0 перед цветением накрывали мешками. Семенные шапки после каждой обработки EMS собирали и обмолачивали большой партией. В следующий вегетационный период мутантные семена M1 растений, обработанных 0,1%, 1,0%, 5,0% или 10,0% EMS, высаживали в открытом грунте, каждую обработанную партию в отдельную грядку. Через двенадцать суток, когда растения находились на стадии развития с 2-4 парами листьев, все обработанные EMS растения опрыскивали 2× Sweeper 70DG (100 г а.и./га). Активным ингредиентом в Sweeper является имазамокс. После опрыскивания гербицидом выжило всего 53 растения, и их отобрали как предположительно устойчивых. Распределение устойчивых растений на обработку EMS представлено в таблице 1.

Таблица 1
Количество устойчивых к имидазолинонам растений подсолнечника M1, полученных после каждой обработки EMS
Концентрация EMS (%) Кол-во полученных устойчивых растений
0,1 14
1 18
5 5
10 16

От каждого отдельного выжившего растения M1 забирали образцы тканей и из каждого образца для исследований путем амплификации с помощью ПЦР и секвенирования, описанных ниже в примере 2, выделяли ДНК.

53 предположительно устойчивым растениям (таблица 1) позволяли созревать в поле. Из указанных 53 растений 29 образовали семена M2 и эти семена собирали. Вскоре после этого каждые из указанных семейств M1:2 высевали в отдельные грядки (т.е. 29 грядок с количеством рядов от 1 до 3 каждая в Fargo, North Dakota, USA. Эти семейства M1:2 и чувствительные (дикого типа) контрольные растения HA89 опрыскивали 0,5 × Sweeper (25 г а.и./га). Через одиннадцать суток после обработки гербицидом идентифицировали три семейства, у которых после обработки гербицидом выжило более 50% растений. Перед цветением выжившие растения в каждом из указанных трех семейств M1:2 покрывали мешками для получения образующегося в результате самоопыленного семени M3. Отдельные семенные шапки каждого растения M1:2 собирали и обмолачивали. Собирали отдельные ткани растений M2 отобранных семейств.

ПРИМЕР 2: Амплификация ПЦР и секвенирование полинуклеотидов подсолнечника, кодирующих устойчивые к имидазолинонам и дикого типа белки AHASL1

ДНК выделяли из ткани M1 одного из трех семейств M1:2, которые были описаны выше в примере 1. ДНК растения M1 подвергали амплификации с помощью полимеразной цепной реакции (ПЦР) и секвенировали для определения источника толерантности к имидазолинонам, что подробно описано ниже.

Растение M1 указанного семейства обозначили как MUT28. Из ткани MUT28, а также из ткани растения HA89 дикого типа выделили геномную ДНК. Образцы выделенной ДНК из MUT28 и HA89 разбавляли до исходной концентрации 100 нг/мкл для применения в качестве матричной ДНК для амплификаций ПЦР. Для образцов ДНК из MUT28 и HA89 амплифицировали полную кодирующую область гена AHASL1 подсолнечника. Конкретные праймеры, использованные для получения каждого ампликона, приведены в таблице 2.

Таблица 2
Праймеры ПЦР для амплификации кодирующей области гена AHASL1 подсолнечника
Область AHASL1 Название праймера Последовательность праймера
1-й ампликон (843 п.н.) ALS1-1F CATCATCATTAAATAACCAGAC (SEQ ID NO: 11)
ALS1-1R AACCCGGTAACCTCATCGGTTC (SEQ ID NO: 12)
2-й ампликон (739 п.н.) ALS1-2F CCCGGTTTTGATAGATGTACCG (SEQ ID NO: 13)
ALS1-2R CTGAGCAGCCCACATCTGATGT (SEQ ID NO: 14)
3-й ампликон (674 п.н.) ALS1-3F CTGAGCAGCCCACATCTGATGT (SEQ ID NO: 15)
ALS1-3R AATTACACAACAAAACATTAAC (SEQ ID NO:16)

На основании сравнений нуклеотидных последовательностей известных генов AHASL1, AHASL2 и AHASL3 были сконструированы праймеры ПЦР для специфической амплификации гена AHASL1 подсолнечника. Использовали следующие условия ПЦР при общем объеме реакционной смеси 25 мкл: 1× буфер (Invitrogen Corp., Carlsbad, CA, USA), 0,2 мМ dNTP (Invitrogen), 2,5 мМ MgCl2 (Invitrogen), 0,2 мкМ каждого праймера, 0,5 мкл Platinium Taq (5 Ед/мкл) (Invitrogen) и 100 нг геномной ДНК. Реакции ПЦР проводили в устройстве для ПЦР GeneAmp PCR System 9700 (PerkinElmer, Inc., Boston, MA, USA). Условия проведения циклов были следующие: стадия начальной денатурации при 94°C в течение 1 минуты с последующими 35 циклами, состоящими из 94°C в течение 45 секунд, 52°C в течение 45 секунд и 72°C в течение 70 секунд, и стадией финальной элонгации при 72°C в течение 10 минут. Затем два микролитра каждого полученного продукта ПЦР анализировали с помощью электрофореза в агарозном геле и рассчитывали концентрацию ДНК по сравнению с маркером низкомолекулярной ДНК Low DNA Mass Ladder (Invitrogen Corp., Carlsbad, CA, USA). Оставшийся продукт ПЦР очищали с применением Wizard® SV Gel и PCR Clean-Up System (Promega Corp., Madison, WI, USA). Затем очищенные продукты ПЦР подвергали циклическому секвенированию с применением набора BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) в соответствии с инструкциями производителя. Кроме праймеров, использованных в амплификациях ПЦР (таблица 2), для проведения секвенирования полной кодирующей области гена AHASL1 подсолнечника были использованы дополнительные праймеры, приведенные в таблице 3.

Таблица 3
Дополнительные праймеры для секвенирования кодирующей области гена AHASL1 подсолнечника
Область AHASL1 Название праймера Последовательность праймера
1-й ампликон ALS-3F GCGCTGTTAGACAGTGTCC (SEQ ID NO: 17)
2-й ампликон SUNALS1F1 ACTAATCTTGATTTTTCG (SEQ ID NO: 18)
3-й ампликон ALS-6R CGGCAGATTTTCAACACGGA (SEQ ID NO:19)

Флуоресцентно-меченные продукты после реакций секвенирования разрешали посредством капиллярного электрофореза на устройстве ABI Prism 310 Genetic Analyzer (Applied Biosystems) и анализировали с применением программного обеспечения ABI Prism DNA Sequencing Analysis, версия 3.7. Файлы с результатами секвенирования AHASL1 подсолнечника, полученные в случае каждого ампликона, объединяли с применением программного обеспечения Vector NTI Suite-Contig Express, версия 7.0 (InforMax, Frederick, MD, USA). Полученные последовательности ДНК выравнивали с полинуклеотидными последовательностями AHASL1 линии подсолнечника HA89 и Xanthium sp. (фиг. 1). Предсказанную аминокислотную последовательность нового мутантного гена AHASL1 подсолнечника выравнивали с аминокислотными последовательностями AHASL1 HA89 и Xanthium sp. (фиг. 2) с применением программного обеспечения Vector NTI Suite-AlignX, версия 7.0 (InforMax), используя параметры по умолчанию. Затем идентифицировали однонуклеотидные полиморфизмы и единичные аминокислотные замены.

ПРИМЕР 3: Устойчивость к гербицидам растений подсолнечника MUT28

Для оценки устойчивости растений подсолнечника MUT28 к имидазолиноновым гербицидам растения подсолнечника HA89 (дикого типа), MUT28 (гомозиготы) и HA89/MUT28 (гетерозиготы) высевали в открытом грунте в Balcarce, Argentina, в течение вегетационного периода в полевом испытании, рандомизированном по схеме полноблочного эксперимента (RCBD), с двумя повторениями для оценки толерантности растений MUT28 и HA89/MUT28 к трем уровням Sweeper 70DG: 1×, 2× и 3×. Активным ингредиентом в Sweeper является имазамокс, а 1× доза составляет 50 г а.и./га. Результаты приведены в таблице 4.

Таблица 4
Толерантность растений подсолнечника MUT28 к имидазолинонам (уровни повреждения гербицидом)
Линия Уровень
HA89 0* 75 75
MUT28 в пределах семейств 0 33 -
HA89/MUT28 0 28 45
IMISUN-1 0 4 9
* Отсутствие повреждения = 0

По сравнению с HA89 дикого типа линии подсолнечника MUT28 испытывали меньшее повреждение при 1× уровне Sweeper. Линии HA89/MUT28 в этом испытании также был оказан меньший вред, чем линии HA89, в случае обоих уровней Sweeper: 1× и 2×. Результаты испытания демонстрируют, что обе линии: MUT28 (гомозигота) и HA89/MUT28 (гетерозигота), обладали повышенной толерантностью к имидазолиноновому гербициду, в частности к имазамоксу. Однако ни MUT28, ни HA89/MUT28 не продемонстрировали уровня толерантности линий подсолнечника IMISUN-1, для которых известно, что они гомозиготны по гену AHASL1, кодирующему белок AHASL1 с заменой Ala190 на Val.

В отдельном испытании в Balcarce, сходным с описанным только что испытанием, линия MUT28 не продемонстрировала повышенной толерантности к Sweeper по сравнению с HA89. Однако в другом отдельном испытании, проведенном в Fargo, ND, USA, 52% растений M2 MUT28 были толерантными, но демонстрировали меньший уровень толерантности, чем линия SURES-1. SURES-1 является устойчивой к сульфонилкарбамидам линией, полученной из F3 поддерживающей масличные культуры линией F4, которую получили из растений дикой популяции Helianthus annuus, собранной в Kansas, USA (Al-Khatib et al. (1999) "Survey of common sunflower (Helianthus annuus) resistance to ALS-inhibiting herbicides in northeast Kansas", в Proceedings of 21th Sunflower Research Workshop, National Sunflower Association, Bismarck, N.D., рp.210-215).

Для оценки толерантности растений подсолнечника MUT28 к сульфонилкарбамидным гербицидам линии подсолнечника HA89 (дикого типа), MUT28, IMISUN-1 и SURES-1 высаживали в открытом грунте в Balcarce, Argentina в течение вегетационного периода в полевом испытании RCBD с двумя повторениями для оценки толерантности растений MUT28 к сульфонилкарбамидному гербициду тифенсульфурону (TFS) при 1× и 2× уровнях. 1× уровень для TFS составляет 4,4 г а.и./га. Результаты представлены в таблице 5.

Таблица 5
Толерантность растений подсолнечника MUT28 к сульфонилкарбамидам (уровни повреждения гербицидом)
Линия Уровень
HA89 0* 75 75
MUT28 0 30 42
IMISUN-1 0 20 75
SURES-1 0 5 3
* Отсутствие повреждения = 0

Линия MUT28 продемонстрировала большую толерантность к TFS чем HA89 при 1× и 2× уровнях, демонстрируя, что растения MUT28 обладают большей толерантностью к сульфонилкарбамидному гербициду по сравнению с растениями подсолнечника дикого типа.

ПРИМЕР 4: Устойчивые к гербицидам белки AHASL1 подсолнечника

Настоящее изобретение относится к нуклеотидным и аминокислотным последовательностям полипептидов подсолнечника AHASL1 дикого типа и устойчивых к гербицидам. Растения с устойчивыми к гербицидам полипептидами AHASL1 были идентифицированы ранее, и был описан ряд консервативных областей полипептидов AHASL1, являющихся участками замен аминокислот, обуславливающих устойчивость к гербицидам (см. Devine и Eberlein (1997), "Physiological, biochemical and molecular aspects of herbicide resistance based on altered target sites" в Herbicide Activity: Toxicology, Biochemistry and Molecular Biology, Roe (eds.), рp.159-185, IOS Press, Amsterdam и Devine и Shukla, (2000) Crop Protection 19:881-889).

C применением последовательностей AHASL1 по изобретению и известных специалистам в данной области способов можно получать дополнительные полинуклеотиды, кодирующие устойчивые к гербицидам полипептиды AHASL1 с одной, двумя, тремя или более аминокислотными заменами в идентифицированных участках в указанных консервативных областях. В таблице 6 перечислены консервативные области белков AHASL1, аминокислотные замены в указанных областях, для которых известно, что они придают устойчивость к гербицидам, и соответствующие аминокислоты в белке AHASL1 подсолнечника SEQ ID NO: 4.

Таблица 6
Мутации в консервативных областях полипептидов AHASL1, для которых известно, что они придают устойчивость к гербицидам, и их эквивалентное положение в AHASL1 подсолнечника
Консервативная область 1 Мутация 2 Ссылка Положение аминокислоты в подсолнечнике
VFAYPGG A SMEIHQALTRS3 Ala122 на Thr Bernasconi et al. 4 Ala107
Wright & Penner14
AITGQV P RRMIGT3 Pro197 на Ala Boutsalis et al. 6 Pro18213
Pro197 на Thr Guttieri et al. 7
Pro197 на His Guttieri et al. 8
Pro197 на Leu Guttieri et al. 7
Kolkman et al. 15
Pro197 на Arg Guttieri et al. 7
Pro197 на Ile Boutsalis et al. 6
Pro197 на Gln Guttieri et al. 7
Pro197 на Ser Guttieri et al. 7
A FQETP3 Ala205 на Asp Hartnett et al. 9 Ala190
Ala205 на Val Simpson10
Kolkman et al. 15
White et al. 16
Q W ED3 Trp574 на Leu Briniard11 Trp559
Boutsalis et al. 6
IP S GG4 Ser653 на Asn Devine & Eberlein12
Lee et al. 17 Ala638
Ser653 на Thr Chang & Duggleby18
Ser653 на Phe
1Консервативные области из Devine и Eberlein (1997), "Physiological, biochemical and molecular aspects of herbicide resistance based on altered target sites" в Herbicide Activity: Toxicology, Biochemistry and Molecular Biology, Roe et al. (eds.), рp.159-185, IOS Press, Amsterdam, и Devine и Shukla, (2000) Crop Protection 19:881-889.
2Нумерация аминокислот соответствует аминокислотной последовательности полипептида AHASL1 Arabidopsis thaliana.
3AHASL1 подсолнечника (SEQ ID NO: 4) несет ту же консервативную область.
4Область подсолнечника AHASL1 (SEQ ID NO: 4), соответствующая указанной консервативной области, имеет последовательность IP A GG.
5Bernasconi et al. (1995) J. Biol. Chem. 270(29):17381-17385.
6Boutsalis et al. (1999) Pestic. Sci. 55:507-516.
7Guttieri et al. (1995) Weed Sci. 43:143-178.
8Guttieri et al. (1992) Weed Sci. 40:670-678.
9Hartnett et al. (1990) "Herbicide-resistant plants carrying mutated acetolactate synthase genes" в Managing Resistance to Agrochemicals: Fundamental Research to Practical Strategies, Green et al. (eds.), American Chemical Soc. Symp., Series No. 421, Washington, DC, USA.
10Simpson (1998), Down to Earth 53(1):26-35.
11Bruniard (2001), Inheritance of imidazolinone resistance, characterization of cross-resistance pattern, and identification of molecular markers in sunflower (Helianthus annuus L.). Ph.D. Thesis, North Dakota State University, Fargo, ND, USA, рp.1-78.
12Devine и Eberlein (1997), "Physiological, biochemical and molecular aspects of herbicide resistance based on altered target sites" в Herbicide Activity: Toxicology, Biochemistry and Molecular Biology, Roe et al. (eds.), рp.159-185, IOS Press, Amsterdam.
13Настоящее изобретение относится к аминокислотной последовательности устойчивого к гербицидам AHASL1 с заменой Pro182 на Leu (SEQ ID NO: 2) и полинуклеотидной последовательности, кодирующей этот устойчивый к гербицидам AHASL1 (SEQ ID NO: 1).
14Wright и Penner (1998), Theor. Appl. Genet. 96:612-620.
15Kolkman et al. (2004) Theor. Appl. Genet. 109: 1147-1159.
16White et al. (2003) Weed Sci. 51:845-853.
17Lee et al. (1999) FEBS Lett. 452:341-345.
18Chang и Duggleby (1998), Biochem J. 333:765-777.

Все публикации и патентные заявки, указанные в данном описании, показательны для специалистов в данной области, к которой относится настоящее изобретение. Все публикации и патентные заявки включены в настоящий документ в качестве ссылки в такой степени, как если бы каждая отдельная публикация или патентная заявка была прямо и индивидуально указана для включения в качестве ссылки.

Хотя приведенное выше описание для лучшего понимания изобретения довольно подробно изложено с использованием иллюстраций и примеров, очевидно, что можно осуществлять определенные изменения и модификации в пределах объема представленной формулы изобретения.

1. Растение подсолнечника со свойствами гербицидтолерантности растения линии MUT28, причем образец семян указанной линии задепонирован под номером АТСС РТА-6084, где указанное растение подсолнечника содержит по меньшей мере одну копию полинуклеотида, кодирующего гербицидтолерантный белок большой субъединицы ацетогидроксиацидсинтазы 1 (AHASL1).

2. Растение подсолнечника по п.1, где белок большой субъединицы ацетогидроксиацидсинтазы 1 (AHASL1) содержит лейцин в положении аминокислоты 182 или эквивалентном положении.

3. Растение подсолнечника по п.1 или 2, где белок AHASL1 содержит аминокислотную последовательность SEQ ID NO: 2 или 6.

4. Растение подсолнечника по п.2, где ген AHASL1 содержит нуклеотидную последовательность SEQ ID NO: 1 или 5.

5. Растение подсолнечника по п.1, где указанное растение обладает повышенной толерантностью по меньшей мере к одному гербициду, выбранному из группы, состоящей из имидазолиноновых гербицидов, сульфонилкарбамидных гербицидов, триазолопиримидиновых гербицидов, пиримидинилоксибензоатных гербицидов и сульфониламинокарбонилтриазолиноновых гербицидов, и к их комбинациям.

6. Растение подсолнечника по п.1, где указанное растение подсолнечника является растением линии MUT28, причем образец семян задепонирован под номером АТСС РТА-6084.

7. Растение подсолнечника по п.1, где указанное растение является трансгенным для указанного полинуклеотида, кодирующего AHASL1.

8. Семя растения подсолнечника по любому из пп.1-7, где семя обладает повышенной толерантностью по меньшей мере к одному гербициду, выбранному из группы, состоящей из имидазолиноновых гербицидов, сульфонилкарбамидных гербицидов, триазолопиримидиновых гербицидов, пиримидинилоксибензоатных гербицидов и сульфониламинокарбонилтриазолиноновых гербицидов, или к их комбинациям, и где семя обладает повышенной толерантностью по сравнению с толерантностью семени растения подсолнечника дикого типа НА89.

9. Способ контроля сорняков вблизи растения подсолнечника по любому из пп.1-7, где указанный способ предусматривает нанесение эффективного количества гербицида, выбранного из группы, состоящей из имидазолиноновых гербицидов, сульфонилкарбамидных гербицидов, триазолопиримидиновых гербицидов, пиримидинилоксибензоатных гербицидов и сульфониламинокарбонилтриазолиноновых гербицидов или их смесей, на сорняки и на растение подсолнечника.

10. Способ по п.9, где указанный имидазолиноновый гербицид выбран из группы, состоящей из 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)никотиновой кислоты, 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-3-хинолинкарбоновой кислоты, 5-этил-2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)никотиновой кислоты, 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-5-(метоксиметил)никотиновой кислоты, 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-5-метилникотиновой кислоты и смеси метилового эфира 6-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-м-толуиловой кислоты и метилового эфира 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-п-толуиловой кислоты и их комбинаций.

11. Способ по п.9, где указанный сульфонилкарбамидный гербицид выбран из группы, состоящей из хлорсульфурона, метсульфуронметила, сульфометуронметила, хлоримуронэтила, тифенсульфуронметила, трибенуронметила, бенсульфуронметила, никосульфурона, этаметсульфуронметила, римсульфурона, трифлусульфуронметила, триасульфурона, примисульфуронметила, циносульфурона, амидосульфурона, флузасульфурона, имазосульфурона, пиразосульфуронэтила, галогенсульфурона и их смесей.

12. Выделенная, рекомбинантная или мутированная полинуклеотидная молекула, кодирующая белок с активностью AHAS, где указанная полинуклеотидная молекула содержит нуклеотидную последовательность, выбранную из группы, состоящей из
(a) любой из нуклеотидных последовательностей SEQ ID NO: 1 и 5;
(b) нуклеотидных последовательностей, кодирующих любую аминокислотную последовательность SEQ ID NO: 2 или 6;
(c) нуклеотидных последовательностей, которые по меньшей мере на 85% идентичны любой нуклеотидной последовательности, выбранной из группы, состоящей из SEQ ID NO: 1 и 5;
(d) нуклеотидных последовательностей, кодирующих белок, последовательность которого по меньшей мере на 95% идентична любой аминокислотной последовательности, выбранной из группы, состоящей из SEQ ID NO: 2 и 6;
(e) нуклеотидных последовательностей, которые гибридизуются в жестких условиях с любой нуклеотидной последовательностью, выбранной из группы, состоящей из SEQ ID NO: 1 и 5;
(f) нуклеотидных последовательностей, которые полностью комплементарны любым нуклеотидным последовательностям, указанным в (а)-(е).

13. Выделенная, рекомбинантная или мутированная полинуклеотидная молекула по п.12, где указанный белок, кодируемый нуклеотидной последовательностью, указанной в (с) или (е), дополнительно содержит по меньшей мере одну аминокислоту, выбранную из группы, состоящей из
(a) лейцина, аланйна, треонина, гистидина, аргинина или изолейцина в положении аминокислоты 182 и эквивалентном положении;
(b) треонина в положении аминокислоты 107 и эквивалентном положении;
(c) аспартата или валина в положении аминокислоты 190 и эквивалентном положении;
(d) лейцина в положении аминокислоты 559 и эквивалентном положении; и
(e) аспарагина, треонина, фенилаланина или валина в положении аминокислоты 638 и эквивалентном положении.

14. Кассета экспрессии, содержащая промотор, функционально связанный с полинуклеотидной молекулой по п.12 или 13.

15. Кассета экспрессии по п.14, где указанный промотор способен направлять генную экспрессию в бактерии, грибковой клетке, клетке животного или растительной клетке.

16. Клетка-хозяин, не являющаяся клеткой человека, трансформированная кассетой экспрессии по п.14 или 15.

17. Клетка-хозяин по п.16, где указанная клетка-хозяин выбрана из группы, состоящей из бактерии, грибковой клетки, клетки животного и растительной клетки.

18. Трансформирующий вектор, содержащий представляющий интерес ген и ген селективного маркера, где указанный ген селективного маркера содержит промотор, функционально связанный с полинуклеотидной молекулой по п.12.

19. Трансформирующий вектор по п.18, где указанный промотор способен к экспрессии в растительной клетке.

20. Трансформирующий вектор по п.18 или 19, где указанный промотор является конститутивным промотором.

21. Трансформирующий вектор по п.18, где указанный ген селективного маркера дополнительно содержит функционально связанную последовательность для направленного транспорта в хлоропласты.

22. Трансформирующий вектор по п.18, где указанный промотор способен к экспрессии в бактерии или дрожжах.

23. Клетка-хозяин, не являющаяся клеткой человека, содержащая трансформирующий вектор по любому из пп.18-22.

24. Трансформированное растение, содержащее в своем геноме стабильно встроенную полинуклеотидную конструкцию, содержащую нуклеотидную молекулу по п.12, функционально связанную с промотором, направляющим экспрессию в растительной клетке, где активность AHAS указанного трансформированного растения по сравнению с нетрансформированным растением повышена, и где толерантность указанного трансформированного растения по меньшей мере к одному гербициду по сравнению с нетрансформированным растением повышена.

25. Трансформированное растение по п.24, где указанный промотор выбран из группы, состоящей из конститутивных промоторов и тканеспецифических промоторов.

26. Трансформированное растение по п.24 или 25, где указанная полинуклеотидная конструкция дополнительно содержит функционально связанную последовательность для направленного транспорта в хлоропласты.

27. Трансформированное растение по п.24, где указанный гербицид является имидазолиноновым гербицидом.

28. Трансформированное растение по п.27, где указанный имидазолиноновый гербицид выбран из группы, состоящей из 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)никотиновой кислоты, 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-3-хинолинкарбоновой кислоты, 5-этил-2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)никотиновой кислоты, 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-5-(метоксиметил)никотиновой кислоты, 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-5-метилникотиновой кислоты, смесей метилового эфира 6-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-м-толуиловой кислоты и метилового эфира 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-п-толуиловой кислоты и их комбинаций.

29. Трансформированное растение по п.24, где указанный гербицид представляет собой сульфонилкарбамидный гербицид.

30. Трансформированное растение по п.29, где указанный сульфонилкарбамидный гербицид выбран из группы, состоящей из хлорсульфурона, метсульфуронметила, сульфометуронметила, хлоримуронэтила, тифенсульфуронметила, трибенуронметила, бенсульфуронметила, никосульфурона, этаметсульфуронметила, римсульфурона, трифлусульфуронметила, триасульфурона, примисульфуронметила, циносульфурона, амидосульфурона, флузасульфурона, имазосульфурона, пиразосульфуронэтила, галогенсульфурона и их смесей.

31. Трансформированное растение по п.24, где указанное трансформированное растение является двудольным или однодольным.

32. Трансформированное растение по п.31, где указанное двудольное растение выбрано из группы, состоящей из подсолнечника, сои, хлопка, Brassica spp., Arabidopsis thaliana, табака, картофеля, сахарной свеклы, люцерны, сафлора и арахиса.

33. Трансформированное растение по п.31, где указанное однодольное растение выбрано из группы, состоящей из пшеницы, риса, кукурузы, ячменя, ржи, овса, тритикале, проса и сорго.

34. Семя трансформированного растения по любому из пп.24-33, где указанное семя содержит указанную полинуклеотидную конструкцию.

35. Трансформированная растительная клетка, содержащая в своем геноме стабильно встроенную полинуклеотидную конструкцию, содержащую нуклеотидную молекулу по п.12, функционально связанную с промотором, направляющим экспрессию в растительной клетке.

36. Способ повышения активности AHAS у растения, предусматривающий трансформацию растительной клетки полинуклеотидной конструкцией, содержащей нуклеотидную молекулу по п.12, функционально связанную с промотором, направляющим экспрессию в растительной клетке, и регенерацию трансформированного растения из указанной трансформированной растительной клетки.

37. Способ получения гербицидтолерантного растения, предусматривающий
трансформацию растительной клетки полинуклеотидной конструкцией, содержащей полинуклеотидную молекулу по п.12, функционально связанную с промотором, направляющим экспрессию в растительной клетке; и
регенерацию трансформированного растения из указанной трансформированной растительной клетки, где указанное трансформированное растение обладает повышенной толерантностью по меньшей мере к одному гербициду по сравнению с толерантностью нетрансформированного растения к указанному гербициду.

38. Способ по п.37, где указанный промотор выбран из группы, состоящей из конститутивных промоторов и тканеспецифических промоторов.

39. Способ по п.37 или 38, где указанная полинуклеотидная конструкция дополнительно содержит функционально связанную последовательность для направленного транспорта в хлоропласты.

40. Способ по п.37 или 38, где активность AHAS указанного трансформированного растения повышена по сравнению с трансформированным растением.

41. Способ по п.37 или 38, где указанный гербицид представляет собой имидазолиноновый гербицид.

42. Способ по п.41, где указанный имидазолиноновый гербицид выбран из группы, состоящей из 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)никотиновой кислоты, 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-3-хинолинкарбоновой кислоты, 5-этил-2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)никотиновой кислоты, 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-5-(метоксиметил)никотиновой кислоты, 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-5-метилникотиновой кислоты, смесей метилового эфира 6-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-м-толуиловой кислоты и метилового эфира 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-п-толуиловой кислоты и их комбинаций.

43. Способ по п.37 или 38, где указанный гербицид представляет собой сульфонилкарбамидный гербицид.

44. Способ по п.43, указанный сульфонилкарбамидный гербицид выбран из группы, состоящей из хлорсульфурона, метсульфуронметила, сульфометуронметила, хлоримуронэтила, тифенсульфуронметила, трибенуронметила, бенсульфуронметила, никосульфурона, этаметсульфуронметила, римсульфурона, трифлусульфуронметила, триасульфурона, примисульфуронметила, циносульфурона, амидосульфурона, флузасульфурона, имазосульфурона, пиразосульфуронэтила, галогенсульфурона и их смесей.

45. Способ по п.37 или 38, где указанное трансформированное растение является двудольным или однодольным.

46. Способ по п.45, где указанное двудольное растение выбрано из группы, состоящей из подсолнечника, сои, хлопка, Brassica spp., Arabidopsis thaliana, табака, картофеля, сахарной свеклы, люцерны, сафлора и арахиса.

47. Способ по п.45, где указанное однодольное растение выбрано из группы, состоящей из пшеницы, риса, кукурузы, ячменя, ржи, овса, тритикале, проса и сорго.

48. Способ по п.37 или 38, где указанная растительная клетка обладает толерантностью по меньшей мере к одному гербициду до указанной стадии трансформации.

49. Способ повышения гербицидустойчивости у гербицидустойчивого растения, предусматривающий стадии трансформации гербицидустойчивого растения полинуклеотидной конструкцией, содержащей нуклеотидную молекулу, функционально связанную с промотором, направляющим экспрессию в растительной клетке, и регенерации трансформированного растения из указанной трансформированной растительной клетки, где указанное гербицидустойчивое растение обладает повышенной толерантностью по сравнению с трансформированным гербицидустойчивым растением; где полинуклеотидная молекула содержит нуклеотидную последовательность, выбранную из группы, состоящей из
(a) любой из нуклеотидных последовательностей SEQ ID NO: 1 или 5;
(b) нуклеотидных последовательностей, кодирующих любую аминокислотную последовательность SEQ ID NO: 2 или 6;
(c) нуклеотидных последовательностей, которые по меньшей мере на 85% идентичны любой нуклеотидной последовательности, выбранной из группы, состоящей из нуклеотидных последовательностей SEQ ID NO: 1 и 5;
(d) нуклеотидных последовательностей, кодирующих белок, последовательность которого по меньшей мере на 95% идентична любой аминокислотной последовательности, выбранной из группы, состоящей из SEQ ID NO: 2 и 6.

50. Способ по п.49, где указанное гербицидустойчивое растение до указанной стадии трансформации содержит гербицидустойчивый белок AHASL.

51. Способ по п.49 или 50, где указанное гербицидустойчивое растение не является генетически сконструированным для экспрессии указанного гербицидустойчивого белка AHASL.

52. Способ по п.49 или 50, где указанное гербицидустойчивое растение является генетически сконструированным для экспрессии указанного гербицидустойчивого белка AHASL.

53. Способ по п.49 или 50, где указанное гербицидустойчивое растение до указанной стадии трансформации является имидазолинонустойчивым растением.

54. Способ отбора трансформированной растительной клетки, предусматривающий стадии трансформации растительной клетки трансформирующим вектором растений, воздействия на указанную трансформированную растительную клетку по меньшей мере одним гербицидом в концентрации, ингибирующей рост нетрансформированной растительной клетки, и идентификации указанной трансформированной растительной клетки по ее способности расти в присутствии указанного гербицида; где указанный трансформирующий вектор растений содержит ген селективного маркера, содержащий промотор, и функционально связан с полинуклеотидной молекулой по п.12, где указанный промотор направляет экспрессию в растительной клетке.

55. Способ по п.54, где указанный гербицид представляет собой имидазолиноновый гербицид, сульфонилкарбамидный гербицид или их смесь.

56. Способ по п.54, где указанный трансформирующий вектор растений дополнительно содержит по меньшей мере один представляющий интерес ген.

57. Способ по любому из пп.54-56, дополнительно предусматривающий стадию регенерации трансформированного растения из указанной трансформированной растительной клетки.

58. Способ контроля сорняков вблизи от трансформированного растения, где указанный способ предусматривает нанесение эффективного количества имидазолинонового гербицида, сульфонилкарбамидного гербицида, триазолопиримидинового гербицида, пиримидинилоксибензоатного гербицида и сульфониламинокарбонилтриазолинонового гербицида или их смеси на сорняки и на трансформированное растение, где указанное трансформированное растение обладает повышенной толерантностью к гербициду по сравнению с нетрансформированным растением, и трансформированное растение содержит в своем геноме по меньшей мере одну кассету экспрессии, содержащую полинуклеотидную молекулу по п.12, функционально связанную с промотором, направляющим генную экспрессию в растительной клетке.

59. Способ по п.58, где указанный имидазолиноновый гербицид выбран из группы, состоящей из 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)никотиновой кислоты, 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-3-хинолинкарбоновой кислоты, 5-этил-2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)никотиновой кислоты, 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-5-(метоксиметил)никотиновой кислоты, 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-5-метилникотиновой кислоты и смеси метилового эфира 6-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-м-толуиловой кислоты и метилового эфира 2-(4-изопропил-4-метил-5-оксо-2-имидазолин-2-ил)-п-толуиловой кислоты и их комбинаций.

60. Способ по п.58, где указанный сульфонилкарбамидный гербицид выбран из группы, состоящей из хлорсульфурона, метсульфуронметила, сульфометуронметила, хлоримуронэтила, тифенсульфуронметила, трибенуронметила, бенсульфуронметила, никосульфурона, этаметсульфуронметила, римсульфурона, трифлусульфуронметила, триасульфурона, примисульфуронметила, циносульфурона, амидосульфурона, флузасульфурона, имазосульфурона, пиразосульфуронэтила, галогенсульфурона и их комбинаций.

61. Способ по любому из пп.58-60, где указанное растение является двудольным или однодольным.

62. Способ по пп.61, где указанное двудольное растение выбрано из группы, состоящей из подсолнечника, сои, хлопка, Brassica spp., Arabidopsis thaliana, табака, картофеля, сахарной свеклы, люцерны, сафлора и арахиса.

63. Способ по п.61, где указанное однодольное растение выбрано из группы, состоящей из пшеницы, тритикале, кукурузы, риса, сорго, ржи, проса и ячменя.

64. Выделенный полипептид, кодируемый полинуклеотидной молекулой по п.12.

65. Способ получения гербицидтолерантного растения, предусматривающий скрещивание первого растения, которое толерантно к гербициду, со вторым растением, которое не является толерантным к гербициду, где первое растение представляет собой растение по любому из пп.1-7 и 24-33.

66. Способ по п.65, дополнительно предусматривающий отбор растения-потомка, толерантного к гербициду.

67. Гербицидтолерантное растение, полученное способом по п.65 или 66.

68. Семя растения по п.67, где указанное семя обладает повышенной толерантностью по меньшей мере к одному гербициду, выбранному из группы, состоящей из имидазолиноновых гербицидов, сульфонилкарбамидных гербицидов, триазолопиримидиновых гербицидов, пиримидинилоксибензоатных гербицидов и
сульфониламинокарбонилтриазолиноновых гербицидов, или к их комбинациям, и где семя обладает повышенной толерантностью по сравнению с толерантностью семени растения подсолнечника дикого типа НА89.

69. Способ повышения гербицидтолерантности растения, предусматривающий скрещивание первого растения со вторым растением, где первое растение представляет собой растение по любому из пп.1-5, 24-33 и 67.

70. Способ по п.69, дополнительно предусматривающий отбор растения-потомка, обладающего повышенной гербицидтолерантностью по сравнению с гербицидтолерантностью указанного второго растения.

71. Растение, полученное способом по п.69 или 70.

72. Семя растения по п.71, где указанное семя обладает повышенной гербицид-толерантностью по меньшей мере к одному гербициду, выбранному из группы, состоящей из имидазолиноновых гербицидов, сульфонилкарбамидных гербицидов, триазолопиримидиновых гербицидов, пиримидинилоксибензоатных гербицидов и сульфониламинокарбонилтриазолиноновых гербицидов, или к их комбинациям, и где семя обладает повышенной толерантностью по сравнению с толерантностью семени растения подсолнечника дикого типа НА89.

73. Семя растения по любому из пп.1-5, 24-33, 67 и 71, где указанное семя обработано гербицидом, ингибирующим AHAS.

74. Способ борьбы с нежелательной растительностью, предусматривающий приведение семян растений по любому из пп.1-5, 24-33, 67 и 71 перед посевом и/или после предварительного проращивания в контакт с гербицидом, ингибирующим AHAS.



 

Похожие патенты:

Изобретение относится к масложировой промышленности. .

Изобретение относится к биотехнологии и представляет собой рекомбинантную термостабильную ДНК-лигазу Acidilobus sp 1904, проявляющую лигазную активность в присутствии ионов магния, в диапазоне значений рН от 6.8 до 7.4, концентраций натрия хлорида от 0 до 100 мМ.

Изобретение относится к биотехнологии и представляет собой рекомбинантную термостабильную алкогольдегидрогеназу TsAdh319 из археи Thermococcus sibiricus, проявляющую активность в реакциях окисления спиртов и сахаров до соответствующих альдегидов и кетонов и в обратных реакциях восстановления альдегидов и кетонов при температурах до 100°С.

Изобретение относится к биотехнологии и касается способа получения белка, обладающего бутинол I эстеразной активностью, содержащего, по меньшей мере, одну частичную аминокислотную последовательность, соответствующую последовательности номер 3, 4, 5 или 6.

Изобретение относится к биотехнологии и может быть использовано при получении высокоочищенных и высокоактивных препаратов ингибиторов ферментов направленного действия, обладающих противоопухолевым действием.

Изобретение относится к биотехнологии, а именно к композиции, содержащей подвергнутую физиологическому стрессу Arthrospira maxima, для применения в качестве биоцида и/или терапевтического средства.

Изобретение относится к выделенным полипептидам, обладающим антимикробной активностью, и выделенным полинуклеотидам, кодирующим эти полипептиды, а также к конструкциям нуклеиновой кислоты, векторам и клеткам-хозяевам, содержащим указанные полинуклеотиды.

Изобретение относится к области медицины и касается способов лечения заболеваний антагонистами VEGF. .

Изобретение относится к области биотехнологии, в частности к молекулярно-генетическим исследованиям, а именно к области диагностики генетической предрасположенности к различным видам физических нагрузок и особенностей тренировочного процесса.

Изобретение относится к микробиологии и молекулярной биологии и касается конструирования транспозон-индуцированного мутанта возбудителя мелиоидоза Burkholderia pseudomallei, несущего инактивированные последовательности генов лекарственного эффлюкса (multidrag efflux pumps) и хромосомных b-лактамаз класса А для использования в качестве модельного микроорганизма при анализе молекулярно-генетических основ множественной лекарственной устойчивости В.

Изобретение относится к области биотехнологии и может быть использовано в различных разделах медицины при внедрении современных биоматериалов в качестве трехмерных матриксов для клеточных и тканевых культур.

Изобретение относится к области биотехнологии, а именно к получению антимикробного пептида аурелина сцифоидной медузы Aurelia aurita. .

Изобретение относится к области генной и белковой инженерии. .

Изобретение относится к биотехнологии, генной инженерии и медицине и может быть использовано для создания растений - суперпродуцентов антител, в частности антител против фактора роста сосудистого эндотелия, которые могут быть использованы, например, для снижения микрососудистой проницаемости при различных опухолях человека, включая рак ободочной кишки, молочной железы, поджелудочной железы и предстательной железы.

Изобретение относится к области генной инженерии, конкретно к получению вариантов аллергена группы I из Роасеае (зубровка душистая), и может быть использовано для специфической иммунотерапии (гипосенсибилизации) пациентов, имеющих аллергии на пыльцу растений, или для профилактической иммунотерапии аллергий на пыльцу.
Наверх