Вакцинный штамм вируса гриппа в/60/малайзия/04/898 для производства живой гриппозной интраназальной вакцины для взрослых и для детей



Вакцинный штамм вируса гриппа в/60/малайзия/04/898 для производства живой гриппозной интраназальной вакцины для взрослых и для детей
Вакцинный штамм вируса гриппа в/60/малайзия/04/898 для производства живой гриппозной интраназальной вакцины для взрослых и для детей

 


Владельцы патента RU 2416639:

Учреждение Российской Академии медицинских наук Научно-исследовательский институт экспериментальной медицины Северо-западного отделения РАМН (НИИЭМ СЗО РАМН) (RU)

Изобретение относится к медицинской вирусологии и биотехнологии. Штамм В/60/Малайзия/04/898 активно размножается в развивающихся куриных эмбрионах при оптимальной температуре 32-33°С. Характеризуется температурочувствительностью и холодоадаптированностью. Реассортант унаследовал гены, кодирующие поверхностные антигены вируса гемагтлютинин (НА) и нейраминидазу (NA), от эпидемического родительского вируса, остальные шесть генов, кодирующих внутренние негликозилированные белки, - от донора аттенуации. Штамм В/60/Малайзия/04/898 ареактогенен для взрослых и для детей при интраназальном введении. Изобретение может быть использовано в практическом здравоохранении для профилактики заболеваемости сезонным гриппом среди взрослых и детей с помощью живой гриппозной интраназальной вакцины из штамма вируса гриппа В/60/Малайзия/04/898. 4 табл.

 

Изобретение относится к медицинской вирусологии и может быть использовано в практическом здравоохранении для профилактики заболеваемости гриппом среди взрослых и детей с помощью живой гриппозной интраназальной вакцины из штамма вируса гриппа типа В, семейства Orthomyxoviridae, рода Influenzavirus B, B/60/Малайзия/04/898.

В результате появления в циркуляции нового штамма вируса гриппа B/Малайзия/2506/04, принадлежащего к Викторианской антигенной разновидности, известный вакцинный штамм B/60/Джилин/03/1 антигенной линии Ямагата - прототип [патент РФ №2307161 от 27.09.2007 - Опубл. 2007. - БИ №27] - утратил антигенную актуальность и вследствие этого не может вызвать защитную реакцию во время эпидемии, вызванной B/Малайзия/2506/04 - подобными штаммами вируса гриппа.

Задачей, на решение которой направлено заявляемое изобретение, является получение вакцинного штамма для производства живой гриппозной вакцины для взрослых и детей актуальной антигенной разновидности на основе современного эпидемического вируса B/Малайзия/2506/04.

Целью изобретения было получение промышленно значимого и антигенно актуального реассортантного вакцинного штамма. Для его получения выбраны два родительских штамма вируса гриппа: эпидемический штамм вируса гриппа B/Малайзия/2506/04 и безвредный для человека холодоадаптированный донор аттенуации B/СССР/60/69.

Применяемые в настоящее время штаммы для живых гриппозных вакцин получают методом генетической реассортации эпидемически актуальных вирусов с холодоадаптированными штаммами - донорами аттенуации [Александрова Г.И. Применение метода генетической рекомбинации для получения вакцинных штаммов вируса гриппа // Вопр. Вирусол. - 1977. - №4. - C.387-395].

Донор аттенуации B/СССР/60/69 - холодоадаптированный (ca) и температурочувствительный (ts) штамм вируса гриппа, разрешенный для получения безвредных живых интраназальных вакцин для взрослых и детей [Александрова Г.И. Новое в эпидемиологии и профилактике вирусных инфекций. Л., 1968. - С.66-83]. Донор аттенуации B/СССР/60/69, характеризующийся устаревшей антигенной структурой, был ранее получен из эпидемического вируса гриппа B/СССР/69 методом холодовой адаптации [Александрова Г.И., Климов А.И. Живая вакцина против гриппа. - СПб.: Наука. - 1994. - 151 с.], в результате чего он стал безвредным для человека, т.е. приобрел способность бессимптомно размножаться в верхних дыхательных путях привитых лиц, вызывая выработку противовирусного иммунитета.

Цель реассортации - получить штамм с вакцинной формулой генома 6:2. Гены, кодирующие поверхностные белки вируса гриппа гемагглютинин (НА) и нейраминидазу (NA), наследуются от антигенно актуального циркулирующего эпидемического (пандемического) штамма, а шесть генов, кодирующих внутренние и неструктурные белки (PB2, PB1, PA, NP, M, NS) - от безвредного донора аттенуации. На основе донора аттенуации B/СССР/60/69 был создан вакцинный штамм B/60/Джилин/03/1 - прототип.

Получение вакцинного штамма. Вакцинный штамм B/60/Малайзия/04/898 получен методом генетической реассортации эпидемического вируса B/Малайзия/2506/04 с донором аттенуации B/СССР/60/69 путем одновременного инфицирования развивающихся куриных эмбрионов (РКЭ) смесью родительских вирусов в эквивалентных инфекционных дозах, с последующей селекцией клонов с заданными свойствами при пониженной до 25°C температуре инкубации в присутствии антисыворотки к донору аттенуации. Клоны дополнительно очищены трехкратным клонированием методом предельных разведений в присутствии антисыворотки к донору при пониженной (25°C) и оптимальной (33°C) температурах инкубации. Чистые клоны проверены по фенотипическим характеристикам (ts-, ca-фенотип) и по формуле генома на соответствие вакцинному штамму.

Для анализа состава генома полученных реассортантов использовали следующие методы:

a) Реакцию торможения гемагглютинации (РТГА), позволяющую определить принадлежность поверхностного антигена - гемагглютинина (НА) одному из родительских вирусов [Методы определения показателей качества иммунобиологических препаратов для профилактики и диагностики гриппа. МУК 3.3.2.1758-03].

б) Метод ПЦР-рестрикционного анализа ДНК копий генов, основанный на амплификации относительно коротких участков РНК длиной около 150-300 нуклеотидов, включающих уникальные нуклеотидные последовательности, характерные только для донора аттенуации, но не для эпидемических вирусов гриппа. Метод впервые был создан для анализа состава генома реассортантов эпидемических вирусов гриппа А и донора аттенуации А/Ленинград/134/17/57 (H2N2) [Klimov A.I., Сох N.J. PCR restriction analysis of genome composition and stability of cold-adapted reassortant live influenza vaccines // J. Virol. Methods. - 1995. - Vol.52. - №1-2. - Р.41-49]. Мы разработали метод ПЦР-рестрикционного анализа реассортантов современных вирусов гриппа B Викторианской линии и донора аттенуации B/СССР/60/69. Перечень сконструированных праймеров и использованных рестриктаз приведен в табл.1. Обработку амплифицированных фрагментов ДНК производили соответствующими рестриктазами с их последующим электрофорезом в 1,7-2,0%-ном агарозном геле, содержащем 0,5 мкг/мл этидиума бромида. Это позволило четко дифференцировать принадлежность генов исследуемых реассортантных штаммов к любому современному эпидемическому вирусу гриппа B Викторианской линии или донору аттенуации B/СССР/60/69.

Антигенная характеристика вакцинного штамма. Полученный нами вакцинный штамм B/60/Малайзия/04/898 в РТГА идентичен эпидемическому вирусу B/Малайзия/2506/04, антисывороткой к которому полностью нейтрализуется.

ПЦР-рестрикционным методом установлено, что вакцинный штамм B/60/Малайзия/04/898 унаследовал второй из двух генов, кодирующих поверхностные белки - нейраминидазу (NA) - от эпидемического вируса B/Малайзия/2506/04.

Формула генома. Формула генома 6:2 вакцинного штамма B/60/Малайзия/04/898 подтверждена ПЦР-рестрикционным методом с помощью специфических праймеров и соответствующих рестриктаз. Вакцинный штамм B/60/Малайзия/04/898 унаследовал шесть генов, кодирующих внутренние белки (PB1, PB2, PA, NP, M, NS), от донора аттенуации B/СССР/60/69.

Таблица 1.
Перечень праймеров и рестриктаз, использованных для изучения состава генома реассортантного вакцинного штамма B/60/Малайзия/04/898, полученного на основе эпидемического вируса B/Малайзия/2506/04 и донора аттенуации B/СССР/60/69
Ген Рестриктаза Длина амплифицированного участка ДНК и его фрагментов, разрезанных соответствующей рестриктазой Название и нуклеотидная последовательность праймеров (F - прямой праймер; R - обратный праймер) Рестрикция
ЭВ ДО ВШ
PB2 MscI 287 (236, 51) B-PB2-F1743 СААТGGGATGCATТТGAAGC нет да да
B-PB2-R2029 GTTAGGACTTCTGTTTGTGG
PB1 BspHI 379 (200, 179) B-PB1-F906 AGGAGGGATСAGCATGACAG нет да да
B-PB1-R1284 TCCCAACACGGTAGATAGCA
PA BclI 344 (255, 89) B-PA-F1539 CAATCTCATCTGAGGGGAGA нет да да
B-PA-R1882 CCAATACTGAAAGTTTTGGG
NP AvrII 401 (263, 138) B-NP-F1148 AATATGGCAACACCTGTTTC нет да да
B-NP-R1548 TTGACATCTGCATCACGTCC
NA AflII 605 (221,384) B-NA-F591 GGTCCGCATGCCATGATGG да нет да
B-NA-R1196 CCATGGGTCTCCATCATACTT
M BglII 337 (205, 132) B-M-F319 GCTGAGAGAAAAATGAGAAG да нет нет
B-M-R655 CTCCAATGTTGCTTTGCAGC
NS MaeI 308 (230,78) B-NS-F142 CTTTCATGGCAAAGAGCCCT нет да да
B-NS-R449 GGTTCTTCTTCTATGTCATC
ОБОЗНАЧЕНИЯ: ЭВ - эпидемический вирус гриппа Викторианской линии B/Малайзия/2506/04; ДО - донор аттенуации B/СССР/60/69;
ВШ - вакцинный штамм В/60/Малайзия/04/898; «да» - амплифицированная ДНК копия фрагмента РНК режется,
«нет» - не режется соответствующей рестриктазой.

Результаты анализа всех генов вакцинного штамма B/60/Малайзия/04/898 представлены в табл.2.

Таблица 2.
Состав генома реассортантного вакцинного штамма B/60/Малайзия/04/898, полученного на основе эпидемического вируса В/Малайзия/2506/04 и донора аттенуации B/СССР/60/69
Ген Принадлежность гена одному из родительских вирусов
Донор аттенуации Эпидемический вирус Вакцинный штамм
PB2 60 ЭВ 60
PB1 60 ЭВ 60
PA 60 ЭВ 60
HA 60 ЭВ ЭВ
NP 60 ЭВ 60
NA 60 ЭВ ЭВ
M 60 ЭВ 60
NS 60 ЭВ 60
ОБОЗНАЧЕНИЯ: 60 - донор аттенуации B/СССР/60/69;
ЭВ - эпидемический вирус гриппа B/Малайзия/2506/04.

Оценку фенотипических свойств вакцинного штамма В/60/Малайзия/04/898 проводили путем его параллельного титрования в РКЭ при разных температурах. Было показано, что вакцинный вирус является температурочувствительным (разность в показателях инфекционной активности при температуре инкубации 32°C и 38°C составляет 7,0 lg ЭИД50/0,2 мл) и холодоадаптированным (разность в показателях инфекционной активности при температуре инкубации 32°C и 25°C равна 2.5 lg ЭИД50/0,2 мл), что свидетельствует о его безвредности для человека, поскольку по этим показателям он идентичен донору аттенуации B/СССР/60/69.

Оценку токсичности вакцинного штамма B/60/Малайзия/04/898 определяли путем подкожного и внутрибрюшинного введения вирусного материала мышам. Для этого группе из 12 мышей (самцов линии СВА весом 18-20 г вводили соответствующим способом 0,5 мл вируссодержащей аллантоисной жидкости с титром 7,5 lg ЭИД50/0,2 мл и оценивали патогенность вируса по проценту выживших мышей в течение 7 дней после введения вируса. Вакцинный штамм B/60/Малайзия/04/898 в эксперименте на мышах оказался полностью безвредным - 100% мышей выжили в течение всего периода наблюдения.

В результате проведенных доклинических исследований установлено, что заявляемый вакцинный штамм живой гриппозной вакцины B/60/Малайзия/04/898 характеризуется сочетанием полезных признаков, необходимых вакцинному штамму: антигенной специфичностью эпидемического вируса B/Малайзия/2506/04, структурой генома 6:2, оптимальной для реассортантных вакцинных штаммов, а также характерной для донора аттенуации температурочувствительностью и холодоадаптированностью, что коррелирует с аттенуацией для человека. Штамм аттенуирован и безвреден для мышей.

Морфология штамма полиморфная, типичная для вируса гриппа.

Штамм B/60/Малайзия/04/898 ареактогенен для взрослых и для детей при интраназальном введении.

Таким образом, вакцинный штамм B/60/Малайзия/04/898 по биологическим свойствам и показателям реактогенности соответствует требованиям, предъявляемым к вакцинным штаммам Фармакопейной статьей ФСП 42-0417-4097-03 на живую гриппозную вакцину для интраназального применения.

Полученный штамм B/60/Малайзия/04/898 депонирован в коллекции вирусов ФГУН «Государственный НИИ стандартизации и контроля медицинских биологических препаратов имени Л.A.Тарасевича Роспотребнадзора (ФГУН ГИСК им. Л.А.Тарасевича Роспотребнадзора, Россия RU, 119002, город Москва, Сивцев-Вражек, дом 41) под №721

и имеет характеристики, представленные в паспорте штамма.

ХАРАКТЕРИСТИКА ШТАММА

Инфекционная активность штамма B/60/Малайзия/04/898 при репродукции в развивающихся куриных эмбрионах при 32°C в течение 72 часов - 8,0 lg ЭИД50/0,2 мл. Гемагглютинирующая активность - 1:1024.

Штамм проявляет генетическую стабильность аттенуирующих мутаций и биологических признаков после 5 пассажей на куриных эмбрионах (при использовании больших заражающих доз).

ПАСПОРТ ШТАММА

1. Название штамма: B/60/Малайзия/04/898.

2. Серия: №1.

3. Метод получения: генетическая реассортация; характеристика родительских вирусов:

а) эпидемический вирус - B/Малайзия/2506/04;

б) донор аттенуации - B/СССР/60/69.

4. Количество пассажей: 7 в процессе реассортации.

5. Характеристика штамма до лиофилизации:

а) оптимальные условия репродукции: 32°C, 72 часов;

б) гемагглютинирующая активность: 1:1024;

в) инфекционная активность: 8,0 lg ЭИД50/0,2 мл;

г) чувствительность к ингибиторам: ингибитороустойчив в РТГА с нормальной (неиммунной) сывороткой крови лошади;

д) разность в показателях инфекционной активности при 32°C и 38°C (температурочувствительный фенотип): 7,0 lg ЭИД50/0,2 мл;

е) разность в показателях инфекционной активности при 32°C и 25°C (холодоустойчивый фенотип): 2,5 lg ЭИД50/0,2 мл;

ж) структура генома рекомбинанта: гены от эпидемического вируса - НА, NA; гены от донора аттенуации - PA, PB1, PB2, NP, M, NS.

6. Характеристика штамма после лиофилизации:

a) объем материала в ампуле: 1,0 мл;

б) инфекционная активность: 7,5 lg ЭИД50/0,2 мл;

в) гемагглютинирующая активность: 1:512.

7. Антигенная специфичность:

а) гемагглютинина - идентичен эпидемическому вирусу B/Малайзия/2506/04 по данным РТГА с крысиной антисывороткой;

б) нейраминидазы - идентична эпидемическому вирусу B/Малайзия/2506/04 по данным ПЦР-рестрикционного анализа ДНК-копий генов.

8. Безвредность для мышей при подкожном и внутрибрюшинном введении: безвреден.

9. Бактериологический контроль: стерилен.

10. Контроль на посторонние вирусы: посторонние вирусы отсутствуют.

ШТАММ B/60/МАЛАЙЗИЯ/04/898 АРЕАКТОГЕНЕН ДЛЯ ВЗРОСЛЫХ ЛИЦ

Пример 1. При вакцинации 54 взрослых человек интраназально реассортантным вакцинным штаммом B/60/Малайзия/04/898 с инфекционной активностью 7,5 lg ЭИД50/0,2 мл в разведении 1:2 в объеме 0,5 мл слабые температурные реакции (до 37,5°C) наблюдались у одного человека (1,9%), сильных температурных реакций с повышением температуры свыше 38,5°C и средних температурных реакций с повышением температуры в диапозоне 37,6-38,5°C не наблюдалось. Катаральные явления (насморк, гиперемия зева и боль в горле) были отмечены у двух человек (3,8%). Результаты обследования приведены в табл.3.

В получившей плацебо группе из 52 лиц сильных и средних температурных реакций не наблюдалось. Слабые температурные реакции (до 37,5°C) отмечены у 2 человек (2,8%). Катаральные явления (насморк, гиперемия зева и боль в горле) отмечены в 1,9% случаев.

Показатель реактогенности (разница в проценте средних реакций у привитых вакциной и получивших плацебо) составил 0%.

Таким образом, вакцинный штамм B/60/Малайзия/04/898 по показателям реактогенности соответствует требованиям, предъявляемым к вакцинным штаммам Фармакопейной статьей ФСП 42-0417-4097-03 на живую сухую гриппозную аллантоисную вакцину для интраназального применения.

ШТАММ B/60/МАЛАЙЗИЯ/04/898 АРЕАКТОГЕНЕН ДЛЯ ДЕТЕЙ 3-14 ЛЕТ

Пример 2. Группу из 50 детей в возрасте 3-14 лет вакцинировали интраназально в объеме 0,5 мл реассортантным вакцинным штаммом B/60/Малайзия/04/898 с инфекционной активностью 7,5 lg ЭИД50/мл в разведении 1:2. Группа детей того же возраста из 33 человек получила плацебо. Результаты исследований приведены в табл.4.

В группе привитых детей слабые температурные реакции (до 37,5°C) наблюдались у одного ребенка (2,0%), сильных температурных реакций с повышением температуры свыше 38,5°C и средних температурных реакций с повышением температуры в диапозоне 37,6-38,5°C не наблюдалось. Катаральные явления (насморк, гиперемия зева и боль в горле) были отмечены у троих (6,0%).

В получившей плацебо группе сильных и средних температурных реакций не наблюдалось. Слабые температурные реакции (до 37,5°C) отмечены у 2 человек (6,1%).

Катаральные явления (насморк, гиперемия зева и боль в горле) отмечены также в 6,1% случаев.

Испытания на волонтерах подтвердили, что вакцинный штамм B/60/Малайзия/04/898 по показателям реактогенности соответствует требованиям, предъявляемым к вакцинным штаммам Фармакопейной статьей ФСП 42-0417-4097-03 на живую сухую гриппозную аллантоисную вакцину для интраназального применения.

На основе вышесказанного предлагаемый по изобретению вакцинный штамм вируса гриппа B/60/Малайзия/04/898 может быть использован для профилактики гриппа как у взрослых, так и у детей с трехлетнего возраста, что подтверждают результаты изучения его реактогенности для разных возрастных групп.

Штамм вируса гриппа В/60/Малайзия/04/898, депонированный в ФГУН «Государственный НИИ стандартизации и контроля медицинских биологических препаратов имени Л.А.Тарасевича» Роспотребнадзора (ФГУН ГИСК им. Л.А.Тарасевича Роспотребнадзора) под №721, используемый для получения живой гриппозной интраназальной пандемической вакцины для взрослых и для детей.



 

Похожие патенты:

Изобретение относится к области биотехнологии, а именно к противовирусным средствам на основе ген-направленных каталитически активных нуклеиновых кислот. .
Изобретение относится к области вирусологии и может быть использовано для разработки средств и методов биологической защиты. .

Изобретение относится к биотехнологии и ветеринарной медицине, а именно к штаммам для создания профилактических и лечебных биологических препаратов против сальмонеллеза и других бактериальных инфекций.

Изобретение относится к выделенному вирусу растений, названному вирус томата торрадо (ToTV), и его компонентам, а также к способам получения устойчивых к ToTV растений. .

Изобретение относится к области ветеринарной вирусологии и биотехнологии. .

Изобретение относится к области вирусологии и биотехнологии. .
Изобретение относится к области ветеринарии. .
Изобретение относится к области ветеринарной вирусологии. .

Изобретение относится к области биотехнологии, вирусологии и медицины. .

Изобретение относится к области медицины и касается применения сфингоид-полиалкиламинового конъюгата-N-пальмитоил-D-эритросфингозилкарбамоилспермина (CCS) в качестве удерживающего средства для биологически активных молекул, таких как антигены.

Изобретение относится к области генной инженерии и вирусологии. .

Изобретение относится к области молекулярной биологии, вирусологии и генетической инженерии. .
Наверх