Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета

Авторы патента:


Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета
Композиции, реагенты, наборы и способы для диагностики, мониторинга и лечения ожирения и/или диабета

 


Владельцы патента RU 2420583:

МИНТЦ Лиат (US)

Настоящее изобретение относится к области молекулярной генетики и генной инженерии и может быть использовано в медико-биологической промышленности. Описан новый природный вариант предшественника грелина, являющийся результатом альтернативного сплайсинга гена. Методом рекомбинантных ДНК получен кодируемый указанным сплайсинг-вариантом активный белок, в результате исследования функциональных свойств которого на животных моделях установлена способность снижать массу тела и уровень потребления пищи. Предложено использование нового варианта грелина и его активных фрагментов с целью получения медикаментов для лечения ожирения и/или диабета. 7 н.п. ф-лы, 28 ил., 7 табл.

 

Перекрестная ссылка на родственную заявку

По настоящей заявке испрашивается приоритет патентной заявки США № 10/659782, поданной 11 сентября 2003, которая приведена здесь в качестве ссылки в полном объеме.

Область изобретения

Настоящее изобретение относится к маркерам ожирения и диабета, к реагентам, которые могут выявлять маркерные транскрипты и продукты трансляции, к наборам и способам для детекции маркерных транскриптов и продуктов трансляции ожирения и диабета, к способам и наборам для скрининга и диагностики ожирения и диабета у индивидуумов и мониторинга ответа на лечение, прогрессирования заболевания и рецидива заболевания у пациентов с диагнозом ожирение и диабет, к соединениям, специфически, которые связываются с продуктами трансляции ожирения и/или маркерными транскриптами диабета, к лечению ожирения и/или диабета с применением композиции с одним или несколькими маркерами ожирения и диабета или продуктов их трансляции в качестве терапевтических средств, к композициям и способам для лечения ожирения и/или диабета.

Предпосылки изобретения

Ожирение является второй по важности причиной предотвращаемой смерти в Соединенных Штатах, превышаемой только курением сигарет. Было подсчитано, что в Соединенных Штатах ожирением страдает 58000000 человек и ежегодно ожирение приводит к 300000 смертей и его распространение увеличивается. Индивидуумы, страдающие этим заболеванием, подвержены повышенному риску возникновения заболеваний, таких как гипертензия, липидные расстройства, коронарная болезнь сердца, диабет II типа, инсульт, заболевание желчного пузыря, остеоартрит, синдром ночного апноэ, респираторные нарушения и некоторые злокачественные опухоли.

Ожирение развивается вследствие избыточных потреблений энергии над используемой. Причины такого избытка могут различаться у разных пациентов, и полагают, что их причиной являются различные генетические, социальные факторы и факторы внешней среды. Современные исследования поддерживают точку зрения, что при одинаковых условиях внешней среды разные люди набирают вес в разной степени, и количество, которое они набирают, вероятно, определено генетически. Предполагают, что естественный отбор вынуждал наших далеких предков приобретать «экономичные гены», которые поддерживали способность запасать жир при каждом приеме пищи, чтобы поддерживать тело при следующем голодании. В современном окружении избытка пищи «в западном стиле» с высоким содержанием жира и калорий «экономичные гены» становятся помехой.

Все больше ученых и терапевтов приходят к отказу от традиционного убеждения, что за развитие ожирения отвечает исключительно плохая диета и отсутствие упражнений, и в большей мере проявляют стремление рассматривать его как медицинское состояние. Экономисты в области здравоохранения с применением перспективных исследований и статистических данных национального здравоохранения вычислили затраты, связанные с ожирением в США, в 1995 г. как 99,2 миллиарда $. Было сделано предположение, что в 2005 г. более 120 миллионов людей в мире будут страдать ожирением.

В настоящее время экономическое влияние ожирения в США сравнимо с влиянием диабета и по уровню приближается к расходам, связанным с заболеванием сердца и гипертензией. Медицинские исследователи подсчитали, что по меньшей мере 88% всех случаев диабета II типа, 57% случаев коронарной болезни сердца, 11% раков молочной железы и 10% раков кишечника, диагностированных у американцев с избыточным весом, можно отнести к ожирению.

Всемирная организация здравоохранения классифицирует ситуацию с ожирением как эпидемию и учредила специальную комиссию для ограничения распространения одной из величайших опасностей для здоровья и благосостояния человека.

Остается необходимость в специфических маркерах ожирения и/или диабета. Остается необходимость в реагентах и наборах, которые можно применять для выявления присутствия маркеров ожирения и/или диабета в образцах, взятых у пациентов. Остается необходимость в реагентах и наборах, которые можно применять для выявления будущей предрасположенности к развитию ожирения и/или диабета по образцам, взятым у пациентов. Остается необходимость в способах скрининга и диагностики индивидуумов, страдающих ожирением и/или диабетом, и способах мониторинга ответа на лечение, прогрессирования заболевания и рецидива заболевания у пациентов с диагнозом ожирение и/или диабет.

Остается необходимость в реагентах, наборах и способах для определения типа ожирения и/или диабета у индивидуума, страдающего ожирением. Остается необходимость в композициях, специфическими мишенями для которых являются клетки, связанные с ожирением и/или диабетом. Остается необходимость в улучшенных способах лечения индивидуумов, предположительно страдающих ожирением и/или диабетом.

Словарь

В следующих ниже описании и формуле изобретения периодически будет применено множество терминов, и значение таких терминов, как они должны быть поняты по изобретению, следующее:

«Последовательности нуклеиновых кислот при ожирении и/или диабете» - последовательности, представленные любыми последовательностями SEQ ID NO:1 - SEQ ID NO:4 и SEQ ID NO:22 - SEQ ID NO:25, которые по меньшей мере на 90% идентичны (см. ниже, таблица 2) указанным последовательностям и фрагментам вышеупомянутых последовательностей (см. ниже, таблица 2) длиной по меньшей мере 15 п.о. Данные последовательности представляют собой последовательности, кодирующие природные варианты альтернативного сплайсинга природного и известного адипонектина, представленного в Locus Link как локус Hs. 9370 под инвентарным номером NM_004797, который представляет собой последовательность, кодирующую гликопротеин человека размером 30 кДа из 244 аминокислот. Следует подчеркнуть, что новые варианты по настоящему изобретению представляют собой природные последовательности, полученные путем альтернативного сплайсинга адипонектина, а не просто укороченные, мутантные или фрагментированные формы гена.

- последовательности, представленные любыми последовательностями SEQ ID NO:5 - SEQ ID NO:9 и SEQ ID NO:26 - SEQ ID NO:30, которые по меньшей мере на 90% идентичны (см. ниже) указанным последовательностям и фрагментам вышеупомянутых последовательностей (см. ниже, таблица 2) длиной по меньшей мере 15 п.о. Данные последовательности представляют собой последовательности, кодирующие природные варианты альтернативного сплайсинга, природного и известного адипонектина, представленного в Locus Link как локус Mm. 11450 под инвентарным номером NM_009605, который представляет собой последовательность, кодирующую гликопротеин мыши размером 30 кДа из 247 аминокислот. Следует подчеркнуть, что новые варианты по настоящему изобретению представляют собой природные последовательности, полученные путем альтернативного сплайсинга адипонектина, а не просто укороченные, мутантные или фрагментированные формы гена.

- последовательности, представленные любыми последовательностями SEQ ID NO:10 - SEQ ID NO:11 и SEQ ID NO:31 - SEQ ID NO:32, которые по меньшей мере на 90% идентичны (см. ниже, таблицу 2) указанным последовательностям и фрагментам вышеупомянутых последовательностей (см. ниже, таблица 2) длиной по меньшей мере 15 п.о. Данные последовательности представляют собой последовательности, кодирующие природные варианты альтернативного сплайсинга природного и известного грелина, представленного в Locus Link как локус Hs. 51738 под инвентарным номером NM_016362, который представляет собой последовательность, кодирующую гликопротеин человека размером 13 кДа из 117 аминокислот. Следует подчеркнуть, что новые варианты по настоящему изобретению представляют собой природные последовательности, полученные путем альтернативного сплайсинга грелина, а не просто укороченные, мутантные или фрагментированные формы гена.

- последовательности, представленные любыми последовательностями SEQ ID NO:12 - SEQ ID NO:18 и SEQ ID NO:33 - SEQ ID NO:39 по меньшей мере, которые на 90% идентичны (см. ниже, таблица 2) указанным последовательностям и фрагментам вышеупомянутых последовательностей (см. ниже, таблица 2) длиной по меньшей мере 15 п.о. Данные последовательности представляют собой последовательности, кодирующие варианты альтернативного сплайсинга природного и известного 11-β-HSD, представленного в Locus Link как локус Hs. 3290 под инвентарным номером NM_005525, который представляет собой последовательность, кодирующую гликопротеин человека размером 32 кДа из 292 аминокислот. Следует подчеркнуть, что новые варианты по настоящему изобретению представляют собой природные последовательности, полученные путем альтернативного сплайсинга 11-β-HSD, а не просто укороченные, мутантные или фрагментированные формы гена.

- последовательности, представленные любыми последовательностями SEQ ID NO:19 - SEQ ID NO:21 и SEQ ID NO:40 - SEQ ID NO:42, которые по меньшей мере на 90% идентичны (см. ниже, таблица 2) указанным последовательностям и фрагментам вышеупомянутых последовательностей (см. ниже, таблица 2) длиной по меньшей мере 15 п.о. Данные последовательности представляют собой последовательности, кодирующие варианты альтернативного сплайсинга природного и известного 11-β-HSD, представленного в Locus Link как локус Mm. 15483 под инвентарным номером NM_008288, который представляет собой последовательность, кодирующую гликопротеин мыши размером 32 кДа из 292 аминокислот. Следует подчеркнуть, что новые варианты по настоящему изобретению представляют собой природные последовательности, полученные путем альтернативного сплайсинга 11-β-HSD, а не просто укороченные, мутантные или фрагментированные формы гена.

Описание связанных с ожирением и/или диабетом вариантов генов и их отличия от исходной последовательности суммированы в таблице 1, представленной ниже:

Таблица 1
SEQ ID NO: Гены, связанные с ожирением и диабетом ID локуса человека в GenBank ID локуса мыши в GenBank Обозначение гена Описание варианта
1 Адипонектин-WT
(Вариант 1)
9370 (11450) APM Нуклеотидная последовательность белка дикого типа человека (человек)
2 Адипонектин
Вариант 2
Нуклеотидная последовательность 2 варианта (человек)
3 Адипонектин
Вариант 3
Нуклеотидная последовательность 3 варианта (человек)
4 Адипонектин
Вариант 4
Нуклеотидная последовательность 4 варианта (человек)
5 Адипонектин-WT
(Вариант 1)
(9370) 11450 APM Нуклеотидная последовательность белка дикого типа мыши (мышь)
6 Адипонектин
Вариант 2
Нуклеотидная последовательность 2 варианта (мышь)
7 Адипонектин
Вариант 3
Нуклеотидная последовательность 3 варианта (мышь)
8 Адипонектин
Вариант 4
Нуклеотидная последовательность 4 варианта (мышь)
8 Адипонектин
Вариант 4
Нуклеотидная последовательность 4 варианта (мышь)
9 Адипонектин
Вариант 5
Нуклеотидная последовательность 5 варианта (мышь)
10 Грелин-WT
(вариант 1)
51738 (58991) GHRL Нуклеотидная последовательность белка дикого типа человека
11 Грелин
Вариант 2
Нуклеотидная последовательность 2 варианта (человек)
12 11-β-HSD-WT
(Вариант 1)
3290 (15483) HSD11B1 Нуклеотидная последовательность белка дикого типа человека
13 11-β-HSD
Вариант 2
Нуклеотидная последовательность 2 варианта (человек)
14 11-β-HSD
Вариант 3
Нуклеотидная последовательность 3 варианта (человек)
15 11-β-HSD
Вариант 4
Нуклеотидная последовательность 4 варианта (человек)
16 11-β-HSD
Вариант 5
Нуклеотидная последовательность 5 варианта (человек)
17 11-β-HSD
Вариант 6
Нуклеотидная последовательность 6 варианта (человек)
18 11-β-HSD
Вариант 7
Нуклеотидная последовательность 7 варианта (человек)
19 11-β-HSD-WT
(Вариант 1)
Нуклеотидная последовательность белка дикого типа мыши
20 11-β-HSD
Вариант 8
Нуклеотидная последовательность 8 варианта (мышь)
21 11-β-HSD
Вариант 9
Нуклеотидная последовательность 9 варианта (мышь)
22 Адипонектин-WT
(Вариант 1)
9370 (11450) APM Последовательность белка дикого типа человека
23 Адипонектин
Вариант 2
Альтернативная инициация (человек)
24 Адипонектин
Вариант 3
25 Адипонектин
Вариант 4
26 Адипонектин-WT
(Вариант 1)
(9370) 11450 APM Последовательность белка дикого типа мыши
27 Адипонектин
Вариант 2
Альтернативная инициация (мышь)
28 Адипонектин
Вариант 3
Альтернативные 45 аминокислот от положения 111 в белке дикого типа, создающие вариант из 156 аминокислот (мышь)
29 Адипонектин
Вариант 4
Альтернативные 58 аминокислот от положения 111 в белке дикого типа, создающие вариант из 169 аминокислот (мышь)
30 Адипонектин
Вариант 5
Короткий вариант длиной 76 аминокислот (мышь)
31 Грелин-WT
(вариант 1)
51738 (58991) GHRL Последовательность белка дикого типа человека
32 Грелин
Вариант 2
Альтернативные 70 аминокислот от положения 35 в белке дикого типа, создающие вариант из 117 аминокислот (человек)
33 11-β-HSD-WT
(Вариант 1)
3290 (15483) HSD11B1 Последовательность белка дикого типа человека
34 11-β-HSD
Вариант 2
Делеция 18 аминокислот от аминокислоты 64 в белке дикого типа и альтернативный экзон из 16 аминокислот, заменяющий остальные аминокислоты от аминокислоты 165 в белке дикого типа (человек)
35 11-β-HSD
Вариант 3
Альтернативные 9 аминокислот от аминокислоты 286, создающие вариант из 295 аминокислот (человек)
36 11-β-HSD
Вариант 4
Делеция 18 аминокислот от аминокислоты 137 до аминокислоты 155 в белке дикого типа (человек)
37 11-β-HSD
Вариант 5
Делеция 20 аминокислот от аминокислоты 64 до аминокислоты 84 в белке дикого типа (человек)
38 11-β-HSD
Вариант 6
Альтернативная инициация от аминокислоты № 31 в белке дикого типа (человек)
39 11-β-HSD
Вариант 7
Делеция 48 аминокислот от аминокислоты 173 до аминокислоты 221 в белке дикого типа (человек)
40 11-β-HSD-WT
(Вариант 1)
Последовательность белка дикого типа мыши
41 11-β-HSD
Вариант 8
Делеция 32 аминокислот от аминокислоты 29 до аминокислоты 71 в белке дикого типа
42 11-β-HSD
Вариант 9
Альтернативные 19 аминокислот от аминокислоты 173, создающие вариант из 192 аминокислот (мышь)

SEQ ID NO:1-21 представляют собой нуклеотидные последовательности.

SEQ ID NO:22-42 представляют собой последовательности белков, кодируемых SEQ ID NO:1-21.

«Варианты продуктов при ожирении и/или диабете», также называемые «вариантами белков при ожирении и/или диабете» или «вариантами полипептидов при ожирении и/или диабете», представляют собой последовательности аминокислот, кодируемые вариантами последовательностей нуклеиновых кислот при ожирении и/или диабете, которые представляют собой природные последовательности мРНК, полученные в результате альтернативного сплайсинга. Последовательности аминокислот могут представлять собой пептид, белок, также как пептиды и белки с химически модифицированными аминокислотами (см. ниже), такие как гликопептид или гликопротеин. Варианты продуктов при ожирении и/или диабете представлены на любом SEQ ID NO:22 - SEQ ID NO:42. Термин относится также к гомологам (см. ниже) указанных последовательностей, в которых одна или несколько аминокислот добавлена, делетирована, заменена (см. ниже) или химически модифицирована (см. ниже), также как к фрагментам (см. ниже) указанных последовательностей, имеющим по меньшей мере 10 аминокислот.

«Фрагменты вариантов последовательностей нуклеиновых кислот, связанных с ожирением и/или диабетом,» - неполная последовательность по любому SEQ ID NO:1 - SEQ ID NO:21, включающая в себя области, содержащие нуклеотиды, отличающиеся между измененной и исходной последовательностями. Такие области (на аминокислотном уровне) представлены выше в таблице 1.

«Фрагменты вариантов продуктов, связанных с ожирением и/или диабетом,» - аминокислотные последовательности, кодируемые указанным выше фрагментом нуклеиновой кислоты, содержащие области, в которых вариант отличается от исходной последовательности, как указано в таблице 1.

«Нуклеотидная последовательность» - последовательность, состоящая из нуклеотидов ДНК, нуклеотидов РНК или сочетания обоих типов, которая может включать в себя природные нуклеотиды, химически модифицированные нуклеотиды и синтетические нуклеотиды.

«Аминокислотная последовательность» - последовательность, состоящая из любых из 20 природных аминокислот, аминокислот, подвергшихся химической модификации (см. ниже), или состоящая из синтетических аминокислот.

«Гомологи вариантов/продуктов» - аминокислотные последовательности вариантов, в которых одна или несколько аминокислот добавлены, делетированы или заменены. Измененные аминокислоты должны находиться в областях, в которых вариант отличается от исходной последовательности, например, согласно объяснению в таблице 1.

«Консервативная замена» относится к замене аминокислоты одного класса аминокислотой того же класса, где класс определен общими физико-химическими свойствами боковой цепи аминокислоты и высокими частотами замен в гомологичных белках, обнаруженных в природе, как определено, например, с применением общеупотребительной мутационной диаграммы Дайхофф или матрицы BLOSUM. Классифицируют шесть основных классов боковых цепей аминокислот, включающих в себя: класс I (Cys); класс II (Ser, Thr, Pro, Ala, Gly); класс III (Asn, Asp, Gln, Glu); класс IV (His, Arg, Lys); класс V (Ile, Leu, Val, Met) и класс VI (Phe, Tyr, Trp). Например, замена Asp другим остатком класса III, таким как Asn, Gin и Glu, является консервативной заменой.

«Неконсервативная замена» относится к замене аминокислоты одного класса аминокислотой из другого класса; например, замена Ala, остатка II класса, остатком III класса, таким как Asp, Asn, Glu или Gln.

«Химически модифицированный» - когда относится к продукту по изобретению, то означает продукт (белок), в котором по меньшей мере один из его аминокислотных остатков модифицирован посредством природных процессов, таких как процессинг или другие посттрансляционные модификации, или посредством способов химической модификации, хорошо известных в данной области. Среди многочисленных известных модификаций, характерные, но не ограничивающие примеры включают в себя: ацетилирование, ацилирование, октаноилирование, амидирование, ADP-рибозилирование, гликозилирование, формирование GPI-якоря, ковалентное присоединение липида или липидного производного, метилирование, миристоилирование, пегилирование, пренилирование, фосфорилирование, убиквитинилирование или другие подобные процессы.

«Биологически активный» относится к варианту продукта, обладающему каким-либо видом биологической активности, например способностью связывать ген, связанный с ожирением и/или диабетом, или другие известные агонисты исходного гена, связанного с ожирением и/или диабетом.

«Иммунологически активный» определяет способность природного, рекомбинантного или синтетического варианта продукта или любого его фрагмента индуцировать специфический иммунный ответ у соответствующих животных или в соответствующих клетках и связываться со специфическими антителами. Таким образом, например, иммунологически активный фрагмент варианта продукта означает фрагмент, который сохраняет некоторые или все иммунологические свойства варианта продукта, например может связывать специфические антитела к варианту продукта, или который может вызывать иммунный ответ, приводящий к образованию таких антител или вызывающий пролиферацию специфических иммунных клеток, продуцирующих вариант продукта.

«Оптимальное выравнивание» определяют как выравнивание, дающее наивысший показатель процента идентичности. Такое выравнивание можно проводить с применением множества коммерчески доступных программ для анализа последовательностей, таких как программа для локального сравнения LALIGN с применением размера участка максимального совпадения - 1, параметров и PAM по умолчанию. Предпочтительным является выравнивание, осуществляемое с применением программы CLUSTAL-W от MacVector™, действующей со штрафом на внесение пропуска 10,0; со штрафом на продолжение пропуска 0,1 и матрицей подобия BLOSUM. Если нужно ввести пропуск в первую последовательность для оптимального выравнивания ее со второй последовательностью, процент идентичности вычисляют только с использованием остатков, парных соответствующим аминокислотным остаткам (т.е. вычисление не учитывает остатки второй последовательности, попадающие в «пропуск» первой последовательности). В случае выравнивания известных последовательностей гена с новым вариантом оптимальное выравнивание неизменно включает совместное выравнивание идентичных частей обеих последовательностей, затем раздельное сохранение и отмена выравнивания участков последовательностей, отличающихся друг от друга.

«Которые идентичны по меньшей мере на 90%» - по отношению к двум аминокислотным последовательностям или последовательностям нуклеиновой кислоты относится к процентному содержанию остатков, идентичных в двух последовательностях, когда последовательности оптимально выровнены. Таким образом, 90% идентичность аминокислотной последовательности означает, что 90% аминокислот в двух или более оптимально выровненных полипептидных последовательностях являются идентичными.

«Отдельная молекула нуклеиновой кислоты, обладающая последовательностью варианта нуклеиновой кислоты,» - молекула нуклеиновой кислоты, включающая в себя связанный с ожирением и/или диабетом вариант кодирующей последовательности нуклеиновой кислоты. Указанная отдельная молекула нуклеиновой кислоты может включать в себя связанный с ожирением и/или диабетом вариант последовательности нуклеиновой кислоты в качестве независимой вставки; может включать в себя связанный с ожирением и/или диабетом вариант последовательности нуклеиновой кислоты, присоединенный к дополнительным кодирующим последовательностям, вместе кодирующие гибридный белок, в котором последовательность, кодирующая вариант, является основной кодирующей последовательностью (например, дополнительная кодирующая последовательность может кодировать сигнальный пептид); связанный с ожирением и/или диабетом вариант кодирующей последовательности нуклеиновой кислоты может присутствовать в сочетании с некодирующими последовательностями, например интронами, или контрольными элементами, такими как промоторные или терминаторные элементы или 5'- и/или 3'- нетранслируемые области, эффективные для экспрессии кодирующей последовательности в соответствующем хозяине; или может существовать вектор, в котором связанный с ожирением и/или диабетом вариант последовательности, кодирующей белок, является гетерологичным.

«Экспрессирующий вектор» относится к векторам, способным включать и экспрессировать гетерологичные фрагменты ДНК в чужеродной клетке. Известно и/или коммерчески доступно множество прокариотических и эукариотических экспрессирующих векторов. Выбор подходящих экспрессирующих векторов в компетенции специалистов в данной области.

«Делеция» - изменение нуклеотидной или аминокислотной последовательности, при котором отсутствуют один или несколько нуклеотидов или аминокислотных остатков, соответственно.

«Вставка» или «добавление» - изменение нуклеотидной или аминокислотной последовательности, обусловленное добавлением одного или нескольких нуклеотидов или аминокислотных остатков соответственно по сравнению с природной последовательностью.

«Замена» - замена одного или нескольких нуклеотидов или аминокислот другими нуклеотидами или аминокислотами соответственно. Что касается аминокислотных последовательностей, замена может быть консервативной или неконсервативной.

«Антитело» относится к антителу IgG, IgM, IgD, IgA и IgG. Определение включает в себя поликлональные антитела или моноклональные антитела. Данный термин относится к полноразмерным антителам или фрагментам антител, включающим в себя антигенсвязывающий домен антител к варианту продукта, например антителам без Fc-фрагмента, одноцепочечным антителам, фрагментам, главным образом состоящим только из вариабельного, антигенсвязывающего домена антитела и т.д.

«Лечение заболевания» относится к введению терапевтического вещества, эффективного для облегчения связанных с заболеванием симптомов, для уменьшения тяжести или излечения заболевания, или для предупреждения возникновения заболевания.

«Детекция» относится к способу выявления заболевания, расстройства, патологического или нормального состояния. Данный термин может относиться к выявлению предрасположенности к заболеванию, а также к установлению прогноза для пациента посредством определения тяжести заболевания.

«Зонд» - вариант последовательности нуклеиновой кислоты при ожирении и/или диабете или, кроме того, комплементарной последовательности, когда его применяют для детекции присутствия в образце других подобных последовательностей, или последовательностей, обладающих некоторой гомологией с данной последовательностью. Детекцию осуществляют посредством идентификации гибридизационных комплексов между зондом и анализируемой последовательностью. Зонд можно присоединить к твердой подложке или к детектируемой метке.

«Исходные гены, связанные с ожирением и/или диабетом,» - аминокислотная или нуклеотидная последовательность, от которой связанные с ожирением и/или диабетом варианты по изобретению отличаются в результате альтернативного сплайсинга. Исходная нуклеотидная последовательность представляет собой последовательность связанного с ожирением и/или диабетом гена человека, представленную как SEQ ID NO:1 для адипонектина человека, и кодируемая ею последовательность представляет собой исходную аминокислотную последовательность; SEQ ID NO:5 для адипонектина мыши, и кодируемая ею последовательность представляет собой исходную аминокислотную последовательность; SEQ ID NO:10 для грелина, и кодируемая ею последовательность представляет собой исходную аминокислотную последовательность; SEQ ID NO:12 для 11-β-HSD человека, и кодируемая ею последовательность представляет собой исходную аминокислотную последовательность; SEQ ID NO:19 для 11-β-HSD мыши, и кодируемая ею последовательность представляет собой исходную аминокислотную последовательность.

Сущность изобретения

Настоящее изобретение относится к отдельным молекулам нуклеиновой кислоты с последовательностью, выбранной из группы, включающей: SEQ ID NO:2-4, 6-9, 11, 13-18, 20-21 и их фрагментов, включающих в себя по меньшей мере 15 нуклеотидов. Настоящее изобретение относится к отдельным молекулам нуклеиновой кислоты, включающим в себя SEQ ID NO:2-4, 6-9, 11, 13-18, 20-21, и к отдельным молекулам нуклеиновой кислоты, включающим в себя фрагменты SEQ ID NO:2-4, 6-9, 11, 13-18, 20-21, включающим в себя по меньшей мере 15 нуклеотидов.

Настоящее изобретение относится к праймерам для ПЦР, с которыми можно амплифицировать продукты с применением в качестве матриц последовательностей SEQ ID NO:2-4, 6-9, 11, 13-18, 20-21.

Настоящее изобретение относится к способам скрининга, диагностики и мониторинга индивидуумов на предмет ожирения и/или диабета. Способы включают в себя определение присутствия, отсутствия или количества в образце продукта транскрипции, включающего в себя последовательность, выбранную из группы, включающей: SEQ ID NO:2-4, 6-9, 11, 13-18, 20-21. Присутствие или количество вышеупомянутого продукта транскрипции является показательным для ожирения и/или диабета.

Настоящее изобретение относится к способам лечения индивидуумов, страдающих от ожирения и/или диабета, предусматривающим стадию введения продукта трансляции транскрипта с последовательностью, выбранной из группы, включающей: SEQ ID NO:2-4, 6-9, 11, 13-18, 20-21.

Настоящее изобретение относится к наборам для скрининга, диагностики и мониторинга у индивидуумов ожирения и/или диабета.

Настоящее изобретение относится к белкам, кодируемым последовательностью нуклеиновой кислоты, выбранной из группы, включающей: SEQ ID NO:2-4, 6-9, 11, 13-18, 20-21, и их иммуногенным фрагментам.

Настоящее изобретение относится к антителам, специфически связывающим эпитоп белка, кодируемого последовательностью нуклеиновой кислоты, выбранной из группы, включающей: SEQ ID NO:2-4, 6-9, 11, 13-18, 20-21.

Настоящее изобретение относится к антителам, специфически связывающим эпитоп белка, кодируемого последовательностью нуклеиновой кислоты, выбранной из группы, включающей: SEQ ID NO:2-4, 6-9, 11, 13-18, 20-21, к которым присоединены детектируемые метки или активные вещества.

Настоящее изобретение относится к фармацевтической композиции, включающей в себя антитела, специфически связывающие эпитоп белка, кодируемого последовательностью нуклеиновой кислоты, выбранной из группы, включающей из: SEQ ID NO:2-4, 6-9, 11, 13-18, 20-21, к которым присоединены активные вещества.

Настоящее изобретение относится к способам лечения индивидуумов, предположительно страдающих ожирением и/или диабетом. Способы предусматривает стадию введения индивидуумам антител, специфически связывающих эпитоп белка, кодируемого последовательностью нуклеиновой кислоты, выбранной из группы, включающей: SEQ ID NO:2-4, 6-9, 11, 13-18, 20-21, к которым присоединены активные вещества.

Настоящее изобретение относится к способам доставки молекулы нуклеиновой кислоты к пораженной ожирением и/или диабетом клетке индивидуума. Способ предусматривает стадию введения указанному индивидууму фармацевтической композиции, содержащей антитела, специфически связывающие эпитоп белка, кодируемого последовательностью нуклеиновой кислоты, выбранной из группы, включающей: SEQ ID NO:2-4, 6-9, 11, 13-18, 20-21, и молекулы нуклеиновой кислоты.

Краткое описание чертежей

На фиг.1 проиллюстрировано множественное выравнивание четырех аминокислотных последовательностей человеческого происхождения (представленных на SEQ ID NO:22 - SEQ ID NO:25) друг с другом и с исходной последовательностью;

На фиг.2 проиллюстрировано множественное выравнивание пяти аминокислотных последовательностей мышиного происхождения (представленных на SEQ ID NO:26 - SEQ ID NO:30) друг с другом и с исходной последовательностью;

На фиг.3 проиллюстрировано выравнивание двух аминокислотных последовательностей человеческого происхождения (представленных на SEQ ID NO:31 - SEQ ID NO:32) с исходной последовательностью;

На фиг.4 проиллюстрировано множественное выравнивание семи аминокислотных последовательностей человеческого происхождения (представленных на SEQ ID NO:33 - SEQ ID NO:39) друг с другом и с исходной последовательностью;

На фиг.5 проиллюстрировано множественное выравнивание трех аминокислотных последовательностей человеческого происхождения (представленных на SEQ ID NO:40 - SEQ ID NO:42) друг с другом и с исходной последовательностью;

На фиг.6 проиллюстрировано множественное выравнивание четырех последовательностей нуклеиновых кислот человеческого происхождения (представленных на SEQ ID NO:1 - SEQ ID NO:4) друг с другом и с исходной последовательностью;

На фиг.7 проиллюстрировано множественное выравнивание пяти последовательностей нуклеиновых кислот мышиного происхождения (представленных на SEQ ID NO:5 - SEQ ID NO:9) друг с другом и с исходной последовательностью;

На фиг.8 проиллюстрировано выравнивание двух последовательностей нуклеиновых кислот человеческого происхождения (представленных на SEQ ID NO:10 - SEQ ID NO:11) с исходной последовательностью;

На фиг.9 проиллюстрировано множественное выравнивание семи последовательностей нуклеиновых кислот человеческого происхождения (представленных на SEQ ID NO:12 - SEQ ID NO:18) друг с другом и с исходной последовательностью;

На фиг.10 проиллюстрировано множественное выравнивание трех аминокислотных последовательностей человеческого происхождения (представленных на SEQ ID NO:19 - SEQ ID NO:21) друг с другом и с исходной последовательностью.

Подробное описание предпочтительных вариантов осуществления

Авторы конкретно проводят здесь полное содержание всех цитируемых в данном описании ссылок. Далее, когда количество, концентрация или другое значение параметра приведено как диапазон, предпочтительный диапазон, или список верхних предпочтительных значений и нижних предпочтительных значений, его следует понимать, как все специфически включенные диапазоны, сформированные из любой пары любого верхнего предела диапазона или предпочтительного значения и любого нижнего предела диапазона или предпочтительного значения, независимо от того, приведены ли диапазоны по отдельности. Там, где в патенте перечислен диапазон числовых значений, пока не указано иначе, подразумевается, что диапазон включает его конечные точки и все целые и дроби внутри диапазона. Не подразумевается, что объем изобретения ограничен конкретными значениями, перечисленными при определении диапазона.

Последовательность вариантов нуклеиновых кислот при ожирении и/или диабете

Последовательности нуклеиновых кислот по изобретению включают последовательности нуклеиновых кислот, кодирующих продукты вариантов при ожирении и/или диабете, их фрагменты и аналоги. В качестве альтернативы, последовательности нуклеиновых кислот могут представлять собой последовательности, комплементарные вышеуказанным кодирующим последовательностям или областям указанной кодирующей последовательности. Длина комплементарной последовательности является достаточной для прекращения экспрессии кодирующей последовательности. Последовательности нуклеиновых кислот могут быть в форме РНК или в форме ДНК и включать в себя матричную РНК, синтетическую РНК и ДНК, кДНК и геномную ДНК. ДНК может быть двухцепочечной или одноцепочечной, и если является одноцепочечной, может представлять собой кодирующую цепь или некодирующую (антисмысловую, комплементарную) цепь. Последовательности нуклеиновых кислот могут также включать как dNTP и rNTP, так и не природной последовательности. Последовательность может также являться частью гибрида между аминокислотной последовательностью и последовательностью нуклеиновой кислоты.

В основном варианте осуществления последовательность нуклеиновой кислоты по меньшей мере на 90% идентична любой последовательности, определенной как SEQ ID NO:2 - SEQ ID NO:4, или SEQ ID NO:6 - SEQ ID NO:9, или SEQ ID NO:11, или SEQ ID NO:13 - SEQ ID NO:18, или SEQ ID NO:20 - SEQ ID NO:21.

Последовательности нуклеиновой кислоты сами по себе могут включать в себя кодирующую последовательность. В качестве другой альтернативы кодирующая область может присутствовать в сочетании с дополнительными кодирующими последовательностями, такими как кодирующие гибридный белок или сигнальные пептиды, в сочетании с некодирующими последовательностями, такими как интроны и контрольные элементы, промоторные и терминаторные элементы или 5'- и/или 3'-нетранслируемые области, эффективные для экспрессии кодирующей последовательности в соответствующем хозяине, и/или в векторе или окружении хозяина, в которое вариант последовательностей нуклеиновых кислот введен как гетерологичная последовательность.

Последовательности нуклеиновых кислот по настоящему изобретению могут содержать также последовательности, кодирующие варианты продуктов при ожирении и/или диабете, слитные в одной рамке считывания с маркерной последовательностью, позволяющей очищать вариант продукта. Маркерная последовательность может представлять собой, например, гексагистидиновую метку, обеспечивающую очистку зрелого полипептида, слитного с маркером, в случае бактериального хозяина, или маркерная последовательность может представлять собой гемагглютининовую (HA) метку при применении относящегося к млекопитающим хозяина, например, клеток COS-7. HA-метка соответствует эпитопу, производному от белка гемагглютинина гриппа (Wilson, I., et al. Cell 37:767 (1984)).

В объем изобретения также включены фрагменты, как определено выше, также относящиеся здесь к олигонуклеотидам, как правило, обладающие по меньшей мере 17 основаниями, предпочтительнее 17-30 основаниями, соответствующими области кодирующей последовательности в последовательности нуклеиновой кислоты. Фрагменты можно применять в качестве зондов, праймеров и в случае комплементарности также в качестве антисмысловых средств и подобных в соответствии с известными способами.

Как указано выше, последовательность нуклеиновой кислоты может по существу являться такой, как указано в SEQ ID NO:2 - SEQ ID NO:4, или SEQ ID NO:6 - SEQ ID NO:9, или SEQ ID NO:11, или SEQ ID NO:13 - SEQ ID NO:18, или SEQ ID NO:20 - SEQ ID NO:21, или как их фрагменты или последовательности, по меньшей мере на 90% идентичные вышеуказанной последовательности, как объяснено выше. В качестве альтернативы из-за вырожденной природы генетического кода, последовательность может представлять собой последовательность, кодирующую любую из аминокислотных последовательностей SEQ ID NO:23 - SEQ ID NO:25, или SEQ ID NO:27 - SEQ ID NO:30, или SEQ ID NO:32, или SEQ ID NO:34 - SEQ ID NO:39, или SEQ ID NO:41 - SEQ ID NO:42, или фрагменты или аналоги указанной аминокислотной последовательности.

A. Подготовка последовательностей нуклеиновых кислот

Последовательности нуклеиновых кислот можно получить скринингом библиотек кДНК с применением олигонуклеотидных зондов, которые могут гибридизоваться с последовательностями нуклеиновых кислот, кодирующих варианты продуктов при ожирении и/или диабете, описанных выше, или амплифицировать их посредством ПЦР. Библиотеки кДНК, полученные из множества тканей, коммерчески доступны, и процедуры скрининга и выделения клонов кДНК хорошо известны специалистам в данной области. Такие способы описаны, например, в Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd Edition), Cold Spring Harbor Press, Plainview, N.Y. и Ausubel FM et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y.

Последовательности нуклеиновых кислот можно продлить для получения последовательностей выше и ниже, таких как промоторы, регуляторные элементы и 5'- и 3'-нетранслируемые области (UTR). Удлинение доступной последовательности транскрипта можно осуществлять многочисленными способами, известными специалистам в данной области, такими как ПЦР или достройка праймеров (Sambrook et al., выше), или способом RACE, например, с применением набора Marathon RACE (Clontech, каталожный. № K1802-1).

В качестве альтернативы может служить способ «ПЦР участков рестрикции» (Gobinda et al. PCR Methods Appl. 2:318-22 (1993)), в котором применяют универсальные праймеры для восстановления фланкирующих последовательностей, соседних с известным локусом. Сначала геномную ДНК амплифицируют в присутствии праймера для последовательности линкера и праймера, специфического для известной области. Амплифицированные последовательности подвергают второму циклу ПЦР с тем же самым праймером для линкера и другим специфическим праймером, внутренним по отношению к первому. Продукты каждого цикла ПЦР транскрибируют подходящей РНК-полимеразой и секвенируют с применением обратной транскриптазы.

Для амплификации продленных последовательностей можно применять обращенную ПЦР с применением расходящихся праймеров, основанных на известной области (Triglia, T. et al., Nucleic Acids Res. 16:8186 (1988)). С применением программного обеспечения для анализа праймеров OLIGO® 4.06 (1992; National Biosciences Inc, Plymouth, Minn.) или другой подходящей программы можно сконструировать праймеры длиной 22-30 нуклеотидов, с содержанием GC 50% или более, отжигающиеся с последовательностью-мишенью при температурах примерно 68-72°C. Способ применяет несколько ферментов рестрикции для получения подходящего фрагмента известной области гена. Затем фрагмент переводят в кольцевую форму внутримолекулярным лигированием и применяют в качестве матрицы для ПЦР.

«Захватывающий ПЦР» (Lagerstrom, M. et al., PCR Methods Appl. 1:111-19 (1991)) представляет собой способ амплификации ПЦР фрагментов ДНК, соседних с известной последовательностью в ДНК человека и искусственной хромосомы дрожжей. Захватывающий ПЦР требует также множественных расщеплений ферментами рестрикции и лигирований, чтобы перед ПЦР поместить сконструированную двухцепочечную последовательность во фланкирующую часть молекулы ДНК.

Другим способом, который можно применять для восстановления фланкирующих последовательностей, является способ Parker, J.D., et al., Nucleic Acids Res. 19:3055-60 (1991). Дополнительно можно применять ПЦР, гнездовые праймеры, и библиотеки PromoterFinder™ для «прогулки по» геномной ДНК (PromoterFinder™; Clontech, Palo Alto, CA). Данный процесс исключает необходимость скрининга библиотек и полезен для поиска экзон-интронных сочленений. Предпочтительными библиотеками для скрининга полноразмерных кДНК являются прошедшие отбор по размеру и несущие более длинные кДНК. Также предпочтительными являются библиотеки, полученные с применением рассеянной затравки, так как они содержат больше последовательностей, содержащих области генов 5'- и выше.

Библиотеки, полученные с применением рассеянной затравки, могут быть особенно полезными, если с применением олиго-d(T)-библиотеки не получают полноразмерную кДНК. Геномные библиотеки полезны для достройки в 5'-нетранслируемой регуляторной области.

Последовательности нуклеиновых кислот и олигонуклеотиды по изобретению можно получить также твердофазным способом согласно известным способам синтеза. Как правило, фрагменты приблизительно до 100 оснований синтезируют по отдельности, затем соединяют для формирования продолжительных последовательностей до нескольких сотен оснований.

B. Применение вариантов последовательностей нуклеиновых кислот при ожирении и/или диабете для получения вариантов продуктов при ожирении и/или диабете

По настоящему изобретению последовательности нуклеиновых кислот, указанные выше, можно применять в качестве рекомбинантных молекул ДНК, направляющих экспрессию вариантов продуктов при ожирении и/или диабете.

Как понятно специалистам в данной области, может быть выгодно получать нуклеотидные последовательности, кодирующие варианты продуктов при ожирении и/или диабете, обладающие кодонами, отличающимися от показанных на SEQ ID NO:2 - SEQ ID NO:4, или SEQ ID NO:6 - SEQ ID NO:9, или SEQ ID NO:11, или SEQ ID NO:13 - SEQID NO:18, или SEQ ID NO:20 - SEQ ID NO:21, которые встречаются в природе в геноме человека. Можно выбирать кодоны, предпочтительные для конкретного прокариотического или эукариотического хозяина (Murray, E. et al. Nucleic Acids Res. 17:477-508 (1989)), например, для увеличения скорости экспрессии варианта продукта или для получения транскриптов рекомбинантной РНК, обладающих желаемыми свойствами, такими как более длительное время полужизни, чем у транскриптов, получаемых с природных последовательностей.

Последовательности нуклеиновых кислот по настоящему изобретению можно сконструировать для изменения последовательностей, кодирующих варианты продуктов при ожирении и/или диабете, по ряду причин, включающих в себя в качестве неограничивающих примеров изменения, модифицирующие клонирование, процессинг и/или экспрессию продукта. Например, изменения можно вводить с применением способов, хорошо известных в данной области, например сайт-направленного мутагенеза, для введения новых участков рестрикции, для изменения характера гликозилирования, для изменения предпочтения кодонов и т.д.

Настоящее изобретение также включает в себя рекомбинантные конструкции, включающие в себя одну или более последовательностей, как в общих чертах описано выше. Конструкции включают в себя вектор, такой как плазмидный или вирусный вектор, в который вставлены последовательности нуклеиновых кислот по изобретению, в прямой или обратной ориентации. В предпочтительном аспекте данного варианта осуществления конструкции в дальнейшем включают в себя регуляторные последовательности, включающие в себя, например, промотор, функционально связанный с последовательностью. Большое число подходящих векторов и промоторов известны специалистам в данной области и коммерчески доступны. Подходящие клонирующие и экспрессирующие векторы для применения в прокариотических и эукариотических хозяевах описаны также в Sambrook, et al. (выше).

Настоящее изобретение относится также к клеткам-хозяевам, модифицированным генетической инженерией с применением векторов по изобретению, и получению продукта по изобретению с применением рекомбинантных способов. Клетки хозяина модифицированы генетической инженерией (например, трансдуцированы, трансформированы или трансфицированы) с применением векторов по изобретению, которые могут представлять собой, например, клонирующий вектор или экспрессирующий вектор. Вектор может существовать, например, в форме плазмиды, вирусной частицы, фага и т.д. Модифицированные генетической инженерией клетки-хозяева можно культивировать в общепринятой питательной среде, модифицированной, как предназначено для активации промоторов, отбора трансформантов или увеличения экспрессии варианта последовательности нуклеиновой кислоты. Условия культивирования, такие как температура, pH и подобные, остаются такими, как применяли предварительно для клеток-хозяев, выбранных для экспрессии, и очевидны для специалистов в данной области.

Последовательности нуклеиновых кислот по настоящему изобретению можно включить в любой из множества экспрессирующих векторов для экспрессии продукта. Такие векторы включают в себя хромосомные, нехромосомные и синтетические последовательности ДНК, например производные SV40; бактериальные плазмиды; фаговую ДНК; бакуловирус; дрожжевые плазмиды; векторы, производные от сочетания плазмид и фаговой ДНК, вирусной ДНК, такой как ДНК вируса коровьей оспы, аденовируса, вируса оспы птиц и вируса инфекционного бульбарного паралича. Однако можно применять любой другой вектор до тех пор, пока он является воспроизводимым и жизнеспособным в хозяине. Подходящую последовательность ДНК можно вставить в вектор посредством множества процедур. Как правило, последовательность ДНК вставляют в подходящий участок (участки) рестрикционных эндонуклеаз посредством процедур, известных в данной области. Такие процедуры и связанные процедуры субклонирования считаются входящими в сферу деятельности специалистов в данной области.

Последовательность ДНК в экспрессирующем векторе функционально связывают с подходящей последовательностью контроля транскрипции (промотором), чтобы направлять синтез мРНК. Примеры таких промоторов включают в себя: LTR или промотор SV40, промоторы lac или trp E.coli, промотор PL фага лямбда и другие промоторы, известные как контролирующие экспрессию генов в прокариотических или эукариотических клетках или их вирусах. Экспрессирующие векторы содержат также сайт связывания рибосомы для инициации трансляции и терминатор транскрипции. Вектор может содержать также соответствующие последовательности для увеличения экспрессии. Кроме того, экспрессирующие векторы предпочтительнее содержат один или несколько генов селективных маркеров для обеспечения фенотипического признака для отбора трансформированных клеток-хозяев, такого как дигидрофолатредуктаза или устойчивость к неомицину для культуры эукариотических клеток или такого как устойчивость к ампициллину или тетрациклину у E.coli.

Векторы, содержащие подходящую последовательность ДНК, как описано выше, также как подходящую промоторную или контрольную последовательность, могут служить для трансформации подходящего хозяина, чтобы позволить хозяину экспрессировать белок. Примеры подходящих экспрессирующих хозяев включают: бактериальные клетки, такие как E.coli, Streptomyces, Salmonella typhimurium; клетки грибов, таких как дрожжи; клетки насекомых, таких как Drosophila и Spodoptera Sf9; клетки животных, такие как CHO, COS, HEK 293 или меланомы Bowes; аденовирусы; клетки растений и т.д. Выбор подходящего хозяина по объяснениям отсюда считается входящим в сферу деятельности специалистов в данной области. Изобретение не ограничено применяемыми клетками-хозяевами.

В бактериальных системах можно выбрать ряд экспрессирующих векторов в зависимости от намеченного применения варианта продукта при ожирении и/или диабете. Например, если необходимы большие количества варианта продукта при ожирении и/или диабете для индукции антител, могут быть желательными векторы, обеспечивающие высокий уровень экспрессии гибридных белков, которые легко очищать. Такие векторы включают в себя в качестве неограничивающих примеров многофункциональные клонирующие и экспрессирующие векторы для E.coli, такие как Bluescript® (Stratagene), в которых последовательность, кодирующую варианты полипептидов при ожирении и/или диабете, можно лигировать в вектор в одной рамке считывания с последовательностями для N-концевого Met и следующих 7 остатков бета-галактозидазы, так что получается гибридный белок; векторы pIN (Van Heeke & Schuster J. Biol. Chem. 264:5503-5509 (1989)); векторы pET (Novagen, Madison WI) и подобные.

В дрожжах Saccharomyces cerevisiae можно применять ряд векторов, содержащих конститутивные или индуцируемые промоторы, такие как промоторы фактора альфа, алкогольоксидазы и PGH. Обзоры см. в Ausubel et al. (выше) и Grant et al. (Methods in Enzymology 153:516-544 (1987)).

В случае применения экспрессирующих векторов растений экспрессию последовательности, кодирующей варианты продуктов, можно проводить под контролем любого числа промоторов. Например, вирусные промоторы, такие как промоторы 35S и 19S CaMV (Brisson et al., Nature 310:511-514 (1984)), можно применять по отдельности или в сочетании с омега-лидерной последовательностью TMV (Takamatsu et al., EMBO J. 6:307-311 (1987)). В качестве альтернативы можно применять промоторы растений, такие как промотор малой субъединицы RUBISCO (Coruzzi et al., EMBO J. 3:1671-1680 (1984); Broglie et al., Science 224:838-843 (1984)); или промоторы теплового шока (Winter J и Sinibaldi R.M., Results Probl. Cell Differ. 17:85-105 (1991)). Данные конструкции можно вводить в клетки растений прямой трансформацией ДНК или патоген-опосредованной трансфекцией. Обзор таких способов см. у Hobbs S. или Murry L.E. (1992) в McGraw Hill Yearbook of Science and Technology, McGraw Hill, New York, N.Y., pp 191-196; или у Weissbach and Weissbach (1988) Methods for Plant Molecular Biology, Academic Press, New York, N.Y., pp.421-463.

Варианты продуктов при ожирении и/или диабете можно также экспрессировать в системе насекомых. В одной такой системе вирус ядерного полиэдроза Autographa californica (AcNPV) применяют в качестве вектора для экспрессии чужеродных генов в клетках Spodoptera frugiperda или в личинках Trichoplusia. Последовательность, кодирующую варианты продуктов при ожирении и/или диабете, можно клонировать в несущественную область вируса, такую как ген полиэдрина, и поместить под контроль промотора полиэдрина. Успешная вставка кодирующих последовательностей при ожирении и/или диабете приводит к инактивации гена полиэдрина и продукции рекомбинантного вируса без внешней белковой оболочки. Затем рекомбинантные вирусы применяют для инфекции клеток S. frugiperda или личинок Trichoplusia, в которых экспрессируют вариант белка (Smith et al., J. ViroL 46:584 (1983); Engelhard, E. K.et al., Proc. Nat. Acad. Sci. USA 91:3224-7 (1994)).

В клетках-хозяевах млекопитающих можно применять ряд экспрессирующих систем на основе вирусов. В случаях применения аденовируса в качестве экспрессирующего вектора последовательности, кодирующие варианты продуктов при ожирении и/или диабете, можно лигировать в комплекс транскрипции/трансляции аденовируса, состоящий из позднего промотора и трехсегментной лидерной последовательности. Вставка в несущественную область вирусного генома E1 или E3 приводит к получению жизнеспособного вируса, способного экспрессировать вариант белка в инфицированных клетках-хозяевах (Logan and Shenk, Proc. Natl. Acad. Sci. USA 81:3655-59 (1984). В дополнение для увеличения экспрессии в клетках-хозяевах млекопитающих можно применять энхансеры транскрипции, такие как энхансер вируса саркомы Рауса (RSV).

Специфические сигналы инициации также могут потребоваться для эффективной трансляции последовательностей, кодирующих варианты продуктов. Такие сигналы включают в себя инициирующий кодон ATG и соседние последовательности. В случаях, где последовательность, кодирующая варианты продуктов при ожирении и/или диабете, ее инициирующий кодон и вышележащие против хода транскрипции последовательности вставлены в подходящий экспрессирующий вектор, дополнительных контрольных сигналов трансляции может не потребоваться. Однако в случаях, где вставлена только кодирующая последовательность или ее часть, необходимо обеспечить экзогенные транскрипционные контрольные сигналы, включая инициирующий кодон ATG. К тому же инициирующий кодон должен находиться в правильной рамке считывания, чтобы гарантировать транскрипцию полной вставки. Экзогенные транскрипционные элементы и инициирующие кодоны могут быть различного происхождения, как природными, так и синтетическими. Эффективность экспрессии можно усиливать добавлением энхансеров, подходящих для используемой клеточной системы (Scharf, D. et al., Results Probl. Cell Differ. 20:125-62 (1994); Bittner et al., Meth. Enzymol. 153:516-544 (1987)).

В дополнительном варианте осуществления настоящее изобретение относится к клеткам-хозяевам, содержащим описанные выше конструкции. Клетки-хозяева могут представлять собой клетки высших эукариот, такие как клетки млекопитающих, или клетки низших эукариот, такие как клетки дрожжей, или клетки-хозяева могут представлять собой прокариотические клетки, такие как бактериальные клетки. Введение конструкции в клетки хозяина можно осуществить кальций-фосфатной трансфекцией, трансфекцией, опосредованной DEAE-декстраном, или электропорацией (Davis,L., Dibner, M., and Battey, I. (1986) Basic Methods in Molecular Biology). Бесклеточные системы трансляции также могут служить для получения полипептидов с применением РНК, полученной с ДНК-конструкций по настоящему изобретению.

Штамм клеток-хозяев можно выбирать по его способности модулировать экспрессию вставочных последовательностей или процессировать экспрессированный белок желаемым образом. Такие модификации белка включают в себя в качестве неограничивающих примеров ацетилирование, карбоксилирование, гликозилирование, фосфорилирование, присоединение липида и ацилирование. Посттрансляционный процессинг, расщепляющий «пре-про» форму белка, может также быть важным для правильной вставки, укладки и/или функции. Различные клетки-хозяева, такие как CHO, HeLa, MDCK, 293, WI38, и т.д., обладают специфическим клеточным аппаратом и характерными механизмами для таких посттрансляционных активностей и могут быть выбраны так, чтобы гарантировать правильную модификацию и процессинг введенного чужеродного белка.

Для долговременной продукции рекомбинантных белков с высоким выходом предпочтительнее стабильная экспрессия. Например, клеточные линии, стабильно экспрессирующие варианты продуктов, можно трансформировать с применением экспрессирующих векторов, содержащих вирусные точки начала репликации или эндогенные экспрессирующие элементы и ген селективного маркера. После введения вектора клеткам можно позволить расти 1-2 суток в обогащенной среде перед тем, как перевести их в селективную среду. Назначением селективного маркера является обеспечение устойчивости к селекции, и его присутствие позволяет рост и восстановление клеток, успешно экспрессирующих введенные последовательности. Можно вызвать пролиферацию устойчивых колоний стабильно трансформированных клеток с применением способов культуры клеток тканей, соответствующим типу клеток.

Для восстановления трансформированных линий клеток можно применять любое число систем селекции. Они включают в себя в качестве неограничивающих примеров гены тимидинкиназы вируса простого герпеса (Wigler M., et al., Cell 11:223-32 (1977)) и аденин-фосфорибозилтрансферазы (Lowy I., et al., Cell 22:817-23(1980)), которые можно применять в tk- или aprt- клетках соответственно. В качестве основы для селекции можно применять также устойчивость к антиметаболитам, антибиотикам или гербицидам, например dhfr, предоставляющий устойчивость к метотрексату (Wigler M., et al., Proc. Natl. Acad. Sci. USA 77: 3567-70, (1980)); npt, предоставляющий устойчивость к аминогликозидам неомицину и G-418 (Colbere-Garapin, F. et al., J. Mol. Biol. 150:1-14 (1981)); и als или pat, предоставляющие устойчивость к хлорсульфурону и фосфинотрицинацетилтрансферазе соответственно (Murry, выше). Описаны дополнительные селективные гены, например trpB, позволяющий клеткам утилизировать индол вместо триптофана, или hisD, позволяющий клеткам утилизировать гистидинол вместо гиситидина. (Hartman S. C. and R. C. Mulligan, Proc. Natl.Acad. Sci. 85:8047-51, (1988)). Применение видимых маркеров приобрело популярность с такими маркерами, как антоцианы, β-глюкуронидаза и ее субстрат GUS, люцифераза и ее субстраты, люциферин и ATP, широко применяемыми не только для идентификации трансформантов, но также для количественного определения транзиторной или стабильной экспрессии белка, относящейся к конкретной векторной системе.

Клетки-хозяева, трансформированные нуклеотидными последовательностями, кодирующими варианты продуктов при ожирении и/или диабете, можно культивировать в условиях, подходящих для экспрессии и выделения кодируемого белка из культуры клеток. Продукт, продуцируемый рекомбинантными клетками, может быть секретирован или заключен внутри клеток в зависимости от последовательности и/или применяемого вектора. Как понятно специалистам в данной области, экспрессирующие векторы, содержащие последовательности нуклеиновых кислот, кодирующие варианты продуктов при ожирении и/или диабете, можно конструировать с сигнальными последовательностями, направляющими непосредственную секрецию вариантов продуктов при ожирении и/или диабете через мембрану прокариотической или эукариотической клетки.

Варианты продуктов при ожирении и/или диабете можно экспрессировать также в виде рекомбинантных белков с одним или несколькими дополнительными полипептидными доменами, добавленными для облегчения очистки белка. Такие облегчающие очистку домены включают в себя в качестве неограничивающих примеров пептиды, образующие хелатные соединения с металлами, такие как гистидин-триптофановые модули, позволяющие очистку на иммобилизованных металлах; домены белка A, позволяющие очистку на иммобилизованном иммуноглобулине, и домен, применяемый в системе достройки/аффинной очистки FLAGS (Immunex Corp., Settle, Wash.). Для облегчения очистки полезно добавление последовательности расщепляемого протеазами полипептидного линкера между доменом для очистки и вариантами продуктов при ожирении и/или диабете. Один из таких экспрессирующих векторов предусмотрен для экспрессии гибридного белка, содержащего вариант полипептида, слитный с полигистидиновой областью, разделенные участком расщепления энтерокиназой. Гистидиновые остатки облегчают очистку IMIAC (аффинной хроматографией с иммобилизованными ионами металлов), как описано у Porath, et al., Protein Expr. Purif. 3:263-281 (1992)), в то время как участок расщепления энтерокиназой предоставляет возможность выделения варианта полипептида из гибридного белка. Векторы pGEX (Promega, Madison, Wis.) также можно применять для экспрессии чужеродных полипептидов в виде гибридных белков с глутатион-S-трансферазой (GST). Как правило, такие гибридные белки являются растворимыми, и их легко очистить из лизированных клеток посредством адсорбции на лиганд-агарозных бусинах (например, глутатион-агарозных в случае гибридных белков с GST) с последующей элюцией в присутствии свободного лиганда.

После трансформации подходящего штамма-хозяина и роста штамма-хозяина до подходящей плотности клеток выбранный промотор индуцируют подходящими способами (например, сдвигом температуры или химической индукцией) и культивируют клетки дополнительный период времени. Как правило, клетки собирают центрифугированием, разрушают физическими или химическими способами и получившийся грубый экстракт сохраняют для дальнейшей очистки. Клетки микробов, служащие для экспрессии белков, можно разрушить любым подходящим способом, включая циклы замораживания-оттаивания, обработку ультразвуком, механическое разрушение или применение лизирующих клетки средств, или другие способы, хорошо известные специалистам в данной области.

Варианты продуктов при ожирении и/или диабете можно восстановить и очистить из культур рекомбинантных клеток с применением любого числа методов, хорошо известных в данной области, включая осаждение сульфатом аммония или этанолом, кислую экстракцию, анион- или катионообменную хроматографию, хроматографию на фосфоцеллюлозе, хроматографию с гидрофобным взаимодействием, аффинную хроматографию, хроматографию на гидроксиапатите и фитогемагглютининовую хроматографию. Для завершения конфигурации зрелого белка можно применять стадию переукладки белка. Наконец, для заключительных стадий очистки можно применять высокоэффективную жидкостную хроматографию (HPLC).

C. Диагностические варианты применения с использованием последовательностей нуклеиновых кислот

Последовательности нуклеиновых кислот по настоящему изобретению можно применять для множества диагностических целей. Последовательности нуклеиновых кислот можно применять для детекции и количественного определения экспрессии варианта при ожирении и/или диабете в клетках пациента, например, взятых при биопсии тканях, посредством детекции присутствия мРНК, кодирующей варианты продуктов при ожирении и/или диабете. В качестве альтернативы анализ можно применять для детекции растворимых вариантов в сыворотке или крови. Данный анализ, как правило, включает получение тотальной мРНК из ткани или сыворотки и затем приведение мРНК в контакт с нуклеиновой кислотой-зондом. Зонд представляет собой молекулу нуклеиновой кислоты по меньшей мере из 20 нуклеотидов, предпочтительнее из 20-30 нуклеотидов, способную специфически гибридизоваться с последовательностью, заключенной внутри последовательности молекулы нуклеиновой кислоты, кодирующей вариант продукта при ожирении и/или диабете, в условиях гибридизации, детектируя присутствие мРНК, гибридизующейся с зондом и таким образом детектируя экспрессию варианта. Данный анализ можно применять для установления различий между отсутствием, присутствием и избыточной экспрессией вариантов продуктов при ожирении и/или диабете и для мониторинга уровней экспрессии вариантов при ожирении и/или диабете на протяжении терапевтического вмешательства. Дополнительно, анализ можно применять для сравнения уровней вариантов при ожирении и/или диабете по изобретению с уровнями исходной последовательности, от которой они отличаются, или с уровнями друг друга; такое сравнение может иметь какое-либо физиологическое значение.

Изобретение рассматривает также применение последовательностей нуклеиновых кислот в качестве диагностики заболеваний, происходящих в результате наследования дефектных вариантов последовательностей, или заболеваний, при которых изменено отношение количества исходной последовательности при ожирении и/или диабете, от которой отличаются варианты при ожирении и/или диабете, к количеству новых вариантов при ожирении и/или диабете по изобретению. Данные последовательности можно определить сравнением последовательностей кодирующих областей дефектных (т.е. мутантных) вариантов при ожирении и/или диабете с последовательностью нормальной кодирующей области. Можно проверить ассоциацию последовательности, кодирующей мутантные варианты продуктов, с активностью аномальных вариантов продуктов. Кроме того, последовательности, кодирующие мутантные варианты продуктов ожирения и/или диабета, можно вставить в подходящий вектор для экспрессии в системах функционального анализа (например, колориметрического анализа, экспериментов по комплементации на линии клеток HEK293, дефектных по варианту белка) в качестве еще одного способа проверки или идентификации мутаций. Однажды идентифицировав мутантные гены, можно затем скринировать интересующие популяции по носителям мутантного гена.

Индивидуумов, несущих мутации в последовательностях нуклеиновых кислот по настоящему изобретению, можно детектировать на уровне ДНК посредством множества способов. Нуклеиновые кислоты, применяемые для диагностики, можно получить из клеток пациента, включающих в качестве неограничивающих примеров такие, как клетки из крови, мочи, слюны, плаценты, материала биопсии тканей и аутопсии. Геномную ДНК можно применять непосредственно для детекции или до анализа амплифицировать ферментативно с применением ПЦР (Saiki, et al., Nature 324:163-166 (1986)). РНК или кДНК также можно применять для тех же целей. В качестве примера праймеры для ПЦР, комплементарные нуклеиновой кислоте по настоящему изобретению, можно применять для идентификации и анализа мутаций в гене по настоящему изобретению. Делеции и вставки можно детектировать по изменению размера амплифицированного продукта по сравнению с нормальным генотипом.

Точечные мутации можно идентифицировать гибридизацией амплифицированной ДНК с радиоактивно меченной РНК по изобретению или, в качестве альтернативы, радиоактивно меченными антисмысловыми последовательностями ДНК по изобретению. Изменения последовательности в конкретных положениях можно обнаружить также анализами защиты от нуклеазы, такими как защита от РНКазы и S1, или способом химического расщепления (например, Cotton, et al. Proc. Natl. Acad. Sci. USA 85:4397-4401 (1985)), или по различиям в температурах плавления. "Молекулярные маячки" (Kostrikis L. G. et al., Science 279:1228-1229 (1998)), изогнутые шпилькой одноцепочечные синтетические олигонуклеотиды, содержащие последовательности зондов, комплементарные нуклеиновой кислоте по настоящему изобретению, можно также использовать для детекции точечных мутаций или других изменений последовательности, также как для мониторинга уровней экспрессии варианта продукта. Такие диагностики могут быть особенно полезными для пренатального тестирования.

Другой способ для детекции мутаций применяет два ДНК-зонда, сконструированные для гибридизации с соседними областями мишени, с граничащими основаниями, где область известной или предполагаемой мутации(й) располагается в граничащих основаниях или рядом с ними. Два зонда можно соединить по граничащим основаниям, например, в присутствии фермента лигазы, только при точном спаривании оснований обоих зондов в области стыка зондов. В таком случае присутствие или отсутствие мутаций определяют по присутствию или отсутствию лигированного зонда.

Для детекции мутаций в последовательностях вариантов продуктов при ожирении и/или диабете подходят также способы с упорядоченными массивами олигонуклеотидов, основанные на секвенировании посредством гибридизации (SBH), как описано, например в U.S. Patent № 5547839. По типичному способу ДНК-мишень, определяемую при анализе, гибридизуют с массивом олигонуклеотидов, сформированном на микрочипе. Затем последовательность мишени можно «прочитать» по рисунку связывания мишени с массивом.

D. Варианты терапевтического применения последовательностей нуклеиновых кислот

Последовательности нуклеиновых кислот по изобретению можно применять также для терапевтических целей. Ссылаясь на второй аспект изобретения (т.е. ингибирование экспрессии вариантов при ожирении и/или диабете), экспрессию вариантов при ожирении и/или диабете можно модулировать посредством технологии антисмысловых последовательностей, контролирующей экспрессию генов посредством гибридизации комплементарных последовательностей нуклеиновых кислот, т.е. антисмысловых ДНК или РНК с контрольными, 5'- или регуляторными областями гена, кодирующего вариант продукта. Например, 5'-кодирующую часть последовательности нуклеиновой кислоты, кодирующей продукт по настоящему изобретению, использовали для дизайна антисмысловых олигонуклеотидов длиной приблизительно от 10 до 40 пар оснований. Предпочтительными являются олигонуклеотиды, производные от точки инициации транскрипции, например, между положениями -10 и +10 от точки инициации. Антисмысловой ДНК-олигонуклеотид конструируют комплементарным области последовательности нуклеиновой кислоты, вовлеченной в транскрипцию (Lee et al., Nucl. Acids Res. 6:3073 (1979); Cooney et al., Science 241:456 (1988); и Dervan et al., Science 251:1360 (1991)), таким образом предупреждая транскрипцию и продукцию вариантов продуктов. Антисмысловой РНК-олигонуклеотид гибридизуется с мРНК in vivo и блокирует трансляцию вариантов продуктов с молекулы мРНК (Okano, J. Neurochem. 56:560 (1991)). Антисмысловые конструкции можно доставить в клетки посредством процедур, известных в данной области, так что антисмысловую РНК или ДНК можно экспрессировать in vivo. Антисмысловой может являться антисмысловая последовательность мРНК или ДНК, способная кодировать такую антисмысловую мРНК. Антисмысловая мРНК или кодирующая ее ДНК может быть комплементарной полной последовательности последовательностей нуклеиновых кислот, кодирующих вариант белка при ожирении и/или диабете, или фрагменту такой последовательности, что достаточно для ингибирования продукции белкового продукта. Технологии антисмысловых последовательностей можно применять также для ингибирования экспрессии одного варианта по сравнению с другим или ингибирования экспрессии варианта(ов) по сравнению с исходной последовательностью.

Возвращаясь теперь к первому аспекту изобретения, т.е. экспрессии вариантов при ожирении и/или диабете, экспрессию вариантов продуктов при ожирении и/или диабете можно увеличить доставкой кодирующих последовательностей для кодирования указанных выше вариантов продуктов при ожирении и/или диабете под контроль подходящих контрольных элементов, останавливающих их экспрессию в желаемом хозяине.

Последовательности нуклеиновых кислот по изобретению можно применять в сочетании с подходящим фармацевтическим носителем. Такие композиции включают в себя терапевтически эффективное количество соединения и фармацевтически приемлемый носитель или наполнитель. Такой носитель включает в себя в качестве неограничивающих примеров солевой раствор, буферный солевой раствор, глюкозу, воду, глицерин, этанол и их сочетания. Состав должен соответствовать способу введения.

Продукты по изобретению можно применять также в соответствии с настоящим изобретением посредством экспрессии таких полипептидов in vivo, на что часто ссылаются как на «генную терапию». Клетки от пациента можно модифицировать последовательностью нуклеиновой кислоты (ДНК или РНК), кодирующей полипептид ex vivo, с доставкой модифицированных клеток пациенту для лечения полипептидом. Такие способы хорошо известны в данной области. Например, клетки можно модифицировать посредством процедур, известных в данной области, с применением ретровирусных частиц, содержащих РНК, кодирующую полипептид по настоящему изобретению.

Подобным образом клетки можно модифицировать in vivo для экспрессии полипептида in vivo посредством процедур, известных в данной области. Как известно в данной области, клетку-продуцент для продукции ретровирусных частиц, содержащих РНК, кодирующую полипептиды по настоящему изобретению, можно ввести пациенту для модификации клеток in vivo и экспрессии полипептида in vivo. Эти и другие способы введения продуктов по настоящему изобретению посредством таких способов должны быть очевидны специалистам в данной области из объяснений в настоящем изобретении. Например, экспрессирующий вектор для модификации клеток может быть отличным от ретровируса, например аденовирусом, который можно применять для модификации клеток in vivo в сочетании с подходящим носителем для доставки.

Ретровирусы, от которых можно производить ретровирусные плазмидные векторы, упомянутые выше, включают в себя в качестве неограничивающих примеров вирус мышиного лейкоза Молони, вирус некроза селезенки, ретровирусы, такие как вирус саркомы Рауса, вирус саркомы мышей Харви, вирус лейкоза птиц, вирус лейкоза гиббонов, вирус иммунодефицита человека, аденовирус, вирус миелопролиферативной саркомы и вирус опухоли молочной железы.

Ретровирусные плазмидные векторы применяют для трансдукции линий упаковывающих клеток для получения линий клеток-продуцентов. Примеры упаковывающих клеток, которые можно трансфицировать, включают в себя в качестве неограничивающих примеров линии клеток PE501, PA317, psi-2, psi-AM, PA12, T19-14X, VT-19-17-H2, psi-CRE, psi-CRIP, GP+E-86, GP+envAm12 и DAN, как описано у Miller (Human Gene Therapy, Vol.1, pp.5-14, (1990)). Упаковывающие клетки можно трансдуцировать вектором посредством любых способов, известных в данной области. Такие способы включают в себя в качестве неограничивающих примеров электропорацию, применение липосом и преципитацию CaPO4. В качестве одной из альтернатив ретровирусный плазмидный вектор можно инкапсулировать в липосому или присоединить к липиду и затем ввести хозяину.

Линия клеток-продуцентов производит инфекционные ретровирусные векторные частицы, включающие в себя последовательность(и) нуклеиновой кислоты, кодирующие полипептиды. Такие ретровирусные векторы можно применять для трансдукции эукариотических клеток как in vitro, так и in vivo. Трансдуцированные эукариотические клетки экспрессируют последовательность(и) нуклеиновой кислоты, кодирующие полипептид. Эукариотические клетки, которые можно трансдуцировать, включают в себя в качестве неограничивающих примеров эмбриональные стволовые клетки, клетки эмбриональной карциномы, так же как гематопоэтические стволовые клетки, гепатоциты, фибробласты, миобласты, кератиноциты, эндотелиальные клетки и клетки бронхиального эпителия.

Гены, вводимые в клетки, можно помещать под контроль индуцируемых промоторов, таких как индуцируемый облучением промотор Egr-1 (Maceri, H. J.,et al., Cancer Res. 56 (19):4311 (1996)), для стимулирования продукции варианта или антисмыслового ингибирования в ответ на облучение, например лучевую терапию для лечения опухолей.

Варианты продуктов при ожирении и/или диабете

В значительной степени очищенный вариант продукта при ожирении и/или диабете по изобретению определен выше как продукт, кодируемый последовательностью нуклеиновой кислоты по изобретению. Аминокислотная последовательность предпочтительнее представляет собой последовательность, по меньшей мере на 90% идентичную последовательности, идентифицированной как SEQ ID NO:23 - SEQ ID NO:25, или SEQ ID NO:27 - SEQ ID NO:30, или SEQ ID NO:32, или SEQ ID NO:34 - SEQ ID NO:39, или SEQ ID NO:41 - SEQ ID NO:42. Белок или полипептид может присутствовать в зрелой и/или модифицированной форме, так же как определено выше, например, быть модифицированным отщеплением лидирующей последовательности. Также рассматривают фрагменты белка, имеющие по меньшей мере 5 смежных аминокислотных остатков, предпочтительнее по меньшей мере 5-20 остатков, производных от вариантов продуктов при ожирении и/или диабете, так же как их гомологи, как объяснено выше.

Предпочтительнее варианты последовательности, подразумевающие консервативные замены, как определено выше. Так, например, белок с последовательностью по меньшей мере на 90% идентичной последовательности продуктов, идентифицированных как SEQ ID NO:23 - SEQ ID NO:25, или SEQ ID NO:27 - SEQ ID NO:30, или SEQ ID NO:32, или SEQ ID NO:34 - SEQ ID NO:39, или SEQ ID NO:41 - SEQ ID NO:42, предпочтительно с использованием консервативных замен, как определено выше, также является частью изобретения и в том случае, если он не идентичен исходному полипептиду, вариантом которого он является (как правило, замены находятся в областях, где вариант отличается от исходной последовательности, как, например, в таблице 1). В более конкретном варианте осуществления белок имеет или содержит последовательность, идентифицируемую SEQ ID NO:23 - SEQ ID NO:25, или SEQ ID NO:27 - SEQ ID NO:30, или SEQ ID NO:32, или SEQ ID NO:34 - SEQ ID NO:39, или SEQ ID NO:41 - SEQ ID NO:42. Варианты продуктов при ожирении и/или диабете могут представлять собой (i) продукт, в котором один или несколько аминокислотных остатков в последовательности, перечисленной выше, заменен консервативным или неконсервативным аминокислотным остатком (предпочтительнее консервативным аминокислотным остатком), или (ii) продукт, в котором один или несколько аминокислотных остатков включает в себя замещающую группу, или (iii) продукт, в котором варианты продуктов при ожирении и/или диабете соединены с другим веществом, таким как вещество для увеличения полужизни белка (например, полиэтиленгликоль (PEG)), или группа, служащая для способов прицеливания для направления белка к его ткани-мишени или популяции клеток-мишени (такая, как антитело), или (iv) продукт, в котором к варианту продукта при ожирении и/или диабете присоединены дополнительные аминокислоты. Такие фрагменты, варианты и производные по объяснениям отсюда считаются входящими в сферу деятельности специалистов в данной области.

A. Получение вариантов продуктов ожирения и/или диабета

Рекомбинантные способы для получения и очистки вариантов продуктов при ожирении и/или диабете и фрагментов белка описаны выше.

В дополнение к рекомбинантной продукции фрагменты и части вариантов продуктов можно получать прямым синтезом пептидов с применением твердофазных способов (сравни Stewart et al., (1969) Solid-Phase Peptide Synthesis, WH Freeman Co, San Francisco; Merrifield J., J.Am. Chem. Soc. 85:2149-2154 (1963)). Синтез пептидов in vitro можно проводить с применением ручных способов или автоматически. Автоматический синтез можно выполнять, например, с применением пептидного синтезатора Applied Biosystems 431A (Perkin Elmer, Foster City, Calif.) в соответствии с инструкциями, предусмотренными производителем. Фрагменты вариантов продуктов при ожирении и/или диабете можно химически синтезировать отдельно и объединять с применением химических способов для получения полноразмерной молекулы.

B. Терапевтические применения и композиции, применяющие варианты продуктов ожирения и/или диабета

Варианты продуктов ожирения и/или диабета по изобретению, как правило, полезны для лечения ожирения и/или диабета.

Варианты или фрагменты продуктов при ожирении и/или диабете можно вводить любым числом путей и способов, предназначенных для доставки постоянной и предсказуемой концентрации соединения к органу или ткани-мишени. Содержащие продукт композиции можно вводить отдельно или в сочетании с другими средствами, такими как стабилизирующие соединения, и/или в сочетании с другими фармацевтическими средствами, такими как лекарственные средства или гормоны.

Композиции, содержащие варианты продуктов при ожирении и/или диабете, можно вводить множеством способов, включающих в себя в качестве неограничивающих примеров пероральный, внутривенный, внутримышечный, чрескожный, подкожный, местный, сублингвальный или ректальный способы, так же как назальное применение. Композиции, содержащие вариант продукта ожирения и/или диабета, можно вводить также посредством липосом. Такие пути введения и подходящие препараты, как правило, известны специалистам в данной области.

Варианты продуктов ожирения и/или диабета можно вводить посредством внутривенной или интраперитонеальной инъекции. Подобным образом, продукт можно инъецировать в другие локализованные области тела. Продукт можно вводить также посредством назального вдувания. Возможно также кишечное введение. Для такого введения продукт должен быть получен в форме подходящей капсулы или эликсира для перорального введения или в форме суппозитория для ректального введения.

Вышеизложенные примерные способы введения, вероятно, требуют, чтобы продукт был получен в форме подходящего носителя, включая, например, мази, гели или суппозитории. Подходящие препараты хорошо известны специалистам в данной области.

Дозировку продукта изменяют в зависимости от активности и терапевтического индекса конкретного выбранного полипептида.

Терапевтическая композиция для применения по способу лечения может включать в себя продукт в стерильном растворе для инъекций, полипептид на носителе для перорального введения, продукт в аэрозоле, пригодном для назального введения, или продукт в нераспыляемой форме, все приготовленные хорошо известными способами. Такие композиции включают в себя терапевтически эффективные количества соединения и фармацевтически приемлемый носитель или наполнитель. Такой носитель включает в себя в качестве неограничивающих примеров солевой раствор, буферный солевой раствор, глюкозу, воду, глицерин, этанол и их сочетания. Продукт по изобретению можно использовать также, чтобы модулировать дифференцировку и пролиферацию эндотелия, так же как модулировать апоптоз ex vivo или in vitro, например, в культурах клеток.

Антитела к вариантам

A. Синтез

В еще одном аспекте изобретения очищенные варианты продуктов применяют для производства антител к вариантам, имеющих диагностические и терапевтические применения, связанные с активностью, распространением и экспрессией вариантов продуктов при ожирении и/или диабете.

Антитела к варианту при ожирении и/или диабете можно получить способами, хорошо известными в данной области. Такие антитела могут включать в себя в качестве неограничивающих примеров поликлональные, моноклональные, химерные, гуманизированные, одноцепочечные, Fab-фрагменты и фрагменты, полученные из Fab-экспрессирующей библиотеки. Антитела, т.е. те, которые ингибируют формирование димеров, являются особенно предпочтительными для терапевтического применения.

Фрагмент варианта продукта при ожирении и/или диабете для индукции антител не обязательно характеризуется биологической активностью, но должен характеризоваться иммунологической активностью; однако фрагмент белка или олигопептид должен быть антигенным. Пептиды, применяемые для индукции специфических антител, могут обладать аминокислотной последовательностью, состоящей по меньшей мере из пяти аминокислот, предпочтительнее, по меньшей мере, из 10 аминокислот из последовательностей, представленных на SEQ ID NO:23 - SEQ ID NO:25, или SEQ ID NO:27 - SEQ ID NO:30, или SEQ ID NO:32, или SEQ ID NO:34 - SEQ ID NO:39 или SEQ ID NO:41 - SEQ ID NO:42. Предпочтительнее они должны имитировать часть аминокислотной последовательности природного белка и могут содержать полную аминокислотную последовательность небольшой природной молекулы. Короткие участки аминокислот вариантов продуктов при ожирении и/или диабете можно присоединять к участкам другого белка, такого как гемоцианин морского блюдечка, и получать антитела к химерной молекуле. Для получения антител к вариантам продуктов при ожирении и/или диабете можно применять процедуры, хорошо известные в данной области.

Для получения антител различных хозяев, включая коз, кроликов, крыс, мышей и т.д., можно иммунизировать инъекцией вариантов продуктов при ожирении и/или диабете или любой их части, фрагмента или олигопептида, сохраняющего иммуногенные свойства. В зависимости от видов-хозяев можно применять различные адъюванты. Такие адъюванты включают в себя в качестве неограничивающих примеров адъювант Фрейнда; минеральные гели, такие как гидроокись алюминия, и поверхностно-активные вещества, такие как лизолецитин, плюрониловые полиолы, полианионы, пептиды, масляные эмульсии, гемоцианин морского блюдечка и динитрофенол. BCG (бацилла Калметта - Герена) и Corynebacterium parvum являются потенциально полезными адъювантами для человека.

Моноклональные антитела к вариантам белка при ожирении и/или диабете можно получить с применением любого способа, предусмотренного для получения молекул антител посредством постоянной линии клеток в культуре. Они включают в себя в качестве неограничивающих примеров способ гибридомы, первоначально описанный Koehler и Milstein (Nature 256:495-497 (1975)), способ гибридомы B-клеток человека (Kosbor et al., Immunol. Today 4:72 (1983); Cote et al., Proc. Natl. Acad. Sci. USA 80:2026-2030 (1983)) и способ EBV-гибридомы (Cole, et al., Mol. Cell Biol 62:109-120 (1984)).

Можно применять также способы, разработанные для получения «химерных антител», сплайсинг генов антител мыши с генами антител человека для получения молекулы с соответствующей антигенной специфичностью и биологической активностью (Morrison et al., Proc. Natl. Acad. Sci. USA 81:6851-6855 (1984); Neuberger et al., Nature 312:604-608 (1984); Takeda et al., Nature 314:452-454 (1985)). В качестве альтернативы, способы, описанные для получения одноцепочечных антител (U.S. Pat. № 4946778), можно адаптировать для получения одноцепочечных антител, специфических для варианта белка.

Антитела можно получить также индукцией продукции in vivo в популяции лимфоцитов или скринингом библиотек рекомбинантных иммуноглобулинов или панелей высокоспецифичных связывающих реагентов, как описано у Orlandi et al. (Proc. Natl. Acad. Sci. USA 86:3833-3837 (1989)) и Winter G and Milstein C. (Nature 349:293-299 (1991)).

Можно получить фрагменты антител, содержащие специфические сайты связывания для варианта белка при ожирении и/или диабете. Например, такие фрагменты включают в себя в качестве неограничивающих примеров F(ab')2-фрагменты, которые можно получить расщеплением молекулы антитела пепсином, и Fab-фрагменты, которые можно получить восстановлением дисульфидных мостиков F(ab')2-фрагментов. В качестве альтернативы, можно конструировать Fab-экспрессирующие библиотеки, позволяющие быструю и простую идентификацию моноклональных Fab-фрагментов с желаемой специфичностью (Huse W. D. et al., Science 256:1275-1281 (1989)).

B. Варианты диагностического применения антител

Множество протоколов конкурентного связывания или иммунорадиометрических анализов с применением поликлональных или моноклональных антител с установленными специфичностями хорошо известны в данной области. Такие иммунологические анализы, как правило, включают в себя формирование комплексов между вариантами продуктов при ожирении и/или диабете и измерение формирования комплекса. Предпочтительным является двухслойный иммунологический анализ с применением моноклональных антител, отвечающих двум не мешающим друг другу эпитопам специфического варианта продукта, но можно применять также анализ конкурентного связывания. Такие анализы описаны у Maddox D. E., et al. (J. Exp. Med. 158:1211 (1983)).

Антитела, специфически связывающие вариант продукта при ожирении и/или диабете, полезны для диагностики состояний или заболеваний, характеризующихся экспрессией новых вариантов при ожирении и/или диабете по изобретению (где в норме они не экспрессированы), повышенной или пониженной экспрессией вариантов при ожирении и/или диабете, так же как для детекции заболеваний, при которых изменено соотношение между количеством вариантов при ожирении и/или диабете по изобретению и исходной последовательностью, от которой они отличаются. В качестве альтернативы, такие антитела можно применять в анализах для мониторинга пациентов, прошедших лечение вариантами продуктов при ожирении и/или диабете. Диагностические анализы вариантов белков включают в себя способы, применяющие антитела и метку для детекции вариантов продуктов в жидкостях организма человека или экстрактах клеток или тканей. Продукты и антитела по изобретению можно применять с модификацией и без. Часто белки и антитела метят присоединением к ним, ковалентно или нековалентно, репортерной молекулы. Широкий ассортимент репортерных молекул хорошо известен в данной области.

Множество протоколов для измерения вариантов продуктов при ожирении и/или диабете с применением поликлональных или моноклональных антител, специфических к соответствующему белку, известны в данной области. Примеры включают в себя твердофазный иммуносорбентный анализ (ELISA), радиоиммуноанализ (RIA), активизированную флюоресценцией сортировку клеток (FACS). Как указано выше, предпочтительным является двухслойный иммунологический анализ на моноклональной основе с применением моноклональных антител, отвечающих двум не мешающим друг другу эпитопам вариантов продуктов ожирения и/или диабета, но можно применять также анализ конкурентного связывания. Такие анализы описаны, среди других мест, в Maddox, et al. (выше). Такие протоколы предоставляют основу для диагностики измененных или аномальных уровней экспрессии вариантов продуктов при ожирении и/или диабете. Нормальные или стандартные величины экспрессии вариантов продуктов при ожирении и/или диабете устанавливают посредством объединения жидкостей организма или экстрактов клеток, отобранных у нормальных субъектов, предпочтительнее человека, с антителами к вариантам продуктов при ожирении и/или диабете в условиях, подходящих для формирования комплексов, которые хорошо известны в данной области. Степень формирования стандартных комплексов можно определить количественно различными способами, предпочтительнее фотометрическими способами. Затем стандартные значения, полученные для нормальных образцов, можно сравнить со значениями, полученными для образцов от субъектов, потенциально пораженных заболеванием. Расхождение между стандартным значением и значением для субъекта определяет присутствие состояния заболевания.

Анализы антителами полезны для определения уровня вариантов продуктов при ожирении и/или диабете в образце жидкости организма, чтобы определить, экспрессированы ли они вообще, повышена или понижена их экспрессия в ткани, или как определение того, как уровни вариантов изменяемых продуктов при ожирении и/или диабете отвечают на лечение лекарственными средствами.

C. Терапевтические применения антител

В дополнение к их диагностическому применению антитела имеют терапевтическую пользу для блокирования или уменьшения активности вариантов продуктов ожирения и/или диабета в патологических условиях, где таким уменьшением можно достичь благоприятного воздействия.

Применяемое антитело предпочтительнее представляет собой гуманизированное моноклональное антитело или человеческое МАТ, полученное известными способами из библиотеки генов глобулинов. Антитело вводят, как правило, в виде стерильного раствора внутривенной инъекцией, хотя могут быть пригодными другие парентеральные пути. Как правило, антитело вводят в количестве примерно от 1 до 15 мг/кг массы тела субъекта. Лечение продолжают, например, с дозированием каждые 1-7 дней, пока не наблюдают терапевтического улучшения.

Хотя изобретение описано в отношении конкретных способов и вариантов осуществления, подразумевается, что различные модификации и изменения можно сделать без отклонения от изобретения.

Пример 1 - Разделение

Клетки Sf-9 инфицировали бакуловирусом, экспрессирующим варианты при ожирении и/или диабете (AC-вариант при ожирении и/или диабете), содержащий аминокислотную последовательность SEQ ID NO:23 - SEQ ID NO:25, или SEQ ID NO:27 - SEQ ID NO:30, или SEQ ID NO:32, или SEQ ID NO:34 - SEQ ID NO:39, или SEQ ID NO:41 - SEQ ID NO:42 при MOI 2. Клетки растили при 28°C при постоянном покачивании (90 об/мин). Через 60 часов после инфекции (hpi) среду собирали и клетки отделяли от среды центрифугированием при 5000 об/мин в течение 5 минут. 10 мл среды разделяли с применением катионообменной хроматографии на колонке с SP-сефарозой. Колонку уравновешивали PBS pH 6,5 и после нанесения на колонку образца колонку промывали PBS для элюции несвязавшихся белков (фракция проскока). Элюцию проводили увеличивающейся концентрацией NaCI при скорости потока 2 мл/мин (5% NaCI/мин).

Разные фракции подвергали электрофорезу в SDS-PAGE и вестерн-блоттингу с применением антител к варианту при ожирении и/или диабете.

Пример 2 - Секреция

Клетки Sf-9 инфицировали бакуловирусом, экспрессирующим варианты ожирения и/или диабета (Ас-вариант при ожирении и/или диабете) при MOI 2. Клетки растили при 28°С при постоянном покачивании (90 об/мин) и образцы по 1 мл среды собирали через 24, 48 и 60 часов после инфекции (hpi). После центрифугирования осадки клеток лизировали буфером для лизиса (50 мМ Tris pH 7,5, 1% Тритон Х100 и коктейль ингибиторов протеаз) 30 мин при 4°С и 30 секунд разрушали ультразвуком. Образец центрифугировали 10 минут при 14000 об/мин и супернатант обозначали «осадок». 40 мкл приготовленного «осадка» и среды (обозначаемой «среда») смешивали с буфером для нанесения и подвергали электрофорезу в 15% SDS-PAGE. После электрофореза гель подвергали полусухому переносу белков на нитроцеллюлозную мембрану. Мембрану инкубировали 2 часа с антителом к вариантам при ожирении и/или диабете и дополнительно 1 час с вторичными антителами к кроличьим антителам.

Детекцию сигнала осуществляли с применением коммерческого набора для детекции Вестерн-блоттинга.

Пример 3 - In vivo эксперимент

Эксперимент проводили на взрослых самцах мышей 12982/SvHsd ("мыши 129Sv"). Анализируемыми соединениями, которые использовали в экспериментах, были последовательность SEQ ID NO:32 сплайсинг-варианта грелина человека и известный грелин человека (Lot No.3000182, ВАСНЕМ), который использовали в качестве контроля. Также в качестве общего контроля использовали носитель (1,6% маннитол).

Эксперименты были разработаны для анализа эффективности последовательности SEQ ID NO:32 сплайсинг-варианта грелина.

Исследуемую последовательность и контрольные соединения вводили слепым методом один раз в сутки в течение пяти последовательных дней (дни 0-4). Введение осуществляли подкожной инъекцией поочередно в левую и правую части дорзальную части туловища мыши.

Единственным значительным различием в экспериментальной процедуре между экспериментами по настоящей заявке и экспериментами, описанными в статье Tschop et al., является то, что мышам вводили 20 мкг соответствующих исследуемых соединений, а в статье Tschop et al. вводили 200 мкг. Использование низких доз в данном случае было обусловлено данными ранее опубликованных экспериментов, проведенных несколькими исследовательскими группами: Wren А. М., et al. Endocrinology 141:4325-28 (2000); Asakawa A et al. Gut 52:947-52 (2003); and Sun Y. et al., Proc. Natl. Acad. Sci. USA 101:4679-84 (2004); копии которых также приложены к настоящему документу.

Путь введения, частота введения и длительность введения полностью соответствуют пути, частоте и длительности, как описано в статье Tschop et al. Определение массы каждого животного осуществляли раз в сутки во время периода наблюдения утром, приблизительно в одно и тоже время. Измерение массы осуществляли последовательно в соответствии с номером животного. Ежедневные измерения потребления пищи делали приблизительно в течение 24-часого периода. Определение потребления пищи основаны на вычитании неиспользованной пищи из количества, находившегося в кормушке. Измерение потребления пищи осуществляли последовательно в соответствии с номером животного.

Оценку возможного эффекта SEQ ID NO:32 грелина человека и контрольного грелина сначала основывали на сходном и сравнимом измерении массы тела и потребления пищи, значения которых выражали усредненно для каждой анализируемой группы, получавшей исследуемое соединение, по сравнению с группой, получавшей носитель. Статистический анализ осуществляли, используя двухсторонний тест Стьюдента.

Общее увеличение массы у мышей 129Sv, получавших SEQ ID NO:32, было значительно ниже (р=0,007), чем у мышей, получавших контроль с носителем. Напротив, значительных различий (р>0,05) не было отмечено у мышей 129Sv, получавших известный грелин и контроль.

Общее потребление пищи у мышей 129Sv, получавших SEQ ID NO:32, было значительно ниже (р=0,0079) по сравнению с мышами, получавшими контроль с носителем. Напротив, не было отмечено значительных различий (р>0,05) в общем приеме пищи у мышей 129Sv, получавших известный грелин и носитель.

Таким образом, SEQ ID NO:32 значительно усиливает потерю массы тела и снижает потребление пищи, причем известный грелин не оказывает значительного влияния на массу тела и потребление пищи.

Пример 4 - Количественный RT-PCR для образцов РНК человека и клонирование полученного продукта, получение последовательности SEQ ID NO:11 и ее характеристика

Был осуществлен ПЦР одного образца геномной ДНК человека, количественная RT-ПЦР образцов РНК человека и клонирование определенного кДНК фрагмента в клонирующий вектор pGEM-T (Promega).

ПЦР проводили на образце геномной ДНК человека для тестирования качества праймеров. Реакцию проводили с использованием 2 наборов праймеров и 2 концентраций геномной ДНК.

Таблица 3
Праймеры
Праймеры
F1 GTCTGCAGCCTCCTGCTC
F2 CATGCTCTGGCTGGACTTG
R CCGGACTTCCAGTTCATCCT
Таблица 4
ПЦР для геномной ДНК
Компонент Конц. мкл на 25 мкл реакционной смеси
F1 или F2 10 мкМ 0,5
R 10 мкМ 0,5
dNTP 10 мкМ 0,5
10×В (3) 2,5
Quick load 2,5
H2O 17,25
Expand 0,25

Условия ПЦР: 94°С - 2 мин; 95°С - 1 мин; 58°С - 45 с; 68°С - 1 мин; 68°С - 7 мин; Либо 50, либо 500 нг геномной ДНК человека (50 нг/мкл) использовали в качестве матрицы для реакций ПЦР. Результаты представлены на фигуре 18.

Результаты ПЦР для геномной ДНК человека: для пары праймеров F2/R была получена одна специфическая полоса. Таким образом, ожидаемая длина продуктов F1 + R составила 407 п.о., а F2 + R составила 378 п.о.

Количественная RT-ПЦР: кДНК получали из образцов РНК после обработки ДНКазой и качество образцов тестировали с использованием праймеров для GapdH.

Таблица 5
Экспериментальные образцы
Кат. no. (Stratagene) Ткань конц. (мкг/мкл) 5 мкг
1 540013 Почки (Kid) 0,9 5,6
2 540023 Поджелудочная железа (Pane) 1 5,0
3 540037 Желудок (Sto) 0,9 5,6
4 540131 Двенадцатиперстная кишка (Duo) 0,9 5,6
5 540025 Плацента (Р1а) 1 5,0
Кат.no. (Clontech)
6 6254-1 ро1уА+из легкого (Lng) 1 0,5 мкг

Препараты РНК обрабатывали ДНКазой I для удаления следов геномной ДНК и синтезировали 1-ю цепь кДНК (для использования в качестве матрицы для амплификации PCR) с использованием для каждого образца количеств 5 мкг тотальной РНК или 0,5 мкг polyA + РНК, как в таблице 3, для синтеза 1-й цепи кДНК.

Синтез 1-й цепи проводили с использованием праймеров олиго dT и набора для обратной транскриптазы Invitrogen Superscript II. Для каждого образца РНК реакцию проводили с ферментом и без для оценки качества матрицы.

Таблица 6
Амплификация фрагмента GapdH в геномной ДНК человека для оценки качества матрицы
Компонент Конц. мкл на 25 мкл реакционной смеси
GapDH5' 10 мкМ 0,5
GapDH 3' 10 мкМ 0,5
dNTP 10 мкМ 0,5
10×В (3) 2,5
Quick load 2,5
H2O 17,25
Expand 0,25

Условия ПЦР: 9 4°С - 2 мин; 95°С - 1 мин; 58°С - 45 с; 68°С - 1 мин; 68°С - 7 мин;

Результаты ПЦР с использованием праймеров для GapDH: На фигуре 19 представлены образцы 1-6 (нумерация соответствует таблице 3) и показаны «+» и «-» RT. Образец 7 представляет собой 10 нг геномной ДНК, а образцы 8-11 представляют собой 4 образца кДНК А172, 2 необработанных, один после обработки 4 час и один после обработки 16 час. Различия в образцах 8 и 10 могут быть обусловлены различным качеством исходной РНК. Образец 11 используют в дальнейшем. Используемые маркеры представляют собой лестницу по 1 т.п.о. от Invitrogen и лестницу по 100 п.н. от NEB.

Таблица 7
Амплификация специфического фрагмента в образцах кДНК
Компонент Конц. мкл на 50 мкл реакционной смеси
Праймер F2 10 мкМ 1
Праймер R 10 мкМ 1
dNTP 10 мкМ 1
10×В (3) 5
Quick load 5
H2O 34,5
Expand 0,5

В этой реакции использовали общий объем реакционной смеси 50 мкл для получения достаточного количества продукта для элюции из геля для очистки для секвенирования и клонирования.

Условия ПЦР: 94°С - 2 мин; 95°С - 1 мин; 58°С - 45 с; 68°С - 1 мин; 68°С - 7 мин

На фигуре 20 представлены результаты ПЦР с использованием специфических праймеров (нумерация образцов соответствует фигуре 19). Ожидаемая длина продуктов: длинный вариант - 378 п.о.; короткий вариант - 184 п.о. Для образцов 1 (почки) и 5 (плацента) было показано достаточное количество ожидаемого продукта. Эти 2 образца разделяли в 2% агарозном геле и фрагмент 380 п.о. очищали с использованием колонки Geneclean turbo.

На фигуре 21 показан агарозный гель, в котором разделяли 1 мкл очищенного продукта против различных количеств разведения 1:10 низкомолекулярного маркера молекулярной массы Invitrogen. Затем 200 нг продукта кДНК почек посылали на анализ секвенированием. Анализ секвенированием подтвердил идентичность продукта 400 п.о. (последовательность дана на фигуре 22).

На фигуре 23 представлено сравнение с помощью множественного выравнивания последовательностей (MSA) с последовательностями гена грелина человека (gi-37183223) и с вариантом EST человека (gi-12327129).

Подтвержденный фрагмент 400 п.о., полученный из почек человека, лигировали с вектором pGEM-T с использованием набора для клонирования ТА Promega. Продуктами лигирования трансформировали компетентные клетки штамма E.coli DН5-альфа.

Положительные колонии идентифицировали посредством PCR с колоний для 10 случайно выбранных колоний трансформанта с использованием коммерческих праймеров SP6 и Т7.

Одну положительную колонию выделяли. Из нее выделяли плазмидную ДНК и посылали для анализа секвенированием. Анализом секвенированием показали полное совпадение с желаемой последовательностью.

На фигуре 24 показана последовательность вставки, клонированная в pGEM-T (клон рТ103-2) = pGEM-T-tsk103-вставка 400 п.о.

На фигуре 25 показано сравнение вставки в pGEM-T с геном грелина человека и с соответствующей EST.

На фигуре 26 дана нуклеотидная последовательность рТ103-2 (pGEM-T-tsk103- вставка 400 п.о.).

На фигуре 27 приведена схема вектора рТ103-2.

Пример 5 - Выделение и секвенирование промежуточного (~350 п.о.) продукта ПЦР (фиг.20, образец 4)

Фрагмент вырезали из 2% агарозного геля и посылали на анализ секвенированием.

На фигуре 28 дана хроматограмма секвенирования промежуточного продукта, показывающая, что он, наиболее вероятно, представляет собой смесь более одного продукта.

1. Выделенная молекула нуклеиновой кислоты, кодирующая сплайсинг-вариант предшественника грелина, характеризующаяся последовательностью SEQ ID NO:11 или комплементарной ей последовательностью.

2. Фрагмент молекулы нуклеиновой кислоты, который является праймером или зондом и состоит по меньшей мере из 17 оснований, соответствующих кодирующему участку выделенной молекулы нуклеиновой кислоты по п.1, при этом участок содержит нуклеотиды, отличающие вариант с последовательностью SEQ ID NO:11 от природной последовательности SEQ ID NO:10.

3. Выделенный белок, который регулирует прием пищи и который характеризуется последовательностью SEQ ID NO:32, или его активный фрагмент, включающий область различий между SEQ ID NO:32 и SEQ ID NO:31.

4. Фармацевтическая композиция для лечения ожирения и/или диабета, содержащая терапевтически эффективное количество нуклеиновой кислоты по п.1 и фармацевтически приемлемый носитель.

5. Фармацевтическая композиция для лечения ожирения и/или диабета, содержащая терапевтически эффективное количество выделенного белка или его активного фрагмента по п.3 и фармацевтически приемлемый носитель.

6. Применение нуклеиновой кислоты по п.1 для получения лекарственного средства для лечения ожирения и/или диабета.

7. Применение выделенного белка или его активного фрагмента по п.3 для получения лекарственного средства для лечения ожирения и/или диабета.



 

Похожие патенты:

Изобретение относится к биотехнологии, конкретно к получению гормонов, и может быть использовано в разведении беспозвоночных. .

Изобретение относится к области генной инженерии и биотехнологии и может быть использовано в медицине и фармацевтической промышленности. .

Изобретение относится к иммунобиотехнологии и касается новых моноклональных антител, способов их получения с использованием гибридомной технологии и осУр3-интегрина или витронектина в качестве антигена, полипептидов, представляющих легкую и тяжелую цепи антител и ДНК, кодирующие эти полипептиды.

Изобретение относится к медицинской биотехнологии и касается получения моноклональных антител (монАТ) и его фрагментов с использованием гибридомы FERM BR-4382, которая продуцирует упомянутое антитело.

Изобретение относится к биотехнологии, в частности к генной и белковой инженерии. .

Изобретение относится к биотехнологии и представляет собой применение киРНК, способной ингибировать экспрессию 11бета-стероидной дегидрогеназы 1 (11beta-HSD1), для получения лекарственного средства для лечения глазной болезни, отличающейся изменением внутриглазного давления (ВГД).

Изобретение относится к биотехнологии и представляет собой новые эндо-(1-4)- -D-ксиланазы мицелиального гриба Penicillium canescens. .

Изобретение относится к выделенному вирусу растений, названному вирус томата торрадо (ToTV), и его компонентам, а также к способам получения устойчивых к ToTV растений. .

Изобретение относится к области биотехнологии и медицины, а именно к прямым ингибиторам тромбина. .

Изобретение относится к области генетической инженерии и может быть использовано в практических целях для ингибирования в клетках продукции целевых белков. .

Изобретение относится к области молекулярной биологии и генной терапии. .

Изобретение относится к биотехнологии, в частности к области модификации гликозилирования белков. .

Изобретение относится к биотехнологии. .
Наверх