Ингибиторы активности акт



Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт
Ингибиторы активности акт

 


Владельцы патента RU 2421454:

МЕРК ШАРП ЭНД ДОМЭ КОРП. (US)

Описываются новые замещенные нафтиридина общей формулы Е:

(значения радикалов R1 и R3 приведены в формуле изобретения), их фармацевтически приемлемые соли, фармацевтическая композиция, их содержащая, и применение новых соединений для получения лекарственного средства, применимого для лечения или профилактики злокачественной опухоли у млекопитающего. Данные соединения ингибируют активность Akt, в частности избирательно ингибируют одну или две изоформы Akt, и могут найти применение в медицине. 5 н.п. ф-лы, 14 табл.

 

Уровень техники

Изобретение относится к замещенным соединениям нафтиридина, которые являются ингибиторами активности одной или нескольких изоформ сериновой/треониновой киназы, Akt (также называемой PKB; в дальнейшем называемой «Akt»). Настоящее изобретение также относится к фармацевтическим композициям, содержащим такие соединения, и способам применения таких соединений для лечения злокачественной опухоли.

Апоптоз (запрограммированная гибель клеток) играет важные роли в эмбриональном развитии и патогенезе различных заболеваний, таких как дегенеративные заболевания нервной системы, сердечно-сосудистые заболевания и злокачественная опухоль. Недавно проведенная работа привела к идентификации различных продуктов про- и противоапоптозных генов, которые вовлечены в регуляцию или осуществление запрограммированной гибели клеток. Экспрессия противоапоптозных генов, таких как Bcl2 или Bcl-xL, ингибирует апоптозную гибель клеток, индуцированную различными стимулами. С другой стороны, экспрессия проапоптозных генов, таких как Bax или Bad, приводит к запрограммированной гибели клеток (Adams et al. Science, 281: 1322-1326 (1998)). Осуществление запрограммированной гибели клеток опосредовано протеиназами, родственными каспазе-1, включая каспазу-3, каспазу-7, каспазу-8 и каспазу-9, и т.д. (Thornberry et al. Science, 281: 1312-1316 (1998)).

Путь фосфатидилинозитол-3'-OH-киназы (PI3K)/Akt по-видимому играет важную роль в регуляции жизнеспособности клеток/гибели клеток (Kulik et al. Mol. Cell. Biol. 17: 1595-1606 (1997); Franke et al, Cell, 88: 435-437 (1997); Kauffmann-Zeh et al. Nature 385: 544-548 (1997) Hemmings, Science, 275: 628-630 (1997); Dudek et al., Science, 275: 661-665 (1997)). Факторы жизнеспособности, такие как полученный из тромбоцитов фактор роста (PDGF), фактор роста нервов (NGF) и инсулиноподобный фактор роста-1 (IGF-I), повышают жизнеспособность клеток в различных условиях посредством индукции активности PI3K (Kulik et al. 1997, Hemmings 1997). Активированная PI3K приводит к продукции фосфатидилинозитол-(3,4,5)-трифосфата (Ptdlns(3,4,5)-P3), который, в свою очередь, связывается и стимулирует активацию сериновой/треониновой киназы Akt, которая содержит домен гомологии с плекстрином (PH) (Franke et al., Cell, 81: 727-736 (1995); Hemmings Science, 277: 534 (1997); Downward, Curr. Opin. Cell Biol. 10: 262-267 (1998), Alessi et al., EMBO J. 15: 6541-6551 (1996)). Специфичные ингибиторы PI3K или доминантные негативные мутанты Akt подавляют повышающие жизнеспособность активности указанных факторов роста или цитокинов. Ранее было выявлено, что ингибиторы PI3K (LY294002 или вортманнин) блокировали активацию Akt киназами, расположенными в каскаде выше. Кроме того, введение конститутивно активных мутантов PI3K или Akt стимулирует жизнеспособность клеток в условиях, в которых в норме клетки подвергаются гибели вследствие апоптоза клеток (Kulik et al. 1997, Dudek et al. 1997).

Идентифицированы три представителя подсемейства Akt регулируемых вторичными мессенджерами сериновых/треониновых протеинкиназ, которые названы Akt1/PKBα, Akt2/PKBβ и Akt3/PKBγ (в дальнейшем называемые «Akt1», «Akt2» и «Akt3»), соответственно. Изоформы гомологичны, особенно в областях, кодирующих каталитические домены. Akt активируются событиями фосфорилирования, происходящими в ответ на передачу сигнала PI3K. PI3K фосфорилирует мембранные инозитолфосфолипиды, образующие вторичные мессенджеры, фосфатидилинозитол-3,4,5-трифосфат и фосфатидилинозитол-3,4-дифосфат, которые, как было показано, связываются с PH-доменом Akt. Современная модель активации Akt предполагает привлечение фермента в мембрану 3'-фосфорилированными фосфоинозитидами, где происходит фосфорилирование регуляторных сайтов Akt киназами, расположенными в каскаде выше (B.A. Hemmings, Science 275: 628-630 (1997); BA. Hemmings, Science 276: 534 (1997); J. Downward, Science 279: 673-674 (1998)).

Фосфорилирование Akt1 происходит в двух регуляторных сайтах, Thr308 в активационной петле каталитического домена, и в Ser473 вблизи карбоксильного конца (D. R. Alessi et al. EMBO J. 15: 6541-6551 (1996) и R. Meier et al. J. Biol. Chem. 272: 30491-30497 (1997)). Эквивалентные регуляторные сайты фосфорилирования встречаются в Akt2 и Akt3. Находящаяся выше в каскаде киназа, которая фосфорилирует Akt в сайте активационной петли, была клонирована и названа 3'-фосфоинозитид-зависимой протеинкиназой 1 (PDK1). PDK1 фосфорилирует не только Akt, но также киназу p70 рибосомного белка S6, p90RSK, сывороточную и регулируемую глюкокортикоидами киназу (SGK) и протеинкиназу C. Находящаяся выше в каскаде киназа, фосфорилирующая регуляторный сайт Akt вблизи карбоксильного конца, еще не была идентифицирована, но в недавних сообщениях предполагается роль связанной с интегрином киназы (ILK-I), сериновой/треониновой протеинкиназы, или аутофосфорилирования.

Анализ уровней Akt в опухолях человека показал, что Akt2 сверхэкспрессируется в большом количестве в злокачественных опухолях яичника (J. Q. Cheng et al. Proc. Natl. Acad. Sci. USA 89: 9267-9271 (1992)) и поджелудочной железы (J. Q. Cheng et al. Proc. Natl. Acad. Sci. USA 93: 3636-3641 (1996)). Подобным образом обнаружено, что Akt3 сверхэкспрессируется в линиях клеток рака молочной железы и простаты (Nakatani et al. J. Biol. Chem. 274: 21528-21532 (1999)).

Опухолевый супрессор PTEN, фосфатаза белков и липидов, которая специфично удаляет 3'-фосфат Ptdins(3,4,5)-P3, является негативным регулятором пути PI3K/Akt (Li et al. Science 275: 1943-1947 (1997), Stambolic et al. Cell 95: 29-39 (1998), Sun et al. Proc. Natl. Acad. Sci. U.S.A. 96: 6199-6204 (1999)). Мутации PTEN зародышевой линии ответственны за злокачественные синдромы человека, такие как болезнь Коудена (Liaw et al. Nature Genetics 16: 64-67 (1997)). PTEN исчезает в большом проценте опухолей человека, и в линиях опухолевых клеток без функционального PTEN наблюдаются повышенные уровни активированной Akt (Li et al. выше, Guldberg et al. Cancer Research 57: 3660-3663 (1997), Risinger et al. Cancer Research 57: 4736-4738 (1997)).

Такие наблюдения показывают, что путь PI3K/Akt играет важные роли в регуляции выживаемости клеток или апоптоза при образовании опухолей.

Ингибирование активации и активности Akt может быть достигнуто ингибированием PI3K такими ингибиторами, как LY294002 и вортманнин. Однако ингибирование PI3K может без разбора влиять не только на все три изозима Akt, но также на другие содержащие PH-домен передающие сигнал молекулы, которые зависят от PdtIns(3,4,5)-P3, такие как семейство Tec тирозинкиназ. Кроме того, было выявлено, что Akt может активироваться ростовыми сигналами, которые не зависят от PI3K.

Альтернативно активность Akt может быть ингибирована посредством блокирования активности, находящейся выше, в каскаде киназы PDK1. Не было обнаружено специфичных ингибиторов PDK1. И опять ингибирование PDK1 могло бы привести к ингибированию множества протеинкиназ, активности которых зависят от PDK1, таких как атипичные изоформы PKC, SGK, и киназы S6 (Williams et al. Curr. Biol. 10:439-448 (2000)).

Целью настоящего изобретения является получение новых соединений, которые являются ингибиторами Akt. Также целью настоящего изобретения является получение фармацевтических композиций, которые содержат новые соединения, которые являются ингибиторами Akt.

Также целью настоящего изобретения является способ лечения злокачественной опухоли, который включает в себя введение таких ингибиторов активности Akt.

Сущность изобретения

Настоящее изобретение относится к замещенным соединениям нафтиридина, которые ингибируют активность Akt. В частности, заявленные соединения избирательно ингибируют одну или несколько изоформ Akt. Изобретение также относится к композициям, содержащим такие ингибирующие соединения, и к способам ингибирования активности Akt введением соединения пациенту, нуждающемуся в лечении злокачественной опухоли.

Подробное описание изобретения

Соединения согласно настоящему изобретению применимы для ингибирования активности сериновой/треониновой киназы Akt. В первом варианте осуществления настоящего изобретения ингибиторы активности Akt представлены формулой A:

в которой:

E, F, G, H, I, J, K, L и M независимо выбраны из C или N, где каждый E, F, G, H, I, J, K, L и M необязательно замещен R1;

a равно 0 или 1; b равно 0 или 1; m равно 0, 1 или 2; p независимо равно 0, 1, 2, 3, 4 или 5;

кольцо Z выбрано из (C3-C8)циклоалкила, арила, гетероарила и гетероциклила;

R1 выбран из оксогруппы, (C=O)aOb(C1-C10)алкила, (C=O)aOb-арила, (C=O)aOb(C2-C10)алкенила, (C=O)aOb(C2-C10)алкинила, CO2H, галогена, OH, Ob(C1-C6)перфторалкила, (C=O)aNR7R8, CN, (C=O)aOb(C3-C8)циклоалкила, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкила и (C=O)aOb-гетероциклила, при этом указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены одним или несколькими заместителями, выбранными из R6;

R2 независимо выбран из оксогруппы, (C=O)aOb(C1-C10)алкила, (C=O)aOb-арила, (C=O)aOb(C2-C10)алкенила, (C=O)aOb(C2-C10)алкинила, CO2H, галогена, OH, Ob(C1-C6)перфторалкила, (C=O)aNR7R8, CN, (C=O)aOb(C3-C8)циклоалкила, SH, S(O)mNR7R8, S(O)m-(C1-C10)алкила и (C=O)aOb-гетероциклила, при этом указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены одним или несколькими заместителями, выбранными из R6;

R3 независимо выбран из оксогруппы, (C=O)aOb(C1-C10)алкила, (C=O)aOb-арила, (C=O)aOb(C2-C10)алкенила, (C=O)aOb(C2-C10)алкинила, CO2H, галогена, OH, Ob(C1-C6)перфторалкила, (C=O)aNR7R8, CN, (C=O)aOb(C3-C8)циклоалкила, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкила, (C1-C6)алкилгетероциклила и (C=O)aOb-гетероциклила, при этом указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены одним или несколькими заместителями, выбранными из R6;

R6 означает (C=O)aObC1-C10-алкил, (C=O)aOb-арил, C2-C10-алкенил, C2-C10-алкинил, (C=O)aOb-гетероциклил, CO2H, галоген, CN, OH, ObC1-C6-перфторалкил, Oa(C=O)bNR7R8, оксогруппу, CHO, (N=O)R7R8, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкил или (C=O)aObC3-C8-циклоалкил, при этом указанный алкил, арил, алкенил, алкинил, гетероциклил и циклоалкил необязательно замещены одним или несколькими заместителями, выбранными из R6a;

R6a выбран из (C=O)aOb(C1-C10)алкила, Oa(C1-C3)перфторалкила, (C0-C6)алкилен-S(O)mRa, SH, оксогруппы, OH, галогена, CN, (C2-C10)алкенила, (C2-C10)алкинила, (C3-C6)циклоалкила, (C0-C6)алкиленарила, (C0-C6)алкиленгетероциклила, (C0-C6)алкилен-N(Rb)2, C(O)Ra, (C0-C6)алкилен-CO2Ra, C(O)H и (C0-C6)алкилен-CO2H, при этом указанный алкил, алкенил, алкинил, циклоалкил, арил и гетероциклил необязательно имеет до трех заместителей, выбранных из Rb, OH, (C1-C6)алкоксигруппы, галогена, CO2H, CN, Oa(C=O)b(C1-C6)алкила, оксогруппы и N(Rb)2;

R7 и R8 независимо выбраны из H, (C=O)aOb(C1-C10)алкила, (C=O)aOb(C3-C8)циклоалкила, (C=O)aOb-арила, (C=O)aOb-гетероциклила, (C2-C10)алкенила, (C2-C10)алкинила, SH, SO2Ra и (C=O)aNRb2, при этом указанный алкил, циклоалкил, арил, гетероциклил, алкенил и алкинил необязательно замещены одним или несколькими заместителями, выбранными из R6a или R7 и R8, вместе взятые с атомом азота, с которым они связаны, могут образовывать моноциклический или бициклический гетероцикл с 3-7 членами в каждом цикле и необязательно содержащий кроме атома азота один или два дополнительных гетероатома, выбранных из N, O и S, при этом указанный моноциклический или бициклический гетероцикл необязательно замещен одним или несколькими заместителями, выбранными из R6a;

Ra означает (C1-C6)алкил, (C3-C6)циклоалкил, арил или гетероциклил;

и Rb независимо означает H, (C1-C6)алкил, арил, гетероциклил, (C3-C6)циклоалкил, (C=O)aOb(C1-C6)алкил или S(O)mRa;

или их фармацевтически приемлемая соль, или стереоизомер.

Во втором варианте осуществления настоящего изобретения ингибиторы активности Akt представлены формулой B:

в которой

выбран из

R1 выбран из H, оксогруппы, (C=O)aOb(C1-C10)алкила, (C=O)aOb-арила, (C=O)aOb(C2-C10)алкенила, (C=O)aOb(C2-C10)алкинила, CO2H, галогена, OH, Ob(C1-C6)перфторалкила, (C=O)aNR7R8, CN, (C=O)aOb(C3-C8)циклоалкила, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкила и (C=O)aOb-гетероциклила, при этом указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены одним или несколькими заместителями, выбранными из R6;

и все другие заместители и переменные имеют значения, определенные в первом варианте;

или их фармацевтически приемлемая соль, или стереоизомер.

В третьем варианте осуществления настоящего изобретения ингибиторы активности Akt представлены формулой C:

где q равно 0, 1, 2, 3 или 4; r равно 0, 1, 2, 3, 4 или 5; t равно 2, 3, 4, 5 или 6;

Q независимо выбран из оксогруппы, (C=O)aOb(C1-C10)алкила, (C=O)aOb-арила, (C=O)aOb(C2-C10)алкенила, (C=O)aOb(C2-C10)алкинила, CO2H, галогена, OH, Ob(C1-C6)перфторалкила, (C=O)aNR7R8, CN, (C=O)aOb(C3-C8)циклоалкила, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкила и (C=O)aOb-гетероциклила, при этом указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены одним или несколькими заместителями, выбранными из R6a;

R4 и R5 независимо выбраны из H, (C1-C6)алкила и (C1-C6)перфторалкила, или R4 и R5 объединены с образованием -(CH2)t-, где один из атомов углерода необязательно заменен остатком, выбранным из O, S(O)m, -N(Rb)C(O)- и -N(CORa)-;

и все другие заместители и переменные имеют значения, определенные во втором варианте;

или их фармацевтически приемлемая соль, или стереоизомер.

В четвертом варианте ингибиторы согласно настоящему изобретению представлены формулой D:

в которой все другие заместители и переменные имеют значения, определенные в третьем варианте;

или их фармацевтически приемлемая соль, или стереоизомер.

В пятом варианте ингибиторы согласно настоящему изобретению представлены формулой E:

в котором a равно 0 или 1; b равно 0 или 1; m равно 0, 1 или 2;

R1 выбран из H, оксогруппы, (C=O)aOb(C1-C10)алкила, (C=O)aOb-арила, (C=O)aOb(C2-C10)алкенила, (C=O)aOb(C2-C10)алкинила, CO2H, галогена, OH, Ob(C1-C6)перфторалкила, (C=O)aNR7R8, CN, (C=O)aOb(C3-C8)циклоалкила, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкила и (C=O)aOb-гетероциклила, при этом указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены одним или несколькими заместителями, выбранными из R6;

R3 независимо выбран из H, оксогруппы, (C=O)aOb(C1-C10)алкила, (C=O)aOb-арила, (C=O)aOb(C2-C10)алкенила, (C=O)aOb(C2-C10)алкинила, CO2H, галогена, OH, Ob(C1-C6)перфторалкила, (C=O)aNR7R8, CN, (C=O)aOb(C3-C8)циклоалкила, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкила, (C1-C6)алкилгетероциклила и (C=O)aOb-гетероциклила, при этом указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены одним или несколькими заместителями, выбранными из R6;

R6 означает (C=O)aObC1-C10-алкил, (C=O)aOb-арил, C2-C10-алкенил, C2-C10-алкинил, (C=O)aOb-гетероциклил, CO2H, галоген, CN, OH, ObC1-C6-перфторалкил, Oa(C=O)bNR7R8, оксогруппу, CHO, (N=O)R7R8, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкил или (C=O)aObC3-C8-циклоалкил, при этом указанный алкил, арил, алкенил, алкинил, гетероциклил и циклоалкил необязательно замещены одним или несколькими заместителями, выбранными из R6a;

R6a выбран из (C=O)aOb(C1-C10)алкила, Oa(C1-C3)перфторалкила, (C0-C6)алкилен-S(O)mRa, SH, оксогруппы, OH, галогена, CN, (C2-C10)алкенила, (C2-C10)алкинила, (C3-C6)циклоалкила, (C0-C6)алкиленарила, (C0-C6)алкиленгетероциклила, (C0-C6)алкилен-N(Rb)2, C(O)Ra, (C0-C6)алкилен-CO2Ra, C(O)H и (C0-C6)алкилен-CO2H, при этом указанный алкил, алкенил, алкинил, циклоалкил, арил, и гетероциклил необязательно имеет до трех заместителей, выбранных из Rb, OH, (C1-C6)алкоксигруппы, галогена, CO2H, CN, Oa(C=O)b(C1-C6)алкила, оксогруппы и N(Rb)2;

R7 и R8 независимо выбраны из H, (C=O)aOb(C1-C10)алкила, (C=O)aOb(C3-C8)циклоалкила, (C=O)aOb-арила, (C=O)aOb-гетероциклила, (C2-C10)алкенила, (C2-C10)алкинила, SH, SO2Ra и (C=O)aNRb2, при этом указанный алкил, циклоалкил, арил, гетероциклил, алкенил и алкинил необязательно замещены одним или несколькими заместителями, выбранными из R6a или R7 и R8, вместе взятые с атомом азота, с которым они связаны, могут образовывать моноциклический или бициклический гетероцикл с 3-7 членами в каждом цикле и необязательно содержащий кроме атома азота один или два дополнительных гетероатома, выбранных из N, O и S, при этом указанный моноциклический или бициклический гетероцикл необязательно замещен одним или несколькими заместителями, выбранными из R6a;

Ra означает (C1-C6)алкил, (C3-C6)циклоалкил, арил или гетероциклил;

и Rb независимо означает H, (C1-C6)алкил, арил, гетероциклил, (C3-C6)циклоалкил, (C=O)aOb(C1-C6)алкил или S(O)mRa;

или их фармацевтически приемлемая соль, или стереоизомер.

В шестом варианте ингибиторы согласно настоящему изобретению представлены формулой F:

в которой R4 и R5 независимо означают H и (C1-C6)алкил, где указанный алкил необязательно имеет до трех заместителей, выбранных из OH и галогена; и где R4 и R5 могут быть связаны с образованием (C3-C7)циклоалкила; и

все другие заместители и переменные имеют значения, определенные в пятом варианте;

или их фармацевтически приемлемая соль, или стереоизомер.

В седьмом варианте ингибиторы согласно настоящему изобретению представлены формулой F,

в которой:

R1 выбран из H, NH2, OH и (C1-C6)алкила;

R4 и R5 независимо означают H и (C1-C6)алкил;

или их фармацевтически приемлемая соль, или стереоизомер.

В восьмом варианте ингибиторы согласно настоящему изобретению представлены формулой G:

в которой a равно 0 или 1; b равно 0 или 1; m равно 0, 1 или 2;

Q выбран из гетероциклила, который необязательно замещен одним или несколькими заместителями, выбранными из R6a;

R1 выбран из H, оксогруппы, (C=O)aOb(C1-C10)алкила, (C=O)aOb-арила, (C=O)aOb(C2-C10)алкенила, (C=O)aOb(C2-C10)алкинила, CO2H, галогена, OH, Ob(C1-C6)перфторалкила, (C=O)aNR7R8, CN, (C=O)aOb(C3-C8)циклоалкила, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкила и (C=O)aOb-гетероциклила, при этом указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены одним или несколькими заместителями, выбранными из R6;

R4 и R5 независимо означают H, (C1-C6)алкил, (C1-C6)алкенил, (C1-C6)алкинил, где указанный алкил необязательно имеет до трех заместителей, выбранных из OH и галогена; и где R4 и R5 вместе взятые могут образовывать (C3-C7)циклоалкил, при этом указанный циклоалкил необязательно имеет до трех заместителей, выбранных из R6;

R6 означает (C=O)aObC1-C10-алкил, (C=O)aOb-арил, C2-C10-алкенил, C2-C10-алкинил, (C=O)aOb-гетероциклил, CO2H, галоген, CN, OH, ObC1-C6-перфторалкил, Oa(C=O)bNR7R8, оксогруппу, CHO, (N=O)R7R8, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкил или (C=O)aObC3-C8-циклоалкил, при этом указанный алкил, арил, алкенил, алкинил, гетероциклил и циклоалкил необязательно замещены одним или несколькими заместителями, выбранными из R6a;

R6a выбран из (C=O)aOb(C1-C10)алкила, Oa(C1-C3)перфторалкила, (C0-C6)алкилен-S(O)mRa, SH, оксогруппы, OH, галогена, CN, (C2-C10)алкенила, (C2-C10)алкинила, (C3-C6)циклоалкила, (C0-C6)алкиленарила, (C0-C6)алкиленгетероциклила, (C0-C6)алкилен-N(Rb)2, C(O)Ra, (C0-C6)алкилен-CO2Ra, C(O)H и (C0-C6)алкилен-CO2H, при этом указанный алкил, алкенил, алкинил, циклоалкил, арил и гетероциклил необязательно имеют до трех заместителей, выбранных из Rb, OH, (C1-C6)алкоксигруппы, галогена, CO2H, CN, Oa(C=O)b(C1-C6)алкила, оксогруппы и N(Rb)2;

R7 и R8 независимо выбраны из H, (C=O)aOb(C1-C10)алкила, (C=O)aOb(C3-C8)циклоалкила, (C=O)aOb-арила, (C=O)aOb-гетероциклила, (C2-C10)алкенила, (C2-C10)алкинила, SH, SO2Ra и (C=O)aNRb2, при этом указанный алкил, циклоалкил, арил, гетероциклил, алкенил и алкинил необязательно замещены одним или несколькими заместителями, выбранными из R6a или R7 и R8 вместе взятые с атомом азота, с которым они связаны, могут образовывать моноциклический или бициклический гетероцикл с 3-7 членами в каждом цикле и необязательно содержащий кроме атома азота один или два дополнительных гетероатома, выбранных из N, O и S, при этом указанный моноциклический или бициклический гетероцикл необязательно замещен одним или несколькими заместителями, выбранными из R6a;

Ra означает (C1-C6)алкил, (C3-C6)циклоалкил, арил или гетероциклил; и

Rb независимо означает H, (C1-C6)алкил, арил, гетероциклил, (C3-C6)циклоалкил, (C=O)aOb(C1-C6)алкил или S(O)mRa;

или их фармацевтически приемлемая соль, или стереоизомер.

В девятом варианте ингибиторы согласно настоящему изобретению представлены формулой H:

в которой R1 означает гетероциклил, при этом указанный гетероциклил необязательно замещен одним-тремя заместителями, выбранными из (C1-C6)алкила, OH, галогена и NH2;

R6a выбран из

или их фармацевтически приемлемая соль, или стереоизомер.

В десятом варианте ингибиторы согласно настоящему изобретению представлены формулой H:

в которой R1 выбран из

и все другие заместители и переменные имеют значения, определенные в девятом варианте;

или их фармацевтически приемлемая соль, или стереоизомер.

В одиннадцатом варианте ингибиторы согласно настоящему изобретению представлены формулой J:

в которой a равно 0 или 1; b равно 0 или 1; m равно 0, 1 или 2;

R1 выбран из CF3, H, оксогруппы, (C=O)aOb(C1-C10)алкила, (C=O)aOb-арила, (C=O)aOb(C2-C10)алкенила, (C=O)aOb(C2-C10)алкинила, CO2H, галогена, OH, Ob(C1-C6)перфторалкила, (C=O)aNR7R8, CN, (C=O)aOb(C3-C8)циклоалкила, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкила и (C=O)aOb-гетероциклила, при этом указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены одним-шестью заместителями, выбранными из R6;

R3' и R3” независимо выбраны из CF3, H, оксогруппы, (C=O)aOb(C1-C10)алкила, (C=O)aOb-арила, (C=O)aOb(C2-C10)алкенила, (C=O)aOb(C2-C10)алкинила, CO2H, галогена, OH, Ob(C1- C6)перфторалкила, (C=O)aNR7R8, CN, (C=O)aOb(C3-C8)циклоалкила, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкила, (C1-C6)алкилгетероциклила и (C=O)aOb-гетероциклила, при этом указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены одним-пятью заместителями, выбранными из R6; или R3' и R3” вместе взятые с атомом азота, с которым они связаны, могут образовывать пиперидин или пирролидин, который необязательно могут быть замещены одним-пятью заместителями, выбранными из R6;

R4 и R5 независимо означают H, (C1-C6)алкил, (C1-C6)алкенил, (C1-C6)алкинил, при этом указанный алкил необязательно имеет до трех заместителей, выбранных из OH и галогена; и где R4 и R5 вместе взятые могут образовывать (C3-C7)циклоалкил, при этом указанный циклоалкил необязательно имеет до трех заместителей, выбранных из R6;

R6 означает CF3, (C=O)aObC1-C10-алкил, (C=O)aOb-арил, C2-C10-алкенил, C2-C10-алкинил, (C=O)aOb-гетероциклил, CO2H, галоген, CN, OH, ObC1-C6-перфторалкил, Oa(C=O)bNR7R8, оксогруппу, CHO, (N=O)R7R8, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкил или (C=O)aObC3-C8-циклоалкил, при этом указанный алкил, арил, алкенил, алкинил, гетероциклил и циклоалкил необязательно замещены одним-пятью заместителями, выбранными из R6a;

R6a выбран из CF3, (C=O)aOb(C1-C10)алкила, Oa(C1-C3)перфторалкила, (C0-C6)алкилен-S(O)mRa, SH, оксогруппы, OH, галогена, CN, (C2-C10)алкенила, (C2-C10)алкинила, (C3-C6)циклоалкила, (C0-C6)алкиленарила, (C0-C6)алкиленгетероциклила, (C0-C6)алкилен-N(Rb)2, (C=O)aNRb2, C(O)Ra, (C0-C6)алкилен-CO2Ra, C(O)H и (C0-C6)алкилен-CO2H, при этом указанный алкил, алкенил, алкинил, циклоалкил, арил и гетероциклил необязательно имеет до трех заместителей, выбранных из Rb, OH, (C1-C6)алкоксигруппы, галогена, CO2H, CN, Oa(C=O)b(C1-C6)алкила, оксогруппы и N(Rb)2;

R7 и R8 независимо выбраны из CF3, H, (C=O)aOb(C1-C10)алкила, (C=O)aOb(C3-C8)циклоалкила, (C=O)aOb-арила, (C=O)aOb-гетероциклила, (C2-C10)алкенила, (C2-C10)алкинила, SH, SO2Ra и (C=O)aNRb2, при этом указанный алкил, циклоалкил, арил, гетероциклил, алкенил и алкинил необязательно замещены одним-пятью заместителями, выбранными из R6a; или R7 и R8 вместе взятые с атомом азота, с которым они связаны, могут образовывать моноциклический или бициклический гетероцикл с 3-7 членами в каждом цикле и необязательно содержащий кроме атома азота один или два дополнительных гетероатома, выбранных из N, O и S, при этом указанный моноциклический или бициклический гетероцикл необязательно замещен одним-шестью заместителями, выбранными из R6a;

Ra означает (C1-C6)алкил, NRb2, (C3-C6)циклоалкил, арил или гетероциклил; и

Rb независимо означает H, (C1-C6)алкил, NH2, арил, гетероциклил, (C3-C6)циклоалкил, (C=O)aOb(C1-C6)алкил или S(O)mRa;

или их фармацевтически приемлемая соль или стереоизомер.

Конкретные соединения согласно настоящему изобретению включают:

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амин (1-4);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ол (1-5);

9-фенил-8-(4-{[4-(4-пиридин-2-ил-1H-имидазол-1-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амин (1-6);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-тиол (1-7);

3-метил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (2-2);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (2-3);

3-(хлорметил)-9-фенил-8-(4-{[4-(4-пиридин-2-ил-1H-имидазол-1-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (2-4);

3-[(4-метилпиперазин-1-ил)метил]-9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (2-5); и

2-({[9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метил}амино)этанол (2-6);

или их фармацевтически приемлемые соли, или стереоизомеры.

Примеры соединений согласно настоящему изобретению включают ТФУ-соли следующих соединений:

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амина (1-4);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ола (1-5);

9-фенил-8-(4-{[4-(4-пиридин-2-ил-1H-имидазол-1-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амина (1-6);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-тиола (1-7);

3-метил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (2-2);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (2-3);

9-(хлорметил)-9-фенил-8-(4-{[4-(4-пиридин-2-ил-1H-имидазол-1-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (2-4);

3-[(4-метилпиперазин-1-ил)метил]-9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (2-5);

2-({[9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метил}амино)этанола (2-6);

3-(3-метил-1H-1,2,4-триазол-5-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (9-9);

3-имидазо[2,1-b][1,3]тиазол-6-ил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (9-10);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (9-11);

3-имидазо[1,2-a]пиридин-2-ил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (9-12);

3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (13-3);

5-[({4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}амино)метил]пиридин-2-ола (13-8);

N1,N1,2,2-тетраметил-N3-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пропан-1,3-диамина (13-9);

N3-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-N1-(4-гидроксифенил)-бета-аланинамида (14-6);

1-[4-(9-фенил-3-пиридин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (16-13);

4-[3-(1-метил-5-фенил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина (16-41);

1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-1-бензотиен-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-42);

1-{4-[3-(1-изопропил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-43);

1-{4-[9-фенил-3-(1,4,5,6-тетрагидроциклопента[c]пиразол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-44);

1-[4-(3-циклопропил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (16-48);

1-{4-[9-фенил-3-(трифторметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-49);

1-{4-[3-(5-метил-1H-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-50);

1-{4-[3-(1,5-диметил-1H-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-51);

4-[3-(1H-индол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина (16-52);

1-{4-[3-(1-метил-1H-имидазол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-53);

1-{4-[3-(3-метил-2H-3лямбда5-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-54);

4-[3-(6-хлоримидазо[1,2-a]пиридин-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина (16-55);

1-{4-[3-(1H-бензимидазол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-56);

4-[3-(5-циклопропил-4H-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина (16-57);

1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-1H-индазол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-58);

4-[9-фенил-3-(3-фенил-1H-пиразол-5-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина (16-59);

1-(4-{9-фенил-3-[3-(трифторметил)-1H-пиразол-5-ил][1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамина (16-60);

1-[4-(9-фенил-3-пиразоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (16-61);

1-{4-[3-(1-бензил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-62);

1-[4-(9-фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (16-63);

4-[9-фенил-3-(1-фенил-1H-пиразол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина (16-64);

1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-2-бензотиен-1-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-65);

1-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}этан-1,2-диола (16-68);

4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}имидазолидин-2-она (16-69);

(2R)-2-амино-2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}этанола (16-70);

(2R)-2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-2-(метиламино)этанола (16-71);

1-[4-(3-этил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (17-6);

1-[4-(9-фенил-3-пропил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (17-7);

1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропанамина (33-5);

1-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}циклопропанамина (33-6);

1-[4-(9-фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропанамина (33-7);

N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-5-пиридин-4-ил-2-фурамида (39-2);

(3-метил-9-фенил-8-(4-{1-[(пиридин-3-илацетил)амино]циклопропил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (39-43);

3-метил-9-фенил-8-(4-{1-[(хинолин-3-илкарбонил)амино]циклопропил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (39-44);

3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{1-[(пиридин-3-илацетил)амино]циклопропил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (39-46);

1-[4-(9-этил-2-фенил[1,2,4]триазоло[4',3':1,6]пиридо[2,3-b]пиразин-3-ил)фенил]циклопропанамина (42-6); и

1-[4-(9-этил-3-фенил[1,2,4]триазоло[4',3':1,6]пиридо[2,3-b]пиразин-2-ил)фенил]циклопропанамина (42-7);

или их стереоизомеры.

Примеры соединений согласно настоящему изобретению включают соли муравьиной кислоты следующих соединений:

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амина (1-4); и

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ола (1-5);

или их стереоизомеры.

Конкретные соединения согласно настоящему изобретению включают:

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амин (1-4);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ол (1-5);

9-фенил-8-(4-{[4-(4-пиридин-2-ил-1H-имидазол-1-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амин (1-6);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-тиол (1-7);

3-метил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (2-2);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (2-3);

3-(хлорметил)-9-фенил-8-(4-{[4-(4-пиридин-2-ил-1H-имидазол-1-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (2-4);

3-[(4-метилпиперазин-1-ил)метил]-9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (2-5);

2-({[9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метил}амино)этанол (2-6);

8-(4-аминометилфенил)-9-фенил-[1,2,4]триазоло[3,4-f][1,6]нафтиридин-3-ол (3-8);

1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (4-3);

4-(3-метил-9-фенил-[1,2,4]триазоло[3,4-f][1,6]нафтиридин-8-ил)бензиламин (5-3);

8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амин (6-2);

1-[4-(9-фенил-[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамин (7-4); и

9-фенил-8-{4-[4-(5-пиридин-2-ил-4H-[1,2,4]триазол-3-ил)пиперидин-1-илметил]фенил}-[1,2,4]триазоло[3,4-f][1,6]нафтиридин (8-10)

или их фармацевтически приемлемые соли, или стереоизомеры.

Примеры соединений согласно настоящему изобретению включают HCl-соли следующих соединений:

8-(4-аминометилфенил)-9-фенил-[1,2,4]триазоло[3,4-f][1,6]нафтиридин-3-ола (3-8);

1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (4-3);

4-(3-метил-9-фенил-[1,2,4]триазоло[3,4-f][1,6]нафтиридин-8-ил)бензиламина (5-3);

8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амина (6-2); и

1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамина (7-4);

3-(1H-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (9-5);

трет-бутил[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метилкарбамата (9-6);

[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанола (9-7);

5-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]-2,4-дигидро-3H-1,2,4-триазол-3-она (9-8);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-(1H-1,2,4-триазол-5-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (9-13);

3-(1H-бензимидазол-6-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (9-14);

3-(1,5-диметил-1H-пиразол-3-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (9-15);

3-имидазо[1,2-a]пиримидин-2-ил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (9-16);

5-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]пиридин-2-амина (9-17);

9-фенил-3-пиразоло[1,5-a]пиримидин-3-ил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил)фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (9-18);

3-(5-метил-1H-пиразол-3-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (9-19);

3-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]пиридин-2-амина (9-20);

4-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]фенола (9-21);

3-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]фенола (9-22);

2-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]фенола (9-23);

1-{4-[3-(5-оксо-4,5-дигидро-1H-1,2,4-триазол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пиперидин-4-карбоксамида (9-24);

1-[4-(3-имидазо[1,2-a]пиридин-2-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пиперидин-4-карбоксамида (9-25);

3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (13-3);

3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиразин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (13-4);

N-[2-(4-метил-1H-имидазол-2-ил)этил]-N-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}амина (13-5);

N1-(2-гидроксифенил)-N3-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}бета-аланинамида (13-6);

1-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пиперидин-4-карбоксамида (13-7);

3-гидрокси-2,2-диметил-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амина (13-10);

2-фтор-3-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амина (13-11);

2,2-дифтор-3-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амина (13-12);

2,3-дигидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амина (13-13);

4-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]циклогексанамина (13-14);

4-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]циклогексанамина (13-15);

3-гидрокси-2,2-диметил-N-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пропан-1-амина (13-16);

3-гидрокси-2,2-диметил-N-[4-(9-фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амина (13-17);

3-гидрокси-2,2-диметил-N-[4-(9-фенил-3-пиразоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амина (13-18);

3-гидрокси-2,2-диметил-N-{4-[9-фенил-3-(1H-1,2,3-триазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пропан-1-амина (13-19);

N-{4-[3-(аммонийметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-3-гидрокси-2,2-диметилпропан-1-амина (13-21);

N3-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-N1-(2-гидроксифенил)-бета-аланинамида (14-4);

(8-{4-[(циклогексиламино)метил]фенил}-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил)метанола (14-5);

[9-фенил-8-(4-{[4-(5-пиридин-3-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанола (14-7);

l-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пиперидин-4-карбоксамида (14-8);

1-{4-[3-(1-оксидопиридин-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-4);

1-[4-(3,9-дифенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (16-5);

1-{4-[3-(4-фторфенил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-6);

4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}бензонитрила (16-7);

4-(9-фенил-3-пиримидин-4-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензиламина (16-8);

1-{4-[3-(1-оксидопиридин-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-9);

5-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}пиридин-2-ола (16-10);

1-[4-(9-фенил-3-пиридин-3-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (16-11);

4-(9-фенил-3-пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензиламина (16-12);

1-[4-(9-фенил-3-пиразин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (16-14);

1-{4-[9-фенил-3-(1H-1,2,4-триазол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-15);

1-{4-[9-фенил-3-(1,3-тиазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-16);

1-{4-[9-фенил-3-(1H-пиразол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-17);

1-{4-[3-(3-метил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-18);

1-{4-[3-(3-метил-1H-1,2,4-триазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-19);

1-{4-[3-(1-метил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-20);

1-{4-[9-фенил-3-(1,2,5-тиадиазол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-21);

1-{4-[9-фенил-3-(1,2,3-тиадиазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-22);

1-[4-(9-фенил-3-пиразоло[1,5-a]пиримидин-3-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (16-23);

{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метанамина (16-24);

{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метанола (16-25);

1-{4-[9-фенил-3-(2,2,2-трифторэтил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-26);

1-{4-[9-фенил-3-(1H-тетразол-1-илметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-27);

8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-карбоксамида (16-28);

1-{4-[3-(1H-имидазол-1-илметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-29);

1-(4-{3-[(метилсульфонил)метил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамина (16-30);

{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}ацетонитрила (16-31);

2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}этанола (16-32);

N-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)ацетамида (16-33);

1-[4-(3-имидазо[1,2-a]пиридин-2-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (16-36);

1-[4-(3-имидазо[2,1-b][1,3]тиазол-6-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (16-38);

1-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-40);

1-(4-{9-фенил-3-[(2R)-пирролидин-2-ил][1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамина (16-44);

1-(4-{9-фенил-3-[(2S)-пирролидин-2-ил][1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамина (16-45);

4-[3-(1-аминоэтил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина (16-46);

1-{4-[3-(1H-имидазол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-47);

1-{4-[9-фенил-3-(5,6,7,8-тетрагидроимидазо[1,2-a]пиридин-2-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-66);

2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}пропан-2-амина (16-67);

1-{4-[3-(5-этилизоксазол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-72);

5-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-2,4-дигидро-3H-1,2,4-триазол-3-она (16-73);

6-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-4,5-дигидропиридазин-3(2H)-она (16-74);

6-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}пиридазин-3(2H)-она (16-75);

N-(4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}фенил)ацетамида (16-76);

1-{4-[3-(4-феноксифенил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-77);

1-{4-[3-(1H-бензимидазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-78);

(4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}фенил)метанола (16-79);

4-[3-(4-циклогексилфенил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина (16-80);

4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-1,3-дигидро-2H-имидазол-2-она (16-81);

1-{4-[3-(4-метил-1H-имидазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-82);

4-[9-фенил-3-(1-пропил-1H-имидазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина (16-83);

1-{4-[3-(1-изопропил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-84);

1-{4-[3-(1-бутил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (16-85);

1-[4-(3-имидазо[1,2-a]пиримидин-2-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (16-86);

1-(6-метоксипиридин-3-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]метанамина (17-4);

N-[(2-метоксипиримидин-5-ил)метил]-N-[4-(3-метил-9-фенил [1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амина (17-5);

9-фенил-3-(1H-1,2,3-триазол-4-ил)-8-(4-{[4-(4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (21-4);

1-{4-[9-фенил-3-(3H-1лямбда4,3-тиазол-5-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (22-4);

1-{4-[9-фенил-3-(1H-пиразол-3-ил)-2H-4лямбда5-[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (22-5);

1-{4-[9-фенил-3-(1,3-тиазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (22-6);

1-{4-[3-(азетидин-1-илметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (26-3);

1-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)пиперидин-4-карбоксамида (26-4);

1-{4-[3-(морфолин-4-илметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина (26-5);

2-[({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)амино]этанола (26-6);

1-(4-{3-[(4-метилпиперазин-1-ил)метил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамина (26-7);

4-[9-фенил-3-(пиперазин-1-илметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина (26-8);

N-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)-N-метиламина (26-9);

N-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)-N,N-диметиламина (26-10);

3-метил-9-фенил-8-(4-{[4-(4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (31-1);

1-{4-[9-фенил-3-(5,6,7,8-тетрагидроимидазо[1,2-a][пиридин-2-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}циклопропанамина (33-8);

1-[4-(9-фенил-3-пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропанамина (33-9);

1-{4-[3-(1,5-диметил-1H-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}циклопропанамина (33-10);

(1R)-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамина (34-5);

(1R)-1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамина (34-6);

(1R)-1-{4-[9-фенил-3-(5-пиридин-2-ил-1H-пиразол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этанамина (35-1);

(1R)-1-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этанамин (35-2);

(1R)-1-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этанамина (35-3);

(1R)-1-[4-(9-фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамина (35-4);

(1R)-1-[4-(3-имидазо[2,1-b][1,3]тиазол-6-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамина (35-5);

(1R)-1-[4-(9-фенил-3-пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамина (35-6);

(1R)-1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]пропан-1-амина (36-1);

2-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]пропан-2-амина (37-4)

2-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]пропан-2-амина (38-1);

3-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридина (39-1);

N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-5-пиридин-3-ил-2-фурамида (39-3);

N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-5-пиридин-3-ил-1H-пиррол-3-карбоксамида (39-4);

4-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)морфолина (39-7);

2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтанамина (39-8);

4-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридина (39-9);

2,4-дигидрокси-6-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиримидина (39-10);

2-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридина (39-11);

3-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридина (39-12);

3-метил-9-фенил-8-[4-({[(пиридин-3-иламино)карбонил]амино}метил)фенил][1,2,4]триазоло[3,4-f]-1,6-нафтиридина (39-14);

3-метил-9-фенил-8-(4-{[(пиридин-3-илкарбонил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (39-20);

3-метил-9-фенил-8-(4-{[(хинолин-3-илкарбонил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (39-26);

8-(4-{[(1H-бензимидазол-1-илацетил)амино]метил}фенил)-3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (39-29);

8-(4-{[(1H-бензимидазол-2-илацетил)амино]метил}фенил)-3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (39-30);

3-метил-8-[4-({[(6-морфолин-4-илпиридин-3-ил)карбонил]амино}метил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (39-34);

3-метил-9-фенил-8-(4-{[(3-пиридин-3-илпропаноил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (39-37);

3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{[(пиридин-3-илацетил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (39-38);

9-фенил-3-пиразоло[1,5-a]пиримидин-3-ил-8-(4-{[(пиридин-3-илацетил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (39-39);

N-{(1R)-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}-2-пиридин-3-илацетамида (39-47); и

N-((1R)-1-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этил)-2-пиридин-3-илацетамида (39-49);

или их стереоизомеры.

Дополнительные конкретные соединения согласно настоящему изобретению включают:

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амин (1-4);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ол (1-5);

9-фенил-8-(4-{[4-(4-пиридин-2-ил-1H-имидазол-1-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амин (1-6);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-тиол (1-7);

3-метил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (2-2);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (2-3);

3-(хлорметил)-9-фенил-8-(4-{[4-(4-пиридин-2-ил-1H-имидазол-1-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (2-4);

3-[(4-метилпиперазин-1-ил)метил]-9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (2-5);

2-({[9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метил}амино)этанол (2-6);

8-(4-аминометилфенил)-9-фенил-[1,2,4]триазоло[3,4-f][1,6]нафтиридин-3-ол (3-8);

1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-16-нафтиридин-8-ил)фенил]метанамин (4-3);

4-(3-метил-9-фенил-[1,2,4]триазоло[3,4-f][1,6]нафтиридин-8-ил)бензиламин (5-3);

8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амин (6-2);

1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамин (7-4);

9-фенил-8-{4-[4-(5-пиридин-2-ил-4H-[1,2,4]триазол-3-ил)-пиперидин-1-илметил]фенил}-[1,2,4]триазоло[3,4-f][1,6]нафтиридин (8-10);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-(1H-1,2,3-триазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (9-4);

3-(1H-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (9-5);

трет-бутил[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метилкарбамат (9-6);

[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанол (9-7);

5-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]-2,4-дигидро-3H-1,2,4-триазол-3-он (9-8);

3-(3-метил-1H-1,2,4-триазол-5-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (9-9);

3-имидазо[2,1-b][1,3]тиазол-6-ил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (9-10);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (9-11);

3-имидазо[1,2-a]пиридин-2-ил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (9-12);

9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-(1H-1,2,4-триазол-5-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (9-13);

3-(1H-бензимидазол-6-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (9-14);

3-(1,5-диметил-1H-пиразол-3-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (9-15);

3-имидазо[1,2-a]пиримидин-2-ил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (9-16);

5-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]пиридин-2-амин (9-17);

9-фенил-3-пиразоло[1,5-a]пиримидин-3-ил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (9-18);

3-(5-метил-1H-пиразол-3-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (9-19);

3-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]пиридин-2-амин (9-20);

4-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]фенол (9-21);

3-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]фенол (9-22);

2-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]фенол (9-23);

1-{4-[3-(5-оксо-4,5-дигидро-1H-1,2,4-триазол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пиперидин-4-карбоксамид (9-24);

1-[4-(3-имидазо[1,2-a]пиридин-2-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пиперидин-4-карбоксамид (9-25);

9-фенил-8-(4-{[4-(5-пиразин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (10-4);

9-фенил-8-(4-{[4-(5-пиримидин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-(1H-1,2,3-триазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (11-4);

3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиримидин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (12-1);

3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (13-3);

3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиразин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (13-4);

N-[2-(4-метил-1H-имидазол-2-ил)этил]-N-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}амин (13-5);

N1-(2-гидроксифенил)-N3-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-бета-аланинамид (13-6);

1-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пиперидине-4-карбоксамид (13-7);

5-[({4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}амино)метил]пиридин-2-ол (13-8);

N1,N1,2,2-тетраметил-N3-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пропан-1,3-диамин (13-9);

3-гидрокси-2,2-диметил-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амин (13-10);

2-фтор-3-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амин (13-11);

2,2-дифтор-3-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амин (13-12);

2,3-дигидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амин (13-13);

4-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]циклогексанамин (13-14);

4-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]циклогексанамин (13-15);

3-гидрокси-2,2-диметил-N-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пропан-1-амин (13-16);

3-гидрокси-2,2-диметил-N-[4-(9-фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амин (13-17);

3-гидрокси-2,2-диметил-N-[4-(9-фенил-3-пиразоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амин (13-18);

3-гидрокси-2,2-диметил-N-{4-[9-фенил-3-(1H-1,2,3-триазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пропан-1-амин (13-19);

трет-бутил{[8-(4-{[(3-гидрокси-2,2-диметилпропил)амино]метил}фенил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метил}карбамат (13-20);

N-{4-[3-(аммониометил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-3-гидрокси-2,2-диметилпропан-1-амин (13-21);

[9-фенил-8-(4-{[4-(5-пиразин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанол (14-3);

N3-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-N1-(2-гидроксифенил)-бета-аланинамид (14-4);

(8-{4-[(циклогексиламино)метил]фенил}-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил)метанол (14-5);

N3-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-N1-(4-гидроксифенил)-бета-аланинамид (14-6);

[9-фенил-8-(4-{[4-(5-пиридин-3-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанол (14-7);

1-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пиперидин-4-карбоксамид (14-8);

{8-[4-(1-аминоциклопропил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метанол (15-2);

1-[4-(9-фенил-3-пиридин-4-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-3);

1-{4-[3-(1-оксидопиридин-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-4);

1-[4-(3,9-дифенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-5);

1-{4-[3-(4-фторфенил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-6);

4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}бензонитрил (16-7);

4-(9-фенил-3-пиримидин-4-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензиламин (16-8);

1-{4-[3-(1-оксидопиридин-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-9);

5-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}пиридин-2-ол (16-10);

1-[4-(9-фенил-3-пиридин-3-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-11);

4-(9-фенил-3-пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензиламин (16-12);

1-[4-(9-фенил-3-пиридин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-13);

1-[4-(9-фенил-3-пиразин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-14);

1-{4-[9-фенил-3-(1H-1,2,4-триазол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-15);

1-{4-[9-фенил-3-(1,3-тиазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-16);

1-{4-[9-фенил-3-(1H-пиразол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-17);

1-{4-[3-(3-метил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-18);

1-{4-[3-(3-метил-1H-1,2,4-триазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-19);

1-{4-[3-(1-метил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-20);

1-{4-[9-фенил-3-(1,2,5-тиадиазол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-21);

1-{4-[9-фенил-3-(1,2,3-тиадиазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-22);

1-[4-(9-фенил-3-пиразоло[1,5-a]пиримидин-3-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-23);

{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метанамин (16-24);

{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метанол (16-25);

1-{4-[9-фенил-3-(2,2,2-трифторэтил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-26);

1-{4-[9-фенил-3-(1H-тетразол-1-илметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-27);

8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-карбоксамид (16-28);

1-{4-[3-(1H-имидазол-1-илметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-29);

1-(4-{3-[(метилсульфонил)метил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамин (16-30);

{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}ацетонитрил (16-31);

2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}этанол (16-32);

N-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)ацетамид (16-33);

4-[3-(2-метилимидазо[1,2-a]пиридин-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин (16-34);

1-[4-(9-фенил-3-пиразоло[1,5-a]пиридин-3-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-35);

1-[4-(3-имидазо[1,2-a]пиридин-2-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-36);

1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-1,2-бензизоксазол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-37);

1-[4-(3-имидазо[2,1-b][1,3]тиазол-6-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-38);

1-{4-[3-(1-метил-1H-имидазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-39);

1-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-40);

4-[3-(1-метил-5-фенил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин (16-41);

1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-1-бензотиен-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-42);

1-{4-[3-(1-изопропил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-43);

1-{4-[9-фенил-3-(1,4,5,6-тетрагидроциклопента[c]пиразол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-44);

1-(4-{9-фенил-3-[(2S)-пирролидин-2-ил][1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамин (16-45);

4-[3-(1-аминоэтил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин (16-46);

1-{4-[3-(1H-имидазол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-47);

1-[4-(3-циклопропил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-48);

1-{4-[9-фенил-3-(трифторметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-49);

1-{4-[3-(5-метил-1H-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-50);

1-{4-[3-(1,5-диметил-1H-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-51);

4-[3-(1H-индол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин (16-52);

1-{4-[3-(1-метил-1H-имидазол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-53);

1-{4-[3-(3-метил-2H-3лямбда5-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-54);

4-[3-(6-хлоримидазо[1,2-a]пиридин-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин (16-55);

1-{4-[3-(1H-бензимидазол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-56);

4-[3-(5-циклопропил-4H-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин (16-57);

1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-1H-индазол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-58);

4-[9-фенил-3-(3-фенил-1H-пиразол-5-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин (16-59);

1-(4-{9-фенил-3-[3-(трифторметил)-1H-пиразол-5-ил][1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамин (16-60);

1-[4-(9-фенил-3-пиразоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-61);

1-{4-[3-(1-бензил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-62);

1-[4-(9-фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4}триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-63);

4-[9-фенил-3-(1-фенил-1H-пиразол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин (16-64);

1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-2-бензотиен-1-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-65);

1-{4-[9-фенил-3-(5,6,7,8-тетрагидроимидазо[1,2-a]пиридин-2-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-66);

2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}пропан-2-амин (16-67);

1-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}этан-1,2-диол (16-68);

4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}имидазолидин-2-он (16-69);

(2R)-2-амино-2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}этанол (16-70);

(2R)-2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-2-(метиламино)этанол (16-71);

1-{4-[3-(5-этилизоксазол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-72);

5-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-2,4-дигидро-3H-1,2,4-триазол-3-он (16-73);

6-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-4,5-дигидропиридазин-3(2H)-он (16-74);

6-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}пиридазин-3(2H)-он (16-75);

N-(4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}фенил)ацетамид (16-76);

1-{4-[3-(4-феноксифенил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-77);

1-{4-[3-(1H-бензимидазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-78);

(4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}фенил)метанол (16-79);

4-[3-(4-циклогексилфенил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин (16-80);

4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-1,3-дигидро-2H-имидазол-2-он (16-81);

1-{4-[3-(4-метил-1H-имидазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-82);

4-[9-фенил-3-(1-пропил-1H-имидазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин (16-83);

1-{4-[3-(1-изопропил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-84);

1-{4-[3-(1-бутил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (16-85);

1-[4-(3-имидазо[1,2-a]пиримидин-2-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-86);

5-({[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}метил)пиридин-2-ол (17-3);

1-(6-метоксипиридин-3-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]метанамин (17-4);

N-[(2-метоксипиримидин-5-ил)метил]-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амин (17-5);

1-[4-(3-этил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (17-6);

1-[4-(9-фенил-3-пропил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (17-7);

N-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид (18-1);

4-({[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}метил)фенол (19-1);

1-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанамин (20-1);

9-фенил-3-(1H-1,2,3-триазол-4-ил)-8-(4-{[4-(4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (21-4);

1-{4-[3-(1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (22-3);

1-{4-[9-фенил-3-(3H-1лямбда4,3-тиазол-5-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (22-4);

1-{4-[9-фенил-3-(1H-пиразол-3-ил)-2H-4лямбда5-[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (22-5);

1-{4-[9-фенил-3-(1,3-тиазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (22-6);

4-[9-фенил-3-(пирролидин-1-илметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин (26-2);

1-{4-[3-(азетидин-1-илметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (26-3);

1-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)пиперидин-4-карбоксамид (26-4);

1-{4-[3-(морфолин-4-илметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (26-5);

2-[({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)амино]этанол (26-6);

1-(4-{3-[(4-метилпиперазин-1-ил)метил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамин (26-7);

4-[9-фенил-3-(пиперазин-1-илметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин (26-8);

N-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)-N-метиламин (26-9);

N-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)-N,N-диметиламин (26-10);

[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанол (28-1);

{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанол (28-2);

1-[4-(9-фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанол (29-2);

9-фенил-8-(4-{[4-(4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (30-1);

3-метил-9-фенил-8-(4-{[4-(4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (31-1);

9-фенил-8-(4-{[4-(4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ол (32-1);

1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропанамин (33-5);

1-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}циклопропанамин (33-6);

1-[4-(9-фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропанамин (33-7);

1-{4-[9-фенил-3-(5,6,7,8-тетрагидроимидазо[1,2-a]пиридин-2-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}циклопропанамин (33-8);

1-[4-(9-фенил-3-пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропанамин (33-9);

1-{4-[3-(1,5-диметил-1H-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}циклопропанамин (33-10);

(1R)-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамин (34-5);

(1R)-1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамин (34-6);

(1R)-1-{4-[9-фенил-3-(5-пиридин-2-ил-1H-пиразол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этанамин (35-1);

(1R)-1-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этанамин (35-2);

(1R)-1-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этанамин (35-3);

(1R)-1-[4-(9-фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамин (35-4);

(1R)-1-[4-(3-имидазо[2,1-b][1,3]тиазол-6-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамин (35-5);

(1R)-1-[4-(9-фенил-3-пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамин (35-6);

(1R)-1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]пропан-1-амин (36-1);

2-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]пропан-2-амин (37-4);

2-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]пропан-2-амин (38-1);

3-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридин (39-1);

N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-5-пиридин-4-ил-2-фурамид (39-2);

N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-5-пиридин-3-ил-2-фурамид (39-3);

N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-5-пиридин-3-ил-1H-пиррол-3-карбоксамид (39-4);

2-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид (39-5);

трет-бутил(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)карбамат (39-6);

4-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)морфолин (39-7);

2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтанамин (39-8);

4-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридин (39-9);

2,4-дигидрокси-6-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиримидин (39-10);

2-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридин (39-11);

3-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридин (39-12);

N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-2-пиразин-2-илацетамид (39-13);

3-метил-9-фенил-8-[4-({[(пиридин-3-иламино)карбонил]амино}метил)фенил][1,2,4]триазоло[3,4-f]-1,6-нафтиридин (39-14);

2-(2-гидроксифенил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид (39-15);

2-(3-гидроксифенил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид (39-16);

2-(4-гидроксифенил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид (39-17);

2-(3,4-дигидроксифенил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид (39-18);

N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-2-фенилацетамид (39-19);

3-метил-9-фенил-8-(4-{[(пиридин-3-илкарбонил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (39-20);

2-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]бензамид (39-21);

2-(4-гидроксифенил)-2-метил-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропанамид (39-22);

метил-4-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-4-оксобутаноат (39-23);

2-гидрокси-N-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)бензамид (39-24);

N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-2-(5-фенил-4H-1,2,4-триазол-3-ил)ацетамид (39-25);

3-метил-9-фенил-8-(4-{[(хинолин-3-илкарбонил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (39-26);

N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-2-(4-оксохиназолин-3(4H)-ил)ацетамид (39-27);

N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-2-(2-оксо-1,3-бензоксазол-3(2H)-ил)ацетамид (39-28);

8-(4-{[(1H-бензимидазол-1-илацетил)амино]метил}фенил)-3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (39-29);

8-(4-{[(1H-бензимидазол-2-илацетил)амино]метил}фенил)-3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (39-30);

2-(4-метил-1,2,5-оксадиазол-3-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид (39-31);

2-(1H-индазол-1-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид (39-32);

2-(5,6-диметил-4-оксотиено[2,3-d]пиримидин-3(4H)-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид (39-33);

3-метил-8-[4-({[(6-морфолин-4-илпиридин-3-ил)карбонил]амино}метил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (39-34);

2-(6-хлорпиридин-3-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид (39-35);

3-циано-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропанамид (39-36);

3-метил-9-фенил-8-(4-{[(3-пиридин-3-илпропаноил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (39-37);

3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{[(пиридин-3-илацетил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (39-38);

9-фенил-3-пиразоло[1,5-a]пиримидин-3-ил-8-(4-{[(пиридин-3-илацетил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (39-39);

N-(3-гидрокси-2,2-диметилпропил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид (39-40);

N-(3-гидрокси-2,2-диметилпропил)-N-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-2-(4-оксохиназолин-3(4H)-ил)ацетамид (39-41);

трет-бутил{2-[[4-(3-{[(трет-бутоксикарбонил)амино]метил}-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил](3-гидрокси-2,2-диметилпропил)амино]-2-оксоэтил}карбамат (39-42);

3-метил-9-фенил-8-(4-{1-[(пиридин-3-илацетил)амино]циклопропил}фенил)[1,2,4]триазоло[3,4-f]-1,6- нафтиридин (39-43);

3-метил-9-фенил-8-(4-{1-[(хинолин-3-илкарбонил)амино]циклопропил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (39-44);

N-{1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропил}-2-(4-оксохиназолин-3(4H)-ил)ацетамид (39-45);

3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{1-[(пиридин-3-илацетил)амино]циклопропил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (39-46);

N-{(1R)-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}-2-пиридин-3-илацетамид (39-47);

N-{(1R)-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}ацетамид (39-48);

N-((1R)-1-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этил)-2-пиридин-3-илацетамид (39-49);

N-{1-метил-1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}ацетамид (39-50); и

N-{1-метил-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}ацетамид (39-51);

или их фармацевтически приемлемые соли, или стереоизомеры.

Соединения согласно настоящему изобретению могут иметь асимметричные центры, хиральные оси и хиральные плоскости (как описано в: E.L. Eliel and S.H. Wilen, Stereochemistry of Carbon Compounds, John Wiley & Sons, New York, 1994, pp.1119-1190) и встречаются в виде рацематов, рацемических смесей и в виде отдельных диастереомеров со всеми возможными изомерами и их смесями, включая оптические изомеры, причем все такие стереоизомеры включены в настоящее изобретение.

Кроме того, соединения, раскрытые в данном описании, могут существовать в виде таутомеров, и подразумевается, что обе таутомерные формы включены в объем изобретения, даже если изображены только одна таутомерная структура. Например, в объем настоящего изобретения входят следующие соединения:

Тетразолы существуют в виде смеси 1H/2H-таутомеров. Таутомерные формы остатка тетразола также входят в объем настоящего изобретения.

Когда какая-либо переменная (например R2, и т.д.) встречается более одного раза в любом компоненте, ее определение для каждого случая является независимым от определения в любом другом случае. Также комбинации заместителей и переменных допустимы только в том случае, когда такие комбинации приводят к образованию стабильных соединений. Линии, изображенные проходящими внутрь циклических систем от заместителей, означают, что указанная связь может быть образована с любым замещаемым атомом в цикле. Если кольцевая система является бициклической, то подразумевают, что связь образована с любым подходящим атомом в любом цикле бициклического остатка.

Понятно, что специалист в данной области может включить один или несколько атомов кремния (Si) в соединения согласно настоящему изобретению вместо одного или нескольких атомов углерода с получением соединений, которые являются химически стабильными и которые могут быть легко синтезированы способами, известными в данной области, из легко доступных исходных веществ. Атомы углерода и кремния отличаются своими ковалентными радиусами, что приводит к различиям в длине связи и пространственном расположении при сравнении аналогичных связей C-элемента и Si-элемента. Указанные различия приводят к едва уловимым изменениям размера и формы кремнийсодержащих соединений по сравнению с углеродными соединениями. Специалисту в данной области будет понятно, что различия в размере и форме могут приводить к едва заметным или существенным изменениям эффективности, растворимости, отсутствию не направленной к мишени активности, изменениям свойств укладки и т.д. (Diass, J. O. et al. Organometallics (2006) 5: 1188-1198; Showell, G.A. et al. Bioorganic and Medicinal Chemistry Letters (2006) 16: 2555-2558).

Понятно, что специалист в данной области может выбрать заместители и характер замещения соединений согласно настоящему изобретению, чтобы получить соединения, которые являются химически стабильными и которые могут быть легко синтезированы способами, известными в данной области, а также способами, описанными ниже, из легко доступных исходных веществ. Если заместитель сам по себе замещен более чем одной группой, то понятно, что такие многочисленные группы могут быть у одного и того же атома углерода или у разных атомов углерода, при условии, что в результате образуется стабильная структура. Фразу «необязательно замещен одним или несколькими заместителями» следует понимать как эквивалентную фразе «необязательно замещен по меньшей мере одним заместителем», и в таких случаях предпочтительный вариант будет иметь от нуля до четырех заместителей, а более предпочтительный вариант будет иметь от нуля до трех заместителей.

В используемом в данном описании смысле подразумевается, что термин «алкил» включает насыщенные алифатические углеводородные группы как с разветвленной, так и с неразветвленной цепью, имеющие указанное количество атомов углерода. Например, C1-C10, как в выражении «(C1-C10)алкил» по определению включает группы, имеющие 1, 2, 3, 4, 5, 6, 7, 8, 9 или 10 атомов углерода, расположенных в линейной или разветвленной цепи. Например, «(C1-C10)алкил», в частности, включает метил, этил, н-пропил, изопропил, н-бутил, трет-бутил, изобутил, пентил, гексил, гептил, октил, нонил, децил и т.д.

Термин «циклоалкил» означает моноциклическую насыщенную алифатическую углеводородную группу, имеющую указанное количество атомов углерода. Например, «циклоалкил» включает циклопропил, метилциклопропил, 2,2-диметилциклобутил, 2-этилциклопентил, циклогексил, и т.д.

«Алкоксигруппа» означает либо циклическую, либо нециклическую алкильную группу с указанным количеством атомов углерода, связанную кислородным мостиком. Поэтому термин «алкоксигруппа» охватывает определения алкила и циклоалкила, приведенные выше.

Если не указано количество атомов углерода, то термин «алкенил» относится к неароматическому углеводородному радикалу с неразветвленной цепью, с разветвленной цепью или циклическому, содержащему от 2 до 10 атомов углерода и по меньшей мере одну углерод-углеродную двойную связь. Предпочтительно присутствует одна углерод-углеродная двойная связь, и может присутствовать до четырех неароматических углерод-углеродных двойных связей. Таким образом, «(C2-C10)алкенил» означает алкенильный радикал, имеющий от 2 до 10 атомов углерода. Алкенильные группы включают этенил, пропенил, бутенил, 2-метилбутенил и циклогексенил. Имеющая неразветвленную цепь, разветвленную цепь или циклическая часть алкенильной группы может содержать двойные связи и может быть замещена, если указана, замещенная алкенильная группа.

Термин «алкинил» относится к углеводородному радикалу с неразветвленной цепью, с разветвленной цепью или циклическому, содержащему от 2 до 10 атомов углерода и по меньшей мере одну углерод-углеродную тройную связь. Может присутствовать до трех углерод-углеродных тройных связей. Таким образом, «(C2-C10)алкинил» означает алкинильный радикал, имеющий от 2 до 10 атомов углерода. Алкинильные группы включают этинил, пропинил, бутинил, 3-метилбутинил и т.д. Имеющая неразветвленную цепь, разветвленную цепь или циклическая часть алкинильной группы может содержать тройные связи и может быть замещена, если указана, замещенная алкинильная группа.

В некоторых случаях заместители могут быть определены с указанием диапазона количества атомов углерода, который включает ноль, например (C0-C6)алкиленарил. Если допустить, что арил представляет собой фенил, то определение будет включать фенил как таковой, а также -CH2Ph, -CH2CH2Ph, CH(CH3)CH2CH(CH3)Ph и т.д.

В используемом в данном описании смысле подразумевают, что «арил» означает любой стабильный моноциклический или бициклический углеродный цикл, имеющий до 7 атомов в каждом цикле, при этом по меньшей мере один цикл является ароматическим. Примеры таких арильных групп включают фенил, нафтил, тетрагидронафтил, инданил и бифенил. В тех случаях, когда арильный заместитель является бициклическим и один цикл является неароматическим, понятно, что связывание происходит посредством ароматического цикла.

Термин гетероарил в используемом в данном описании смысле означает стабильную моноциклическую или бициклическую кольцевую систему, имеющую до 7 атомов в каждом цикле, при этом по меньшей мере один цикл является ароматическим и содержит от 1 до 4 гетероатомов, выбранных из группы, состоящей из O, N и S. Гетероарильные группы в объеме данного определения включают без ограничения: акридинил, карбазолил, циннолинил, хиноксалинил, пирразолил, индолил, бензотриазолил, фуранил, тиенил, бензотиенил, бензофуранил, хинолинил, изохинолинил, оксазолил, изоксазолил, индолил, пиразинил, пиридазинил, пиридинил, пиримидинил, пирролил, тетрагидрохинолин. Как и в случае определения гетероцикла, приведенного ниже, также понимают, что «гетероарил» включает N-оксидное производное любого азотсодержащего гетероарила. В тех случаях, когда гетероарильный заместитель является бициклическим, и один цикл является неароматическим или не содержит гетероатомов, понятно, что связывание осуществляется посредством ароматического цикла или посредством содержащего гетероатомы цикла, соответственно. Такие гетероарильные остатки в случае заместителя Q включают без ограничения: 2-бензимидазолил, 2-хинолинил, 3-хинолинил, 4-хинолинил, 1-изохинолинил, 3-изохинолинил и 4-изохинолинил.

Термин «гетероцикл» или «гетероциклил» в используемом в данном описании смысле означает 3-10-членный ароматический или неароматический гетероцикл, содержащий от 1 до 4 гетероатомов, выбранных из группы, состоящей из O, N и S, и включает бициклические группы. Следовательно, «гетероциклил» включает указанные выше гетероарилы, а также их дигидро- и тетрагидро-аналоги. Дополнительные примеры «гетероциклила» включают без ограничения следующие группы: бензоимидазолил, бензоимидазолонил, бензофуранил, бензофуразанил, бензопиразолил, бензотриазолил, бензотиофенил, бензоксазолил, карбазолил, карболинил, циннолинил, фуранил, имидазолил, индолинил, индолил, индолазинил, индазолил, изобензофуранил, изоиндолил, изохинолил, изотиазолил, изоксазолил, нафтпиридинил, оксадиазолил, оксазолил, оксазолин, изоксазолин, оксетанил, пиранил, пиразинил, пиразолил, пиридазинил, пиридопиридинил, пиридазинил, пиридил, пиримидил, пирролил, хиназолинил, хинолил, хиноксалинил, тетрагидропиранил, тетразолил, тетразолопиридил, тиадиазолил, тиазолил, тиенил, триазолил, азетидинил, 1,4-диоксанил, гексагидроазепинил, пиперазинил, пиперидинил, пиридин-2-онил, пирролидинил, морфолинил, тиоморфолинил, дигидробензоимидазолил, дигидробензофуранил, дигидробензотиофенил, дигидробензоксазолил, дигидрофуранил, дигидроимидазолил, дигидроиндолил, дигидроизооксазолил, дигидроизотиазолил, дигидрооксадиазолил, дигидрооксазолил, дигидропиразинил, дигидропиразолил, дигидропиридинил, дигидропиримидинил, дигидропирролил, дигидрохинолинил, дигидротетразолил, дигидротиадиазолил, дигидротиазолил, дигидротиенил, дигидротриазолил, дигидроазетидинил, метилендиоксибензоил, тетрагидрофуранил и тетрагидротиенил и их N-оксиды. Связывание гетероциклильного заместителя может происходить через атом углерода или через гетероатом.

Как будет понятно специалистам в данной области, подразумевается, что «галоген» в используемом в данном описании смысле включает хлор (Cl), фтор (F), бром (Br) и йод (I).

В варианте формул A, B, C или D остаток, представленный формулой:

включает следующие структуры, которые являются только иллюстративными, а не ограничивающими:

В другом варианте формул A, B, C или D остаток, изображенный формулой:

представляет собой:

В одном варианте кольцо Z выбрано из фенила и гетероциклила. В другом кольцо Z выбрано из

В еще одном варианте кольцо Z представляет собой фенил.

В одном варианте p независимо равен 0, 1, 2 или 3.

В следующем варианте p независимо равен 0, 1 или 2.

В другом варианте p независимо равен 1.

В одном варианте r равен 0, 1, 2 или 3.

В следующем варианте r равен 0, 1 или 2.

В другом варианте r равен 1.

В одном варианте Q выбран из бензоимидазолила, бензоимидазолонила, бензофуранила, бензофуразанила, бензопиразолила, бензотриазолила, бензотиофенила, бензоксазолила, карбазолила, карболинила, циннолинила, фуранила, имидазолила, индолинила, индолила, индолазинила, индазолила, изобензофуранила, изоиндолила, изохинолила, изотиазолила, изоксазолила, нафтпиридинила, оксадиазолила, оксазолила, оксазолина, изоксазолина, оксетанила, пиранила, пиразинила, пиразолила, пиридазинила, пиридопиридинила, пиридазинила, пиридила, пиримидила, пирролила, хиназолинила, хинолила, хиноксалинила, тетрагидропиранила, тетразолила, тетразолопиридила, тиадиазолила, тиазолила, тиенила, триазолила, азетидинила, 1,4-диоксанила, гексагидроазепинила, пиперазинила, пиперидинила, пиридин-2-онила, пирролидинила, морфолинила, тиоморфолинила, дигидробензоимидазолила, дигидробензофуранила, дигидробензотиофенила, дигидробензоксазолила, дигидрофуранила, дигидроимидазолила, дигидроиндолила, дигидроизооксазолила, дигидроизотиазолила, дигидрооксадиазолила, дигидрооксазолила, дигидропиразинила, дигидропиразолила, дигидропиридинила, дигидропиримидинила, дигидропирролила, дигидрохинолинила, дигидротетразолила, дигидротиадиазолила, дигидротиазолила, дигидротиенила, дигидротриазолила, дигидроазетидинила, метилендиоксибензоила, тетрагидрофуранила и тетрагидротиенила и их N-оксидов, необязательно замещенных одним-тремя заместителями, выбранными из R6a. Связывание гетероциклильного заместителя может происходить посредством атома углерода или посредством гетероатома.

В следующем варианте Q выбран из 2-азепинона, бензимидазолила, бензимидазолонила, 2-диазапинона, имидазолила, 2-имидазолидинона, индолила, изохинолинила, морфолинила, пиперидила, пиперазинила, пиридила, пирролидинила, 2-пиперидинона, 2-пиримидинона, 2-пироллидинона, хинолинила, тетразолила, тетрагидрофурила, тетрагидроизохинолинила и тиенила, необязательно замещенных одним-тремя заместителями, выбранными из R6a. Связывание гетероциклильного заместителя может происходить посредством атома углерода или посредством гетероатома.

В еще одном варианте, когда Q означает гетероциклил, Q выбран из

которые необязательно замещены одним-тремя заместителями, выбранными из R6a.

В еще одном варианте, когда Q означает гетероциклил, Q выбран из

которые необязательно замещены одним заместителем, выбранным из R6a.

В одном варианте R1 выбран из оксогруппы, (C=O)aOb(C1-C10)алкила, (C=O)aOb-арила, (C=O)aOb(C2-C10)алкенила, (C=O)aOb(C2-C10)алкинила, CO2H, галогена, OH, Ob(C1-C6)перфторалкила, (C=O)aNR7R8, CN, (C=O)aOb(C3-C8)циклоалкила, S(O)2NR7R8, SH, S(O)2-(C1-C10)алкила и (C=O)aOb-гетероциклила, где указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены R6a.

В другом варианте R1 выбран из оксогруппы, (C=O)aOb(C1-C10)алкила, CO2H, галогена, OH, CN, (C1-C6)алкоксигруппы, S(O)2NR7R8, SH, S(O)2-(C1-C10)алкила, O(C=O)(C1-C6)алкила и N(Rb)2, где указанный алкил необязательно замещен R6a.

В другом варианте R1 выбран из оксогруппы, NH2, OH, SH, Oa(C1-C6)алкила, где указанный алкил необязательно замещен R6a.

В одном варианте R1 выбран из H, оксогруппы, (C=O)aOb(C1-C10)алкила, (C=O)aOb-арила, (C=O)aOb(C2-C10)алкенила, (C=O)aOb(C2-C10)алкинила, CO2H, галогена, OH, Ob(C1-C6)перфторалкила, (C=O)aNR7R8, CN, (C=O)aOb(C3-C8)циклоалкила, S(O)2NR7R8, SH, S(O)2-(C1-C10)алкила и (C=O)aOb-гетероциклила, где указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены R6a.

В другом варианте R1 выбран из H, оксогруппы, (C=O)aOb(C1-C10)алкила, CO2H, галогена, OH, CN, (C1-C6)алкоксигруппы, S(O)2NR7R8, SH, S(O)2-(C1-C10)алкила, O(C=O)(C1-C6)алкила и N(Rb)2, где указанный алкил необязательно замещен R6a.

В другом варианте R1 выбран из H, оксогруппы, NH2, OH, SH, Oa(C1-C6)алкила, где указанный алкил необязательно замещен R6a.

В одном варианте R2 выбран из оксогруппы, (C=O)aOb(C1-C10)алкила, (C=O)aOb-арила, (C=O)aOb(C2-C10)алкенила, (C=O)aOb(C2-C10)алкинила, CO2H, галогена, OH, Ob(C1-C6)перфторалкила, (C=O)aNR7R8, CN, (C=O)aOb(C3-C8)циклоалкила, S(O)2NR7R8, S(O)2-(C1-C10)алкила и (C=O)aOb-гетероциклила, где указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены Rb, OH, (C1-C6)алкоксигруппой, галогеном, CO2H, CN, O(C=O)(C1-C6)алкилом, оксогруппой и N(Rb)2.

В другом варианте R2 выбран из оксогруппы, (C=O)aOb(C1-C10)алкила, CO2H, галогена, OH, CN, (C1-C6)алкоксигруппы, O(C=O)(C1-C6)алкила, (C2-C10)алкенила и N(Rb)2, где указанный алкил необязательно замещен Rb, OH, (C1-C6)алкоксигруппой, галогеном, CO2H, CN, O(C=O)(C1-C6)алкилом, оксогруппой и N(Rb)2.

В одном варианте R3 выбран из H, оксогруппы, Ob(C1-C10)алкила, Ob-арила, Ob(C2-C10)алкенила, Ob(C2-C10)алкинила, галогена, OH, Ob(C1-C6)перфторалкила, (C=O)aNR7R8, CN, (C=O)aOb(C3-C8)циклоалкила, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкила, (C1-C6)алкилгетероциклила и (C=O)aOb-гетероциклил, где указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены одним или несколькими заместителями, выбранными из R6.

В другом варианте R3 выбран из (C1-C10)алкила, арила, (C2-C10)алкенила, (C2-C10)алкинила, галогена, NR7R8, CN, (C3-C8)циклоалкила, S(O)mNR7R8, SH, S(O)m-(C1-C10)алкила, (C1-C6)алкилгетероциклила и (C=O)aOb-гетероциклила, где указанный алкил, арил, алкенил, алкинил, циклоалкил и гетероциклил необязательно замещены одним или несколькими заместителями, выбранными из R6.

В другом варианте R3 выбран из (C1-C10)алкила, при этом указанный алкил необязательно замещен одним-тремя заместителями, выбранными из NH2, OH, оксогруппы и галогена.

В другом варианте R4 и R5 означают H.

В одном варианте, когда Q замещен R6a, указанный R6a является гетероциклилом, необязательно имеющим до трех заместителей, выбранных из Rb, OH, (C1-C6)алкоксигруппы, галогена, CO2H, CN, Oa(C=O)b(C1-C6)алкила, оксогруппы и N(Rb)2.

В другом варианте, когда Q замещен R6a, указанный R6a выбран из

необязательно замещенных 1-3 заместителями, выбранными из оксогруппы, OH, N(Rb)2, галогена и Oa(C1-C6)алкила.

В одном варианте Rb независимо выбран из H и (C1-C6)алкила.

В одном варианте формулы J R4 и R5 независимо означают H и CH3, или R4 и R5 могут быть связаны с образованием циклопропила.

В объем настоящего изобретения включена свободная форма соединений формулы A, а также их фармацевтически приемлемые соли и стереоизомеры. Некоторые конкретные выделенные соединения, приведенные в данном описании в качестве примеров, представляют собой протонированные соли аминных соединений. Термин «свободная форма» относится к аминным соединениям в несолевой форме. Включенные в изобретение фармацевтически приемлемые соли включают не только отдельные соли, приведенные в качестве примеров для конкретных соединений, описанных в данной публикации, но также все типичные фармацевтически приемлемые соли свободной формы соединений формулы A. Свободная форма конкретного описанного соединения в виде соли может быть выделена способами, известными в данной области. Например, свободная форма может быть восстановлена обработкой соли подходящим разбавленным водным раствором основания, таким как разбавленный водный раствор NaOH, карбоната калия, аммиака и бикарбоната натрия. Свободные формы в некоторой степени могут отличаться от соответствующих им солевых форм по некоторым физическим свойствам, таким как растворимость в полярных растворителях, но в других отношениях соли кислот и оснований фармацевтически эквивалентны соответствующим свободным формам в целях изобретения.

Фармацевтически приемлемые соли предлагаемых соединений могут быть синтезированы из соединений согласно настоящему изобретению, которые содержат остаток основания или кислоты, обычными химическими способами. В общем соли основных соединений получают либо ионообменной хроматографией, либо посредством взаимодействия свободного основания со стехиометрическими количествами или с избытком требуемой образующей соли неорганической или органической кислоты в подходящем растворителе или различных комбинациях растворителей. Подобным образом соли кислотных соединений образуют посредством взаимодействия с подходящим неорганическим или органическим основанием.

Таким образом, фармацевтически приемлемые соли соединений согласно настоящему изобретению включают обычные нетоксичные соли соединений согласно настоящему изобретению, которые образованы при взаимодействии соединения согласно изобретению в виде основания с неорганической или органической кислотой. Например, обычные нетоксичные соли включают соли, полученные из неорганических кислот, таких как хлористоводородная, бромистоводородная, серная, сульфаминовая, фосфорная, азотная и тому подобные, а также соли, полученные из органических кислот, таких как уксусная, пропионовая, янтарная, гликолевая, стеариновая, молочная, яблочная, винная, лимонная, аскорбиновая, памовая, малеиновая, гидроксималеиновая, фенилуксусная, глутаминовая, бензойная, салициловая, сульфаниловая, 2-ацетоксибензойная, фумаровая, толуолсульфоновая, метансульфоновая, этандисульфоновая, щавелевая, изетионовая, трифторуксусная (ТФУ) и т.п.

В том случае, когда соединение согласно настоящему изобретению является кислотным, термин «фармацевтически приемлемые соли» относится к солям, полученным из фармацевтически приемлемых нетоксичных оснований, включая неорганические основания и органические основания. Соли, полученные из неорганических оснований, включают соли алюминия, аммония, кальция, меди, трехвалентного железа, двухвалентного железа, лития, магния, трехвалентного марганца, двухвалентного марганца, калия, натрия, цинка и тому подобные. Особенно предпочтительными являются соли аммония, кальция, магния, калия и натрия. Соли, полученные из фармацевтически приемлемых органических нетоксичных оснований, включают соли первичных, вторичных и третичных аминов, замещенных аминов, включая встречающиеся в природе замещенные амины, циклических аминов и основных ионообменных смол, таких как смолы на основе аргинина, бетаина, кофеина, холина, N,N1-дибензилэтилендиамина, диэтиламина, 2-диэтиламиноэтанола, 2-диметиламиноэтанола, этаноламина, этилендиамина, N-этилморфолина, N-этилпиперидина, глюкамина, глюкозамина, гистидина, гидрабамина, изопропиламина, лизина, метилглюкамина, морфолина, пиперазина, пиперидина, полиаминовой смолы, прокаина, пуринов, теобромина, триэтиламина, триметиламина, трипропиламина, трометамина и т.п.

Получения фармацевтически приемлемых солей, описанных выше, и других типичных фармацевтически приемлемых солей более полно описаны в Berg et al., «Pharmaceutical Salts», J. Pharm. Sci., 1977: 66: 1-19.

Также будет указано, что соединения согласно настоящему изобретению могут представлять собой внутренние соли или цвиттерионы, так как в физиологических условиях депротонированный кислотный остаток в соединении, такой как карбоксильная группа, может быть анионным, и такой электронный заряд затем может быть внутренне сбалансирован катионным зарядом протонированного или алкилированного основного остатка, такого как четвертичный атом азота.

Применимость

Соединения согласно настоящему изобретению являются ингибиторами активности Akt и таким образом применимы для лечения злокачественной опухоли, в частности злокачественных опухолей, связанных с ненормальной активностью Akt и находящихся в каскаде ниже клеточных мишеней Akt. Такие злокачественные опухоли включают без ограничения рак яичника, поджелудочной железы, молочной железы и простаты, а также злокачественные опухоли (включая глиобластому), при которых мутирует опухолевый супрессор PTEN (Cheng et al., Proc. Natl. Acad. Sci. (1992) 89: 9267-9271; Cheng et al., Proc. Natl. Acad. Sci. (1996) 93: 3636-3641; Bellacosa et al., Int. J. Cancer (1995) 64: 280-285; Nakatani et al., J. Biol. Chem. (1999) 274: 21528-21532; Graff, Expert. Opin. Ther. Targets (2002) 6(l): 103-113; и Yamada and Araki, J. Cell Science. (2001) 114: 2375-2382; Mischel and Cloughesy, Brain Pathol. (2003) 13(1): 52-61).

Соединения, композиции и способы, предлагаемые в изобретении, применимы для лечения злокачественной опухоли. Злокачественные опухоли, которые можно лечить соединениями, композициями и способами согласно изобретению, включают без ограничения: злокачественные опухоли сердца: саркому (ангиосаркому, фибросаркому, рабдомиосаркому, липосаркому), миксому, рабдомиому, фиброму, липому и тератому; легких: бронхогенную карциному (плоскоклеточную, недифференцированную мелкоклеточную, недифференцированную крупноклеточную, аденокарциному), альвеолярную (бронхиолярную) карциному, аденому бронхов, саркому, лимфому, хондроматозную гамартому, мезотелиому; желудочно-кишечного тракта: пищевода (плоскоклеточную карциному, аденокарциному, лейомиосаркому, лимфому), желудка (карциному, лимфому, лейомиосаркому), поджелудочной железы (аденокарциному протока, инсулиному, глюкагоному, гастриному, карциноидные опухоли, випому), тонкого кишечника (аденокарциному, лимфому, карциноидные опухоли, саркому Капоши, лейомиому, гемангиому, липому, нейрофиброму, фиброму), толстого кишечника (аденокарциному, тубулярную аденому, ворсинчатую аденому, гамартому, лейомиому), ободочной кишки, ободочной и прямой кишки, прямой кишки; мочеполового тракта: почек (аденокарциному, опухоль Вильма [нефробластому], лимфому, лейкоз), мочевого пузыря и уретры (плоскоклеточную карциному, переходно-клеточную карциному, аденокарциному), простаты (аденокарциному, саркому), семенников (семиному, тератому, эмбриональную карциному, тератокарциному, хориокарциному, саркому, интерстициально-клеточную карциному, фиброму, фиброаденому, аденоматоидную опухоль, липому); печени: гепатому (гепатоклеточную карциному), холангиокарциному, гепатобластому, ангиосаркому, гепатоклеточную аденому, гемангиому; костей: остеогенную саркому (остеосаркому), фибросаркому, злокачественную фиброзную гистиоцитому, хондросаркому, саркому Эвинга, злокачественную лимфому (ретикулоклеточную саркому), множественную миелому, злокачественную гигантоклеточную опухоль, хордому, остеохондрому (костно-хрящевой экзостоз), доброкачественную хондрому, хондробластому, хондромиксофиброму, остеоидную остеому и гигантоклеточные опухоли; нервной системы: черепа (остеому, гемангиому, гранулему, ксантому, деформирующий остеит), оболочек мозга (менингиому, менингиосаркому, глиоматоз), головного мозга (астроцитому, медуллобластому, глиому, эпендимому, герминому [пинеалому], глиобластому, олигодендроглиому, шванному, ретинобластому, врожденные опухоли), нейрофиброму спинного мозга (менингиому, глиому, саркому); гинекологические: матки (эндометриальную карциному), шейки матки (карциному шейки матки, предопухолевую дисплазию шейки матки), яичников (карциному яичников [серозную цистаденокарциному, мукоидную цистаденокарциному, неклассифицированную карциному], опухоли гранулезно-текальных клеток, опухоли клеток Сертоли-Лейдига, дисгерминому, злокачественную тератому), вульвы (плоскоклеточную карциному, внутриэпителиальную карциному, аденокарциному, фибросаркому, меланому), влагалища (светлоклеточную карциному, плоскоклеточную карциному, смешанную мезодермальную опухоль (эмбриональную рабдомиосаркому), фаллопиевых труб (карциному); гематологические: крови (миелоидный лейкоз [острый и хронический], острый лимфобластный лейкоз, хронический лимфоцитарный лейкоз, миелопролиферативные заболевания, множественную миелому, миелодиспластический синдром), болезнь Ходжкина, неходжкинскую лимфому [злокачественную лимфому]; кожи: злокачественную меланому, базально-клеточную карциному, плоскоклеточную карциному, саркому Капоши, синдром диспластического невуса, липому, ангиому, дерматофиброму, келоиды, псориаз; и надпочечных желез: нейробластому. Таким образом, термин «злокачественная клетка», который встречается в данном описании, включает клетку, пораженную любым из указанных выше состояний.

Злокачественные опухоли, которые можно лечить соединениями, композициями и способами согласно изобретению, включают без ограничения: рак молочной железы, простаты, ободочной кишки, прямой и ободочной кишки, легкого, головного мозга, семенников, желудка, поджелудочной железы, кожи, тонкого кишечника, толстого кишечника, горла, головы и шеи, ротовой полости, кости, печени, мочевого пузыря, почки, щитовидной железы и крови.

Злокачественные опухоли, которые можно лечить соединениями, композициями и способами согласно изобретению, включают рак молочной железы, простаты, ободочной кишки, яичников, прямой и ободочной кишки и легкого.

Злокачественные опухоли, которые можно лечить соединениями, композициями и способами согласно изобретению, включают рак молочной железы, ободочной кишки (прямой и ободочной кишки) и легкого.

Злокачественные опухоли, которые можно лечить соединениями, композициями и способами согласно изобретению, включают лимфому и лейкоз.

Передача сигнала Akt регулирует множество важных стадий ангиогенеза. Shiojima and Walsh, Circ. Res. (2002) 90: 1243-1250. Применение ингибиторов ангиогенеза для лечения злокачественной опухоли известно из литературы, см., например J. Rak et al. Cancer Research, 55: 4575-4580, 1995 и Dredge et al., Expert Opin. Biol. Ther. (2002) 2(8): 953-966. Роль ангиогенеза в развитии злокачественной опухоли показана в случае многих типов злокачественных опухолей и тканей: карциномы молочной железы (G. Gasparini and A.L. Harris, J. Clin. Oncol., 1995, 13: 765-782; M. Toi et al., Japan. J. Cancer Res., 1994, 85: 1045-1049); карцином мочевого пузыря (A.J. Dickinson et al., Br. J. Urol, 1994, 74: 762-766); карциномы ободочной кишки (L.M. Ellis et al., Surgery, 1996, 120(5): 871-878) и опухоли ротовой полости (J.K. Williams et al., Am. J. Surg., 1994, 168: 373-380). Другие злокачественные опухоли включают опухоли на поздней стадии, лейкоз ворсистых клеток, меланому, рак головы и шеи на поздней стадии, метастатический почечно-клеточный рак, неходжкинскую лимфому, метастатический рак молочной железы, аденокарциному молочной железы, меланому на поздней стадии, рак поджелудочной железы, желудка, глиобластому, рак легкого, яичника, немелкоклеточный рак легкого, рак простаты, мелкоклеточный рак легкого, почечно-клеточную карциному, различные твердые опухоли, множественную миелому, метастатический рак простаты, злокачественную глиому, рак почек, лимфому, рефрактерное метастатическое заболевание, рефрактерную множественную миелому, рак шейки матки, саркому Капоши, рецидивирующую анапластическую глиому и метастатический рак ободочной кишки (Dredge et al., Expert Opin. Biol. Ther. (2002) 2(8): 953-966). Таким образом, ингибиторы Akt, раскрытые в настоящей заявке, также применимы для лечения указанных связанных с ангиогенезом злокачественных опухолей.

Опухоли, которые подверглись неоваскуляризации, с большей вероятностью образуют метастазы. Действительно, ангиогенез имеет важное значение для роста опухоли и образования метастазов (S. P. Cunningham, et al., Can. Research, 61: 3206-3211 (2001)). Поэтому ингибиторы Akt, раскрытые в настоящей заявке, также применимы для предотвращения или уменьшения метастазов опухолевых клеток.

Кроме того, в объем изобретения включен способ лечения или профилактики заболевания, в которое вовлечен ангиогенез, который заключается во введении млекопитающему, нуждающемуся в таком лечении, терапевтически эффективного количества соединения согласно настоящему изобретению. Связанные с неоваскуляризацией заболевания глаз являются примером состояний, при которых большая часть конечного повреждения ткани может быть объяснена аномальным прорастанием кровеносных сосудов в глаз (см. WO 00/30651, опубл. 2 июня 2000). Нежелательное прорастание может быть запущено ишемической ретинопатией, например, в результате диабетической ретинопатии, ретинопатии, вызванной преждевременными родами, окклюзией вен сетчатки и т.д., или дегенеративными заболеваниями, такими как хороидальная неоваскуляризация, наблюдаемая в случае возрастной дегенерации желтого пятна. Поэтому ингибирование роста кровеносных сосудов введением соединений согласно изобретению предотвращает прорастание кровеносных сосудов и позволяет предотвращать или лечить заболевания, в которые вовлечен ангиогенез, такие как заболевания глаз, подобные васкуляризации сетчатки, диабетической ретинопатии, возрастной дегенерации желтого пятна и т.п.

Кроме того, в объем изобретения включен способ лечения или профилактики незлокачественного заболевания, в которое вовлечен ангиогенез, включая без ограничения: глазных болезней (такие как васкуляризация сетчатки, диабетическая ретинопатия и возрастная дегенерация желтого пятна), атеросклероз, артрит, псориаз, ожирение и болезнь Альцгеймера (Dredge et al., Expert Opin. Biol. Ther. (2002) 2(8): 953-966). В другом варианте способ лечения или профилактики заболевания, в которые вовлечен ангиогенез, включает способ лечения или профилактики: глазных болезней (таких как васкуляризация сетчатки, диабетическая ретинопатия и возрастная дегенерация желтого пятна), атеросклероза, артрита и псориаза.

Кроме того, в объем изобретения включен способ лечения гиперпролиферативных расстройств, таких как рестеноз, воспаление, аутоиммунные заболевания и аллергия/астма.

В объем настоящего изобретения также включено применение соединений согласно изобретению для покрывания стентов и поэтому применение настоящих соединений на покрытых ими стентах для лечения и/или профилактики рестеноза (WO 03/032809).

Кроме того, в объем настоящего изобретения включено применение соединений согласно изобретению для лечения и/или профилактики остеоартрита (WO 03/035048).

Кроме того, в объем изобретения включен способ лечения гиперинсулинизма.

Соединения согласно изобретению также применимы для получения лекарственного средства, которое применимо для лечения описанных выше заболеваний, в частности злокачественной опухоли.

В одном варианте осуществления изобретения предлагаемое соединение является избирательным ингибитором, ингибирующая эффективность которого зависит от PH-домена. В данном варианте соединение проявляет пониженную ингибирующую активность in vitro или отсутствие ингибирующей активности in vitro против укороченных белков Akt, в которых отсутствует PH-домен.

В следующем варианте соединение согласно настоящему изобретению выбрано из группы, состоящей из избирательного ингибитора Akt1, избирательного ингибитора Akt2 и избирательного ингибитора Akt1 и Akt2.

В другом варианте соединение согласно настоящему изобретению выбрано из группы, состоящей из избирательного ингибитора Akt1, избирательного ингибитора Akt2, избирательного ингибитора Akt3 и избирательного ингибитора двух из трех изоформ Akt.

В другом варианте соединение согласно настоящему изобретению является избирательным ингибитором всех трех изоформ Akt, но не является ингибитором одной, двух или всех таких изоформ Akt, которые были модифицированы с удалением PH-домена, шарнирной области или одновременно PH-домена и шарнирной области.

Настоящее изобретение, кроме того, относится к способу ингибирования активности Akt, который включает в себя введение нуждающемуся в этом млекопитающему фармацевтически эффективного количества соединения согласно настоящему изобретению.

Соединения согласно настоящему изобретению могут быть введены млекопитающим, включая человека, либо отдельно, либо в комбинации с фармацевтически приемлемыми носителями, эксципиентами или разбавителями в фармацевтической композиции согласно стандартной фармацевтической практике. Соединения могут быть введены перорально или парентерально, включая внутривенный, внутримышечный, внутрибрюшинный, подкожный, ректальный и местный пути введения.

Фармацевтические композиции, содержащие активный ингредиент, могут быть в форме, подходящей для перорального применения, например, в виде таблеток, пилюль, лепешек, водных и масляных суспензий, диспергируемых порошков или гранул, эмульсий, твердых и мягких капсул или сиропов либо эликсиров. Композиции, предназначенные для перорального применения, могут быть получены любым способом, известным в данной области для производства фармацевтических композиций, и такие композиции могут содержать один или несколько агентов, выбранных из группы, состоящей из подсластителей, корригентов, красителей и консервантов, чтобы получить качественные и приятные на вкус фармацевтические препараты. Таблетки содержат активный ингредиент в смеси с нетоксичными фармацевтически приемлемыми эксципиентами, которые подходят для производства таблеток. Указанными эксципиентами могут быть, например, инертные разбавители, такие как карбонат кальция, карбонат натрия, лактоза, фосфат кальция или фосфат натрия; гранулирующие и дезинтегрирующие средства, например микрокристаллическая целлюлоза, натрий-кроскармелоза, кукурузный крахмал или альгиновая кислота; связывающие агенты, например крахмал, желатин, поливинилпирролидон или аравийская камедь, и скользящие агенты, например стеарат магния, стеариновая кислота или тальк. Таблетки могут быть без покрытия или могут быть покрыты известными способами, чтобы замаскировать неприятный вкус лекарственного средства или замедлить расщепление и всасывание в желудочно-кишечном тракте и тем самым обеспечить непрерывное действие в течение более длительного периода времени. Например, можно использовать растворимое в воде маскирующее вкус вещество, такое как гидроксипропилметилцелллоза или гидроксипропилцеллюлоза, либо замедляющее вещество, такое как этилцеллюлоза, ацетат-бутират целлюлозы.

Препараты для перорального применения также могут быть предложены в виде твердых желатиновых капсул, в которых активный ингредиент смешан с инертным разбавителем, например карбонатом кальция, фосфатом кальция или каолином, или в виде мягких желатиновых капсул, в которых активный ингредиент смешан с водорастворимым носителем, таким как полиэтиленгликоль или масляная среда, например арахисовое масло, жидкий парафин или оливковое масло.

Водные суспензии содержат активное вещество в смеси с эксципиентами, подходящими для производства водных суспензий. Такими эксципиентами являются суспендирующие агенты, например натрийкарбоксиметилцеллюлоза, метилцеллюлоза, гидроксипропилметилцеллюлоза, альгинат натрия, поливинилпирролидон, трагакантовая камедь и аравийская камедь; диспергирующими агентами или увлажнителями могут быть встречающийся в природе фосфатид, например лецитин, или продукты конденсации алкиленоксида с жирными кислотами, например полиоксиэтиленстеарат, или продукты конденсации этиленоксида с алифатическими спиртами с длинными цепями, например гептадекаэтиленоксицетанол, или продукты конденсации этиленоксида с неполными сложными эфирами, полученными из жирных кислот и гексита, такие как моноолеат полиоксиэтиленсорбита, или продукты конденсации этиленоксида с неполными сложными эфирами, полученными из жирных кислот и гекситовых ангидридов, например моноолеат полиэтиленсорбитана. Водные суспензии также могут содержать один или несколько консервантов, например этил-, или н-пропил-п-гидроксибензоат, один или несколько красителей, один или несколько корригентов и один или несколько подсластителей, таких как сахароза, сахарин или аспартам.

Масляные суспензии могут быть приготовлены суспендированием активного ингредиента в растительном масле, например арахисовом масле, оливковом масле, кунжутном масле или кокосовом масле, или в растительном масле, таком как жидкий парафин. Масляные суспензии могут содержать загуститель, например пчелиный воск, твердый парафин или цетиловый спирт. Могут быть добавлены подсластители, такие как подсластители, указанные выше, и корригенты, чтобы получить приятный на вкус пероральный препарат. В такие композиции в качестве консерванта может быть добавлен антиоксидант, такой как бутилированный гидроксианизол или альфа-токоферол.

Дисперсные порошки и гранулы, подходящие для получения водной суспензии добавлением воды, позволяют получать активный ингредиент в смеси с диспергирующим агентом или увлажнителем, суспендирующим агентом и одним или несколькими консервантами. Примерами подходящих диспергирующих агентов или увлажнителей и суспендирующих агентов являются агенты, уже указанные выше. Также могут присутствовать дополнительные эксципиенты, например подсластители, корригенты и красители. В такие композиции в качестве консерванта может быть добавлен антиоксидант, такой как аскорбиновая кислота.

Фармацевтические композиции согласно изобретению также могут быть в форме эмульсии масло в воде. Масляной фазой может быть растительное масло, например оливковое масло или арахисовое масло, или минеральное масло, например жидкий парафин, или их смеси. Подходящими эмульгаторами могут быть встречающиеся в природе фосфатиды, например лецитин сои, и сложные эфиры или неполные сложные эфиры, полученные из жирных кислот и гекситовых ангидридов, например моноолеат сорбитана, и продукты конденсации указанных неполных сложных эфиров с этиленоксидом, например моноолеат полиоксиэтиленсорбитана. Эмульсии также могут содержать подсластители, корригенты, консерванты и антиоксиданты.

Сиропы и эликсиры могут быть приготовлены с подсластителями, например глицерином, пропиленгликолем, сорбитом или сахарозой. Такие препараты также могут содержать средства, уменьшающие раздражение, консерванты, корригенты и красители и антиоксидант.

Фармацевтические композиции могут быть в форме стерильных инъекционных водных растворов. К приемлемым наполнителям и растворителям, которые можно использовать, относятся вода, раствор Рингера и изотонический раствор хлорида натрия.

Стерильный инъекционный препарат также может представлять собой стерильную инъекционную микроэмульсию «масло в воде», в которой активный ингредиент растворен в масляной фазе. Например, активный ингредиент может быть сначала растворен в смеси соевого масла и лецитина. Затем масляный раствор вводят в смесь воды и глицерина и обрабатывают, образуя микроэмульсию.

Инъекционные растворы или микроэмульсии могут быть введены в кровоток пациента посредством локальной болюсной инъекции. Альтернативно преимущественным может быть введение раствора или микроэмульсии таким путем, который поддерживает постоянную концентрацию в циркулирующей крови соединения согласно настоящему изобретению. Чтобы поддерживать такую постоянную концентрацию можно использовать устройство для непрерывной внутривенной доставки. Примером такого устройства является внутривенный насос Deltec CADD-PLUSTM модель 5400.

Фармацевтические композиции могут быть в форме стерильной инъекционной водной или масляной суспензии для внутримышечного и подкожного введения. Такая суспензия может быть приготовлена согласно известному уровню техники с использованием подходящих диспергирующих агентов или увлажнителей и суспендирующих агентов, которые были описаны выше. Стерильный инъекционный препарат также может представлять собой стерильный инъекционный раствор или суспензию в нетоксичном приемлемом для парентерального введения разбавителя или растворителя, например в виде раствора в 1,3-бутандиоле. Кроме того, в качестве растворителя или суспензионной среды обычно используют стерильные нелетучие масла. Для этой цели можно использовать мягкое нелетучее масло, включая синтетические моно- или диглицериды. Кроме того, для приготовления инъекционных препаратов используют жирные кислоты, такие как олеиновая кислота.

Соединения формулы A также можно вводить в форме суппозиториев для ректального введения лекарственного средства. Такие композиции могут быть приготовлены смешиванием лекарственного средства с подходящим не раздражающим эксципиентом, который является твердым при обычных температурах, но становится жидким при ректальной температуре и поэтому будет плавиться в прямой кишке, высвобождая лекарственное средство. Такие вещества включают масло какао, глицеринизированный желатин, гидрогенизированные растительные масла, смеси полиэтиленгликолей с разной молекулярной массой и сложные эфиры жирных кислот и полиэтиленгликоля.

Для местного применения используют кремы, мази, желе, растворы или суспензии и т.д., содержащие соединение формулы A. (В целях такого применения средства для местного применения включают средства для промывания или полоскания ротовой полости).

Соединения согласно настоящему изобретению можно вводить в интраназальной форме посредством местного применения подходящих интраназальных носителей и устройств для доставки или посредством трансдермальных путей, используя формы трансдермальных кожных пластырей, хорошо известные специалистам в данной области. В случае введения в форме системы для трансдермальной доставки введение дозы, конечно, будет непрерывным, а не периодическим на протяжении схемы дозирования. Соединения согласно настоящему изобретению также можно доставлять в виде суппозитория с использованием таких основ, как масло какао, глицеринизированный желатин, гидрогенизированные растительные масла, смеси полиэтиленгликолей с разными молекулярными массами и сложные эфиры жирных кислот и полиэтиленгликоля.

В том случае, когда композицию согласно настоящему изобретению вводят человеку, суточную дозу обычно будет определять лечащий врач, при этом доза, как правило, будет варьировать в соответствии с возрастом, массой и ответом конкретного пациента, а также тяжестью симптомов у пациента.

Схема дозирования с применением соединений согласно настоящему изобретению может быть выбрана в соответствии с множеством факторов, включая тип, вид, возраст, массу, пол и тип злокачественной опухоли, подвергаемой лечению; тяжесть (т.е. стадию) злокачественной опухоли, подвергаемой лечению; пути введения; функционирование почек и печени пациента; и конкретное применяемое соединение или его соль. Обычный лечащий врач или ветеринар легко может определить и назначить эффективное количество лекарственного средства, необходимого для лечения, например чтобы предотвратить, подавить (полностью или частично) или задержать прогрессирование болезни.

Например, соединения согласно настоящему изобретению можно вводить в суммарной суточной дозе до 10000 мг. Соединения согласно настоящему изобретению можно вводить один раз в сутки (QD) или разделить на несколько доз за сутки, например два раза в сутки (BID) и три раза в сутки (TID). Соединения согласно настоящему изобретению можно вводить в суммарной суточной дозе до 10000 мг, например 2000, 3000, 4000, 6000, 8000 или 10000 мг, которую можно вводить один раз в сутки или можно разделить на несколько доз в сутки, как описано выше.

Например, соединения согласно настоящему изобретению можно вводить в суммарной суточной дозе до 1000 мг. Соединения согласно настоящему изобретению можно вводить один раз в сутки (QD) или разделить на несколько доз в сутки, например два раза в сутки (BID) и три раза в сутки (TID). Соединения согласно настоящему изобретению можно вводить в суммарной суточной дозе до 1000 мг, например 200, 300, 400, 600, 800 или 1000 мг, которую можно вводить в виде одной дозы в сутки или можно разделить на несколько доз в сутки, как описано выше.

Кроме того, введение может быть непрерывным, т.е. каждый день или периодически. Термины «периодический» или «периодически» в используемом в данном описании смысле означает прекращение и начало либо с регулярными, либо нерегулярными интервалами. Например, периодическое введение соединения согласно настоящему изобретению может представлять собой введение от одного до шести дней в неделю, или может означать введение циклами (например, ежедневное введение в течение от двух до восьми недель последовательно, затем период отдыха без введения в течение периода времени до одной недели), или может означать введение через день.

Кроме того, соединения согласно настоящему изобретению можно вводить согласно схемам, описанным выше, непрерывно в течение нескольких недель с последующим периодом отдыха. Например, соединения согласно настоящему изобретению можно вводить согласно любой из схем, описанных выше, от двух до восьми недель, с последующим периодом покоя в течение одной недели, или дважды в сутки в дозе 100-500 мг в течение трех-пяти дней в неделю. В другом конкретном варианте соединения согласно настоящему изобретению можно вводить три раза в сутки в течение двух следующих друг за другом недель с последующей одной неделей отдыха.

Любая одна или несколько конкретных доз и схем дозирования соединений согласно настоящему изобретению также могут быть применимы к любому одному или нескольким терапевтическим средствам, которые необходимо использовать в комбинированной терапии (в дальнейшем называемому «вторым терапевтическим средством»).

Кроме того, конкретная доза и схема дозирования указанного второго терапевтического средства также могут варьировать, и оптимальная доза, схема дозирования и путь введения будут определяться на основе конкретного используемого второго терапевтического средства.

Конечно, путь введения соединений согласно настоящему изобретению не зависит от пути введения второго терапевтического средства. В одном варианте введение соединения согласно настоящему изобретению представляет собой пероральное введение. В другом варианте введение соединения согласно настоящему изобретению является внутривенным введением. Таким образом, согласно указанным вариантам соединение согласно настоящему изобретению вводят перорально или внутривенно, а второе терапевтическое средство можно вводить перорально, парентерально, внутрибрюшинно, внутривенно, внутриартериально, трансдермально, подъязычно, внутримышечно, ректально, трансбуккально, интраназально, с помощью липосом, посредством ингаляции, вагинально, внутрь глаза, посредством местной доставки через катетер или стент, подкожно, внутрь жировой ткани, внутрь суставов, интратекально или в дозированной форме медленного высвобождения.

Кроме того, соединение согласно настоящему изобретению и второе терапевтическое средство можно вводить одним и тем же способом введения, т.е. средства вводят, например, перорально, внутривенно. Однако в объем настоящего изобретения также входит введение соединения согласно настоящему изобретению одним способом введения, например перорально, а введение второго терапевтического средства другим путем введения, например внутривенно или любым другим способом введения, описанным выше.

Первая процедура лечения, введение соединения согласно настоящему изобретению, может иметь место перед второй процедурой лечения, т.е. перед введением второго терапевтического средства, после лечения вторым терапевтическим средством, одновременно с лечением вторым терапевтическим средством или в виде комбинации указанных выше схем. Например, общий период лечения может быть определен в отношении соединения согласно настоящему изобретению. Второе терапевтическое средство можно вводить до лечения соединением согласно настоящему изобретению или после лечения соединением согласно настоящему изобретению. Кроме того, противоопухолевое лечение можно проводить во время периода введения соединения согласно настоящему изобретению, но не обязательно в течение всего периода лечения соединением согласно настоящему изобретению.

Соединения согласно настоящему изобретению также применимы в комбинации с терапевтическими, химиотерапевтическими и противоопухолевыми средствами. Комбинации описанных в настоящей публикации соединений с терапевтическими, химиотерапевтическими и противоопухолевыми средствами входят в объем изобретения. Примеры таких средств можно найти в Cancer Principles and Practice of Oncology by V.T. Devita and S. Hellman (editors), 6th edition (February 15, 2001), Lippincott Williams and Wilkins Publishers. Специалисту в данной области будет понятно, какие комбинации средств могут быть применимы, на основе конкретных свойств лекарственных средств и конкретной злокачественной опухоли. К таким средствам относятся: модуляторы рецепторов эстрогенов, модуляторы рецепторов андрогенов, модуляторы рецепторов ретиноидов, цитотоксические/цитостатические средства, антипролиферативные средства, ингибиторы пренил-протеин-трансферазы, ингибиторы HMG-CoA-редуктазы и другие ингибиторы ангиогенеза, ингибиторы протеазы ВИЧ, ингибиторы обратной транскриптазы, ингибиторы пролиферации клеток и передачи сигнала жизнеспособности, бисфосфонаты, ингибиторы ароматазы, терапевтические средства на основе мяРНК, ингибиторы γ-секретазы, средства, которые отрицательно влияют на рецепторные тирозинкиназы (RTK), и средства, которые мешают прохождению контрольных точек клеточного цикла. Соединения согласно настоящему изобретению особенно применимы при совместном введении с лучевой терапией.

Термин «модуляторы рецепторов эстрогенов» относится к соединениям, которые мешают или ингибируют связывание эстрогена с рецептором, независимо от механизма. Примеры модуляторов рецепторов эстрогенов включают без ограничения тамоксифен, ралоксифен, идоксифен, LY353381, LY117081, торемифен, фулвестрант, 4-[7-(2,2-диметил-1-оксопропокси-4-метил-2-[4-[2-(1-пиперидинил)этокси]фенил]-2H-1-бензопиран-3-ил]фенил-2,2-диметилпропаноат, 4,4'-дигидроксибензофенон-2,4-динитрофенилгидразон и SH646.

Термин «модуляторы рецепторов андрогенов» относится к соединениям, которые мешают или ингибируют связывание с рецептором, независимо от механизма. Примеры модуляторов рецепторов андрогенов включает финастерид и другие ингибиторы 5α-редуктазы, нилутамид, флутамид, бикалутамид, лиарозол и ацетат абиратерона.

Термин «модуляторы рецепторов ретиноидов» относится к соединениям, которые мешают или ингибируют связывание ретиноидов с рецептором, независимо от механизма. Примеры таких модуляторов рецепторов ретиноидов включают бексаротен, третиноин, 13-цис-ретиноевую кислоту, 9-цис-ретиноевую кислоту, α-дифторметилорнитин, ILX23-7553, транс-N-(4'-гидроксифенил)ретинамид и N-4-карбоксифенилретинамид.

Термин «цитотоксические/цитостатические средства» относится к соединениям, которые вызывают клеточную гибель или ингибируют пролиферацию клеток главным образом посредством того, что непосредственно мешают функционированию клеток или ингибируют, или мешают митозу клеток, включая алкилирующие агенты, факторы некроза опухолей, интеркаляторы, активируемые гипоксией соединения, ингибиторы микротрубочек/агенты, стабилизирующие микротрубочки, ингибиторы митотических кинезинов, ингибиторы деацетилазы гистонов, ингибиторы киназ, вовлеченных в прохождение митоза, ингибиторы киназ, вовлеченных в пути сигнальной трансдукции факторов роста и цитокинов, антиметаболиты, модификаторы биологического ответа, гормональные/антигормональные терапевтические средства, гематопоэтические факторы роста, терапевтические средства, направляемые к мишени моноклональными антителами, ингибиторы топоизомераз, ингибиторы протеосом, ингибиторы убиквитинлигазы и ингибиторы киназы aurora.

Примеры цитотоксических/цитостатических средств включают без ограничения сертенеф, кахектин, ифосфамид, тасонермин, лонидамин, карбоплатин, алтретамин, преднимустин, дибромдульцитол, ранимустин, фотемустин, недаплатин, оксалиплатин, темозоломид, гептаплатин, эстрамустин, тозилат импросульфана, трофосфамид, нимустин, диброспидий хлорид, пумитепа, лобаплатин, сатраплатин, профиромицин, цисплатин, ирофульвен, дексифосфамид, цис-аминдихлор(2-метилпиридин)платина, бензилгуанин, глуфосфамид, GPX100, (транс, транс, транс)-бис-мю-(гексан-1,6-диамин)-мю-[диаминплатина (II)]бис[диамин(хлор)платина (II)]тетрахлорид, диаризидинилспермин, триоксид мышьяка, 1-(11-додециламино-10-гидроксиундецил)-3,7-диметилксантин, зорубицин, идарубицин, даунорубицин, бисантрен, митоксантрон, пирарубицин, пинафид, валрубицин, амрубицин, антинеопластон, 3'-дезамино-3'-морфолино-13-деоксо-10-гидроксикарминомицин, аннамицин, галарубицин, элинафид, MEN10755, 4-деметокси-3-дезамино-3-азиридинил-4-метилсульфонилдаунорубицин (см. WO 00/50032), ингибиторы киназы Raf (такие как Bay43-9006) и ингибиторы mTOR (такие как CCI-779 Wyeth).

Примером активируемого гипоксией соединения является тирапазамин. Примеры ингибиторов протеосом включают без ограничения лактацистин и MLN-341 (Velcade).

Примеры ингибиторов микротрубочек/стабилизирующих микротрубочки агентов включают паклитаксел, сульфат виндезина, 3',4'-дидегидро-4'-дезокси-8'-норвинкалейкобластин, доцетаксол, ризоксин, доластатин, изетионат мивобулина, ауристатин, цемадотин, RPR109881, BMS 184476, винфлунин, криптофицин, сульфонамид 2,3,4,5,6-пентафтор-N-(3-фтор-4-метоксифенил)бензола, ангидровинбластин, N,N-диметил-L-валил-L-валил-N-метил-L-валил-L-пролил-L-пролин-трет-бутиламид, TDX258, эпотилоны (см., например, патенты США №6284781 и 6288237) и BMS188797. В одном варианте эпотилоны не включены в группу ингибиторов микротрубочек/стабилизирующих микротрубочки агентов.

Некоторыми примерами ингибиторов топоизомераз являются топотекан, гикаптамин, иринотекан, рубитекан, 6-этоксипропионил-3',4'-O-экзо-бензилиден-шартрезин, 9-метокси-N,N-диметил-5- нитропиразоло[3,4,5-kl]акридин-2-(6H)пропанамин, 1-амино-9-этил-5-фтор-2,3-дигидро-9-гидрокси-4-метил-1H,12H-бензо[de]пирано[3',4':b,7]-индолизино[1,2b]хинолин-10,13(9H,15H)дион, луртотекан, 7-[2-(N-изопропиламино)этил]-(20S)камптотецин, BNP1350, BNPI1100, BN80915, BN80942, этопозид фосфат, тенипозид, собузоксан, 2'-диметиламино-2'-дезоксиэтопозид, GL331, N-[2-(диметиламино)этил]-9-гидрокси-5,6-диметил-6H-пиридо[4,3-b]карбазол-1-карбоксамид, асулакрин, (5a,5aB,8aa,9b)-9-[2-[N-[2-(диметиламино)этил]-N-метиламино]этил]-5-[4-гидроокси-3,5-диметоксифенил]-5,5a,6,8,8a,9-гексогидрофуро(3',4':6,7)нафто(2,3-d)-1,3-диоксол-6-он, 2,3-(метилендиокси)-5-метил-7-гидрокси-8-метоксибензо[c]фенантридиний, 6,9-бис[(2-аминоэтил)амино]бензо[g]изохинолин-5,10-дион, 5-(3-аминопропиламино)-7,10-дигидрокси-2-(2-гидроксиэтиламинометил)-6H-пиразоло[4,5,1-de]акридин-6-он, N-[1-[2(диэтиламино)этиламино]-7-метокси-9-оксо-9H-тиоксантен-4-илметил]формамид, N-(2-(диметиламино)этил)акридин-4-карбоксамид, 6-[[2-(диметиламино)этил]амино]-3-гидрокси-7H-индено[2,1-c]хинолин-7-он и димесна.

Примеры ингибиторов митотических кинезинов и, в частности, митотического кинезина KSP человека описаны в публикациях WO 03/039460, WO 03/050064, WO 03/050122, WO 03/049527, WO 03/049679, WO 03/049678, WO 04/039774, WO 03/079973, WO 03/099211, WO 03/105855, WO 03/106417, WO 04/037171, WO 04/058148, WO 04/058700, WO 04/126699, WO 05/018638, WO 05/019206, WO 05/019205, WO 05/018547, WO 05/017190, US 2005/0176776. В одном варианте ингибиторы митотических кинезинов включают без ограничения ингибиторы KSP, ингибиторы MKLP1, ингибиторы CENP-E, ингибиторы MCAK и ингибиторы Rab6-KIFL.

Примеры «ингибиторов деацетилаз гистонов» включают без ограничения SAHA, TSA, оксамфлатин, PXD101, MG98 и скриптаид. Дополнительную ссылку на другие ингибиторы деацетилаз гистонов можно найти в рукописи Miller, T.A. et al. J. Med. Chem. 46(24): 5097-5116 (2003).

«Ингибиторы киназ, вовлеченных в прохождение митоза» включают без ограничения ингибиторы киназы aurora, ингибиторы Polo-подобных киназ (PLK; в частности, ингибиторы PLK-1), ингибиторы bub-1 и ингибиторы bub-R1. Примером «ингибитора киназы aurora» является VX-680.

«Антипролиферативные средства» включают антисмысловые олигонуклеотиды РНК и ДНК, такие как G3139, ODN698, RVASKRAS, GEM231, и MX3001, и антиметаболиты, такие как эноцитабин, кармофур, тегафур, пентостатин, доксифлуридин, триметрексат, флударабин, капецитабин, галоцитабин, окфосфат цитарабина, гидрат фостеабин-натрия, ралтитрексед, палтитрексид, эмитефур, тиазофурин, децитабин, нолатрексед, пеметрексед, нелзарабин, 2'-дезокси-2'-метилиденцитидин, 2'-фторметилен-2'-дезоксицитидин, N-[5-(2,3-дигидробензофурил)сульфонил]-N'-(3,4-дихлорфенил)мочевину, N6-[4-дезокси-4-[N2-[2(E),4(E)-тетрадекадиеноил]глициламино]-L-глицеро-B-L-манногептопиранозил]аденин, аплидин, эктеинасцидин, троксацитабин, 4-[2-амино-4-оксо-4,6,7,8-тетрагидро-3H-пиримидино[5,4-b][1,4]тиазин-6-ил-(S)-этил]-2,5-тиеноил-L-глутаминовая кислота, аминоптерин, 5-фторурацил, аланозин, сложный эфир 11-ацетил-8-(карбамоилоксиметил)-4-формил-6-метокси-14-окса-1,11-диазатетрацикло(7.4.1.0.0)-тетрадека-2,4,6-триен-9-илуксусной кислоты, сваинсонин, лометрексол, декстразоксан, метиониназу, 2'-циано-2'-дезокси-N4-пальмитоил-1-B-D-арабинофуранозилцитозин, тиосемикарбоазон 3-аминопиридин-2-карбоксальдегида и трастузумаб.

Примеры направляемых к мишени моноклональным антителом терапевтических средств включают терапевтические средства, которые содержат цитотоксические агенты или радиоизотопы, связанные с моноклональным антителом, специфичным по отношению к злокачественной клетке или специфичным по отношению к клетке-мишени. Примеры включают Bexxar.

Термин «ингибиторы HMG-CoA-редуктазы» относится к ингибиторам 3-гидрокси-3-метилглутарил-CoA-редуктазы. Примеры ингибиторов HMG-CoA-редуктазы, которые могут быть использованы, включают без ограничения ловастатин (MEVACOR®; см. патенты США №№4231938, 4294926 и 4319039), симвастатин (ZOCOR®; см. патенты США №№4444784, 4820850 и 4916239), правастатин (PRAVACHOL®; см. патенты США №№4346227, 4537859, 4410629, 5030447 и 5180589), флувастатин (LESCOL®; см. патенты США №№5354772, 4911165, 4929437, 5189164, 5118853, 5290946 и 5356896), аторвастатин (LIPITOR®; см. патенты США №№5273995, 4681893, 5489691 и 5342952) и церивастатин (также известный как ривастатин и BAYCHOL®; см. патент США №5177080). Структурные формулы указанных и дополнительных ингибиторов HMG-CoA-редуктазы, которые могут быть использованы в способах согласно изобретению, описаны на стр.87 в M. Yalpani, «Cholesterol Lowering Drugs», Chemistry and Industry, pp.85-89 (5 февраля 1996) и в патентах США №4782084 и 4885314. Термин ингибитор HMG-CoA-редуктазы в используемом в данном описании смысле включает все фармацевтически приемлемые формы лактона и открытой кислоты (т.е. формы, в которой лактонный цикл раскрыт с образованием свободной кислоты), а также формы соли и сложного эфира соединений, которые обладают ингибирующей активностью по отношению к HMG-CoA-редуктазе, и поэтому применение таких форм в виде солей, сложных эфиров, открытой кислоты и лактона включено в объем настоящего изобретения.

Термин «ингибитор пренил-протеин-трансферазы» относится к соединению, которое ингибирует любой один или любую комбинацию ферментов пренил-протеин-трансфераз, включая фарнезил-протеин-трансферазу (FPTазу), геранилгеранил-протеин-трансферазу типа I (GGPTазу-I) и геранилгеранил-протеин-трансферазу типа II (GGPTазу II, также называемую GGPTазой Rab).

Примеры ингибиторов пренил-протеин-трансфераз можно найти в следующих публикациях и патентах: WO 96/30343, WO 97/18813, WO 97/21701, WO 97/23478, WO 97/38665, WO 98/28980, WO 98/29119, WO 95/32987, патенте США №5420245, патенте США №5523430, патенте США №5532359, патенте США №5510510, патенте США №5589485, патенте США №5602098, публикации Европейского патента 0618221, публикации Европейского патента 0675112, публикации Европейского патента 0604181, публикации Европейского патента 0696593, WO 94/19357, WO 95/08542, WO 95/11917, WO 95/12612, WO 95/12572, WO 95/10514, патенте США №№5661152, WO 95/10515, WO 95/10516, WO 95/24612, WO 95/34535, WO 95/25086, WO 96/05529, WO 96/06138, WO 96/06193, WO 96/16443, WO 96/21701, WO 96/21456, WO 96/22278, WO 96/24611, WO 96/24612, WO 96/05168, WO 96/05169, WO 96/00736, патенте США №№5571792, WO 96/17861, WO 96/33159, WO 96/34850, WO 96/34851, WO 96/30017, WO 96/30018, WO 96/30362, WO 96/30363, WO 96/31111, WO 96/31477, WO 96/31478, WO 96/31501, WO 97/00252, WO 97/03047, WO 97/03050, WO 97/04785, WO 97/02920, WO 97/17070, WO 97/23478, WO 97/26246, WO 97/30053, WO 97/44350, WO 98/02436 и патенте США №5532359. В качестве примера описания роли ингибитора пренил-протеин-трансферазы в ангиогенезе см. European J. Of Cancer, Vol.35, №9, pp.1394-1401 (1999).

Термин «ингибиторы ангиогенеза» относится к соединениям, которые ингибируют образование новых кровеносных сосудов, независимо от механизма. Примеры ингибиторов ангиогенеза включают без ограничения ингибиторы тирозинкиназ, такие как ингибиторы тирозинкиназных рецепторов FIt-I (VEGFR1) и FIk-1/KDR (VEGFR2), ингибиторы эпидермальных, полученных из фибробластов или полученных из тромбоцитов факторов роста, ингибиторы MMP (матриксных металлопротеаз), блокаторы интегринов, интерферон-α, интерлейкин-12, полисульфат пентозана, ингибиторы циклооксигеназы, включая нестероидные противовоспалительные средства (НПВС), подобные аспирину и ибупрофену, а также избирательные ингибиторы циклооксигеназы-2, подобные целекоксибу и рофекоксибу (PNAS, Vol.89, p.7384 (1992); JNCI, Vol.69, p.475 (1982); Arch. Opthalmol., Vol.108, p.573 (1990); Anat. Rec, Vol.238, p.68 (1994); FEBS Letters, Vol.372, p.83 (1995); Clin. Orthop. Vol.313, p.76 (1995); J. Mol. Endocrinol, Vol.16, p.107 (1996); Jpn. J. Pharmacol., Vol.75, p.105 (1997); Cancer Res., Vol.57, p.1625 (1997); Cell, Vol.93, p.705 (1998); Intl. J. Mol. Med., Vol.2, p.715 (1998); J. Biol. Chem., Vol.274, p.9116 (1999)), стероидные противовоспалительные средства (такие как кортикостероиды, минералокортикоиды, дексаметазон, преднизон, преднизолон, метилпред, бетаметазон), карбоксиамидотриазол, комбретастатин A-4, скваламин, 6-O-хлорацетилкарбонилфумагиллол, талидомид, ангиостатин, тропонин-1, антагонисты ангиотензина II (см. Fernandez et al., J. Lab. Clin. Med. 105: 141-145 (1985)), и антитела к VEGF (см. Nature Biotechnology, Vol.17, pp.963-968 (October 1999); Kim et al., Nature, 362, 841-844 (1993); WO 00/44777 и WO 00/61186).

Другие терапевтические средства, которые модулируют или ингибируют ангиогенез, и также могут быть использованы в комбинации с соединениями согласно настоящему изобретению, включают средства, которые модулируют или ингибируют системы коагуляции и фибринолиза (см. обзор в Clin. Chem. La. Med. 38: 679-692 (2000)). Примеры таких средств, которые модулируют или ингибируют пути коагуляции и фибринолиза, включают без ограничения гепарин (см. Thromb. Haemost. 80: 10-23 (1998)), низкомолекулярные гепарины и ингибиторы карбоксипептидазы U (также известные как ингибиторы активируемого активным тромбином ингибитора фибринолиза [TAFIa]) (см. Thrombosis Res. 101: 329-354 (2001)). Ингибиторы TAFIa описаны в заявках на выдачу патента США с регистрационным №60/310927 (поданной 8 августа 2001) и 60/349925 (поданной 18 января 2002).

Термин «средства, которые мешают прохождению контрольных точек клеточного цикла» относится к соединениям, которые ингибируют протеинкиназы, которые передают сигналы контрольных точек клеточного цикла, тем самым сенсибилизируя злокачественную клетку к действию ДНК-повреждающих агентов. Такие средства включают ингибиторы киназ ATR, ATM, CHKI1 и CHK12 и ингибиторы киназ cdk и cdc, и конкретными примерами таких агентов являются 7-гидроксистауроспорин, флавопиридол, CYC202 (циклацел) и BMS-387032.

Термин «средства, которые отрицательно влияют на рецепторные тирозинкиназы (RTK)» относится к соединениям, которые ингибируют RTK и, следовательно, ингибируют механизмы, вовлеченные в онкогенез и прогрессирование опухолей. Такие средства включают ингибиторы c-Kit, Eph, PDGF, Flt3 и c-Met. Дополнительные средства включают ингибиторы RTK, которые описаны в Bume-Jensen and Hunter, Nature, 411: 355-365, 2001.

Термин «ингибиторы пути передачи сигналов пролиферации и жизнеспособности клеток» относится к соединениям, которые ингибируют каскады сигнальной трансдукции ниже рецепторов клеточной поверхности. Такие средства включают ингибиторы сериновых/треониновых киназ (включая без ограничения ингибиторы Akt, такие, которые описаны в WO 02/083064, WO 02/083139, WO 02/083140, US 2004-0116432, WO 02/083138, US 2004-0102360, WO 03/086404, WO 03/086279, WO 03/086394, WO 03/084473, WO 03/086403, WO 2004/041162, WO 2004/096131, WO 2004/096129, WO 2004/096135, WO 2004/096130, WO 2005/100356, WO 2005/100344, US 2005/029941, US 2005/44294, US 2005/43361, 60/734188, 60/652737, 60/670469), ингибиторы киназы Raf (например, BAY-43-9006), ингибиторы MEK (например, CI-1040 и PD-098059), ингибиторы mTOR (например, Wyeth CCI-779) и ингибиторы PI3K (например, LY294002).

Как описано выше, комбинации с НПВС относятся к применению НПВС, которые являются сильными ингибирующими ЦОГ-2 агентами. В целях данного описания НПВС является сильным, если оно имеет IC50 в отношении ингибирования ЦОГ-2, составляющую 1 мкМ или меньше, при измерении в анализах на основе клеток или микросом.

Изобретение также охватывает комбинации с НПВС, которые являются избирательными ингибиторами ЦОГ-2. В целях данного описания НПВС, которые являются избирательными ингибиторами ЦОГ-2, определяют как НПВС, которые обладают специфичностью в отношении ингибирования ЦОГ-2 по сравнению с ЦОГ-1 по меньшей мере в 100 более высокой при измерении по отношению IC50 для ЦОГ-2 к IC50 для ЦОГ-1, оцениваемому в анализах на основе клеток или микросом. Такие соединения включают без ограничения соединения, описанные в патенте США 5474995, патенте США 5861419, патенте США 6001843, патенте США 6020343, патенте США 5409944, патенте США 5436265, патенте США 5536752, патенте США 5550142, патенте США 5604260, патенте США 5698584, патенте США 5710140, WO 94/15932, патенте США 5344991, патенте США 5134142, патенте США 5380738, патенте США 5393790, патенте США 5466823, патенте США 5633272 и патенте США 5932598, которые все включены в данное описание в виде ссылки.

Ингибиторами ЦОГ-2, которые особенно применимы в данном способе лечения, являются: 3-фенил-4-(4-(метилсульфонил)фенил)-2-(5H)-фуранон; и 5-хлор-3-(4-метилсульфонил)фенил-2-(2-метил-5-пиридинил)пиридин; или их фармацевтически приемлемые соли.

Соединения, которые были описаны как специфичные ингибиторы ЦОГ-2 и поэтому применимы в настоящем изобретении, включают без ограничения следующие соединения: парекоксиб, BEXTRA® и CELEBREX® или их фармацевтически приемлемые соли.

Другие примеры ингибиторов ангиогенеза включают без ограничения эндостатин, украин, ранпирназу, IM862, 5-метокси-4-[2-метил-3-(3-метил-2-бутенил)оксиранил]-1-оксаспиро[2,5]окт-6-ил(хлорацетил)карбамат, ацетилдинаналин, 5-амино-1-[[3,5-дихлор-4-(4-хлорбензоил)фенил]метил]-1H-1,2,3-триазол-4-карбоксамид, CM101, скваламин, комбретастатин, RPI4610, NX31838, фосфат сульфатированной маннопентаозы, 7,7-(карбонил-бис[имино-N-метил-4,2-пирролокарбонилимино[N-метил-4,2-пиррол]карбонилимино]-бис-(1,3-нафталиндисульфонат) и 3-[(2,4-диметилпиррол-5-ил)метилен]-2-индолинон (SU5416).

Как указано выше, термин «блокаторы интегринов» относится к соединениям, которые избирательно антагонизируют, ингибируют или противодействуют связыванию физиологического лиганда с αvβ3-интегрином, к соединениям, которые избирательно антагонизируют, ингибируют или противодействуют связыванию физиологического лиганда с αvβ5-интегрином, к соединениям, которые антагонизируют, ингибируют или противодействуют связыванию физиологического лиганда как с αvβ3-интегрином, так и с αvβ5-интегрином, и к соединениям, которые антагонизируют, ингибируют или противодействуют активности конкретного интегрина(ов), экспрессируемых на эндотелиальных клетках капилляров. Термин также относится к анатагонистам интегринов αvβ6, αvβ8, α1β1, α2β1, α5β1, α6β1 и α6β4. Термин также относится к антагонистам любой комбинации интегринов αvβ3, αvβ5, αvβ6, αvβ8, α1β1, α2β1, α5β1, α6β1 и α6β4.

Некоторые конкретные примеры ингибиторов тирозинкиназы включают N-(трифторметилфенил)-5-метилизоксазол-4-карбоксамид, 3-[(2,4-диметилпиррол-5-ил)метилиденил)индолин-2-он, 17-(аллиламино)-17-деметоксигелданамицин, 4-(3-хлор-4-фторфениламино)-7-метокси-6-[3-(4-морфолинил)пропоксил]хиназолин, N-(3-этинилфенил)-6,7-бис(2-метоксиэтокси)-4-хиназолинамин, BIBX1382, 2,3,9,10,11,12-гексагидро-10-(гидроксиметил)-10-гидрокси-9-метил-9,12-эпокси-1H-дииндоло[1,2,3-fg:3',2',1'-kl]пирроло[3,4-i][1,6]бензодиазоцин-1-он, SH268, генистеин, STI571, CEP2563, сульфонат 4-(3-хлорфениламино)-5,6-диметил-7H-пирроло[2,3-d]пиримидинметана, 4-(3-бром-4-гидроксифенил)амино-6,7-диметоксихиназолин, 4-(4'-гидроксифенил)амино-6,7- диметоксихиназолин, SU6668, STI571A, N-4-хлорфенил-4-(4-пиридилметил)-1-фталазинамин и EMD121974.

Комбинации с другими соединениями, отличными от противоопухолевых соединений, также применимы в способах согласно настоящему изобретению. Например, комбинации заявленных соединений с агонистами PPAR-γ (т.е. PPAR-гамма) и агонистами PPAR-δ (т.е. PPAR-дельта) применимы для лечения некоторых злокачественных болезней. PPAR-γ и PPAR-δ являются ядерными активируемыми пролифератором пероксисом рецепторами γ и δ. Экспрессия PPAR-γ на эндотелиальных клетках и их участие в ангиогенезе описаны в литературе (см. J. Cardiovasc. Pharmacol. 1998; 31: 909-913; J. Biol. Chem. 1999; 274: 9116-9121; Invest. Ophthalmol. Vis. Sci. 2000; 41: 2309-2317). Недавно было показано, что агонисты PPAR-γ ингибируют ангиогенный ответ на VEGF in vitro; троглитазон и малеат росиглитазона ингибируют развитие неоваскуляризации сетчатки у мышей (Arch. Ophthamol. 2001; 119: 709-717). Примеры агонистов PPAR-γ и агонистов PPAR-γ/α включают без ограничения тиазолидиндионы (такие как DRF2725, CS-011, троглитазон, росиглитазон и пиоглитазон), фенофибрат, гемфиброзил, клофибрат, GW2570, SB219994, AR-H039242, JTT-501, MCC-555, GW2331, GW409544, NN2344, KRP297, NP0110, DRF4158, NN622, GI262570, PNU182716, DRF552926, 2-[(5,7-дипропил-3-трифторметил-1,2-бензизоксазол-6-ил)окси]-2-метилпропионовую кислоту (обсуждаемую в USSN 09/782856), и 2(R)-7-(3-(2-хлор-4-(4-фторфенокси)фенокси)пропокси)-2-этилхроман-2-карбоновую кислоту (обсуждаемую в USSN 60/235708 и 60/244697).

Другим вариантом осуществления настоящего изобретения является применение заявленных соединений в комбинации с генной терапией для лечения злокачественной опухоли. Обзор генетической методики лечения злокачественной опухоли см. в Hall et al. (Am. J. Hum. Genet. 61: 785-789, 1997) и Kufe et al (Cancer Medicine, 5th Ed., pp.876-889, BC Decker, Hamilton 2000). Генную терапию можно использовать для доставки любого подавляющего опухоль гена. Примеры таких генов включают без ограничения p53, который может быть доставлен посредством опосредованного вирусом переноса генов (см., например, патент США №6069134), антагонист uPA/uPAR («Adenovirus-Mediated Delivery of a uPA/uPAR Antagonist Suppresses Angiogenesis-Dependent Tumor Growth and Dissemination in Mice» Gene Therapy, August 1998; 5(8): 1105-13), и интерферон гамма (J. Immunol. 2000; 164: 217-222).

Соединения согласно настоящему изобретению также могут быть введены в комбинации с ингибитором врожденной полилекарственной резистентности (MDR), в частности MDR, связанной с высокими уровнями экспрессии белков-переносчиков. Такие ингибиторы MDR включают ингибиторы p-гликопротеида (P-gp), такие как LY335979, XR9576, OC144-093, R101922, VX853 и PSC833 (валсподар).

Соединение согласно настоящему изобретению можно использовать вместе с противорвотными средствами для лечения тошноты или рвоты, включая острую, отсроченную, позднюю и ожидаемую рвоту, которая может быть вызвана применением соединения согласно настоящему изобретению отдельно или вместе с лучевой терапией. Для предотвращения или лечения рвоты соединение согласно настоящему изобретению можно использовать вместе с другими противорвотными средствами, особенно с антагонистами рецептора нейрокинина-1, антагонистами рецептора 5HT3, такими как ондансетрон, гранисетрон, трописетрон и затисетрон, агонистами рецептора GABAB, такими как баклофен, кортикостероидом, таким как декадрон (дексаметазон), кеналог, аристокорт, насалид, преферид, бенекортен или другие, такие как описанные в патентах США №№2789118, 2990401, 3048581, 3126375, 3929768, 3996359, 3928326 и 3749712, антидопаминергическим средством, таким как фенотиазины (например, прохлорперазин, флуфеназин, тиоридазин и мезоридазин), метоклопрамид или дронабинол. В другом варианте совместная терапия с противорвотным средством, выбранным из антагониста рецептора нейрокинина-1, антагониста рецептора 5HT3 и кортикостерида, предлагается для лечения или профилактики рвоты, которая может быть результатом введения соединений согласно настоящему изобретению.

Антагонисты рецептора нейрокинина-1, применяемые вместе с соединениями, согласно настоящему изобретению полно описаны, например, в патентах США №№5162339, 5232929, 5242930, 5373003, 5387595, 5459270, 5494926, 5496833, 5637699, 5719147; публикациях Европейских патентов №№ЕР 0360390, 0394989, 0428434, 0429366, 0430771, 0436334, 0443132, 0482539, 0498069, 0499313, 0512901, 0512902, 0514273, 0514274, 0514275, 0514276, 0515681, 0517589, 0520555, 0522808, 0528495, 0532456, 0533280, 0536817, 0545478, 0558156, 0577394, 0585913, 0590152, 0599538, 0610793, 0634402, 0686629, 0693489, 0694535, 0699655, 0699674, 0707006, 0708101, 0709375, 0709376, 0714891, 0723959, 0733632 и 0776893; международных публикациях патентов №№WO 90/05525, 90/05729, 91/09844, 91/18899, 92/01688, 92/06079, 92/12151, 92/15585, 92/17449, 92/20661, 92/20676, 92/21677, 92/22569, 93/00330, 93/00331, 93/01159, 93/01165, 93/01169, 93/01170, 93/06099, 93/09116, 93/10073, 93/14084, 93/14113, 93/18023, 93/19064, 93/21155, 93/21181, 93/23380, 93/24465, 94/00440, 94/01402, 94/02461, 94/02595, 94/03429, 94/03445, 94/04494, 94/04496, 94/05625, 94/07843, 94/08997, 94/10165, 94/10167, 94/10168, 94/10170, 94/11368, 94/13639, 94/13663, 94/14767, 94/15903, 94/19320, 94/19323, 94/20500, 94/26735, 94/26740, 94/29309, 95/02595, 95/04040, 95/04042, 95/06645, 95/07886, 95/07908, 95/08549, 95/11880, 95/14017, 95/15311, 95/16679, 95/17382, 95/18124, 95/18129, 95/19344, 95/20575, 95/21819, 95/22525, 95/23798, 95/26338, 95/28418, 95/30674, 95/30687, 95/33744, 96/05181, 96/05193, 96/05203, 96/06094, 96/07649, 96/10562, 96/16939, 96/18643, 96/20197, 96/21661, 96/29304, 96/29317, 96/29326, 96/29328, 96/31214, 96/32385, 96/37489, 97/01553, 97/01554, 97/03066, 97/08144, 97/14671, 97/17362, 97/18206, 97/19084, 97/19942 и 97/21702; и в британских публикациях патентов №№2266529, 2268931, 269170, 2269590, 2271774, 2292144, 2293168, 2293169 и 2302689. Получение таких соединений полно описано в указанных выше патентах и публикациях, которые включены в данное описание в виде ссылки.

В одном варианте антагонист рецептора нейрокинина-1, применяемого вместе с соединениями согласно настоящему изобретению, выбран из 2-(R)-(1-(R)-(3,5-бис(трифторметил)фенил)этокси)-3-(S)-(4-фторфенил)-4-(3-(5-оксо-1H,4H-1,2,4-триазоло)метил)морфолина или его фармацевтически приемлемой соли, которые описаны в патенте США №5719147.

Соединение согласно настоящему изобретению также можно вводить с агентом, применимым для лечения анемии. Таким агентом для лечения анемии является, например, активатор рецептора эритропоэза длительного действия (такой, как эпоэтин альфа).

Соединение согласно настоящему изобретению также можно вводить с агентом, применимым для лечения нейтропении. Таким агентом для лечения нейтропении является, например, гематопоэтический фактор роста, который регулирует продукцию и функционирование нейтрофилов, такой как колониестимулирующий фактор гранулоцитов человека (G-CSF). Примеры G-CSF включают филграстим.

Соединение согласно настоящему изобретению также можно вводить с лекарственным средством, усиливающим иммунологический ответ, таким как левамизол, изопринозин и задаксин.

Соединение согласно настоящему изобретению также может быть применимо для лечения или профилактики злокачественной опухоли в комбинации с ингибиторами P450, включая: ксенобиотики, хинидин, тирамин, кетоконазол, тестостерон, хинин, метирапон, кофеин, фенелзин, доксорубицин, тролеандомицин, циклобензаприн, эритромицин, кокаин, фурафилин, циметидин, декстрометорфан, ритонавир, индинавир, ампренавир, дилтиазем, терфенадин, верапамил, кортизол, итраконазол, мибефрадил, нефазодон и нелфинавир.

Соединение согласно настоящему изобретению также может быть применимо для лечения или профилактики злокачественной опухоли в комбинации с ингибиторами Pgp и/или BCRP, включая циклоспорин A, PSC833, GF120918, кремофор EL, фумитреморгин C, Kol32, Kol34, иресса, мезилат иматиниба, EKI-785, C11033, новобиоцин, диэтилстилбестрол, тамоксифен, респерпин, VX-710, трипростатин A, флавоноиды, ритонавир, саквинавир, нелфинавир, омепразол, хинидин, верапамил, терфенадин, кетоконазол, нифидепин, FK506, амиодарон, XR9576, индинавир, ампренавир, кортизол, тестостерон, LY335979, OC144-093, эритромицин, винкристин, дигоксин и талинолол.

Соединение согласно настоящему изобретению также может быть применимо для лечения или профилактики злокачественной опухоли, включая злокачественную опухоль кости, в комбинации с бисфосфонатами (подразумевается, что они включают бисфофонаты, дифосфонаты, бисфосфоновые кислоты и дифосфоновые кислоты). Примеры бисфосфонатов включают без ограничения этидронат (дидронел), памидронат (аредиа), алендронат (фосамакс), риседронат (актонель), золедронат (зомета), ибандронат (бонива), инкадронат или цимадронат, клодронат, EB-1053, минодронат, неридронат, пиридронат и тилудронат, включая любые и все их фармацевтически приемлемые соли, производные, гидраты и смеси.

Соединение согласно настоящему изобретению также может быть применимо для лечения или профилактики злокачественной опухоли молочной железы в комбинации ингибиторами ароматазы. Примеры ингибиторов ароматазы включают без ограничения анастрозол, летрозол и эксеместан.

Соединение согласно настоящему изобретению также может быть применимо для лечения или профилактики злокачественной опухоли в комбинации с терапевтическим средствами на основе мяРНК.

Соединения согласно настоящему изобретению также можно вводит в комбинации с ингибиторами γ-секретазы и/или ингибиторами передачи сигнала NOTCH. Такие ингибиторы включают соединения, описанные в WO 01/90084, WO 02/30912, WO 01/70677, WO 03/013506, WO 02/36555, WO 03/093252, WO 03/093264, WO 03/093251, WO 03/093253, WO 2004/039800, WO 2004/039370, WO 2005/030731, WO 2005/014553, USSN 10/957251, WO 2004/089911, WO 02/081435, WO 02/081433, WO 03/018543, WO 2004/031137, WO 2004/031139, WO 2004/031138, WO 2004/101538, WO 2004/101539 и WO 02/47671 (включая LY-450139).

Ингибиторы Akt, которые описаны в следующих публикациях: WO 02/083064, WO 02/083139, WO 02/083140, US 2004-0116432, WO 02/083138, US 2004-0102360, WO 03/086404, WO 03/086279, WO 03/086394, WO 03/084473, WO 03/086403, WO 2004/041162, WO 2004/096131, WO 2004/096129, WO 2004/096135, WO 2004/096130, WO 2005/100356, WO 2005/100344, US 2005/029941, US 2005/44294, US 2005/43361, 60/734188, 60/652737, 60/670469 и включая соединения согласно настоящему изобретению, также применимы в комбинации с солями калия, солями магния, бета-блокаторами (такими как атенолол) антагонистами эндотелина-a (ETa) с целью поддержания сердечно-сосудистого гомеостаза.

Ингибиторы Akt, которые описаны в следующих публикациях: WO 02/083064, WO 02/083139, WO 02/083140, US 2004-0116432, WO 02/083138, US 2004-0102360, WO 03/086404, WO 03/086279, WO 03/086394, WO 03/084473, WO 03/086403, WO 2004/041162, WO 2004/096131, WO 2004/096129, WO 2004/096135, WO 2004/096130, WO 2005/100356, WO 2005/100344, US 2005/029941, US 2005/44294, US 2005/43361, 60/734188, 60/652737, 60/670469 и включая соединения согласно настоящему изобретению, также применимы в комбинации с инсулином, стимуляторами секреции инсулина, агонистами PPAR-гамма, метформином, агонистами рецептора соматостатина, такими как октреотид, ингибиторами DPP4, сульфонилмочевинами и ингибиторами альфа-глюкозидазы с целью поддержания гомеостаза глюкозы.

Соединение согласно настоящему изобретению также может быть применимо для лечения или профилактики злокачественной опухоли в комбинации с ингибиторами PARP.

Соединение согласно настоящему изобретению также может быть применимо для лечения злокачественной опухоли в комбинации со следующими терапевтическими средствами: абареликс (депонируемый Plenaxis®); альдеслейкин (Prokine®); альдеслейкин (Proleukin®); алемтузумаб (Campath®); алитретиноин (Panretin®); аллопуринол (Zyloprim®); алтретамин (Hexalen®); амифостин (Ethyol®); анастрозол (Arimidex®); триоксид мышьяка (Trisenox®); аспарагиназу (Elspar®); азацитидин (Vidaza®); бевакузимаб (Avastin®); бексаротен в капсулах (Targretin®); гель бексаротен (Targretin®); блеомицин (Blenoxane®); бортезомиб (Velcade®); внутривенный препарат бусульфана (Busulfex®); пероральный бусульфан (Myleran®); калустерон (Methosarb®); капецитабин (Xeloda®); карбоплатин (Paraplatin®); кармустин (BCNU®, BiCNU®); кармустин (Gliadel®); имплантируемый кармустин с полифепросаном 20 (Gliadel Wafer®); целекоксиб (Celebrex®); цетуксимаб (Erbitux®); хлорамбуцил (Leukeran®); цисплатин (Platinol®); кладрибин (Leustatin®, 2-CdA®); клофарабин (Clolar®); циклофосфамид (Cytoxan®, Neosar®); циклофосфамид (инъекционный Cytoxan®); циклофосфамид (Cytoxan® в таблетках); цитарабин (Cytosar-U®); цитарабин липосомный (DepoCyt®); дакарбазин (DTIC-Dome®); дактиномицин, актиномицин D (Cosmegen®); дарбепоэтин альфа (Aranesp®); даунорубицин липосомный (DanuoXome®); даунорубицин, дауномицин (Daunorubicin®); даунорубицин, дауномицин (Cerubidine®); денилейкин дифтитокс (Ontak®); декстразоксан (Zinecard®); доцетаксел (Taxotere®); доксорубицин (Adriamicin PFS®); доксорубицин (Adriamycin®, Rubex®); доксорубицин (Adriamycin PFS® инъекционный); доксорубицин липосомный (Doxil®); пропионат дромостанолона (dromostanolone®); пропионат дромостанолона (masterone® для инъекций); раствор Эллиота B (Elliott's B solution®); эпирубицин (Ellence®); эпоэтин альфа (epogen®); эрлотиниб (Tarceva®); эстрамустин (Emcyt®); этопозид фосфат (Etopophos®); этопозид, VP-16 (Vepesid®); эксеместан (Aromasin®); филграстим (Neupogen®); флоксуридин (внутриартериальный) (FUDR®); флударабин (Fludara®); фторурацил, 5-FU (Adrucil®); фулвестрант (Faslodex®); гефитиниб (Iressa®); гемцитабин (Gemzar®); гемтузумаб озогамицин (Mylotarg®); госерелин ацетат (Zoladex® имплантируемый)); госерелин ацетат (Zoladex®); гистрелин ацетат (Histrelin® имплантируемый); гидроксимочевину (Hydrea®); ибритумомаб ксуксетан (Zevalin®); идарубицин (Idamicin®); ифосфамид (IFEX®); мезилат иматиниба (Gleevec®); интерферон альфа 2a (Roferon A®); интерферон альфа-2b (Intron A®); иринотекан (Camptosar®); леналидомид (Revlimid®); летрозол (Femara®); лейковорин (Wellcovorin®, Leucovorin®); ацетат лейпролида (Eligard®); левамизол (Ergamisol®); ломустин, CCNU (CeeBU®); меклоретамин, азотистый иприт (Mustargen®); ацетат мегестрола (Megace®); мелфалан, L-PAM (Alkeran®); меркаптопурин, 6-MP (Purinethol®); месна (Mesnex®); месна (Mesnex tabs®); метотрексат (Methotrexate®); метоксален (Uvadex®); митомицин C (Mutamicin®); митотан (Lysodren®); митоксантрон (Novantrone®); фенпропионат нандролона (Durabolin-50®); неларабин (Arranon®); нофетумомаб (Verluma®); опрелвекин (Neumega®); оксалиплатин (Eloxatin®); паклитаксел (Paxene®); паклитаксел (Taxol®); связанные с белком частицы паклитаксела (Abraxane®); палифермин (Kepivance®); памидронат (Aredia®); пегадемазу (Adagen® (пегадемаза бычья)); пегаспаргазу (Oncaspar®); пегфилграстим (Neulasta®); динатрий-пеметрексед (Alimta®); пентостатин (Nipent®); пипоброман (Vercyte®); пликамицин, митрамицин (Mithracin®); натрий-порфимер (Photofrin®); прокарбазин (Matulane®); хинакрин (Atabrine®); расбуриказу (Elitek®); ритуксимаб (Rituxan®); сарграмостим (Leukine®); сарграмостим (Prokine®); сорафениб (Nexavar®); стрептозоцин (Zanosar®); сунитиниб малеат (Sutent®); тальк (Sclerosol®); тамоксифен (Nolvadex®); темозоломид (Temodar®); тенипозид, VM-26 (Vumon®); тестолактон (Teslac®); тиогуанин, 6-TG (Thioguanine®); тиотепа (Thioplex®); топотекан (Hycamtin®); торемифен (Fareston®); тозитумомаб (Bexxar®); тозитумомаб/I-131 тозитумомаб (Bexxar®); трастузумаб (Herceptin®); третиноин, ATRA (Vesanoid®); урамустин (Uracil Mustard® в капсулах); валрубицин (Valstar®); винбластин (Velban®); винкристин (Oncovin®); винорелбин (Navelbine®); изоледронат (Zometa®).

Таким образом, в объем настоящего изобретения включено применение заявленных соединений в комбинации со вторым соединением, выбранным из модулятора рецептора эстрогена, модулятора рецептора андрогена, модулятора рецептора ретиноида, цитотоксического/цитостатического средства, антипролиферативного средства, ингибитора пренил-протеин-трансферазы, ингибитора HMG-CoA-редуктазы, ингибитора протеазы ВИЧ, ингибитора обратной транскриптазы, ингибитора ангиогенеза, агонистов PPAR-γ, агонистов PPAR-δ, ингибитора врожденной полилекарственной резистентности, противорвотного средства, средства, применимого для лечения анемии, средства, применимого для лечения нейтропении, лекарственного средства, усиливающего иммунный ответ, ингибитора пролиферации клеток и передачи сигнала жизнеспособности, бисфосфоната, ингибитора ароматазы, терапевтического средства на основе мяРНК, ингибиторов γ-секретазы, средств, которые отрицательно влияют на рецепторные тирозинкиназы (RTK), средства, которое мешает прохождению контрольных точек клеточного цикла, и любого из терапевтических средств, перечисленных выше.

Термин «введение» и его варианты (например, «введение» соединения) по отношению к соединению согласно изобретению означает введение соединения или пролекарства соединения в систему животного, нуждающегося в лечении. В том случае, когда соединение согласно изобретению или его пролекарство представлены в комбинации с одним или несколькими другими активными средствами (например, с цитотоксическим средством и т.д.), следует понимать, что термин «введение» и его варианты включает в себя одновременное и последовательное введение соединения или его пролекарства и других средств.

В используемом в данном описании смысле подразумевается, что термин «композиция» охватывает продукт, содержащий конкретно указанные ингредиенты в указанных количествах, а также любой продукт, который прямо или опосредованно образуется в результате комбинирования конкретных ингредиентов в указанных количествах.

Термин «терапевтически эффективное количество» в используемом в данном описании смысле означает, что количество активного соединения или фармацевтического средства, которое вызывает биологический или медицинский ответ в ткани, системе, у животного или человека, к которому стремится исследователь, ветеринар, лечащий врач или другой клиницист.

Термин «лечение злокачественной опухоли» относится к введению млекопитающему, страдающему от злокачественного заболевания, и относится к эффекту, который улучшает состояние при злокачественном заболевании, посредством вызывания гибели злокачественных клеток, а также к эффекту, результатом которого является ингибирование роста и/или метастазов злокачественной опухоли.

В одном варианте ингибитор ангиогенеза, используемый в качестве второго соединения, выбран из ингибитора тирозинкиназы, ингибитора эпидермального фактора роста, ингибитора полученного из фибробластов фактора роста, ингибитора полученного из тромбоцитов фактора роста, ингибитора MMP (матриксной металлопротеазы), блокатора интегрина, интерферона-α, интерлейкина-12, полисульфата пентозана, ингибитора циклооксигеназы, карбоксиамидотриазола, комбретастатина A-4, скваламина, 6-O-(хлорацетилкарбонил)фумагиллола, талидомида, ангиостатина, тропонина-1 или антитела к VEGF. В одном варианте модулятором рецептора эстрогена является тамоксифен или ралоксифен.

Также в объем формулы изобретения включен способ лечения злокачественной опухоли, который включает в себя введение терапевтически эффективного количества соединения согласно настоящему изобретению в комбинации с лучевой терапией и/или в комбинации со вторым соединением, выбранным из модулятора рецептора эстрогена, модулятора рецептора андрогена, модулятора рецептора ретиноида, цитотоксического/цитостатического средства, антипролиферативного средства, ингибитора пренил-протеин-трансферазы, ингибитора HMG-CoA-редуктазы, ингибитора протеазы ВИЧ, ингибитора обратной транскриптазы, ингибитора ангиогенеза, агонистов PPAR-γ, агонистов PPAR-δ, ингибитора врожденной полилекарственной резистентности, противорвотного средства, средства, применимого для лечения анемии, средства, применимого для лечения нейтропении, лекарственного средства, усиливающего иммунный ответ, ингибитора клеточной пролиферации и передачи сигнала жизнеспособности, бисфосфоната, ингибитора ароматазы, терапевтического средства на основе мяРНК, ингибиторов γ-секретазы, средств, которые отрицательно влияют на рецепторные тирозинкиназы (RTK), средства, которое мешает прохождению контрольных точек клеточного цикла, и любого из терапевтических средств, перечисленных выше.

Еще одним вариантом осуществления изобретению является способ лечения злокачественной опухоли, который включает в себя введение терапевтически эффективного количества соединения согласно настоящему изобретению в комбинации с паклитакселом или трастузумабом.

Изобретение, кроме того, охватывает способ лечения или профилактики злокачественной опухоли, который включает в себя введение терапевтически эффективного количества соединения согласно настоящему изобретению в комбинации ингибитором COX-2.

Настоящее изобретение также относится к фармацевтической композиции, применимой для лечения или профилактики злокачественной опухоли, которая содержит терапевтически эффективное количество соединения согласно настоящему изобретению и второго соединения, выбранного из модулятора рецептора эстрогена, модулятора рецептора андрогена, модулятора рецептора ретиноида, цитотоксического/цитостатического средства, антипролиферативного средства, ингибитора пренил-протеин-трансферазы, ингибитора HMG-CoA-редуктазы, ингибитора протеазы ВИЧ, ингибитора обратной транскриптазы, ингибитора ангиогенеза, агониста PPAR-γ, агониста PPAR-δ, ингибитора клеточной пролиферации и передачи сигнала жизнеспособности, бисфосфоната, ингибитора ароматазы, терапевтического средства на основе мяРНК, ингибиторов γ-секретазы, средств, которые отрицательно влияют на рецепторные тирозинкиназы (RTK), средства, которое мешает прохождению контрольных точек клеточного цикла, и любого из терапевтических средств, перечисленных выше.

Все указанные патенты, публикации и совместно рассматриваемые заявки на выдачу патента включены в данное описание в виде ссылки.

Следующие сокращения использованы в описании химических реакций и в примерах: AEBSF (п-аминоэтилбензолсульфонилфторид); БСА (бычий сывороточный альбумин); BuLi (н-бутиллитий); CDCl3 (хлороформ-d); CuI (йодид меди); CuSO4 (сульфат меди); DCE (дихлорэтан); ДХМ (дихлорметан); DEAD (диэтилазодикарбоксилат); ДМФА (N,N-диметилформамид); ДМСО (диметилсульфоксид); DTT (дитиотреитол); EDTA (этилендиаминтетрауксусная кислота); EGTA (этиленгликольтетрауксусная кислота); EtOAc (этилацетат); EtOH (этанол); HOAc (уксусная кислота); ВЭЖХ (высокоэффективная жидкостная хроматография); МС-ВР (масс-спектр высокого разрешения); ЖХ-МС (жидкостная хроматография-масс-спектрометрия); LHMDS (литий-бис(триметилсилил)амид); МС-НР (масс-спектр низкого разрешения); MeOH (метанол); MP-B(CN)H3 (крупнопористый цианоборгидрид); NaHCO3 (бикарбонат натрия); Na2SO4 (сульфат натрия); Na(OAc)3BH (триацетоксиборгидрид натрия); NH4OAc (ацетат аммония); NBS (N-бромсукцинамид); ЯМР (ядерный магнитный резонанс); PBS (фосфатно-солевой буфер); ПЦР (полимеразная цепная реакция); Pd(dppf) ([1,1'-бис(дифенилфосфино)ферроцен]палладий); Pd(Ph3)4 (палладий(0)тетракистрифенилфосфин); POCl3 (оксихлорид фосфора); PS- DIEA (диизопропилэтиламин полистирола); PS-PPh3 (полистиролтрифенилфосфин); TBAF (фторид тетрабутиламмония); ТГФ (тетрагидрофуран); ТФУ (трифторуксусная кислота); TMSCH2N2 (триметилсилилдиазометан) и Ac (ацетил); BOC (трет-бутоксикарбонил); Bu (бутил); Выч. (вычислено); DIEA (диизопропилэтиламин); DMAP (4-диметиламинопиридин); EDC (N-этил-N'-(3-диметиламинопропил)карбодиимид); экв. (эквиваленты); Et (этил); HOBT (гидроксибензотриазол); PA (изопропанол); ЖХ/МС (жидкостная хроматография-масс-спектрометрия); Me (метил); MeCN (ацетонитрил); NMP (N-метилпирролидинон); Pr (пропил); Pyr (пиридин); насыщ. (насыщенный) и тозиловая (пара-толуолсульфоновая кислота).

Соединения согласно настоящему изобретению могут быть получены с использованием реакций, которые показаны на следующих схемах реакций, кроме других стандартных способов, которые известны в литературе или приведены в качестве примеров в разделе «Экспериментальные способы». Поэтому приведенные ниже иллюстративные схемы реакций не ограничены указанными соединениями или какими-либо конкретными заместителями, используемыми в целях иллюстрации. Нумерация заместителей, которая показана на схемах реакций, не обязательно коррелирует с нумерацией, используемой в формуле изобретения, и часто для ясности показан один заместитель, связанный с соединением, когда допускается множество заместителей согласно определениям формулы A, приведенным выше.

Начальный синтез соединений согласно изобретению показан на схемах реакций I-IX. Конечные реакции, которые могут быть использованы для создания соединений согласно настоящему изобретению, показаны на схемах реакций X-XIV.

Краткое описание схем реакций

На следующих схемах реакций, схемах реакций I-IX, приведены полезные подробности получения бициклических остатков соединений согласно изобретению.

Необходимые промежуточные продукты в некоторых случаях являются коммерчески доступными или могут быть получены согласно описанным в литературе способам. Как показано на схеме реакций I, соответствующим образом замещенный фенилацетилид может быть подвергнут взаимодействию с йодидом меди с образованием соответствующего ацетилида меди I-1 (см., например, Sonogashira, K.; Toda, Y.; Hagihara, N. Tetrahedron Lett. 1975, 4467). Затем промежуточный продукт I-1 может взаимодействовать с соответствующим образом замещенным электрофильным компонентом, давая асимметрично замещенный I-2. Взаимодействие с NBS с последующим гидролизом дает I-3 (см., например, Yusybov, M.S.; Filimonov, V.D.; Synthesis 1991, 2, 131). Множество замещенных и незамещенных арилов и гетероциклилов также могут быть получены коммерческим путем.

На схеме реакций II показано получение соединений, исходя из соответствующим образом замещенного II-1. Указанный промежуточный продукт может быть подвергнут взаимодействию с соответствующим образом замещенным амином с получением промежуточного продукта II-2, который может быть подвергнут взаимодействию с соответствующим арил- или гетероарилдиамином с получением смеси региоизомеров соединений согласно изобретению, которые обычно можно разделить хроматографически.

На схеме реакций III показан синтез другого бициклического гетероциклила.

На схеме реакций IV показано получение соединений, исходя из соответствующим образом замещенного 4-амино-3-нитробензонитрила IV-I. Указанный промежуточный продукт затем может быть подвергнут стимулируемой микроволновым излучением реакции циклоприсоединения [3+2] с получением тетразола IV-II. Алкилирование кислого тетразола электрофилом, таким как метилйодид, дает смесь 2-метил(IV-III)/1-метил(IV-IV)-алкилированных тетразолов, которые разделяют хроматографией на колонке. Ra-Ni-гидрирование IV-III дает диамин IV-V. Дальнейший синтез осуществляют как описано для указанных выше схем реакций.

Схема реакций V является иллюстрацией синтеза соединений. Циклоконденсация Фридлендера соответствующим образом замещенного арил- или гетероариламиноальдегида с соответствующим образом замещенным кетоном дает промежуточные продукты формулы V-1. Превращение функциональной группы карбоновой кислоты в функциональную группу альдегида дает промежуточный продукт V-2 и осуществляется способами, хорошо известными специалисту в данной области. Восстановительное алкилирование соответствующим образом замещенным амином дает соединения формулы V-3.

Схема реакций VI иллюстрирует альтернативный синтез промежуточного продукта V-2.

Схема реакций VII иллюстрирует синтез соединений, начиная с кетона VII-1, который получают согласно способу, описанному в литературе (Renault, O.; Dallemagne, P.; and Rault, S. Org. Prep. Proced. Int., 1999, 31, 324). Конденсация VII-1 с диметилацеталем N,N-диметилформамида дает кетоенамин VII-2, который циклизуется с 2-цианоацетамидом, давая пиридон VII-3. Обработка VII-3 оксихлоридом фосфора дает хлорпиридин VII-4. Бромирование радикала с последующим замещением соответствующим образом замещенными аминами дает амины VII-5. Последующее взаимодействие хлорникотинонитрилов VII-5 с различными биснуклеофилами дает циклизованные структуры VII-6.

Схема реакции VIII иллюстрирует получение соединений 1,6-нафтиридин-6(5H)-она. Синтез начинается с коммерчески доступной карбоновой кислоты (VIII-I), которую превращают в амид Вайнреба (VIII-2). Взаимодействие амида с ариллитиевым реагентом, образованным посредством реакции обмена литий-галоген арилбромида с н-бутиллитием, дает кетон (VIII-3). Конденсация указанного замещенного кетона с 4-аминоникотинальдегидом в присутствии основания, например гидроксида натрия или метоксида натрия, дает 1,6-нафтиридин (VIII-4). Заместителем R на фениле может быть функциональная группа, такая как (силил)защищенный гидроксиметил, замаскированный альдегид (т.е. ацеталь) или карбоновая кислота. Полученное вещество можно превратить в требуемый альдегид VIII-4. В том случае, когда группа R представляет собой гидроксиметил, окисление реагентом, таким как активированный диоксид марганца, дает альдегид VIII-4. В том случае, когда R представляет собой ацеталь, мягкий кислотный гидролиз дает альдегид. Восстановление группы карбоновой кислоты посредством восстановления смешанного ангидрида боргидридом также дает альдегид VIII-4. Полученный альдегид затем может быть подвергнут восстановительному аминированию рядом разнообразных аминов, например 4-замещенным пиперидином, и боргидридом с получением 1,6-нафтиридин-5(H)-онов (VIII-5). Обработка (VIII-5) гидрохлоридом пиридиния при 150°C дает конечный продукт (VIII-6).

Схема реакций IX иллюстрирует альтернативный способ введения гетероциклов в C3-положение. Он начинается с коммерчески доступного дихлорбензопиразина, который может быть подвергнут реакции сочетания с арилбороновой кислотой в присутствии палладиевого катализатора (реакция Сузуки). Затем повтор указанной реакции с другой гетероциклической бороновой кислотой дает конечный продукт при таких же условиях реакции.

Схема реакций I

Схема реакций II

Схема реакций III

Схема реакций IV

Схема реакций V

Схема реакций VI

Схема реакций VII

Схема реакций VIII

Схема реакций IX

Краткое описание конечных схем реакций

На следующих схемах реакций, схемах реакций X-XIV, приведены полезные подробности получения трициклических остатков соединений согласно настоящему изобретению.

Требуемые промежуточные продукты в некоторых случаях являются коммерчески доступными или могут быть получены согласно описанным в литературе способам. Обработка соответствующим образом замещенного промежуточного арила или гетероарила X-1 с использованием POCl3 дает промежуточные продукты формулы X-2. Превращение функциональной группы хлорида в функциональную группу гидразида дает промежуточный продукт X-3 и осуществляется способами, хорошо известными специалисту в данной области. Циклизация с соответствующим диимидазольным предшественником дает соединения формулы X-4.

Схема реакций XI иллюстрирует альтернативный синтез соединений формулы X-4.

Схема реакций XII иллюстрирует синтез соединений формулы XII-2. Конденсация X-3 с подходящим триметоксихлорацетатом дает хлорметилсодержащий промежуточный продукт XII-1, который в результате нуклеофильного замещения дает структуру XII-2.

Схема реакций XIII иллюстрирует получение соединения триазолонафтиридина. Синтез начинается с известного из литературы и патентов нафтиридона (XIII-I), который превращают в хлорид нафтиридина (XIII-2) после обработки POCl3 в условиях кипячения с обратным холодильником. Взаимодействие последнего соединения с неразбавленным гидразином при кипячении с обратным холодильником дает гидразид (XIII-3), который служит в качестве ключевого промежуточного продукта для синтеза соединения триазолонафтиридина. Превращение гидразида (XIII-4) в требуемые соединения триазолонафтиридина в указанных условиях завершает запланированный синтез. Заместитель R на остатке триазола может представлять собой функциональную группу, такую как аминогруппа, оксогруппа или тиольная группа.

Схема реакций XIV иллюстрирует альтернативный способ введения остатка триазола в левую часть молекулы. Он начинается с ранее синтезированного промежуточного гидразида (XIII-3), который можно обработать триметоксиортоацетатом, получая требуемый конечный продукт, соединения тиазолонафтиридина (XIV-I). Заместитель R на остатке триазола может представлять собой функциональную группу, такую как протон, простая алкильная группа, группа хлорметила или функционализированная алкильная группа.

Схема реакций XV иллюстрирует синтез соединений формулы XV-I с использованием трех разных способов восстановительного аминирования для введения первичного амина в определенное положение в бензиле. Способы также применимы по отношению к другим альдегидам, таким как соединения формулы XVII-I.

Схема реакций XVI иллюстрирует синтез соединений формулы XVI-2 с использованием варианта условий для циклоконденсации, показанного на схеме реакций VIII. Применение апротонного растворителя и основания позволяет получать хлорнафтиридины структуры XVI-2.

Схема реакций XVII иллюстрирует синтез соединений формулы XVII-4. В данном случае заместитель метил вводят в положение бензила через сульфонамид XVII-2. Другие заместители могут быть введены с использованием металлоорганических реагентов, таких как реагенты Гриньяра. Трет-бутилсульфинимид можно расщепить с использованием кислоты, такой как HCl, получая амин.

Схема реакций XVIII иллюстрирует синтез соединений формулы XVIII-2 в качестве варианта синтеза триазола, описанного на схеме реакций XI. В данном случае гидразин XVIII-I связывают с карбоновой кислотой и промежуточный ацилгидразин циклизуют до конденсированного триазола в условиях кислотного катализа.

Схема реакций XIX иллюстрирует синтез соединений формулы XIX-2, при котором циклопропиламин синтезируют из нитрила XIX-1.

Схема реакций XX иллюстрирует синтез соединений формулы XX-2 из аминов формулы XX-1 в стандартных условиях восстановительного аминирования.

Схема реакций X

Схема реакций XI

Схема реакций XII

Схема реакций XIII

Схема реакций XIV

Схема реакций XV

Схема реакций XVI

Схема реакций XVII

Схема реакций XVIII

Схема реакций XIX

Схема реакций XX

ПРИМЕРЫ

Приведенные примеры и схемы предназначены для того, чтобы дополнительно помочь в понимании изобретения. Имеется в виду, что конкретные используемые вещества и условия являются дополнительными иллюстрациями изобретения и не ограничивают соответствующий объем изобретения.

СХЕМА 1

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,41триазоло[3,4-f]-1,6-нафтиридин-3-амин (1-4)

5-хлор-3-фенил-2-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридин (1-2)

Во флакон RB объемом 25 мл с якорем для магнитной мешалки загружали 3-фенил-2-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридин-5(6H)-он (0,86 г, 1,6 ммоль), затем безводный POCl3 (8 мл). Смесь нагревали до 120°C и перемешивали при кипячении с обратным холодильником в течение 4 часов. После того как реакционную смесь охлаждали до комнатной температуры, реакционную смесь осторожно добавляли к смеси холодного насыщенного водного раствора NaHCO3 (20 мл) и EtOAc (20 мл). В ходе процесса гашения pH водного слоя поддерживали около pH 8-9. Затем водный раствор дважды экстрагировали EtOAc (15 мл) и остаток промывали MeOH (20 мл). Органические фазы объединяли и концентрировали в вакууме, получая 5-хлор-3-фенил-2-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридин (1-2) (900 мг). Неочищенное вещество непосредственно использовали на следующей стадии без дополнительной очистки.

5-гидразино-3-фенил-2-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил)фенил)-1,6-нафтиридин (1-3)

Во флакон RB объемом 25 мл с якорем для магнитной мешалки загружали 5-хлор-3-фенил-2-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридин (1-2) (900 мг, 1,6 ммоль), затем безводный NH2NH2 (8 мл). Суспензию нагревали до 110°C и перемешивали при кипячении с обратным холодильником в течение 5 часов. После того как реакционную смесь охлаждали до комнатной температуры, реакционную смесь концентрировали в вакууме, получая желтоватый порошок (900 мг). Неочищенный продукт использовали на следующей стадии без дополнительной очистки.

9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амин (1-4)

К 5-гидразино-3-фенил-2-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридину (1-3) (70 мг, 0,126 ммоль) в ДМФА (1,5 мл) добавляли известный из литературы 1,1-ди-1H-имидазол-1-илметанимин (102 мг, 0,633 ммоль). Реакционную смесь перемешивали при 85°C в течение 4 часов, концентрировали в вакууме и подвергали хроматографии, получая требуемый 9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил}[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амин (1-4) (46 мг) в виде соли трифторуксусной кислоты. 1H ЯМР (500 МГц, CDCl3): δ 8,76 (с, 1H), 8,74 (д, J=4,3 Гц, 1H), 8,29-8,27 (м, 2H), 8,19 (м, 1H), 7,67 (м, 1H), 7,54-7,53 (м, 2H), 7,48-7,46 (м, 2H), 7,47 (д, J=7,7 Гц, 1H), 7,34-7,26 (м, 5H), 4,43 (с, 2H), 3,65 (ушир.д, J=10,9 Гц, 2H), 3,46 (ушир.с, 1Н), 3,27-3,19 (м, 2H), 2,50-2,42 (м, 2H), 2,10-2,06 (м, 2H).

Следующие соединения, указанные в таблице 1, получали способом, подобным способу, показанному на схеме 1, и как показано на схемах реакций.

Таблица 1
Соед. Структура Название МС-ВР m/z (M+H)
1-5 9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ол 579,3
1-6 9-фенил-8-(4-{[4-(4-пиридин-2-ил-1H-имидазол-1-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амин 577,3
1-7 9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-тиол 595,2

СХЕМА 2

3-метил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (2-2)

К 5-гидразино-3-фенил-2-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридину (2-1) (55 мг, 0,101 ммоль) в ДМФА (1,0 мл) добавляли триметилортоацетат (0,63 мл, 5,04 ммоль). Реакционную смесь перемешивали при 100°C в течение 3 часов и затем концентрировали в вакууме и подвергали хроматографии, получая требуемый 3-метил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (2-2) (28 мг) в виде соли трифторуксусной кислоты. 1H ЯМР (500 МГц, CDCl3): δ 8,87 (с, 1H), 8,65 (д, J=6,4 Гц, 1H), 8,33 (д, J=7,5 Гц, 1H), 8,11 (д, J=7,8 Гц, 1H), 7,92 (т, J=7,8 Гц, 1H), 7,49-7,41 (м, 3H), 7,36-7,30 (м, 8H), 3,61 (с, 2H), 3,02-3,00 (м, 2H), 3,00-2,84 (м, 1Н), 2,25-2,21 (м, 2H), 2,10-1,83 (м, 4H), 1,97 (с, 3H).

Следующие соединения, приведенные в таблице 2, получали способом, подобным способу, описанному на схеме 2, и как показано на схемах реакций:

Таблица 2
Соед. Структура Название МС-ВР m/z (M+H)
2-3 9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин 563,3
2-4 3-(хлорметил)-9-фенил-8-(4-{[4-(4-пиридин-2-ил-1H-имидазол-1-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин 610,2
2-5 3-[(4-метилпиперазин-1-ил)метил]-9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин 675,4
2-6 2-({[9-фенил-8-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метил}амино)этанол 636,3

СХЕМА 3

8-(4-Аминометилфенил)-9-фенил-[1,2,4]триазоло[3,4-f][1,6]нафтиридин-3-ол (3-8)

СТАДИЯ A: Трет-бутил(2-хлор-3-формилпиридин-4-ил)карбамат (3-1)

Раствор 4-амино-2-хлорпиридина (1,28 г, 10 ммоль) и ди-трет-бутилдикарбоната (2,21 г, 10,1 ммоль) в ТГФ (20 мл) охлаждали до 0°C и медленно добавляли 1М раствор бис(триметилсилил)амида лития в ТГФ (20 мл, 20 ммоль), поддерживая температуру ниже 0°C. Реакционной смеси давали возможность нагреться до комнатной температуры в течение одного часа и затем гасили добавлением 1,5н. водного раствора хлорида аммония (15 мл). После перемешивания в течение нескольких часов реакционную смесь экстрагировали этилацетатом, промывали насыщенным раствором соли, органический слой сушили (Na2SO4), фильтровали и упаривали. Остаток растирали в диэтиловом эфире, получая очищенный трет-бутил(2-хлорпиридин-4-ил)карбамат. Остаточные растворы подвергали хроматографии на силикагеле, элюируя смесью 25-45% этилацетат/гексан, получая дополнительное количество продукта.

Раствор трет-бутил(2-хлорпиридин-4-ил)карбамата (1,14 г, 5 ммоль) в безводном ТГФ (20 мл) охлаждали до -70°C в инертной атмосфере и медленно добавляли 1,7 M трет-бутиллитий/пентан (8 мл, 13,5 ммоль). Реакционную смесь перемешивали в течение двух часов и затем добавляли безводный ДМФА (1,2 мл, 15,5 ммоль). Реакционной смеси давали возможность медленно нагреться до комнатной температуры в течение трех часов. Реакционную смесь гасили 3н. HCl (12 мл) и разбавляли диэтиловым эфиром. Эфирный слой промывали водным раствором NaHCO3, сушили (над Na2SO4), фильтровали и упаривали. Остаток растирали в холодном диэтиловом эфире, получая очищенный трет-бутил(2-хлор-3-формилпиридин-4-ил)карбамат. Остаточные растворы подвергали хроматографии на силикагеле, элюируя смесью 15-20% этилацетат/гексан, получая дополнительное количество продукта. 1H ЯМР (500 МГц, CDCl3): δ 11,0 (1H, ушир.с), 10,52 (1H, с) 8,38 (1H, д, J=6 Гц), 8,31 (1H, д, J=6 Гц), 1,54 (9H, с); m/e (m+1): 257,2.

СТАДИЯ B: 1-[4-(1,3-Диоксолан-2-ил)фенил]-2-фенилэтанон (3-2)

К раствору 4-цианобензальдегида (20,0 г, 152,5 ммоль) и этиленгликоля (25,5 мл, 457,5 ммоль) в толуоле (250 мл) добавляли пара-толуолсульфоновую кислоту (300 мг). Колбу оборудовали ловушкой Дина-Старка и смесь кипятили с обратным холодильником. Через 5 часов смесь концентрировали. Остаток собирали в этилацетате и промывали насыщенным раствором NaHCO3, водой (2Ч) и насыщенным раствором соли. Органический слой сушили (MgSO4), фильтровали и концентрировали, получая 4-(1,3-диоксолан-2-ил)бензонитрил в виде прозрачного масла, которое отверждалось в вакууме: 1H ЯМР (500 МГц, CDCl3): δ 7,67 (2H, д, J=8,06 Гц), 7,59 (2H, д, J=8,30 Гц), 5,85 (1H, с), 4,13-4,05 (4H, м).

К раствору 4-(1,3-диоксолан-2-ил)бензонитрила (5,0 г, 28,54 ммоль) в безводном ТГФ (100 мл) медленно при 0°C добавляли хлорид бензилмагния (36 мл, 20% масс. раствор в ТГФ, 43 ммоль). Спустя один час смесь нагревали до комнатной температуры. Через 4 час смесь охлаждали до 0°C и гасили насыщенным раствором NH4Cl. Смесь нагревали до комнатной температуры и экстрагировали этилацетатом (3Ч). Объединенные органические слои сушили (MgSO4), фильтровали и концентрировали. Флэш-хроматография на колонке (10% этилацетат/гексаны) давала 1-[4-(1,3-диоксолан-2-ил)фенил]-2-фенилэтанон в виде бледно-желтого твердого вещества: 1H ЯМР (500 МГц, CDCl3): δ 8,02 (2H, д, J=8,30 Гц,), 7,57 (2H, д, J=8,30 Гц,), 7,38-7,24 (5H, м), 5,86 (1H, с), 4,29 (2H, с), 4,28-4,09 (4H, м).

СТАДИЯ C: 5-Хлор-2-(4-[1,3]диоксолан-2-илфенил)-3-фенил[1,6]нафтиридин (3-3)

К раствору трет-бутил(2-хлор-3-формилпиридин-4-ил)карбамата (3-1, 30,5 г, 118,9 ммоль) и 1-[4-(1,3-диоксолан-2-ил)фенил]-2-фенилэтанона (3-2, 29,0 г, 108,1 ммоль) в безводном ТГФ (300 мл) при комнатной температуре добавляли LHMDS (1М в ТГФ, 248 мл) в потоке. Реакционную смесь перемешивали при комнатной температуре в течение ночи и затем кипятили с обратным холодильником в течение 24 час. Смесь охлаждали и концентрировали до получения сиропа и обрабатывали NaHCO3 (насыщенный раствор, 50 мл) и водой (300 мл) с образованием твердого вещества, которое собирали фильтрованием. Твердое вещество сушили, промывали эфиром и затем азеотропно сушили с толуолом, получая указанное в заголовке соединение. МС-НР m/z (M+1) вычислено: 389,1; найдено 389,1.

СТАДИЯ D: [2-(4-[1,3]Диоксолан-2-илфенил)-3-фенил[1,6]нафтиридин-5-ил]гидразин (3-4)

Суспензию 5-хлор-2-(4-[1,3]диоксолан-2-илфенил)-3-фенил[1,6]нафтиридин (3-3, 5,2 г, 13,4 ммоль) и безводный гидразин (5 мл) в безводном 1,4-диоксане (15 мл) нагревали при 100°C в микроволновом реакторе в течение 5 мин. Реакционную смесь охлаждали, концентрировали и азеотропно сушили с толуолом, получая указанное в заголовке соединение в виде твердого вещества. МС-НР m/z (M+1) вычислено: 385,2; найдено 385,3.

СТАДИЯ E: 8-(4-[1,3]Диоксолан-2-илфенил)-9-фенил[1,2,4]триазоло[3,4-f][1,6]нафтиридин-3-ол (3-5)

К раствору [2-(4-[1,3]диоксолан-2-илфенил)-3-фенил[1,6]нафтиридин-5-ил]гидразина (3-4, 5,3 г, 13,8 ммоль) в CH2Cl2 (безводный, 40 мл) при 0°C добавляли триэтиламин (9,7 мл, 68,9 ммоль), затем быстро добавляли фосген в толуоле (2М, 7,6 мл). После перемешивания в течение 10 мин при комнатной температуре смесь концентрировали и добавляли воду (30 мл). Твердое вещество собирали и азеотропно сушили с толуолом, получая указанное в заголовке соединение, которое использовали для следующей стадии без дополнительной очистки. МС-НР m/z (M+1) вычислено: 411,1; найдено 411,2.

СТАДИЯ F: 4-(3-Гидрокси-9-фенил[1,2,4]триазоло[3,4-f][1,6]нафтиридин-8-ил)бензальдегид (3-6)

Суспензию 8-(4-[1,3]диоксолан-2-илфенил)-9-фенил[1,2,4]триазоло[3,4-f][1,6]нафтиридин-3-ола (3-5, 2,7 г, 6,6 ммоль) в диоксане (20 мл) и 2н. HCl (20 мл) перемешивали при комнатной температуре в течение 20 мин. Смесь концентрировали, чтобы удалить большую часть диоксана, при 25°C. Остаток вливали в ледяную воду, получая коричневое твердое вещество, которое собирали фильтрованием и азеотропно сушили с толуолом, получая указанное в заголовке соединение. МС-НР m/z (M+1) вычислено: 367,1; найдено 367,1.

СТАДИЯ G: 8-(4-Аминометил-фенил)-9-фенил[1,2,4]триазоло[3,4-f][1,6]нафтиридин-3-ол (3-8)

Суспензию 4-(3-гидрокси-9-фенил[1,2,4]триазоло[3,4-f][1,6]нафтиридин-8-ил)бензальдегида (3-6, 2,4 г, 6,6 ммоль) и 2-амино-2,4-диметилпентановой кислоты (3-7, 1,9 г, 13,1 ммоль) в ДМФА (25 мл) нагревали при 150°C в течение 20 мин. Реакционную смесь охлаждали, разбавляли диоксаном (50 мл) и 2н. HCl (50 мл) и нагревали при 100°C в течение 30 мин. Смесь охлаждали и очищали обращенно-фазовой ВЭЖХ (0-60% ацетонитрил/вода), получая после выпаривания растворителя указанное в заголовке соединение в виде желтого твердого вещества. МС-ВР m/z (M+1) вычислено: 368,1506; найдено 368,1504. 1H ЯМР (CD3OD): δ 8,72 (с, 1Н), 7,98 (д, 1Н), 7,52 (д, 2H), 7,46 (д, 2H), 7,24-7,38 (м, 5Н), 7,12 (д, 1H), 4,14 (с, 2H).

СХЕМА 4

1-[4-(9-Фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (4-3)

СТАДИЯ A: 8-[4-(1,3-Диоксолан-2-ил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (4-1)

К раствору [2-(4-[1,3]диоксолан-2-илфенил)-3-фенил[1,6]нафтиридин-5-ил]гидразина (3-4, 1,6 г, 4,2 ммоль) и моногидрата толуолсульфоновой кислоты (79 мг, 0,4 ммоль) в смеси 3:1 толуол:MeOH (16 мл) добавляли триметилортоформиат (0,58 мл, 12,5 ммоль). Смесь нагревали до 100°C в микроволновом реакторе в течение 1 часа. Затем реакционную смесь концентрировали в вакууме. Твердое вещество собирали и азеотропно сушили с толуолом, получая указанное в заголовке соединение, которое использовали для следующей стадии без дополнительной очистки. МС-НР m/z (M+1) вычислено: 395,1, найдено 395,2.

СТАДИЯ B: 4-(9-Фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензальдегид (4-2)

Суспензию 8-[4-(1,3-диоксолан-2-ил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (4-1, 0,80 г, 2,0 ммоль) в диоксане (10 мл) и 3н. HCl (10 мл) перемешивали при комнатной температуре в течение 15 мин. Смесь концентрировали при 25°C, чтобы удалить большую часть диоксана. Остаток вливали в ледяную воду, получая коричневое твердое вещество, которое собирали фильтрованием и азеотропно сушили с толуолом (х2), получая указанное в заголовке соединение. МС-НР m/z (M+1) вычислено: 351,1; найдено 351,2.

СТАДИЯ C: 1-[4-(9-Фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (4-3)

Суспензию 4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензальдегида (4-2, 0,80 г, 2,3 ммоль) и 2-амино-2,4-диметилпентановой кислоты (3-7, 0,340 г, 2,3 ммоль) в ДМФА (10 мл) нагревали при 150°C в течение 30 мин. Реакционную смесь охлаждали и растворитель удаляли в вакууме. Неочищенный остаток растворяли в 3н. HCl (8 мл) и нагревали при 100°C в течение 30 мин. Смесь охлаждали и очищали обращенно-фазовой ВЭЖХ (5-65% ацетонитрил/вода в течение 15 мин), получая после выпаривания растворителей указанное в заголовке соединение в виде желтого твердого вещества. 1H ЯМР (CD3OD): δ 9,60 (с, 1Н), 8,98 (с, 1Н), 8,73 (д, 1Н), 7,75 (д, 1Н), 7,60 (д, 2H), 7,46 (д, 2H), 7,39-7,36 (м, 5Н), 4,15 (с, 2H).

СХЕМА 5

4-(3-Метил-9-фенил-[1,2,4]триазоло[3,4-f][1,6]нафтиридин-8-ил)бензиламин (5-3)

СТАДИЯ A: 8-[4-(1,3-Диоксолан-2-ил)фенил]-3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (5-1)

К раствору [2-(4-[1,3]диоксолан-2-илфенил)-3-фенил[1,6]нафтиридин-5-ил]гидразина (3-4, 0,35 г, 0,91 ммоль) и моногидрата толуолсульфоновой кислоты (17 мг, 0,09 ммоль) в смеси 3:1 толуол:MeOH (4 мл) добавляли триметилортоацетат (0,157 мл, 1,23 ммоль). Смесь нагревали до 100°C в микроволновом реакторе в течение 75 мин. Затем реакционную смесь концентрировали в вакууме. Твердое вещество собирали и азеотропно сушили с толуолом, получая указанное в заголовке соединение, которое использовали для следующей стадии без дополнительной очистки. МС-НР m/z (M+1) вычислено: 409,2, найдено 409,2.

СТАДИЯ B: 4-(3-Метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензальдегид (5-2)

Суспензию 8-[4-(1,3-диоксолан-2-ил)фенил]-3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридина (5-1, 0,30 г, 0,73 ммоль) в диоксане (5 мл) и 3н. HCl (5 мл) перемешивали при комнатной температуре в течение 15 мин. Смесь концентрировали при 25°C, чтобы удалить большую часть диоксана. Остаток вливали в ледяную воду, получая коричневое твердое вещество, которое собирали фильтрованием и азеотропно сушили с толуолом (х2), получая указанное в заголовке соединение. МС-НР m/z (M+1) вычислено: 365,1; найдено 365,2.

СТАДИЯ C: 4-(3-Метил-9-фенил[1,2,4]триазоло[3,4-f][1,6]нафтиридин-8-ил)бензиламин (5-3)

Суспензию 4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензальдегида (13, 0,25 г, 0,69 ммоль) и 2-амино-2,4-диметилпентановой кислоты (3-7, 0,101 г, 0,69 ммоль) в ДМФА (3 мл) нагревали при 150°C в течение 30 мин. Реакционную смесь охлаждали и растворитель удаляли в вакууме. Неочищенный остаток растворяли в 3н. HCl (2,5 мл) и нагревали при 100°C в течение 30 мин. Смесь охлаждали и очищали обращенно-фазовой ВЭЖХ (5-65% ацетонитрил/вода в течение 15 мин), получая после выпаривания растворителей указанное в заголовке соединение в виде желтого твердого вещества. МС-ВР m/z (M+1) вычислено: 366,1713, найдено 366,1715.

СХЕМА 5 (АЛЬТЕРНАТИВНЫЙ СИНТЕЗ)

4-(3-Метил-9-фенил[1,2,4]триазоло[3,4-f][1,6]нафтиридин-8-ил)бензиламин (5-3)

СТАДИЯ A: 4-(5-Хлор-3-фенил[1,6]нафтиридин-2-ил)бензальдегид (A)

К раствору 3-3 (5,0 г, 12,9 ммоль) в 1,4-диоксане (30 мл) при 0°C добавляли 8,5 мл 3н. HCl (25,7 ммоль). Смеси давали возможность нагреться до комнатной температуры и перемешивали в течение 1,3 часа. Реакционную смесь гасили NaHCO3 (насыщенным раствором) вплоть до pH 7-8. Смесь экстрагировали EtOAc (х3). Объединенные органические слои промывали насыщенным раствором соли, сушили над MgSO4 и концентрировали, получая желтое твердое вещество в качестве требуемого продукта A. ЖХ/МС найдено: M+1=345,1.

СТАДИЯ B: Трет-бутиловый эфир [4-(5-хлор-3-фенил[1,6]нафтиридин-2-ил)бензил]карбаминовой кислоты (C)

К раствору A (2,8 г, 8,1 ммоль) и B (1,1 г, 8,9 ммоль) в 15 мл безводного MeCN добавляли триэтилсилан (8,5 г, 73 ммоль), затем трифторуксусную кислоту (3,7 г, 32,5 ммоль). Смесь перемешивали при комнатной температуре в течение 3 часов. Затем смесь вливали в водный раствор бикарбоната натрия (30 мл) и экстрагировали EtOAc (х3). Объединенные органические слои промывали насыщенным раствором соли и сушили над MgSO4. После удаления растворителя остаток очищали флэш-хроматографией на колонке, получая требуемый продукт C. ЖХ/МС найдено: M+1=446,1.

СТАДИЯ C: Трет-бутиловый эфир [4-(5-гидразино-3-фенил[1,6]нафтиридин-2-ил)бензил]карбаминовой кислоты (D)

К раствору C (3,7 г, 8,3 ммоль) в 22 мл 1,4-диоксана по каплям добавляли гидразин (6,1 г, 189,1 ммоль). Смесь нагревали при 100°C в микроволновом реакторе в течение 5 мин. После удаления растворителя остаток собирали в EtOAc и промывали насыщенным раствором NaHCO3. Органический слой промывали насыщенным раствором соли, сушили над MgSO4 и концентрировали, получая требуемый продукт D, который использовали на следующей стадии без дополнительной очистки. ЖХ/МС найдено: M+1=442,2.

СТАДИЯ D: Трет-бутиловый эфир [4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f][1,6]нафтиридин-8-ил)бензил]карбаминовой кислоты (E)

К раствору D (3,8 г, 8,6 ммоль) и моногидрата пара-толуолсульфоновой кислоты (0,08 г, 0,4 ммоль) в 20 мл смеси толуол/метанол (3:1) добавляли триметилортоацетат (1,4 г, 11,6 ммоль). Раствор нагревали в микроволновом реакторе при 100°C в течение 35 мин. Реакционную смесь гасили твердым NaHCO3 (0,5 г). Органический слой концентрировали и очищали флэш-хроматографией на колонке (100% EtOAc - 10% MeOH/90% EtOAc в течение 35 мин), получая требуемый продукт E. ЖХ/МС найдено: M+1=466,2.

СТАДИЯ E: 4-(3-Метил-9-фенил[1,2,4]триазоло[3,4-f][1,6]нафтиридин-8-ил)бензиламин (5-3)

К раствору E (4,1 г, 8,7 ммоль) в 80 мл CH2Cl2 по каплям добавляли 40 мл ТФУ. Смесь перемешивали при комнатной температуре в течение 15 мин. Растворитель удаляли. Остаток обрабатывали NaHCO3 (насыщенный раствор) вплоть до pH 9. Смесь экстрагировали EtOAc (х6). Объединенные органические слои концентрировали и сушили над MgSO4. После удаления растворителя получали требуемый продукт 5-6 в виде желтого твердого вещества. ЖХ/МС, найдено: M+1=366,1. 1H ЯМР (300 МГц, CD3OD): δ 8,95 (с, 1Н), 8,66 (д, 1Н), 7,82 (д, 1Н), 7,60 (д, 2H), 7,45 (д, 2H), 7,42-7,34 (м, 5Н), 4,15 (с, 2H), 3,00 (с, 3H).

СХЕМА 6

8-[4-(Аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амин (6-2)

СТАДИЯ A: 8-[4-(1,3-Диоксолан-2-ил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амин (6-1)

К безводному EtOH (1 мл) добавляли бромциан (0,104 мл, 0,52 ммоль, 5 М в MeCN), затем карбонат натрия (96 мг, 0,91 ммоль). Добавляли [2-(4-[1,3]Диоксолан-2-илфенил)-3-фенил[1,6]нафтиридин-5-ил]гидразин (3-4, 100 мг, 0,26 ммоль) и смесь перемешивали в течение 3 час. Реакционную смесь концентрировали в вакууме и полученное в результате твердое вещество использовали без дополнительной очистки. МС-НР m/z (M+1) вычислено: 410,2; найдено 410,1.

СТАДИЯ B: 8-[4-(Аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амин (6-2)

Указанное в заголовке соединение получали из 8-[4-(1,3-диоксолан-2-ил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амина (6-1), используя способы, описанные на схеме 5 (от 5-1 до 5-3). МС-НР m/z (M+1) вычислено: 367,2; найдено 367,1.

СХЕМА 7

1-[4-(9-Фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамин (7-4)

СТАДИЯ A: 2-Метил-N-{(1E)-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метилиден}пропан-2-сульфинамид (7-2)

Рацемический 2-метил-2-пропансульфинамид (7-1, 647 мг, 5,3 ммоль), сульфат меди (1,70 г, 7,30 ммоль) и альдегид 4-2 (511 мг, 1,45 ммоль) перемешивали в метиленхлориде (10 мл) в течение 5 дней при 50°C. После охлаждения до комнатной температуры смесь фильтровали через целит, концентрировали до минимального объема и очищали автоматизированной хроматографией на силикагеле (0-10% MeOH в CH2Cl2 в течение 30 мин), получая указанное в заголовке соединение в виде коричневой пены. МС-НР m/z (M+1) вычислено: 454,2; найдено 454,2.

СТАДИЯ B: 2-Метил-N-{1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил1этилпропан-2-сульфинамид (7-3)

Раствор бромида метилмагния (13,5 мл 1,4 М раствора в смеси 3:1 толуол/ТГФ, 19 ммоль) добавляли к перемешиваемому раствору 2-метил-N-{(1E)-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метилиден}пропан-2-сульфинамида (7-2, 298 мг, 0,66 ммоль) в метиленхлориде (5 мл) при -78°C и раствор нагревали до комнатной температуры. Через 18 час реакционную смесь гасили насыщенным раствором хлорида аммония и экстрагировали этилацетатом, промывали насыщенным раствором соли, сушили над сульфатом магния, фильтровали и концентрировали, получая пену янтарного цвета, которую очищали хроматографией на силикагеле (0-10% MeOH/CH2Cl2 в течение 30 мин), получая указанное в заголовке соединение в виде желтой пены. МС-НР m/z (M+1) вычислено: 470,2; найдено 470,3.

СТАДИЯ C: 1-[4-(9-Фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамин (7-4)

К перемешиваемому раствору 2-метил-N-{1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}пропан-2-сульфинамида (7-3, 180 мг, 0,38 ммоль) в метаноле (6 мл) добавляли концентрированную HCl (1,5 мл). Через 1 час добавляли воду и смесь промывали метиленхлоридом. Водную часть подщелачивали насыщенным раствором карбоната натрия и экстрагировали метиленхлоридом. К органическому слою добавляли 2н. HCl (5 мл) и смесь концентрировали до минимального объема. Сырой продукт очищали, используя обращенно-фазовую препаративную ВЭЖХ, получая указанное в заголовке соединение в виде бледно-желтого твердого вещества. МС-НР m/z (M+1) вычислено: 366,2, найдено 366,3.

СХЕМА 8

9-Фенил-8-{4-[4-(5-пиридин-2-ил-4H-[1,2,4]триазол-3-ил)пиперидин-1-илметил]фенил}-[1,2,4]триазоло[3,4-f][1,6]нафтиридин (8-10)

Трет-бутил(2-хлор-3-формилпиридин-4-ил)карбамат (8-1)

Раствор 4-амино-2-хлорпиридина (1,28 г, 10 ммоль) и ди-трет-бутилдикарбоната (2,21 г, 10,1 ммоль) в ТГФ (20 мл) охлаждали до 0°C и медленно добавляли 1М раствор бис(триметилсилил)амида лития в ТГФ (20 мл, 20 ммоль), поддерживая температуру ниже 0°C. Реакционной смеси давали возможность нагреться до комнатной температуры в течение одного часа и затем гасили добавлением 1,5н. водного раствора хлорида аммония (15 мл). Смесь экстрагировали этилацетатом, промывали насыщенным раствором соли и органический слой сушили (Na2SO4), фильтровали и упаривали. Остаток растирали в диэтиловом эфире, получая очищенный трет-бутил(2-хлорпиридин-4-ил)карбамат. Остаточные растворы подвергали хроматографии на силикагеле, элюируя смесью 25-45% этилацетат/гексан, получая дополнительное количество продукта.

Раствор трет-бутил(2-хлорпиридин-4-ил)карбамата (1,14 г, 5 ммоль) в безводном ТГФ (20 мл) охлаждали до -70°C в инертной атмосфере и медленно добавляли 1,7 М трет-бутиллитий/пентан (8 мл, 13,5 ммоль). Реакционную смесь перемешивали в течение двух часов и затем добавляли безводный ДМФА (1,2 мл, 15,5 ммоль). Реакционной смеси давали возможность медленно нагреться до комнатной температуры в течение трех часов. Реакционную смесь гасили 3н. HCl (12 мл) и разбавляли диэтиловым эфиром. Эфирный слой промывали водным раствором NaHCO3, сушили (над Na2SO4), фильтровали и упаривали. Остаток растирали в холодном диэтиловом эфире, получая очищенный трет-бутил(2-хлор-3-формилпиридин-4-ил)карбамат. Остаточные растворы подвергали хроматографии на силикагеле, элюируя смесью 15-20% этилацетат/гексан, получая дополнительное количество продукта. 1H ЯМР (500 МГц, CDCl3): δ 11,0 (1H, ушир.с), 10,52 (1H, с), 8,38 (1H, д, J=6 Гц), 8,31 (1H, д, J=6 Гц), 1,54 (9H, с); m/e (m+1): 257,2.

1-[4-(1,3-Диоксолан-2-ил)фенил]-2-фенилэтанон (8-2)

К раствору 4-цианобензальдегида (20,0 г, 152,5 ммоль) и этиленгликоля (25,5 мл, 457,5 ммоль) в толуоле (250 мл) добавляли пара-толуолсульфоновую кислоту (300 мг). Колбу оборудовали ловушкой Дина-Старка и смесь кипятили с обратным холодильником. Через 5 час смесь концентрировали. Остаток собирали в этилацетате и промывали насыщенным раствором NaHCO3, водой (2х) и насыщенным раствором соли. Органический слой сушили (MgSO4), фильтровали и концентрировали, получая 4-(1,3-диоксолан-2-ил)бензонитрил в виде прозрачного масла, которое отверждалось в вакууме: 1H ЯМР (500 МГц, CDCl3): δ 7,67 (2H, д, J=8,06 Гц), 7,59 (2H, д, J=8,30 Гц), 5,85 (1H, с), 4,13-4,05 (4H, м).

К раствору 4-(1,3-диоксолан-2-ил)бензонитрила (5,0 г, 28,54 ммоль) в безводном ТГФ (100 мл) медленно при 0°C добавляли хлорид бензилмагния (36 мл, 20% масс. раствор в ТГФ, 43 ммоль). Через один час смесь нагревали до комнатной температуры. Через четыре часа смесь охлаждали до 0°C и гасили насыщенным раствором NH4Cl. Смесь нагревали до комнатной температуры и экстрагировали этилацетатом (3х). Объединенные органические слои сушили (MgSO4), фильтровали и концентрировали. Флэш-хроматография на колонке (10% этилацетат/гексаны) давала 1-[4-(1,3-диоксолан-2-ил)фенил]-2-фенилэтанон в виде бледно-желтого твердого вещества: 1H ЯМР (500 МГц, CDCl3): δ 8,02 (2H, д, J=8,30 Гц), 7,57 (2H, д, J=8,30 Гц,), 7,38-7,24 (5H, м), 5,86 (1H, с), 4,29 (2H, с), 4,28-4,09 (4H, м).

2-[4-(1,3-Диоксолан-2-ил)фенил]-5-метокси-3-фенил-1,6-нафтиридин (8-3)

К неполному раствору 1-[4-(1,3-диоксолан-2-ил)фенил]-2-фенилэтанона (997 мг, 3,72 ммоль) и трет-бутил(2-хлор-3-формилпиридин-4-ил)карбамата (924 мг, 3,6 ммоль) в безводном метаноле (14 мл) добавляли смесь 25% масс. метоксид натрия/метанол (2,5 мл, 11,4 ммоль). Реакционную смесь нагревали при 65°C в течение четырех часов. Охлажденную реакционную смесь концентрировали, чтобы удалить метанол и остаток распределяли между водой и этилацетатом. Органический слой сушили (Na2SO4), фильтровали и упаривали. Остаток растирали в холодном эфире, получая очищенный 2-[4-(1,3-диоксолан-2-ил)фенил]-5-метокси-3-фенил-1,6-нафтиридин. Остаточные растворы очищали хроматографией на силикагеле, и элюирование смесью 20-40% этилацетат/гексан давало дополнительное количество продукта. 1H ЯМР (500 МГц, CDCl3): δ 8,54 (1H, с), 8,23 (1H, д, J=5,9 Гц), 7,55 (1H, д, J=5,9 Гц), 7,48 (2H, д, J=8 Гц), 7,40 (2H, д, J=8 Гц), 7,29-7,30 (3H, м), 7,22-7,25 (2H, м), 4,16 (3H, с), 4,02-411 (4H, 2 м), m/e (m+1): 385,1.

4-(5-Метокси-3-фенил-1,6-нафтиридин-2-ил)бензальдегид (8-4)

К раствору 2-[4-(1,3-диоксолан-2-ил)фенил]-5-метокси-3-фенил-1,6-нафтиридина (760 мг, 1,98 ммоль) в ТГФ (8 мл) добавляли 1н. HCl (6 мл) и раствор перемешивали в течение трех часов. Этилацетат добавляли и смесь подщелачивали водным раствором Na2CO3. Органический слой сушили (Na2SO4), фильтровали и растворитель выпаривали. Остаток растирали в диэтиловом эфире, получая чистый продукт. Остаточные растворы очищали хроматографией на колонке с силикагелем, и элюирование смесью 10-30% этилацетат/гексан давало дополнительное количество продукта. 1H ЯМР (500 МГц, CDCl3): δ 10,10 (1H, с), 8,60 (1H, с), 8,26 (1H, д, J=6 Гц), 7,81 (2H, д, J=8,3 Гц), 7,62 (2H, д, J=8,3 Гц), 7,56 (1H, д, J=6,1 Гц), 7,30-7,32 (3H, м), 7,21-7,23 (2H, м), 4,17 (3H, с), m/e (m+1): 341,1.

Дигидрохлорид 2-(3-пиперидин-4-ил-1H-1,2,4-триазол-5-ил)пиридина (8-5)

Карбонилдиимидазол (3,57 г, 22 ммоль) добавляли к раствору 1-(трет-бутоксикарбонил)пиперидин-4-карбоновой кислоты (4,59 г, 20 ммоль) в метиленхлориде (50 мл) и перемешивали в течение двух часов вплоть до прекращения выделения газа. Затем к реакционной смеси добавляли гидразин (0,8 мл, 26 ммоль) и реакционную смесь перемешивали при комнатной температуре еще в течение двух часов. Реакционную смесь разбавляли дополнительным количеством метиленхлорида и промывали насыщенным водным раствором NaHCO3. Органический слой сушили над безводным Na2SO4, фильтровали и растворитель выпаривали, получая вязкий остаток. Растирание в диэтиловом эфире давало трет-бутил-4-(гидразинокарбонил)пиперидин-1-карбоксилат в виде не совсем белого твердого вещества. 1H ЯМР (500 МГц, CDCl3): δ 6,77 (1H, ушир.с), 4,15 (2H, ушир.с), 3,90 (2H, ушир.с), 2,75 (2H, ушир.с), 2,22 (1H, м), 1,78 (2H, ушир.д, J=11,9 Гц), 1,66 (2H, ушир.кв, J=12,2 Гц, J=27,5 Гц), 1,47 (9H, с).

Полученное вещество (2,43 г, 10 ммоль) растворяли в безводном 2-этоксиэтаноле (20 мл) и к раствору добавляли 2-цианопиридин (1,14 г, 11 ммоль). После добавления смеси 25% масс. метоксид натрия/метанол (1,1 мл, ~5 ммоль) смесь нагревали до 130°C в течение 16 часов. Охлажденную реакционную смесь нейтрализовали уксусной кислотой и распределяли между этилацетатом и водным раствором NaHCO3. Органический слой сушили над Na2SO4, соли удаляли фильтрованием и растворитель выпаривали в вакууме. Полученный остаток растирали в диэтиловом эфире, получая трет-бутил-4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-карбоксилат в виде белого твердого вещества. 1H ЯМР (500 МГц, CDCl3): δ 8,70 (1H, д, J=3,9 Гц), 8,19 (1H, д, J=7,9 Гц), 7,87 (1H, дт, J=1,7 Гц, J=8 Гц), 7,40 (1H, м), 4,20 (2H, ушир.с), 3,03 (1H, м), 2,95 (2H, ушир.с), 2,09 (2H, ушир.д, J=12 Гц), 1,86 (2H, ушир.кв, J=4,2 Гц), 1,49 (9H, с); m/e (m+1): 330,2.

Полученное вещество (2,68 г, 8,14 ммоль) суспендировали в смеси 4н. HCl/диоксан. Реакционную смесь в закрытом сосуде перемешивали при комнатной температуре в течение 16 часов и затем разбавляли диэтиловым эфиром. Твердое вещество выделяли фильтрованием и гигроскопичное твердое вещество обрабатывали ацетонитрилом. Полученное твердое вещество выделяли фильтрованием и частично растворяли в горячем метаноле. После охлаждения и добавления к раствору некоторого количества этилового эфира 2-(3-пиперидин-4-ил-1H-1,2,4-триазол-5-ил)пиридин медленно выпадал в осадок в виде дигидрохлоридной соли. 1Н ЯМР (500 МГц, ДМСО-d6): δ 9,10 (1H, ушир.с), 8,92 (1H, ушир.с), 8,73 (1H, д, J=4,9 Гц), 8,10-8,20 (2H, м), 7,64 (1H, т, J=5,7 Гц), 3,33 (2H, ушир.д, J=12,7 Гц), 3,16 (1H, м), 3,05 (2H, ушир.кв, J=11,9 Гц, J=21,8 Гц), 2,18 (2H, ушир.д, J=11,5 Гц), 1,99 (2H, ушир.кв, J=11,0 Гц, J=22,2 Гц): m/e (m+1): 230,3.

5-Метокси-3-фенил-2-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метилфенил-1,6-нафтиридин (8-6)

К раствору дигидрохлорида 2-(3-пиперидин-4-ил-1H-1,2,4-триазол-5-ил)пиридина (542 мг, 1,80 ммоль) и 4-(5-метокси-3-фенил-1,6-нафтиридин-2-ил)бензальдегида (560 мг, 1,65 ммоль) в безводном ДМФА (6 мл) добавляли триэтиламин (0,83 мл, 6 ммоль). После перемешивания в течение 10 минут добавляли уксусную кислоту (1,03 мл, 18 ммоль) и смесь перемешивали при комнатной температуре в течение ночи. Затем одной порцией добавляли триацетоксиборгидрид натрия (367 мг, 1,73 ммоль) и перемешивали в течение шести часов. После проверки с помощью ЖХ/МС определили, что реакция не была завершена, добавляли дополнительные порции триацетооксиборгидрида натрия (2×90 мг) в течение нескольких последующих часов, за это время реакция была завершена. Смесь разбавляли этилацетатом и добавляли водный раствор Na2CO3. Органический слой отделяли и дважды промывали водой, сушили (Na2SO4) и растворитель выпаривали. Остаток обрабатывали ацетонитрилом и после охлаждения твердый продукт выделяли фильтрованием. Полученное твердое вещество суспендировали в горячем этилацетате и медленно добавляли метанол вплоть до полного растворения. Затем растворители выпаривали до небольшого объема и давали возможность остыть, при этом выкристаллизовывался чистый продукт. Остаточные растворы очищали хроматографией на колонке с силикагелем, и элюирование смесью 1-7% метанол/этилацетат давало дополнительное количество продукта. 1H ЯМР (500 МГц, CDCl3): δ 8,66 (1H, д, J=4,7 Гц), 8,54 (1H, с), 8,23 (1H, д, J=6 Гц), 8,16 (1H, д, J=7,8 Гц), 7,83 (1H, дт, J=1,7 Гц, J=7,8 Гц), 7,56 (1H, д, J=6 Гц), 7,40 (2H, д, J=8 Гц), 7,36 (1H, дд), 7,28-7,30 (3H, м), 7,23-7,25 (2H, м), 4,16 (3H, с), 3,54 (2H, с), 2,96 (2H, ушир.д, J=11,5 Гц), 2,85 (1H, т, J=3,7 Гц), 2,06-2,17 (4H, м), 1,92-2,01 (2H, м), m/e (m+1): 554,3, 277,9 [(m+2)/2].

3-Фенил-2-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридин-5(6H)-он (8-7)

Смесь 5-метокси-3-фенил-2-(4-{[4-(5-пиридин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридина (725 мг, 1,31 ммоль) и гидрохлорида пиридина (6,9 г, ~60 ммоль) нагревали при 150°C в течение десяти минут. Охлажденный остаток растворяли в минимальном количестве воды и нейтрализовали водным раствором NaHCO3. Преципитированное твердое вещество собирали фильтрованием и очищали хроматографией на колонке с силикагелем, элюируя смесью 1-14% метанол/этилацетат (насыщенный NH4OH). Выделенный продукт обрабатывали смесью метанол/ацетонитрил, получая чистый продукт. 1Н ЯМР (500 МГц, ДМСО-d6): δ 11,58 (1H, д, J=4,8 Гц), 8,68 (1H, ушир.с), 8,39 (1H, с), 8,03 (1H, д, J=7,3 Гц), 7,50 (2H, т, J=6,5 Гц), 7,31-7,33 (5H, м), 7,24-7,25 (4H, м), 6,79 (2H, д, J=7,3 Гц), 3,50 (2H, с), 2,84 (2H, ушир.д, J=10,5 Гц), 2,72 (1H, м), 2,08 (2H, ушир.т, J=11 Гц), 1,95 (2H, ушир.д, J=11,6 Гц), 1,77 (2H, м). m/e (m+1): 540,3, 270,9 [(m+2)/2].

5-Хлор-3-фенил-2-{4-[4-(5-пиридин-2-ил-4H-[1,2,4]триазол-3-ил)пиперидин-1-илметил]фенил}[1,6]нафтиридин (8-8)

Смесь 8-7 (5,5 г, 10,2 ммоль) и POCl3 (50,0 г, 326,1 ммоль) и ДМФА (0,3 г, 4,1 ммоль) кипятили с обратным холодильником при 130°C в течение 3 час. Реакционную смесь охлаждали и концентрировали, чтобы удалить POCl3. Добавляли 40 мл толуола и концентрировали, получая твердое вещество. К твердому веществу добавляли 50 мл H2O и 40 мл NaHCO3 (насыщенный) и 20 мл 1н. NaOH до pH 9. Смесь перемешивали, чтобы преципитировать твердое вещество, которое собирали фильтрованием в виде требуемого продукта 8-8. Продукт промывали водой и CH3CN и сушили в вакууме.

ЖХ/МС: M+1=559,09.

(3-Фенил-2-{4-[4-(5-пиридин-2-ил-4H-[1,2,4]триазол-3-ил)пиперидин-1-илметил]фенил}[1,6]нафтиридин-5-ил)гидразин (8-9)

Суспензию 8-8 (4,3 г, 7,7 ммоль) в 30 мл 1,4-диоксана и гидразина (7,4 г, 231,1 ммоль) нагревали в микроволновом реакторе при 100°C в течение 5 мин. Смесь охлаждали и концентрировали, чтобы удалить растворители. Добавляли толуол 40 мл (х3) и удаляли в вакууме, чтобы удалить остаточный гидразин. Требуемый продукт 8-9 получали в виде твердого вещества.

ЖХ/МС: M+1=554,4.

9-Фенил-8-{4-[4-(5-пиридин-2-ил-4H-[1,2,4]триазол-3-ил)пиперидин-1-илметил]фенил}[1,2,4]триазоло[3,4-f][1,6]нафтиридин (8-10)

К раствору 8-9 (4,5 г, 8,1 ммоль) в 20 мл метанола и 60 мл толуола добавляли триметоксиортоформиат (3,5 г, 32,5 ммоль) и толуолсульфоновую кислоту (0,1 г, 0,8 ммоль). Смесь кипятили с обратным холодильником в течение 10 час. После удаления растворителя остаток очищали флэш-хроматографией на колонке (от 100% CHCl3 до 50% CHCl3 и 50% метанола), получая требуемый продукт 8-10.

МС-ВР: M+1 (вычислено) = 564,2619; найдено = 564,2589.

1H ЯМР (500 МГц, CD3OD): δ 9,35 (1H, с), 8,96 (1H, с), 8,72 (1H, д), 8,59 (1H, д), 8,28-8,10 (2H, м), 7,68-7,48 (6H, м), 7,40-7,30 (5H, м), 4,40 (2H, с), 3,68-3,20 (5H, м), 2,50-2,10 (4H, м).

СХЕМА 9

9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-(1H-1,2,3-триазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (9-4)

4-(5-хлор-3-фенил-1,6-нафтиридин-2-ил)бензальдегид (9-1)

К перемешиваемому раствору 3-3 (16 г, 41,1 ммоль) в безводном 1,4-диоксане (75 мл) при 0°C добавляли 3н. HCl (27 мл). Затем реакционной смеси давали возможность достичь комнатной температуры и перемешивали в течение примерно 3 часов. После завершения реакцию гасили насыщенным раствором NaHCO3 до pH>7. Продукт экстрагировали этилацетатом (3×150 мл). Объединенные органические слои промывали насыщенным раствором соли, сушили над Na2SO4 и MgSO4, фильтровали и концентрировали в вакууме, получая 4-(5-хлор-3-фенил-1,6-нафтиридин-2-ил)бензальдегид 9-1 в виде желто-коричневого твердого вещества. ЖХ/МС (M+1) вычислено: 345,8; найдено: 345,0.

5-хлор-3-фенил-2-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридин (9-2)

К перемешиваемому раствору 9-1 (4,9 г, 14,2 ммоль) и 8-5 (4,2 г, 15,6 ммоль) в NMP (50 мл) добавляли триэтиламин (6 мл, 42,6 ммоль), затем уксусную кислоту (1,6 мл, 28,4 ммоль). После перемешивания при температуре окружающей среды в течение ночи порциями добавляли триацетоксиборгидрид натрия (3,6 г, 17 ммоль). После завершения реакционную смесь разбавляли этилацетатом и промывали насыщенным раствором NaHCO3, затем водой, затем насыщенным раствором соли. Органический слой сушили над Na2SO4 и MgSO4, фильтровали и концентрировали в вакууме. Сырой остаток очищали, используя флэш-хроматографию на диоксиде кремния (градиент: 0% - 10% MeOH в CHCl3 в течение 25 мин), получая 9-2 в виде оранжевого твердого вещества. ЖХ/МС (M+1) вычислено: 559,1; найдено: 559,2.

5-гидразино-3-фенил-2-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридин (9-3)

К перемешиваемому раствору 9-2 (5 г, 8,9 ммоль) в безводном 1,4-диоксане (20 мл) добавляли гидразин (5,9 мл, 188,1 ммоль). Раствор нагревали до 100°C в микроволновом реакторе в течение 5 минут. Растворитель удаляли в вакууме и три раза проводили азеотропную сушку с толуолом. Неочищенное твердое вещество растирали в насыщенном растворе NaHCO3 в течение 20 минут. Суспензию фильтровали и промывали большим количество воды. Твердое вещество три раза азеотропно сушили с толуолом, получая 9-3 в виде желто-коричневого твердого вещества. ЖХ/МС (M+1) вычислено: 554,6; найдено: 554,2.

9-фенил-8-(4-{[4-(5-пиридин-2-ил~4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-(1H-1,2,3-триазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (9-4)

К перемешиваемому раствору 9-3 (2,0 г, 3,6 ммоль), HOBT (0,5 г, 3,9 ммоль) и 1H-1,2,3-триазол-4-карбоновой кислоты (0,4 г, 3,9 ммоль) в безводном ДМФА (20 мл) добавляли DIEA (1,2 мл, 7,2 ммоль), затем EDC (0,76 г, 3,9 ммоль). Раствор перемешивали при температуре окружающей среды в течение ночи. Затем раствор обрабатывали 2 мл уксусной кислоты и нагревали до 80°C в течение 3 час. После охлаждения до комнатной температуры раствор фильтровали через шприцевой фильтр и очищали обращенно-фазовой ВЭЖХ на колонке C18, получая 9-4 в виде твердого вещества. МС (M+1), вычислено: 631,2789; найдено: 631,2778.

В таблице 3 указаны соединения, полученные с использованием способов согласно схеме 9, с заменой 8-9 соответствующим амином и с заменой 1H-1,2,3-триазол-4-карбоновой кислоты соответствующей карбоновой кислотой. Соединения 9-5 - 9-8 и 9-13 - 9-25 выделяли в виде HCl-солей. Соединения 9-9 - 9-12 выделяли в виде ТФУ-солей.

Таблица 3
Соед. Структура Название МС-ВР m/z (M+H)
9-5 3-(1H-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин 630,2831
9-6 трет-бутил[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метилкарбамат 693,3394
9-7 [9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанол 594,2703
9-8 5-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]-2,4-дигидро-3H-1,2,4-триазол-3-он 647,2729
9-9 3-(3-метил-1H-1,2,4-триазол-5-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин 645,2948
9-10 3-имидазо[2,1-b][1,3]тиазол-6-ил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин 686,2547
9-11 9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин 682,2902
9-12 3-имидазо[1,2-a]пиридин-2-ил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин МС-НР (M+1)=680,3
9-13 9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-(1H-1,2,4-триазол-5-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин 631,2792
9-14 3-(1H-бензимидазол-6-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин 680,2988
9-15 3-(1,5-диметил-1H-пиразол-3-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил}метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин 658,3145
9-16 3-имидазо[1,2-a]пиримидин-2-ил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин 681,2949
9-17 5-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]пиридин-2-амин 656,2988
9-18 9-фенил-3-пиразоло[1,5-a]пиримидин-3-ил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин 681,2951
9-19 3-(5-метил-1H-пиразол-3-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин 644,2998
9-20 3-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]пиридин-2-амин 656,298
9-21 4-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]фенол 656,288
9-22 3-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]фенол 656,288
9-23 2-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]фенол 656,2894
9-24 1-{4-[3-(5-оксо-4,5-дигидро-1H-1,2,4-триазол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пиперидин-4-карбоксамид 546,2344
9-25 1-[4-(3-имидазо[1,2-a]пиридин-2-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пиперидин-4-карбоксамид 579,2598

СХЕМА 10

9-фенил-8-(4-{[4-(5-пиразин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (10-4)

2-(3-пиперидин-4-ил-1H-1,2,4-триазол-5-ил)пиразин (10-1)

К раствору 1-(трет-бутоксикарбонил)пиперидин-4-карбоновой кислоты (120 г, 520 ммоль) в ДХМ (250 мл) порциями добавляли карбонилдиимидазол (96 г, 590 ммоль) при комнатной температуре. Через 30 минут реакционную смесь добавляли к свежеприготовленному раствору гидразина (27 г, 840 ммоль) в ДХМ (100 мл). Через 30 минут реакционную смесь промывали насыщенным раствором карбоната натрия, насыщенным раствором соли, сушили над сульфатом натрия, фильтровали и концентрировали. Полученное в результате твердое вещество суспендировали в эфире и фильтровали, получая трет-бутил-4-(гидразинокарбонил)пиперидин-1-карбоксилат в виде белого твердого вещества. 1Н ЯМР (400 МГц, ДМСО-d6): δ 9,00 (с, 1H), 4,15-4,10 (с, 2H), 3,95-3,90 (м, 2H), 2,80-2,60 (м, 2H), 2,25-2,20 (м, 1H), 1,62-1,55 (м, 2H), 1,40 (с, 9H).

Раствор пиразинкарбонитрила (2,0 г, 19 ммоль) в метаноле (20 мл) обрабатывали метоксидом натрия в метаноле (25% масс., 1,3 мл, 5,7 ммоль) при комнатной температуре. Через 30 минут добавляли раствор трет-бутил-4-(гидразинокарбонил)пиперидин-1-карбоксилата (4,6 г, 19 ммоль) в метаноле (20 мл) и реакционную смесь кипятили с обратным холодильником в течение 19 часов. Реакционную смесь концентрировали, растворяли в этоксиэтаноле (50 мл) и кипятили с обратным холодильником в течение 22 часов. Реакционную смесь охлаждали до комнатной температуры, гасили уксусной кислотой (0,38 мл, 6,6 ммоль) и концентрировали. Остаток суспендировали в эфире и фильтровали, получая трет-бутил-4-(5-пиразин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-карбоксилат в виде твердого вещества. МС-ВР(М+Н+): найдено = 331,1876, вычислено = 331,1877. 1H ЯМР (400 МГц, CD3OD): δ 9,29 (д, J=1,6 Гц, 1H), 8,70 (дд, J=2,4, 1,6 Гц, 1H), 8,64 (д, J=2,4 Гц, 2H), 4,19-4,15 (м, 2H), 3,15-3,09 (м, 1H), 2,97 (м, 2H), 2,07-2,03 (м, 2H), 1,84-1,75 (м, 2H), 1,48 (с, 9H).

Раствор трет-бутил-4-(5-пиразин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-карбоксилата (6,0 г, 18 ммоль) в трифторуксусной кислоте (25 мл) перемешивали при комнатной температуре. Через 1 час реакционную смесь концентрировали. Полученное в результате твердое вещество суспендировали в этилацетате и метаноле и фильтровали, получая 10-1 в виде ТФУ-соли. Соль растворяли в смеси 1:1 ацетонитрил:вода, наносили на ионообменную смолу SCX, промывали ацетонитрилом и элюировали 10% NH3 в этаноле, получая 10-1 в виде твердого вещества. 1H ЯМР (400 МГц, CDCl3): δ 9,28-9,26 (м, 1H), 8,70-8,68 (м, 1H), 8,60-8,58 (м, 1H), 3,35-3,22 (м, 2H), 3,15-3,05 (м, 1H), 2,90-2,85 (м, 2H), 2,15-2,08 (м, 2H), 1,95-1,90 (м, 2H).

5-хлор-3-фенил-2-(4-{[4-(5-пиразин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридин (10-2)

К перемешиваемому раствору 9-1 (1 г, 2,9 ммоль) и 10-1 (1,09 г, 3,2 ммоль) в NMP (10 мл) добавляли триэтиламин (0,8 мл, 5,8 ммоль), затем уксусную кислоту (0,3 мл, 5,8 ммоль). После перемешивания при температуре окружающей среды в течение ночи порциями добавляли триацетоксиборгидрид натрия (0,6 г, 2,9 ммоль). После завершения реакционную смесь разбавляли этилацетатом и промывали насыщенным раствором NaHCO3, затем водой, затем насыщенным раствором соли. Органический слой сушили Na2SO4 и MgSO4, фильтровали и концентрировали в вакууме. Сырой остаток очищали, используя флэш-хроматографию на диоксиде кремния (градиент: 0% - 10% MeOH в CHCl3 в течение 25 мин), получая 10-2 в виде твердого вещества. ЖХ/МС (M+1) вычислено: 560,1; найдено: 560,2.

5-гидразино-3-фенил-2-(4-{[4-(5-пиразин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридин (10-3)

К перемешиваемому раствору 10-2 (0,5 г, 0,9 ммоль) в безводном 1,4-диоксане (5 мл) добавляли гидразин (0,56 мл, 17,8 ммоль). Раствор нагревали до 100°C в микроволновом реакторе в течение 20 минут. Растворитель удаляли в вакууме и три раза азеотропно сушили с толуолом. Неочищенное твердое вещество растирали в насыщенном растворе NaHCO3 в течение 20 минут. Суспензию фильтровали и промывали большим количеством воды. Твердое вещество три раза азеотропно сушили с толуолом, получая 10-3 в виде коричневого твердого вещества. ЖХ/МС (M+1) вычислено: 555,6; найдено: 555,2.

9-фенил-8-(4-{[4-(5-пиразин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (10-4)

К перемешиваемому раствору 10-3 (0,5 г, 0,9 ммоль) в 16 мл смеси 3:1 толуол:метанол добавляли триметилортоформиат (0,3 г, 2,7 ммоль) и моногидрат пара-толуолсульфоновой кислоты (0,017 г, 0,09 ммоль). Реакционную смесь нагревали до 100°C в микроволновом реакторе в течение 1 часа. После охлаждения до комнатной температуры растворитель удаляли при пониженном давлении. Продукт очищали обращенно-фазовой ВЭЖХ на колонке C18, получая 10-4 в виде твердого вещества. Масса (M+1) вычислено: 565,2571; найдено: 565,2523.

СХЕМА 11

9-фенил-8-(4-{[4-(5-пиримидин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-(1H-1,2,3-триазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (11-4)

2-(3-пиперидин-4-ил-1H-1,2,4-триазол-5-ил)пиримидин (11-1)

Смесь трет-бутил-4-(гидразинокарбонил)пиперидин-1-карбоксилата (10,1 г, 41,5 ммоль) и 2-цианопиримидина (4,36 г, 41,5 ммоль) в 1-бутаноле (20 мл) кипятили с обратным холодильником в течение 48 часов. Смесь концентрировали, суспендировали в эфире и фильтровали, получая трет-бутил-4-(5-пиримидин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-карбоксилат в виде твердого вещества. МС (M+H+): найдено 331,2; 1H ЯМР (400 МГц, CD3OD): δ 8,92 (д, J=4,0 Гц, 2H), 7,52 (т, J=4,0 Гц, 1H), 4,18-4,15 (м, 2H), 3,14-3,08 (м, 1H), 2,98 (ушир.с, 2H), 2,07-2,01 (м, 2H), 1,85-1,77 (м, 2H), 1,48 (с, 9H).

К раствору трет-бутил-4-(5-пиримидин-2-ил-1H-1,2,4-триазол-3-ил)пиперидин-1-карбоксилата (13,6 г, 41,1 ммоль) в метаноле (30 мл) и ДХМ (15 мл) добавляли насыщенный раствор безводного HCl в этилацетате (60 мл). Через 2 часа реакционную смесь концентрировали. Полученное в результате твердое вещество суспендировали в этилацетате и метаноле и фильтровали, получая 11-1 в виде HCl-соли. Соль растворяли в смеси 1:1 ацетонитрил:вода, наносили на ионообменную смолу SCX, промывали ацетонитрилом и элюировали 10% NH3 в этаноле, получая 11-1 в виде твердого вещества. МС (M+H+): 231,2.

5-хлор-3-фенил-2-(4-{[4-(5-пиримидин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридин (11-2)

К перемешиваемому раствору 9-1 (0,25 г, 0,73 ммоль) и 11-1 (0,23 г, 0,87 ммоль) в NMP (5 мл) добавляли триэтиламин (0,3 мл, 2,2 ммоль), затем уксусную кислоту (0,082 мл, 1,5 ммоль). После перемешивания при температуре окружающей среды в течение ночи добавляли триацетоксиборгидрид натрия (0,18 г, 0,87 ммоль). После завершения реакции реакционную смесь разбавляли этилацетатом и промывали насыщенным раствором NaHCO3, затем водой, затем насыщенным раствором соли. Органический слой сушили над Na2SO4 и MgSO4, фильтровали и концентрировали в вакууме, получая 11-2. ЖХ/МС вычислено: 559,1; найдено: 559,3.

5-гидразино-3-фенил-2-(4-{[4-(5-пиримидин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридин (11-3)

К перемешиваемому раствору 11-2 (0,4 г, 0,7 ммоль) в безводном 1,4-диоксане (3 мл) добавляли гидразин (0,45 мл, 14,5 ммоль). Раствор нагревали до 100°C в микроволновом реакторе в течение 5 минут. Растворитель удаляли в вакууме и три раза азеотропно сушили с толуолом, получая 11-3. ЖХ/МС (M+1) вычислено: 555,6; найдено: 555,4.

9-фенил-8-(4-{[4-(5-пиримидин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-(1H-1,2,3-триазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (11-4)

К перемешиваемому раствору 11-3 (0,2 г, 0,36 ммоль), HOBT (0,05 г, 0,4 ммоль) и 1H-1,2,3-триазол-4-карбоновой кислоты (0,05 г, 0,4 ммоль) в безводном ДМФА (2 мл) добавляли DIEA (0,18 мл, 1,1 ммоль) с последующим добавлением EDC (0,08 г, 0,4 ммоль). Раствор нагревали в микроволновом реакторе в течение 30 минут при 80°C. Затем раствор обрабатывали 0,5 мл уксусной кислоты и нагревали до 80°C в микроволновом реакторе в течение 10 мин. После охлаждения до комнатной температуры раствор пропускали через шприцевой фильтр и очищали обращенно-фазовой ВЭЖХ на колонке C18, получая 11-4 в виде твердого вещества. Масса (M+1) вычислено: 632,2742; найдено: 632,274.

СХЕМА 12

3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиримидин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил]фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (12-1)

К перемешиваемому раствору 11-3 (0,23 г, 0,4 ммоль), HOBT (0,06 г, 0,45 ммоль) и 1-метил-1H-имидазол-4-карбоновой кислоты (0,06 г, 0,45 ммоль) в безводном ДМФА (2 мл) добавляли DIEA (0,13 мл, 0,8 ммоль), затем EDC (0,09 г, 0,5 ммоль). Раствор нагревали в микроволновом реакторе в течение 15 минут при 80°C. Затем раствор обрабатывали 0,2 мл уксусной кислоты и нагревали до 80°C в микроволновом реакторе в течение 20 минут. После охлаждения до комнатной температуры раствор пропускали через шприцевой фильтр и очищали обращенно-фазовой ВЭЖХ на колонке C18, получая 12-1 в виде твердого вещества. Масса (M+1) вычислено: 632,2742; найдено: 632,274.

СХЕМА 13

3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (13-3)

8-[4-(1,3-диоксолан-2-ил)фенил]-3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (13-1)

К перемешиваемому раствору 3-4 (5 г, 13 ммоль), HOBT (1,9 г, 14,3 ммоль), и 1-метил-1H-имидазол-4-карбоновой кислоты (2 г, 15,6 ммоль) в безводном ДМФА (100 мл) добавляли EDC (2,7 г, 14,3 ммоль). Раствор перемешивали в течение ночи при температуре окружающей среды. Затем раствор обрабатывали 24 мл уксусной кислоты и нагревали до 80°C на масляной бане в течение 5 часов. После охлаждения до комнатной температуры добавляли равный объем воды, полученную в результате суспензию фильтровали и промывали большим количеством воды. Собранное твердое вещество три раза азеотропно сушили с толуолом, получая 13-1 в виде желто-коричневого твердого вещества. Масса (M+1) вычислено: 475,1877; найдено: 475,1871.

4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензальдегид (13-2)

К перемешиваемому раствору 13-1 (2 г, 4,2 ммоль) в ТГФ (32 мл) добавляли 1н. HCl (32 мл). По мере перемешивания реакционной смеси при комнатной температуре в течение 1 часа образовывалась суспензия. Затем реакцию гасили 100 мл насыщенного раствора NaHCO3. Суспензию фильтровали и промывали водой. Собранное твердое вещество три раза азеотропно сушили толуолом, получая 13-2 в виде желто-коричневого твердого вещества. Масса (M+1) вычислено: 431,1615; найдено: 431,1616.

3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,41триазоло[3,4-f]-1,6-нафтиридин (13-3)

К перемешиваемому раствору 13-2 (0,5 г, 1,2 ммоль) и 8-5 (0,34 г, 1,3 ммоль) в NMP (10 мл) добавляли триэтиламин (0,33 мл, 2,3 ммоль), затем уксусную кислоту (0,13 мл, 2,3 ммоль). После перемешивания в течение ночи при комнатной температуре порциями добавляли триацетоксиборгидрид натрия (0,3 г, 1,3 ммоль). После перемешивания в течение 6 часов раствор фильтровали через шприцевой фильтр и очищали обращенно-фазовой ВЭЖХ на колонке C18, получая 13-3 в виде твердого вещества. Масса (M+1) вычислено: 644,2993; найдено: 644,2988.

Таблица 4 содержит соединения, полученные с применением способов, указанных на схеме 13, с заменой 8-5 соответствующим амином. Соединения 13-4 - 13-7, 13-10 - 13-19 и 13-21 выделяли в виде HCl-соли. Соединения 13-8 и 13-9 выделяли в виде ТФУ-солей.

Таблица 4
Соед. Структура Название МС-ВР m/z (M+H)
13-4 3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиразин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин 645,2946
13-5 N-[2-(4-метил-1H-имидазол-2-ил)этил]-N-(4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}амин 540,2609
13-6 N1-(2-гидроксифенил)-N3-(4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}бета-аланинамид 595,2564
13-7 1-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пиперидин-4-карбоксамид 543,2611
13-8 5-[({4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}амино)метил]пиридин-2-ол 539,2302
13-9 N1,N1,2,2-тетраметил-N3-(4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пропан-1,3-диамин 545,3125
13-10 3-гидрокси-2,2-диметил-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амин Вычислено: 452,2659 Найдено: 452,2655
13-11 2-фтор-3-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амин Вычислено: 442,2038 Найдено: 442,2021
13-12 2,2-дифтор-3-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амин Вычислено: 460,1944 Найдено: 460,1926
13-13 2,3-дигидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амин Вычислено: 440,2081 Найдено: 440,2076
13-14 4-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]циклогексанамин Вычислено: 464,2445 Найдено: 464,2448
13-15 4-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]циклогексанамин Вычислено: 464,2445 Найдено: 464,2438
13-16 3-гидрокси-2,2-диметил-N-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пропан-1-амин Вычислено: 518,2663 Найдено: 518,2663
13-17 3-гидрокси-2,2-диметил-N-[4-(9-фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амин Вычислено: 556,2568 Найдено: 556,2570
13-18 3-гидрокси-2,2-диметил-N-[4-(9-фенил-3-пиразоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амин Вычислено: 555,2616 Найдено: 555,2575
13-19 3-гидрокси-2,2-диметил-N-{4-[9-фенил-3-(1H-1,2,3-триазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пропан-1-амин Вычислено: 505,2459 Найдено: 505,2453
13-20 трет-бутил{[8-(4-{[(3-гидрокси-2,2-диметилпропил)амино]метил}фенил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метил}карбамат Вычислено: 567,3018 Найдено: 567,3015
13-21 N-{4-[3-(аммониометил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-3-гидрокси-2,2-диметилпропан-1-амин Вычислено: 467,2554 Найдено: 467,2553

Соединение 13-4

3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиразин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-

ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (13-4)

К перемешиваемому раствору 13-2 (1,5 г, 3,5 ммоль) и 10-1 (1,4 г, 4,0 ммоль) в NMP (30 мл) добавляли триэтиламин (1 мл, 7 ммоль), затем уксусную кислоту (0,4 мл, 7 ммоль). После перемешивания в течение ночи при комнатной температуре порциями добавляли триацетоксиборгидрид натрия (0,9 г, 4,2 ммоль). После перемешивания в течение 6 часов добавляли насыщенный раствор NaHCO3 вплоть до pH выше 7. Полученную в результате суспензию фильтровали и промывали водой. Твердое вещество три раза азеотропно сушили толуолом и очищали, используя нормально-фазовую флэш-хроматографию (градиент: от 100% CHCl3 до 10% MeOH в CHCl3 в течение 40 мин), получая 13-4 в виде белого твердого вещества. Масса (M+1) вычислено: 645,2946; найдено: 645,2946.

СХЕМА 14

[9-фенил-8-(4-{[4-(5-пиразин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанол (14-3)

{8-[4-(1,3-диоксолан-2-ил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанол (14-1)

К перемешиваемому раствору 3-4 (5 г, 13 ммоль), HOBT (1,9 г, 14,3 ммоль) и гликолевой кислоты (1,2 г, 15,6 ммоль) в безводном ДМФА (100 мл) добавляли EDC (2,7 г, 14,3 ммоль). Раствор перемешивали в течение ночи при температуре окружающей среды. Затем раствор обрабатывали 5 мл ледяной уксусной кислоты и нагревали до 80°C на масляной бане в течение 2 часов. После охлаждения до комнатной температуры реакционную смесь разбавляли этилацетатом и промывали NaHCO3 (водный раствор), водой и насыщенным раствором соли. Органический слой сушили над MgSO4, фильтровали и концентрировали в вакууме, получая 14-1 в виде красного твердого вещества. ЖХ/МС (M+1) вычислено: 425,5; найдено: 425,6.

4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензальдегид (14-2).

К суспензии 14-1 (2,1 г, 4,9 ммоль) в ТГФ (50 мл) добавляли 1н. HCl (50 мл). После перемешивания при комнатной температуре в течение 30 минут реакционную смесь разбавляли этилацетатом и дважды промывали водой, затем насыщенным раствором соли. Органический слой сушили над MgSO4 и Na2SO4, фильтровали и концентрировали в вакууме, получая 14-2 в виде красного твердого вещества. Масса (M+1) вычислено: 381,1346; найдено: 381,1346.

[9-фенил-8-(4-{[4-(5-пиразин-2-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанол (14-3)

К перемешиваемому раствору 14-2 (0,05 г, 0,1 моль) и 10-1 (0,05 г, 0,15 ммоль) в NMP (1 мл) добавляли триэтиламин (0,04 мл, 0,26 ммоль), затем уксусную кислоту (0,01 мл, 0,26 ммоль). После перемешивания в течение ночи при комнатной температуре добавляли триацетоксиборгидрид натрия (0,03 г, 0,2 ммоль). После перемешивания в течение 6 часов раствор фильтровали через шприцевой фильтр и очищали обращенно-фазовой ВЭЖХ на колонке C18, получая 14-3 в виде твердого вещества. Масса (M+1) вычислено: 595,2677; найдено: 595,2679.

В таблице 5 приведены соединения, полученные с применением способов, указанных на схеме 14, с заменой 10-1 соответствующим амином. Соединения 14-4, 14-5, 14-7 и 14-8 выделяли в виде HCl-солей. Соединение 14-6 выделяли в виде ТФУ-соли.

Таблица 5
Соед. Структура Название МС-ВР m/z (M+H)
14-4 N3-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-N1-(2-гидроксифенил)бета-аланинамид 545,2293
14-5 (8-{4-[(циклогексиламино)метил]фенил}-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил)метанол 464,2435
14-6 N3-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-N1-(4-гидроксифенил)бета-аланинамид 545,2296
14-7 [9-фенил-8-(4-{[4-(5-пиридин-3-ил-4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанол МС-НР (M+1)= 594,2
14-8 1-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пиперидин-4-карбоксамид 493,2344

СХЕМА 15

{8-[4-(1-аминоциклопропил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метанол (15-2)

4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензонитрил (15-1)

К перемешиваемой суспензии 14-2 (0,4 г, 1,1 ммоль) в безводном ТГФ (15 мл) добавляли 3 мл концентрированного NH4OH. Затем раствор обрабатывали йодом (0,4 г, 1,1 ммоль) с последующим перемешиванием при комнатной температуре в течение ночи. Реакцию гасили насыщенным раствором тиосульфата натрия (20 мл) и продукт три раза экстрагировали этилацетатом. Объединенные органические слои промывали насыщенным раствором соли, сушили над Na2SO4, фильтровали и концентрировали в вакууме, получая 15-1 в виде желто-коричневого твердого вещества. Масс (M+1) вычислено: 378,135; найдено: 378,1345.

{8-[4-(1-аминоциклопропил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метанол (15-2)

Бромид этилмагния в диэтиловом эфире (0,4 мл, 1,2 ммоль, 3 М) добавляли при

-70°C к раствору 15-1 (0,1 г, 0,3 ммоль) и изопропоксида титана (IV) (0,17 г, 0,6 ммоль) в безводном ТГФ (7 мл). Через 10 мин охлаждающую баню убирали и реакционную смесь нагревали до комнатной температуры. После перемешивания в течение 1 часа добавляли дополнительное количество бромида этилмагния в диэтиловом эфире (0,18 мл, 0,5 ммоль, 3 М), реакционную смесь охлаждали до 0°C на ледяной бане и обрабатывали эфиратом трифторида бора (0,18 г, 1,2 ммоль). Реакционную смесь перемешивали при 0°C в течение 30 минут, затем нагревали до комнатной температуры в течение 1 часа. Реакцию гасили 1н. HCl с последующим перемешиванием в течение 3 часов. Раствор подщелачивали 1 М NaOH, экстрагировали хлороформом, сушили над Na2SO4, фильтровали и концентрировали в вакууме. Сырой остаток собирали в метаноле и очищали, используя обращенно-фазовую ВЭЖХ на колонке C18, получая 15-2 в виде твердого вещества. ЖХ/МС (M+1) вычислено: 408,4; найдено: 408,0.

СХЕМА 16

1-[4-(9-фенил-3-пиридин-4-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-3)

Трет-бутил-4-(5-хлор-3-фенил-1,6-нафтиридин-2-ил)бензилкарбамат (16-1)

К перемешиваемому раствору 9-1 (7 г, 20,2 ммоль) и трет-бутилкарбамата (2,6 г, 22,3 ммоль) в безводном ацетонитриле (35 мл) добавляли триэтилсилан (29,1 мл, 182 ммоль), затем трифторуксусную кислоту (6 мл, 81 ммоль). После перемешивания в течение 3 часов раствор вливали в водный раствор NaHCO3 и три раза экстрагировали этилацетатом. Объединенные органические слои промывали водой, затем насыщенным раствором соли. Затем органический слой сушили над Na2SO4, фильтровали и концентрировали в вакууме и очищали, используя флэш-хроматографию на диоксиде кремния. ЖХ/МС (M+1) вычислено: 446,9; найдено: 446,1.

Трет-бутил-4-(5-гидразино-3-фенил-1,6-нафтиридин-2-ил)бензилкарбамат (16-2)

К перемешиваемому раствору 16-1 (6,8 г, 15,2 ммоль) в безводном 1,4-диоксане (20 мл) добавляли гидразин (10,8 мл, 343 ммоль). Раствор нагревали до 100°C в микроволновом реакторе в течение 5 минут. Растворитель удаляли в вакууме, неочищенный остаток собирали в этилацетате и промывали водным раствором NaHCO3, затем насыщенным раствором соли. Органический слой сушили над MgSO4, фильтровали и концентрировали в вакууме, получая 16-2 в виде оранжевого твердого вещества. ЖХ/МС (M+1) вычислено: 442,5; найдено: 442,2.

1-[4-(9-фенил-3-пиридин-4-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (16-3)

К перемешиваемому раствору 16-2 (0,08 г, 0,2 ммоль), HOBT (0,03 г, 0,2 ммоль) и изоникотиновой кислоты (0,02 г, 0,2 ммоль) в безводном ДМФА (1 мл) добавляли DIEA (0,08 мл, 0,5 ммоль), затем EDC (0,04 г, 0,2 ммоль). Раствор нагревали в микроволновом реакторе при 80°C в течение 12 мин. Затем раствор обрабатывали 0,5 мл уксусной кислоты и нагревали в микроволновом реакторе при 80°C в течение 30 минут. После охлаждения до комнатной температуры летучие вещества выпаривали в вакууме, раствор фильтровали через шприцевой фильтр и очищали обращенно-фазовой ВЭЖХ на колонке C18, получая 16-3 в виде твердого вещества. Масса (M+1) вычислено: 429,1822; найдено: 429,1811.

В таблице 6 приведены соединения, полученные с применением способов, указанных на схеме 16, с заменой изоникотиновой кислоты соответствующей карбоновой кислотой:

Таблица 6
Соед. Структура Название МС-ВР m/z (M+H)
16-4 1-{4-[3-(1-оксидопиридин-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 445,1772
16-5 1-[4-[3,9-дифенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 428,1865
16-6 1-{4-[3-(4-фторфинил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 446,177
16-7 4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}бензонитрил; выделенный в виде соли HCl 453,182
16-8 4-(9-фенил-3-пиримидин-4-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензиламин; выделенный в виде соли HCl 430,1774
16-9 1-{4-[3-(1-оксидопиридин-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 445,174
16-10 5-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}пиридин-2-ол; выделенный в виде соли HCl 445,1771
16-11 1-[4-(9-фенил-3-пиридин-3-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин; выделенный в виде соли HCl 429,1846
16-12 4-(9-фенил-3-пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензиламин; выделенный в виде соли HCl 430,177
16-13 1-[4-(9-фенил-3-пиридин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин; выделенный в виде соли ТФУ МС-НР (M+1)=42 9,1
16-14 1-[4-(9-фенил-3-пиразин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин; выделенный в виде соли HCl 430,1775
16-15 1-{4-[9-фенил-3-(1H-1,2,4-триазол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 419,1727
16-16 1-{4-[9-фенил-3-(1,3-тиазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 470,1824
16-17 1-{4-[9-фенил-3-(1H-пиразол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 418,1764
16-18 1-{4-[3-(3-метил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 432,193
16-19 1-{4-[3-(3-метил-1H-1,2,4-триазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин, выделенный в виде соли HCl 433,182
16-20 1-{4-[3-(1-метил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 432,193
16-21 1-{4-[9-фенил-3-(1,2,5-тиадиазол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 436,1341
16-22 1-{4-[9-фенил-3-(1,2,3-тиадиазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 436,1333
16-23 1-[4-(9-фенил-3-пиразоло[1,5-a]пиримидин-3-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин; выделенный в виде соли HCl 469,1882
16-24 {8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метанамин; выделенный в виде соли HCl 381,1817
16-25 {8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метанол; выделенный в виде соли HCl 382,1657
16-26 1-{4-[9-фенил-3-(2,2,2-трифторэтил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 434,1584
16-27 1-{4-[9-фенил-3-(1H-тетразол-1-илметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 434,1831
16-28 {8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-карбоксамид; выделенный в виде соли HCl МС-НР (M+1)=39 5,2
16-29 1-{4-[3-(1H-имидазол-1-илметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 432,1931
16-30 1-(4-{3-[(метилсульфонил)метил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамин; выделенный в виде соли HCl 444,1488
16-31 {8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}ацетонитрил; выделенный в виде соли HCl 391,166
16-32 2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}этанол; выделенный в виде соли HCl 396,1819
16-33 N-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)ацетамид; выделенный в виде соли HCl 423,1925
16-34 4-[3-(2-метилимидазо[1,2-a]пиридин-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин МС-НР (M+1)=48
2,2
16-35 1-[4-(9-фенил-3-пиразоло[1,5-a]пиридин-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин МС-НР (M+1)=46
8,1
16-36 1-[4-(3-имидазо[1,2-a]пиридин-2-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин; выделенный в виде свободного основания и соли HCl 468,1923
16-37 1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-1,2-бензизоксазол-3-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин МС-НР (M+1)=45
6,2
[M-NH2]
16-38 1-[4-(3-имидазо[2,1-b][1,3]тиазол-6-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин; выделенный в виде свободного основания и соли HCl 474,1474
16-39 1-{4-[3-(1-метил-1H-имидазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин МС-НР (M+1)=41
5,1
[M-NH2]
16-40 1-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде свободного основания и соли HCl МС-НР (M+1)=43
2,1
16-41 1-[3-(1-метил-5-фенил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин; выделенный в виде соли ТФУ 508,2232
16-42 1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-1-бензотиен-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин, выделенный в виде соли ТФУ 488,189
16-43 1-{4-[3-(1-изопропил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин, выделенный в виде соли ТФУ 460,2245
16-44 1-{4-[9-фенил-3-(1,4,5,6-тетрагидроциклопента[c]пиразол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли ТФУ 458,2067
16-45 1-(4-{9-фенил-3-[(2S)-пирролидин-2-ил][1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамин; выделенный в виде соли HCl 421,2137
16-46 4-[3-(1-аминоэтил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин); выделенный в виде соли HCl 395,1962
16-47 1-{4-[3-(1H-имидазол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 418,1774
16-48 1-[4-(3-циклопропил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин; выделенный в виде соли ТФУ 392,1866
16-49 1-{4-[9-фенил-3-(трифторметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли ТФУ 420,1423
16-50 1-{4-[3-(5-метил-1H-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли ТФУ 432,1924
16-51 1-{4-[3-(1,5-диметил-1H-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли ТФУ 446,2077
16-52 4-[3-(1H-индол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин; выделенный в виде соли ТФУ 467,1968
16-53 1-{4-[3-(1-метил-1H-имидазол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли ТФУ 432,1921
16-54 1-{4-[3-(3-метил-2H-3лямбда5-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин, выделенный в виде соли ТФУ МС-НР (M+1)=43
2,1
16-55 4-[3-(6-хлоримидазо[1,2-a]пиридин-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин; выделенный в виде соли ТФУ МС-НР (M+1)=50
2,1
16-56 1-{4-[3-(1H-бензимидазол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли ТФУ 468,1921
16-57 4-[3-(5-циклопропил-4H-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин; выделенный в виде соли ТФУ 458,2087
16-58 1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-1H-индазол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли ТФУ 472,2244
16-59 4-[9-фенил-3-(3-фенил-1H-пиразол-5-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин; выделенный в виде соли ТФУ 494,2085
16-60 1-(4-{9-фенил-3-[3-(трифторметил)-1H-пиразол-5-ил][1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамин; выделенный в виде соли ТФУ 486,1643
16-61 1-[4-(9-фенил-3-пиразоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин; выделенный в виде соли ТФУ 469,1881
16-62 1-{4-[3-(1-бензил-1H-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли ТФУ 508,2235
16-63 1-[4-(9-фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин; выделенный в виде соли ТФУ 470,1834
16-64 4-[9-фенил-3-(1-фенил-1H-пиразол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин; выделенный в виде соли ТФУ 494,2085
16-65 1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-2-бензотиен-1-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли ТФУ 488,1901
16-66 1-{4-[9-фенил-3-(5,6,7,8-тетрагидроимидазо[1,2-a]пиридин-2-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 472,2231
16-67 2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}пропан-2-амин; выделенный в виде соли HCl 409,2126
16-68 1-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}этан-1,2-диол; выделенный в виде соли ТФУ 412,1761
16-69 4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}имидазолидин-2-он; выделенный в виде соли ТФУ 436,1873
16-70 (2R)-2-амино-2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}этанол; выделенный в виде соли ТФУ 411,1921
16-71 (2R)-2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-2-(метиламино)этанол; выделенный в виде соли ТФУ 425,2077
16-72 1-{4-[3-(5-этилизоксазол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 447,1913
16-73 5-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-2,4-дигидро-3H-1,2,4-триазол-3-он; выделенный в виде соли HCl МС-НР (M+1)=43 5,2
16-74 6-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-4,5-дигидропиридазин-3(2H)-он; выделенный в виде соли HCl МС-НР (M+1)=43 1,2
[M-NH2]
16-75 6-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}пиридазин-3(2H)-он; выделенный в виде соли HCl МС-НР (M+1)=42 9,1
[M-NH2]
16-76 N-(4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}фенил)ацетамид; выделенный в виде соли HCl 485,2074
16-77 1-{4-[3-(4-феноксифенил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 520,2136
16-78 1-{4-[3-(1H-бензимидазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 468,1927
16-79 (4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}фенил)метанол; выделенный в виде соли HCl 458,1963
16-80 4-[3-(4-циклогексилфенил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин; выделенный в виде соли HCl 510,2634
16-81 4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-1,3-дигидро-2H-имидазол-2-он; выделенный в виде соли HCl 434,1719
16-82 1-{4-[3-(4-метил-1H-имидазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 432,1921
16-83 4-[9-фенил-3-(1-пропил-1H-имидазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин; выделенный в виде соли HCl 460,2231
16-84 1-{4-[3-(1-изопропил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 460,2231
16-85 1-{4-[3-(1-бутил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин; выделенный в виде соли HCl 474,2387
16-86 1-[4-(3-имидазо[1,2-a]пиримидин-2-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин; выделенный в виде соли HCl 469,1867

СХЕМА 17

5-({[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}метил)пиридин-2-ол (17-3)

Трет-бутил-4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензилкарбамат (17-1)

К перемешиваемому раствору 16-2 (5 г, 11,3 ммоль) в 20 мл смеси 3:1 толуол:метанол добавляли триметилортоацетат (1,8 г, 15,3 ммоль) и моногидрат пара-толуолсульфоновой кислоты (0,1 г, 0,6 ммоль). Реакционную смесь нагревали до 100°C в микроволновом реакторе в течение 35 минут. После охлаждения до комнатной температуры растворитель удаляли при пониженном давлении. Остаток очищали, используя нормально-фазовую флэш-хроматографию, получая 17-1 в виде твердого вещества. ЖХ/МС (M+1) вычислено: 466,6; найдено: 466,2.

1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин (5-3)

HCl барботировали через метанол (75 мл) в течение 5 мин. К полученному раствору добавляли 17-1 (7,5 г, 16 ммоль) и раствор перемешивали при комнатной температуре в течение 6 часов. После удаления растворителя в вакууме полученное в результате твердое вещество растирали в течение 30 минут в растворе 10:1 этилацетата и метанола, соответственно. Суспензию фильтровали и сушили, получая 5-3 в виде соли HCl. Масса (M+1) вычислено: 366,1713; найдено: 366,1694.

6-Гидроксиникотинальдегид (17-2)

Перемешиваемый раствор 6-метокси-3-пиридинкарбоксальдегида (0,45 г, 3,3 ммоль) в 3н. HCl (10 мл) нагревали до 100°C в течение 30 минут. После охлаждения образовывались игольчатые кристаллы. Кристаллы собирали фильтрованием, получая 17-2. 1H ЯМР (CD3OD): δ 9,64 (c, 1H), δ 8,17-8,16 (м, 1Н), δ 7,96-7,94 (м, 1Н), δ 6,58 (д, 1Н).

5-({[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}метил)пиридин-2-ол (17-3)

К перемешиваемому раствору 5-3 (0,1 г, 0,3 ммоль) и триэтиламина (0,08 мл, 0,5 ммоль) в NMR (1 мл) добавляли 17-2 (0,03 г, 0,3 ммоль) и уксусную кислоту (0,03 мл, 0,5 ммоль), затем триацетоксиборгидрид натрия (0,12 г, 0,5 ммоль). После перемешивания в течение ночи при комнатной температуре реакционную смесь фильтровали через шприцевой фильтр и очищали обращенно-фазовой ВЭЖХ на колонке C18, получая 17-3 в виде соли HCl. Масса (M+1) вычислено: 473,2085; найдено: 473,2092.

В таблице 7 приведены соединения, полученные с использованием способов, указанных на схеме 17, с заменой 17-2 соответствующим альдегидом. Соединения 17-4 и 17-5 выделяли в виде солей HCl. Соединения 17-6 и 17-7 выделяли в виде солей ТФУ.

Таблица 7
Соед. Структура Название МС-ВР m/z (M+H)
17-4 1-(6-метоксипиридин-3-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]метанамин 487,2237
17-5 N-[(2-метоксипиримидин-5-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-и)бензил]амин МС-НР (M+1)=488,1
17-6 1-[4-(3-этил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин МС-НР (M+1)=380,2
17-7 1-[4-(9-фенил-3-пропил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамин 394,2023

СХЕМА 18

N-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид (18-1)

К раствору 4-3 (0,02 г, 0,06 ммоль) и триэтиламина (0,02 мл, 0,2 ммоль) в абсолютном этаноле (0,5 мл) добавляли уксусный ангидрид (0,02 мл, 0,2 ммоль). Реакция завершалась через 10 минут и продукт непосредственно очищали обращенно-фазовой ВЭЖХ на колонке C18, получая 18-1 в виде твердого вещества. ЖХ/МС (M+1) вычислено: 394,5; найдено: 394,2.

СХЕМА 19

4-({[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}метил)фенол (19-1)

К перемешиваемому раствору 4-2 (0,05 г, 0,14 ммоль) и 4-(аминометил)фенола (0,04 г, 0,35 ммоль) в ДМФА (0,5 мл) добавляли уксусную кислоту (0,04 мл, 0,7 ммоль). После перемешивания в течение 2 часов при комнатной температуре добавляли триацетоксиборгидрид натрия (0,06 г, 0,3 ммоль). После перемешивания в течение ночи реакционную смесь фильтровали через шприцевой фильтр и очищали обращенно-фазовой ВЭЖХ на колонке C18, получая 19-1 в виде твердого вещества. ЖХ/МС (M+1) вычислено: 458,5; найдено: 458,3.

СХЕМА 20

1-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4H-1,2,4-триазол-3-ил)[пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанамин (20-1)

Раствор 9-6 (0,03 г, 0,04 ммоль) в 30% ТФУ в дихлорметане (1 мл, 30% об.) перемешивали при комнатной температуре в течение 30 минут. Растворитель удаляли в вакууме и неочищенный остаток собирали в метанол и очищали обращенно-фазовой ВЭЖХ на колонке C18, получая 20-1 в виде твердого вещества. Масса (M+1) вычислено: 593,2884; найдено: 593,2867.

СХЕМА 21

9-фенил-3-(1H-1,2,3-триазол-4-ил)-8-(4-{[4-(4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (21-4)

4-(1H-1,2,4-триазол-3-ил)пиперидин (21-1)

К раствору бензил-4-цианопиперидин-1-карбоксилата (20 г, 82 ммоль) в метаноле (150 мл) добавляли раствор метоксида натрия в метаноле (25% масс., 5,6 мл, 25 ммоль) при комнатной температуре. Через 30 минут добавляли раствор гидразида муравьиной кислоты (4,9 г, 82 ммоль) в метаноле (20 мл) и реакционную смесь кипятили с обратным холодильником в течение 24 часов, в это время добавляли метоксид натрия в метаноле (25% масс., 5,6 мл, 25 ммоль) и гидразид муравьиной кислоты (4,9 г, 82 ммоль). Через 72 часа реакционную смесь охлаждали до комнатной температуры, гасили уксусной кислотой (3,0 мл, 49 ммоль) и концентрировали. Полученный в результате остаток растворяли в этилацетате, промывали водой, насыщенным раствором бикарбоната натрия, насыщенным раствором соли, сушили над сульфатом натрия, фильтровали и концентрировали. Остаток очищали хроматографией на колонке, элюируя 1-35% IPA/ДХМ. Соответствующие фракции объединяли и растворитель удаляли в вакууме, получая бензил-4-(1H-1,2,4-триазол-3-ил)пиперидине-1-карбоксилат в виде твердого вещества. МС (M+H+): 287,2; 1H ЯМР (400 МГц, CDCl3): δ 11,13 (с, 1H), 8,06 (с, 1H), 7,36-7,31 (м, 5H), 5,15 (с, 2H), 4,24 (ушир.с, 2H), 3,06-2,98 (м, 3H), 2,07-2,04 (м, 2H), 1,84-1,78 (м, 2H).

К раствору бензил 4-(1H-1,2,4-триазол-3-ил)пиперидин-1-карбоксилата (7,3 г, 25 ммоль) в этаноле (100 мл) добавляли 10% палладий на угле (500 мг), реакционный сосуд продували водородом и перемешивали в атмосфере водорода в течение 3 часов. Реакционную смесь фильтровали и концентрировали, получая 21-1 в виде твердого вещества. МС (M+H+): 153,2; 1Н ЯМР (400 МГц, ДМСО-d6): δ 7,99 (с, 1H), 2,98-2,94 (м, 2H), 2,82-2,74 (м, 1H), 2,57-2,50 (м, 2H), 1,82-1,78 (м, 2H), 1,60-1,50 (м, 2H).

5-хлор-3-фенил-2-(4-{[4-(4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридин (21-2)

К перемешиваемому раствору 9-1 (0,25 г, 0,73 ммоль) и 21-1 (0,13 г, 0,87 ммоль) в NMP (5 мл) добавляли триэтиламин (0,3 мл, 2,2 ммоль), затем уксусную кислоту (0,082 мл, 1,5 ммоль). После перемешивания при температуре окружающей среды в течение ночи добавляли триацетоксиборгидрид натрия (0,18 г, 0,87 ммоль). После завершения реакции реакционную смесь разбавляли этилацетатом и промывали насыщенным раствором NaHCO3, затем водой, затем насыщенным раствором соли. Органический слой сушили над Na2SO4 и MgSO4, фильтровали и концентрировали в вакууме, получая 21-2. ЖХ/МС (M+1) вычислено: 482,0; найдено: 482,2.

5-гидразино-3-фенил-2-(4-{[4-(4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-1,6-нафтиридин (21-3)

К перемешиваемому раствору 21-2 (0,4 г, 0,8 ммоль) в безводном 1,4-диоксане (3 мл) добавляли гидразин (0,45 мл, 14,5 ммоль). Раствор нагревали до 100°C в микроволновом реакторе в течение 5 минут. Растворитель удаляли в вакууме и остаток три раза азеотропно сушили с толуолом, получая 21-3. ЖХ/МС (M+1) вычислено: 477,6; найдено: 477,3.

9-фенил-3-(1H-1,2,3-триазол-4-ил)-8-(4-{[4-(4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,41триазоло[3,4-f]-1,6-нафтиридин (21-4)

К перемешиваемому раствору 21-3 (0,2 г, 0,36 ммоль), HOBT (0,05 г, 0,4 ммоль) и 1H-1,2,3-триазол-4-карбоновой кислоты (0,05 г, 0,4 ммоль) в безводном ДМФА (2 мл) добавляли DIEA (0,18 мл, 1,1 ммоль), затем EDC (0,08 г, 0,4 ммоль). Раствор нагревали в микроволновом реакторе в течение 12 минут при 80°C. Затем раствор обрабатывали 0,5 мл уксусной кислоты и нагревали до 80°C в микроволновом реакторе еще в течение 10 минут. После охлаждения до комнатной температуры раствор пропускали через шприцевой фильтр и очищали обращенно-фазовой ВЭЖХ на колонке C18, получая 21-4 в виде соли HCl. Масс (M+1) вычислено: найдено: ЖХ/МС (M+1) вычислено: 554,6; найдено: 554,3.

СХЕМА 22

1-{4-[3-(1H-Имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (22-3)

8-[4-(1,3-Диоксолан-2-ил)фенил]-3-(1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин (22-1)

К раствору 3-4 (0,2 г, 0,5 ммоль), 1H-имидазол-4-карбоновой кислоты (0,06 г, 0,5 ммоль), HOBT (0,06 г, 0,5 ммоль) и DIEA (0,2 мл, 1,4 ммоль) в ДМФА (2 мл) добавляли EDC (0,1 г, 0,6 ммоль). Раствор перемешивали при комнатной температуре в течение 45 мин и затем нагревали при 80°C в микроволновом реакторе в течение 15 мин. Растворитель удаляли в вакууме. Остаток собирали в ДМФА (0,5 мл) и обрабатывали ледяной AcOH (2,0 мл). Реакционную смесь нагревали при 80°C в течение 45 мин. Затем реакцию гасили водой (10 мл) и экстрагировали EtOAc (3×20 мл). Объединенные органические слои концентрировали в вакууме, получая 22-1 в виде коричневого остатка. МС вычислено M+H: 461,5; найдено 461,2.

4-[3-(1H-Имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензальдегидоксим (22-2)

К раствору 22-1 (0,8 г, 1,7 ммоль) в 1,4-диоксане (3 мл) по каплям добавляли 3н. HCl (1,1 мл, 3,4 ммоль). После перемешивания в течение 10 мин раствор обрабатывали гидрохлоридом гидроксиламина (0,5 г, 6,9 ммоль) в воде (0,5 мл). Смесь перемешивали в течение 1 часа и затем гасили NaHCO3 (насыщенный) вплоть до pH 8. После удаления растворителя остаток собирали в воде, фильтровали и азеотропно сушили с толуолом, получая 22-2 в виде твердого вещества. МС вычислено M+H: 432,5; найдено 432,2.

1-{4-[3-(1H-Имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин (22-3)

Раствор 22-2 (0,06 г, 0,1 ммоль) и Zn (0,02 г, 0,3 ммоль) в безводной ледяной AcOH перемешивали при комнатной температуре в течение 30 мин. К раствору добавляли еще 4 эквивалента Zn (0,04 г, 0,6 ммоль). Реакционную смесь перемешивали еще в течение 1 часа. После фильтрования и удаления растворителя остаток собирали в MeOH и обрабатывали гидроксидом аммония. После удаления растворителя остаток очищали обращенно-фазовой ВЭЖХ, получая 22-3 в виде твердого вещества. МС вычислено M+H: 418,5; найдено: 401,1 (M-NH2).

В таблице 8 приведены соединения, полученные с применением способов, указанных на схеме 22, с заменой имидазол-4-карбоновой кислоты соответствующей кислотой. Соединения в таблице 8 выделяли в виде солей HCl.

Таблица 8
Соед. Структура Название МС-ВР m/z (M+H)
22-4 1-{4-[9-фенил-3-(3H-1лямбда4,3-имазол-5-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин 437,1543
22-5 1-{4-[9-фенил-3-(1H-пиразол-3-ил)-2H-4лямбда5-[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин 418,1776
22-6 1-{4-[9-фенил-3-(1,3-тиазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин 435,1385

СХЕМА 23

5,6,7,8-Тетрагидроимидазо[1,2-a]пиридин-2-карбоновая кислота (23-2)

К раствору 23-1 (0,1 г, 0,7 ммоль) в EtOH (15 мл) в сухой колбе добавляли Pt2O (0,1 г, 0,4 ммоль). Реакционную смесь помещали в атмосферу азота и затем в условия вакуума. Указанные операции повторяли 3 раза, затем реакционную смесь помещали в атмосферу водорода. Через 3 часа реакционную смесь фильтровали через целит. После удаления растворителя получали требуемый продукт 23-2 получали в виде не совсем белого порошка. МС вычислено M+H: 167,2; найдено: 167,1.

СХЕМА 24

4-Метил-1H-имидазол-5-карбоновая кислота (24-2)

К раствору 24-1 (0,5 г, 2,4 ммоль) в EtOH (2 мл) добавляли 3н. LiOH (2,2 мл, 6,5 ммоль). Реакционную смесь нагревали при 80°C в течение 1 часа. Температуру уменьшали до 40°C и смесь перемешивали в течение ночи. Затем смесь нагревали при 80°C еще в течение 5,5 часов. Реакционную смесь нейтрализовали 12н. HCl и концентрировали в вакууме. Остаток азеотропно сушили с толуолом, получая требуемый продукт 24-2 в виде твердого вещества. МС: вычислено M+H: 127,1; найдено 127,1.

СХЕМА 25

Метил-1-пропил-1H-имидазол-4-карбоксилат (25-2)

К раствору 25-1 (0,5 г, 4,0 ммоль) в безводном ТГФ (15 мл) в сухой колбе порциями добавляли NaH (0,1 г, 4,8 ммоль). После окончания выделения пузырьков добавляли йодпропан (0,8 мл, 8,0 ммоль) и перемешивали при комнатной температуре в течение ночи. К реакционной смеси добавляли дополнительно 0,5 экв. NaH вместе с 3 экв. йодпропана. После перемешивания в течение 50 часов добавляли еще 0,5 экв. NaH вместе с 2 экв. йодпропана. Реакционную смесь перемешивали еще в течение 20 часов, затем гасили этанолом (5 мл). Удаление растворителя давало требуемый продукт 25-2 в виде твердого вещества. МС: вычислено M+H: 169,2; найдено: 155,1 (M-CH2).

1-Пропил-1H-имидазол-4-карбоновая кислота (25-3)

К раствору 25-2 (0,6 г, 3,6 ммоль) в безводном MeOH (2 мл) добавляли 3н. LiOH (2,6 мл, 7,9 ммоль). Реакционную смесь нагревали при 80°C в течение 1 часа. Температуру снижали и смесь перемешивали при 40°C в течение ночи. Затем реакционную смесь нейтрализовали 12н. HCl и затем концентрировали в вакууме. Остаток азеотропно сушили с толуолом, получая требуемый продукт 25-3 в виде твердого вещества. МС: вычислено M+H: 155,2; найдено: 155,1.

В таблице 9 приведены соединения, полученные с применением способов, указанных на схеме 25, с заменой соответствующим алкилгалогенидом.

Таблица 9
Соед. Структура Название МС-ВР m/z (M+H)
25-4 1-изопропил-1H-имидазол-4-карбоновая кислота 155,1
25-5 1-бутил-1H-имидазол-4-карбоновая кислота 155,1

СХЕМА 26

4-[9-Фенил-3-(пирролидин-1-илметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин (26-2)

Трет-бутил-4-[3-(хлорметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензилкарбамат (26-1)

К суспензии 16-2 (1,2 г, 2,7 ммоль) в CH2Cl2 (10 мл) добавляли DMAP (0,03 г, 0,03 ммоль) и пиридин (0,4 мл, 5,4 ммоль), затем хлоруксусный ангидрид (0,5 г, 3,0 ммоль). Реакционную смесь перемешивали при комнатной температуре в течение 2 часов, затем дополнительно добавляли хлоруксусный ангидрид (0,2 г, 0,9 ммоль). После перемешивания еще в течение 10 мин растворитель удаляли в вакууме. Остаток распределяли между насыщенную водным раствором NaHCO3 и EtOAc (3×30 мл). Объединенные органические слои промывали водой, насыщенным раствором соли и сушили (Na2SO4/MgSO4). Удаление растворителя давало требуемый продукт 26-1 в виде красного порошка. МС: вычислено: 500,2; найдено; 500,1.

4-[9-Фенил-3-(пирролидин-1-илметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин (26-2)

К раствору 26-1 (0,05 г, 0,1 ммоль) в ДМСО (1 мл) добавляли пирролидин. Раствор нагревали при 150°C в течение 30 мин. Реакционную смесь очищали, используя обращенно-фазовую ВЭЖХ. Остаток растворяли в MeOH (0,5 мл) и обрабатывали 1н. HCl (0,4 мл). Реакционную смесь перемешивали при 35°C в течение 1 дня. Удаление растворителя давало требуемый продукт 26-2 в виде твердого вещества. МС: вычислено: 535,7; 435,5.

В таблице 10 приведены соединения, полученные с применением способов, указанных на схеме 26, с заменой пирролидина соответствующим амином. Соединения, указанные в таблице 10, выделяли в виде солей HCl.

Таблица 10
Соед. Структура Название МС-ВР m/z (M+H)
26-3 1-{4-[3-(азетидин-1-илметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин 421,2124
26-4 1-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)пиперидин-4-карбоксамид 492,249
26-5 1-{4-[3-(морфолин-4-илметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамин 451,2228
26-6 2-[({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)амино]этанол 425,2071
26-7 1-(4-{3-[(4-метилпиперазин-1-ил)метил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанами 464,2543
26-8 4-[9-фенил-3-(пиперазин-1-илметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламин 450,2386
26-9 N-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)-N-метиламин; 395,1969
26-10 N-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)-N,N-диметиламин 409,2125

СХЕМА 28

[4-(3-Метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанол (28-1)

К раствору 4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензальдегида (5-2, 0,317 г, 0,870 ммоль) в метаноле (5 мл) добавляли боргидрид натрия (0,033 г, 0,870 ммоль) при 0°C. Через 10 минут реакционную смесь вливали в этилацетат и органический слой промывали насыщенным раствором бикарбоната натрия, водой, затем насыщенным раствором соли, сушили над сульфатом натрия, фильтровали и концентрировали досуха при пониженном давлении. Очистка обращенно-фазовой хроматографией (Waters Sunfire MSC18, 1% ацетонитрил/0,1% трифторуксусная кислота/вода → 95% ацетонитрил/0,1% трифторуксусная кислота/вода) давала указанные в заголовке соединения в виде твердого вещества. МС-ВР (M+H+): вычислено = 367,1554; найдено = 367,1547.

{4-[3-(1-Метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанол (28-2)

Указанное в заголовке соединение получали из 13-2 согласно способу, указанному на схеме 28; МС-ВР (M-H+): вычислено = 433,1772; найдено = 433,1761.

СХЕМА 29

1-[4-(9-Фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанол (29-2)

1-[4-(5-Хлор-3-фенил-1,6-нафтиридин-2-ил)фенил]этанол (29-1)

К раствору 4-(5-хлор-3-фенил-1,6-нафтиридин-2-ил)бензальдегида (9-1, 0,500 г, 1,450 ммоль) в безводном метиленхлориде (10 мл) добавляли бромид метилмагния (2,072 мл, 2,9 ммоль, 1,4 М раствор в смеси толуол/тетрагидрофуран (75:25)) при 0°C. Через 15 минут реакционную смесь вливали в этилацетат и органический слой промывали насыщенным раствором бикарбоната натрия, водой, затем насыщенным раствором соли, сушили над сульфатом натрия, фильтровали и концентрировали досуха при пониженном давлении, получая указанное в заголовке соединение. МС (M+H+): вычислено = 361,85; найдено = 361,1.

1-[4-(9-Фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанол (29-2)

Указанное в заголовке соединение получали согласно способам, указанным на схеме 9; МС-ВР (M+H+): вычислено = 485,1833; найдено = 485,1812.

Следующие соединения, указанные в таблице 11, получали согласно способу, указанному на схеме 13, из пиперидина 21-1 и указанного альдегида.

Таблица 11
Соед. Структура Название МС-ВР m/z (M+H)
30-1 (из 4-2) 9-фенил-8-(4-{[4-(4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин Вычислено: 487,2371 Найдено: 484,2371
31-1 (из 5-2) 3-метил-9-фенил-8-(4-{[4-(4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин; выделенный в виде соли HCl Вычислено: 501,2510 Найдено: 501,2531
32-1 (из 3-6) 9-фенил-8-(4-{[4-(4H-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ол Вычислено: 503,2303 Найдено: 503,2327

СХЕМА 33

Трифторацетат 1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропанаминия (33-5)

4-(2-Бензил-1,3-диоксолан-2-ил)бензонитрил (33-1)

Раствор 1-(4-бромфенил)-2-фенилэтанона (5,0 г, 18 ммоль), этиленгликоля (3,0 мл, 54 ммоль) и пара-толуолсульфоновой кислоты (0,04 г, 0,2 ммоль) в толуоле (30 мл) кипятили с обратным холодильником с ловушкой Дина-Старка в течение 15 часов. Реакционную смесь охлаждали до комнатной температуры, разбавляли этилацетатом, промывали насыщенным раствором бикарбоната натрия, насыщенным раствором соли, сушили над сульфатом натрия, фильтровали и концентрировали, получая неочищенный 2-бензил-2-(4-бромфенил)-1,3-диоксолан в виде белого твердого вещества. К неочищенному веществу добавляли цианид цинка (2,3 г, 20 ммоль), тетракис(трифенилфосфин)палладий (3,3 г, 2,8 ммоль), ДМФА (20 мл) и диоксан (20 мл), полученную в результате суспензию продували азотом в течение 15 минут, затем нагревали при 100°C в течение 15 часов. Реакционную смесь охлаждали до комнатной температуры, вливали в эфир и фильтровали. Органический фильтрат промывали водой, насыщенным раствором бикарбоната, насыщенным раствором соли, сушили над сульфатом натрия, фильтровали и концентрировали. Очистка хроматографией на силикагеле (1% этилацетат/гексан → 50% этилацетат/гексан) давала указанное в заголовке соединение в виде белого твердого вещества. МС (M+H+): вычислено = 265,31; найдено = 266,1.

Трет-бутил{1-[4-(фенилацетил)фенил]циклопропил}карбамат (33-2)

К раствору 4-(2-бензил-1,3-диоксолан-2-ил)бензонитрила (33-1, 1,5 г, 5,6 ммоль) в эфире (25 мл) добавляли изопропоксид титана (1,8 мл, 6,2 ммоль), затем бромид этилмагния (4,2 мл, 12 ммоль, 3 М в эфире) при -78°C. Через 10 минут реакционную смесь нагревали до комнатной температуры в течение 60 минут. Реакционную смесь охлаждали до 0°C и добавляли комплекс эфирата трифторида бора (1,4 мл, 11 ммоль). Через 30 минут при 0°C реакционную смесь нагревали до комнатной температуры в течение 1 часа, спустя указанный период времени реакцию гасили и подкисляли 1 М HCl. Суспензию перемешивали еще в течение 3 часов при комнатной температуре, затем смесь подщелачивали 1 М NaOH и экстрагировали хлороформом. Объединенные органические слои сушили над сульфатом натрия, фильтровали и концентрировали. К неочищенному веществу сразу же добавляли ацетонитрил (15 мл) и ди-трет-бутилдикарбонат (1,2 г, 5,6 ммоль) при комнатной температуре. Через 12 часов реакционную смесь концентрировали досуха и очищали хроматографией на силикагеле (1% этил ацетат/гексан → 60% этилацетат/гексан), получая указанное в заголовке соединение в виде белого твердого вещества. МС (M+H+): вычислено = 351,44; найдено = 352,1.

Трет-бутил{1-[4-(5-хлор-3-фенил-1,6-нафтиридин-2-ил)фенил]циклопропил)карбамат (33-3)

Раствор 33-2 (0,64 г, 2,5 ммоль), 3-1 (0,88 г, 2,5 ммоль) и карбоната калия (2,1 г, 15 ммоль) в ДМФА (14 мл) нагревали до 120°C в течение 4,5 часов. Реакционную смесь охлаждали до комнатной температуры, разбавляли этилацетатом, промывали водой, насыщенным раствором соли, сушили над сульфатом натрия, фильтровали и концентрировали. Очистка хроматографией на силикагеле (1% этилацетат/гексан → 70% этилацетат/гексан) давала указанное в заголовке соединение в виде пены. МС (M+H+): вычислено = 471,98; найдено = 472,1.

Трет-бутил{1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропил}карбамат (33-4)

Указанное в заголовке соединение получали из 33-3 согласно способу, указанному на схеме 27; МС (M+H+): вычислено = 491,58; найдено = 492,1.

Трифторацетат 1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропанаминия (33-5)

Указанное в заголовке соединение получали согласно способу, указанному на схеме 27; МС-ВР (M+H+): вычислено = 392,1870; найдено = 392,1893.

Следующие соединения, приведенные в таблице 12, получали согласно способу, указанному на схеме 33. Соединения 33-8 - 33-10 выделяли в виде солей HCl. Соединение 33-6 выделяли в виде соли ТФУ.

Таблица 12
Соед. Структура Название МС-ВР m/z (M+H)
33-6 1-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}циклопропанамин Вычислено: 458,2088 Найдено: 458,2114
33-7 1-[4-(9~фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропанамин Вычислено: 496,1993 Найдено: 496,1987
33-8 1-{4-[9-фенил-3-(5,6,7,8-тетрагидроимидазо[1,2-a]пиридин-2-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}циклопропанамин 498,238
33-9 1-[4-(9-фенил-3-пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропанамин 456,1915
33-10 1-{4-[3-(1,5-диметил-1H-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}циклопропанамин 472,2227

СХЕМА 34

Хлорид (1R)-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-нафтиридин-8-ил)фенил]этанаминия (34-5)

N-{(1E)-[4-(5-хлор-3-фенил-1,6-нафтиридин-2-ил)фенил]метилен}-2-метилпропан-2-сульфинамид (34-1)

Раствор 4-(5-хлор-3-фенил-1,6-нафтиридин-2-ил)бензальдегида (9-1, 4,24 г, 12,3 ммоль), S-(-)-2-метилпропан-2-сульфинамида (3,43 мл, 28,3 ммоль) и сульфата меди (4,49 г, 28,1 ммоль) в метиленхлориде (20 мл) кипятили с обратным холодильником в атмосфере азота. Через 18 часов реакционную смесь промывали насыщенным раствором бикарбоната натрия, насыщенным раствором соли, сушили над сульфатом магния, фильтровали и концентрировали. Очистка хроматографией на силикагеле (0% этилацетат/гексан → 45% этилацетат/гексан) давала указанное в заголовке соединение в виде оранжевой пены. МС (M+H+): вычислено = 447,99; найдено = 448,2.

N-{(1R)-1-[4-(5-хлор-3-фенил-1,6-нафтиридин-2-ил)фенил]этил}-2-метилпропан-2-сульфинамид (34-2)

К раствору N-{(1E)-[4-(5-хлор-3-фенил-1,6-нафтиридин-2-ил)фенил]метилен}-2-метилпропан-2-сульфинамида (34-1, 4,53 г, 10,1 ммоль) в метиленхлориде (100 мл) добавляли бромид метилмагния (30 мл, 42,0 ммоль, 1,4 М в смеси 75:25 толуол:ТГФ) при -10°C. Через 30 минут реакцию гасили добавлением насыщенного раствора хлорида аммония (поддерживая температуру ниже 0°C) и экстрагировали метиленхлоридом. Объединенные органические слои промывали водой, насыщенным раствором соли, сушили над сульфатом магния, фильтровали и концентрировали, получая указанное в заголовке соединение в виде бледно-желтого твердого вещества. МС (M+H+): вычислено = 464,03; найдено = 464,2.

Трет-бутил({(1R)-1-[4-(5-гидразино-3-фенил-1,6-нафтиридин-2-ил)фенил]этил}амино)сульфонийолат (34-3)

К раствору N-{(1R)-1-[4-(5-хлор-3-фенил-1,6-нафтиридин-2-ил)фенил]этил}-2-метилпропан-2-сульфинамида (34-2, 0,707 г, 1,52 ммоль) и безводном гидразине (15 мл) нагревали при 115°C в течение 1 часа. Реакционную смесь вливали в этилацетат и органический слой промывали насыщенным раствором бикарбоната натрия, затем водой, затем насыщенным раствором соли, сушили над сульфатом магния, фильтровали и концентрировали досуха при пониженном давлении, получая сырой аддукт гидразина в виде оранжевого твердого вещества. МС (M+H+): вычислено = 459,62; найдено = 460,4.

Трет-бутил({(1R)-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил)амино)сульфонийолат (34-4)

К неочищенному трет-бутил({(1R)-1-[4-(5-гидразино-3-фенил-1,6-нафтиридин-2-ил)фенил]этил}амино)сульфонийолату (34-3, 1,06 г, 2,31 ммоль), п-толуолсульфоновой кислоте (63 мг, 0,36 ммоль) и триметилортоацетату (1,0 мл, 7,7 ммоль) добавляли безводный толуол (10 мл) и нагревали до 110°C в течение 48 часов. Объем реакционной смеси уменьшали при пониженном давлении и очищали хроматографией на силикагеле (0-10% метанол/метиленхлорид), получая оранжевую пену. МС (M+H+): вычислено = 483,64; найдено = 484,2.

Хлорид (1R)-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанаминия (34-5)

Трет-бутил({(1R)-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}амино)сульфонийолат (34-4) обрабатывали 4н. HCl в диоксане при комнатной температуре в течение 15 минут. Объем реакционной смеси уменьшали при пониженном давлении и очищали обращенно-фазовой хроматографией (Waters Sunfire MCC18, 1% ацетонитрил/0,1% трифторуксусная кислота/вода → 95% ацетонитрил/0,1% трифторуксусная кислота/вода) и превращали в соль HCl (добавлением насыщенного раствора HCl в этилацетате (концентрация ~4N)), получая указанное в заголовке соединение в виде твердого вещества. МС (M+H+): вычислено = 379,47; найдено = 380,2.

(1R)-1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамин (34-6)

Указанное в заголовке соединение получали согласно способам, указанным на схеме 34; МС (M+H+): вычислено = 365,43; найдено = 366,2. Соединение 34-6 выделяли в виде соли HCl.

СХЕМА 35

Дигидрохлорид (1R)-1-{4-[9-Фенил-3-(5-пиридин-2-ил-1H-пиразол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенилэтанамина (35-1)

К трет-бутил({(1R)-1-[4-(5-гидразино-3-фенил-1,6-нафтиридин-2-ил)фенил]этил}амино)сульфонийолату (34-3, 0,20 г, 0,43 ммоль), EDC (0,11 г, 0,57 ммоль), безводному HOBT (0,06 г, 0,39 ммоль), DIPEA (0,17 мл, 0,96 ммоль) и 5-пиридин-2-ил-1H-пиразол-3-карбоновой кислоте (0,08 г, 0,43 ммоль) добавляли безводный ДМФА (2 мл) и перемешивали при комнатной температуре в течение ночи. К реакционной смеси добавляли HCl/эфир (1 мл, 2н.) и перемешивали в течение 20 мин при комнатной температуре, затем нагревали в микроволновом реакторе при 100°C в течение 30 мин. Растворитель удаляли в вакууме и очищали обращенно-фазовой хроматографией (Waters Sunfire MCC18, 1% ацетонитрил/0,1% трифторуксусная кислота/вода → 95% ацетонитрил/0,1% трифторуксусная кислота/вода) и превращали в соль HCl (добавлением насыщенного раствора HCl в этилацетате (концентрация ~ 4N), получая указанное в заголовке соединение в виде твердого вещества. МС (M+H+): вычислено = 508,58; найдено = 509,1.

Следующие соединения, приведенные в таблице 13, получали согласно способу, указанному на схеме 35. Соединения, указанные в таблице 13, выделяли в виде солей HCl.

Таблица 13
Соед. Структура Название МС-ВР m/z (M+H)
35-2 (1R)-1-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этанамин Найдено: 396,0
35-3 (1R)-1-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этанамин Найдено: 445,9
35-4 (1R)-1-[4-[9-фенил-3-[1,2,4]триазоло[1,5-a]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамин Найдено: 484,1
35-5 (1R)-1-[4-(3-имидазо[2,1-b][1,3]тиазолол-6-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамин Найдено: 488,0
35-6 (1R)-1-[4-[9-фенил-3-пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамин Найдено: 444,1

(1R)-1-[4-(9-Фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]пропан-1-амин (36-1)

Указанное в заголовке соединение получали согласно способам, указанным на схеме 34. МС (M+H+): вычислено = 379,47; найдено = 380,2. Соединение 36-1 выделяли в виде соли HCl.

СХЕМА 37

2-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]пропан-2-амин (37-4)

N-{1-метил-1-[4-(фенилацетил)фенил]этил]ацетамид (37-1)

Раствор N-(1-метил-1-фенилэтил)ацетамида (21,3 г, 121 ммоль), фенилацетилхлорида (19,5 г, 126 ммоль) и трихлорида алюминия (19 г, 142 ммоль) в метиленхлориде (140 мл) перемешивали в течение ночи при комнатной температуре в атмосфере азота. Реакционную смесь вливали в лед и перемешивали вплоть до расплавления льда, затем слои разделяли и органический слой промывали насыщенным раствором бикарбоната натрия, насыщенным раствором соли, сушили над сульфатом магния, фильтровали и концентрировали. Очистка хроматографией на силикагеле давала указанное в заголовке соединение. МС (M+H+): вычислено = 295,38; найдено = 296,1.

N-{1-[4-(5-хлор-3-фенил-1,6-нафтиридин-2-ил)фенил]-1-метилэтил}ацетамид (37-2)

Указанное в заголовке соединение получали из 37-1 согласно способу, указанному на схеме 3; МС (M+H+): вычислено = 415,91; найдено = 416,1.

Трет-бутил{1-[4-(5-хлор-3-фенил-1,6-нафтиридин-2-ил)фенил]-1-метилэтил}карбамат (37-3)

К раствору N-{1-[4-(5-хлор-3-фенил-1,6-нафтиридин-2-ил)фенил]-1-метилэтил}ацетамида (37-2, 4,73 г, 11,4 ммоль) в безводном ТГФ (120 мл) добавляли дифенилсилан (10,5 мл, 56,9 ммоль) и изопропоксид титана (16,6 мл, 56,9 ммоль) при 40°C в течение 1 часа. Реакционную смесь вынимали из бани и гасили добавлением насыщенного раствора бикарбоната. Добавляли метиленхлорид и фильтровали через подушку целита и сульфата магния. К раствору добавляли ди-трет-бутилдикарбонат (3,08 г, 14,1 ммоль), затем упаривали на роторном испарителе до минимального объема. Добавляли безводный метиленхлорид (140 мл), ди-трет-бутилдикарбонат (4,1 г, 18,8 ммоль) и TEA (4,0 мл, 28,7 ммоль) и перемешивали в течение ночи при комнатной температуре. Реакционную смесь промывали бикарбонатом натрия, насыщенным раствором соли, сушили над сульфатом магния, фильтровали и концентрировали. Очистка хроматографией на силикагеле (0-40% EtOAc/гексан в течение 30 мин) давала указанное в заголовке соединение в виде белой пены. МС (M+H+): вычислено = 473,99; найдено = 474,1.

Гидрохлорид 2-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]пропан-2-амина (37-4)

Указанное в заголовке соединение получали из 37-3 согласно способам, указанным на схеме 5; МС (M+H+): вычислено = 393,48; найдено = 394,1.

2-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]пропан-2-амин (38-1)

Указанное в заголовке соединение получали согласно способам, указанным на схеме 37; МС (M+H+): вычислено = 421,51; найдено = 422,3. Соединение 38-1 выделяли в виде соли HCl.

СХЕМА 39

Хлорид 3-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридиния (39-1)

К гидрохлориду 1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина (5-3, 20 мг, 0,050 ммоль), EDC (12 мг, 0,065 ммоль), HOBT (10 мг, 0,0650 ммоль), DIPEA (0,033 мл, 0,199 ммоль) и гидрохлориду пиридин-3-илуксусной кислоты (11 мг, 0,0650 ммоль) добавляли 0,6 мл безводного диметилформамида. Затем реакционную смесь нагревали микроволновым излучением при 100°C в течение 5 минут. Очистка сырой реакционной смеси обращенно-фазовой хроматографией (Waters Sunfire MCC18, 1% ацетонитрил/0,1% трифторуксусная кислота/вода → 95% ацетонитрил/0,1% трифторуксусная кислота/вода) и превращение в соль HCl (добавлением насыщенного раствора HCl в этилацетате (концентрация ~ 4N) давали указанное в заголовке соединение в виде желтого твердого вещества. МС-ВР (M+H+): вычислено = 243,1079; найдено = 243,1083.

Следующие соединения, приведенные в таблице 14, получали из указанного амина (см. колонку «Соединение» в скобках) согласно способу, указанному на схеме 39.

Таблица 14
Соед. Структура Название МС-ВР m/z (M+H)
39-2 (5-3) N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-5-пиридин-4-ил-2-фурамид; выделенный в виде соли ТФУ Вычислено: 537,2034 Найдено: 537,2027
39-3 (5-3) N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-5-пиридин-3-ил-2-фурамид; выделенный в виде соли HCl Вычислено: 537,2034 Найдено: 537,2023
39-4 (5-3) N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-5-пиридин-3-ил-1H-пиррол-3-карбоксамид; выделенный в виде соли HCl Вычислено: 536,2194 Найдено: 536,2218
39-5 (5-3) 2-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид Вычислено: 424,1768 Найдено: 424,1767
39-6 (5-3) трет-бутил(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)карбамат Вычислено: 523,2452 Найдено: 523,2444
39-7 (5-3) 4-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)морфолин; выделенный в виде соли HCl Вычислено: 494,2347 Найдено: 493,2358
39-8 (5-3) 2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтанамин; выделенный в виде соли HCl Вычислено: 423,1928 Найдено: 423,1942
39-9 (5-3) 4-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридин; выделенный в виде соли HCl Вычислено: 485,2085 Найдено: 485,2120
39-10 (5-3) 2,4-дигидрокси-6-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиримидин; выделенный в виде соли HCl Вычислено: 518,1935 Найдено: 518,1960
39-11 (5-3) 2-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридин; выделенный в виде соли HCl Вычислено: 485,2085 Найдено: 485,2118
39-12 (5-3) Хлорид 3-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридиния Вычислено: 243,1079 Найдено: 243,1083
39-13 (5-3) N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-2-пиразин-2-илацетамид Вычислено: 486,2037 Найдено: 486,2044
39-14 (5-3) 3-метил-9-фенил-8-[4-({[пиридин-3-иламино)карбонил]амино}метил)фенил][1,2,4]триазоло[3,4-f]-1,6-нафтиридин, выделенный в виде соли HCl Вычислено: 486,2037 Найдено: 486,2056
39-15 (5-3) 2-(2-гидроксифенил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид Вычислено: 500,2081 Найдено: 500,2087
39-16 (5-3) 2-(3-гидроксифенил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид Вычислено: 500,2081 Найдено: 500,2086
39-17 (5-3) 2-(4-гидроксифенил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид Вычислено: 500,2081 Найдено: 500,2085
39-18 (5-3) 2-(3,4-дигидроксифенил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид Вычислено: 576,2030 Найдено: 576,2025
39-19 (5-3) N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-2-фенилацетамид Вычислено: 484,2132 Найдено: 4844,2161
39-20 (5-3) 3-метил-9-фенил-8-(4-{[(пиридин-3-илкарбонил)амино]метил}фенил)[1,2,4]
триазоло[3,4-f]-1,6-нафтиридин; выделенный в виде соли HCl
Вычислено: 471,1928 Найдено: 471,1928
39-21 (5-3) 2-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]бензамид Вычислено: 486,1925 Найдено: 486,1919
39-22 (5-3) 2-(4-гидроксифенил)-2-метил-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропанамид Вычислено: 528,2394 Найдено: 528,2386
39-23 (5-3) Метил-4-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-4-оксобутаноат Вычислено: 480,2030 Найдено: 480,2030
39-24 (5-3) 2-гидрокси-N-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)бензамид Вычислено: 543,2139 Найдено: 543,2127
39-25 (5-3) N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-2-(5-фенил-4H-1,2,4-триазол-3-ил)ацетамид Вычислено: 551,2303 Найдено: 551,2292
39-26 (5-3) 3-метил-9-фенил-8-(4-{[(хинолин-3-илкарбонил)амино]метил}фенил)[1,2,4]
триазоло[3,4-f]-1,6-нафтиридин; выделенный в виде соли HCl
Вычислено: 521,2085 Найдено: 521,2061
39-27 (5-3) N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-2-(4-оксохиназолин-3(4H)-ил)ацетамид Вычислено: 552,2143 Найдено: 552,2126
39-28 (5-3) N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-2-(2-оксо-1,3-бензоксазол-3(2H)-ил)ацетамид Вычислено: 541,1983 Найдено: 541,1965
39-29 (503) 8-(4-{[(1H-бензимидазол-1-илацетил)амино]метил}фенил)-3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин, выделенный в виде соли HCl Вычислено: 524,2194 Найдено: 524,2199
39-30 (5-3) 8-(4-{[(1H-бензимидазол-2-илацетил)амино]метил}фенил)-3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин, выделенный в виде соли HCl Вычислено: 524,2194 Найдено: 524,2185
39-31 (5-3) 2-(4-метил-1,2,5-оксадиазол-3-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид Вычислено: 440,1986 Найдено: 490,1976
39-32 (5-3) 2-(1H-индазол-1-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид Вычислено: 524,2194 Найдено: 524,2171
39-33 (5-3) 2-(5,6-диметил-4-оксотиено[2,3-d]пиримидин-3(4H)-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид Вычислено: 586,2020 Найдено: 586,1993
39-34 (5-3) 3-метил-8-[4-({[(6-морфолин-4-илпиридин-3-ил)карбонил]амино}метил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин; выделенный в виде соли HCl Вычислено: 556,2456 Найдено: 556,2441
39-35 (5-3) 2-(6-хлорпиридин-3-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид Вычислено: 519,1695 Найдено: 519,1673
39-36 (5-3) 3-циано-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропанамид Вычислено: 447,1928 Найдено: 447,1921
39-37 (5-3) 3-метил-9-фенил-8-(4-{[(3-пиридин-3-илпропаноил)амино]метил}фенил)[1,2,4]
триазоло[3,4-f]-1,6-нафтиридин, выделенный в виде соли HCl
Вычислено: 499,2241 Найдено: 499,2244
39-38 (16-44) 3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{[(пиридин-3-илацетил)амино]метил}фенил)[1,2,4]три-азоло[3,4-f]-1,6-нафтиридин; выделенный в виде соли HCl Вычислено: 551,2303 Найдено: 551,2326
39-39 (16-22) 9-фенил-3-пиразоло[1,5-a]пиримидин-3-ил-8-(4-{[(пиридин-3-илацетил)амино]метил}фенил)[1,2,4]три-азоло[3,4-f]-1,6-нафтиридин; выделенный в виде соли HCl Вычислено: 588,2255 Найдено: 588,2276
39-40 (13-10) N-(3-гидрокси-2,2-диметилпропил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамид Вычислено: 494,2551 Найдено: 494,2557
39-41 (13-16) N-(3-гидрокси-2,2-диметилпропил)-N-{4-[3-(1-метил-1H-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-2-(4-оксохиназолин-3(4H)-ил)ацетамид МС-НР (M+1)=
Найдено: 704,3
39-42 (13-20) трет-Бутил{2-[[4-(3-{[(трет-бутоксикарбонил)амино]метил}-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил](3-гидрокси-2,2-диметилпропил)амино]-2-оксоэтил}карбамат Вычислено: 724,3817 Найдено: 724,3822
39-43 (33-5) 3-метил-9-фенил-8-(4-{1-[(пиридин-3-илацетил)амино]циклопропил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин; выделенный в виде соли ТФУ Вычислено: 511,2241 Найдено: 511,2264
39-44 (33-5) 3-метил-9-фенил-8-(4-{1-[(хинолин-3-илкарбонил)амино]циклопропил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин; выделенный в виде соли ТФУ Вычислено: 547,2241
Найдено: 547,2225
39-45 (33-5) N-{1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропил}-2-(4-оксохиназолин-3(4H)-ил)ацетамид Вычислено: 578,2299 Найдено: 578,2276
39-46 (33-6) 3-(1-метил-1H-имидазол-4-ил)-9-фенил-8-(4-{1-[(пиридин-3-илацетил)амино]циклопропил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин; выделенный в виде соли ТФУ Вычислено: 577,2459
Найдено: 577,2488
39-47 (34-5) N-{(1R)-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}-2-пиридин-3-илацетамид; выделенный в виде соли HCl МС-НР (M+1) = найдено: 498,4
39-48 (34-5) N-{(1R)-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}ацетамид МС-НР (M+1) = найдено: 422,2
39-49 (34-5) N-((1R)-1-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этил)-2-пиридин-3-илацетамид; выделенный в виде соли HCl МС-НР (M+1) = найдено: 514,8
39-50 (38) N-{1-метил-1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}ацетамид МС-НР (M+1) = найдено: 422,3
39-51 (37-4) N-{1-метил-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}ацетамид МС-НР (M+1) = найдено: 435,8

2-[{4-[3-(Аммониометил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}(3-гидрокси-2,2-диметилпропил)амино]-2-оксоэтанамин (39-52)

Указанное в заголовке соединение получали согласно способам, указанным на схеме 27, из 39-42; МС (M+H+): вычислено: 524,2769; найдено: 524,2777. Соединение 39-52 выделяли в виде соли HCl.

ПРИМЕР 1

Клонирование изоформ Akt человека и ΔPH-Akt1

Вектор pS2neo (депонированный в ATCC 3 апреля 2001 с номером ATCC PTA-3253) получали следующим образом. Вектор pRmHA3 (полученный, как описано в Nucl. Acid Res. 16: 1043-1061 (1988)) разрезали BglII и выделяли фрагмент длиной 2734 п.о. Вектор pUChsneo (полученный, как описано в EMBO J. 4: 167-171 (1985)) также разрезали BglII и выделяли полосу, соответствующую 4029 п.о. Два полученных фрагмента лигировали вместе с образованием вектора, названного pS2neo-1. Указанная плазмида содержит полилинкер между промотором металлотионеина и сайтом присоединения поли-A-участки алкогольдегидрогеназы. Плазмида также имеет ген резистентности neo, регулируемый промотором теплового шока. Вектор pS2neo-1 разрезали Psp5II и BsiWI. Синтезировали и затем отжигали два комплиментарных олигонуклеотида (CTGCGGCCGC (SEQ ID NO:1) и GTACGCGGCCGCAG (SEQ ID NO:2)). Разрезанный pS2neo-1 и подвергнутые отжигу олигонуклеотиды лигировали вместе с образованием второго вектора, pS2neo. При таком превращении добавляли сайт NotI, чтобы обеспечить линеаризацию перед трансфекцией клеток S2.

Ген Akt1 человека амплифицировали в ПЦР (Clontech) с кДНК селезенки человека (Clontech), используя 5'-праймер: 5'CGCGAATTCAGATCTACCATGAGCGACGTGGCTATTGTG 3' (SEQ ID NO:3) и 3'-праймер: 5'CGCTCTAGAGGATCCTCAGGCCGTGCTGCTGGC3' (SEQ ID NO:4). 5'-праймер включал сайты EcoRI и BglII. 3'-праймер включал сайты XbaI и BamHI в целях клонирования. Полученный в результате ПЦР-продукт субклонировали в pGEM3Z (Promega) в виде EcoRI/XbaI-фрагмента. В целях экспрессии/очистки добавляли метку «middle-T» к 5'-концу полноразмерного гена Akt1, используя праймер для ПЦР: 5'GTACGATGCTGAACGATATCTTCG 3' (SEQ ID NO:5). Полученный в результате ПЦР-продукт содержал 5'-Kpn1-сайт и 3'-BamHI-сайт, которые использовали для субклонирования фрагмента в рамке с содержащим биотиновую метку экспрессирующим вектором клеток насекомых, pS2neo.

Для экспрессии варианта Akt1 с делетированным плекстрин-гомологичным доменом (PH) (Δ а/к 4-129, которая включает делецию части шарнирной области Akt1) осуществляли основанный на ПЦР делеционный мутагенез, используя полноразмерный ген Akt1 в векторе pS2neo в качестве матрицы. ПЦР осуществляли в две стадии, используя внутренние перекрывающиеся праймеры (5'GAATACATGCCGATGGAAAGCGACGGGGCTGAAGAGATGGAGGTG 3' (SEQ ID NO:6) и 5'CCCCTCCATCTCTTCAGCCCCGTCGCTTTCCATCGGCATGTATTC 3' (SEQ ID NO:7)), которые охватывали делецию, и 5'- и 3'-фланкирующие праймеры, которые охватывали сайт KpnI и метку «middle-T» на 5'-конце. Конечный ПЦР-продукт расщепляли KpnI и SmaI и лигировали в вектор pS2neo, разрезанный KpnI/SmaI и содержащий полноразмерный Akt1, эффективно заменяя 5'-конец клона делетированным вариантом.

Ген Akt3 человека амплифицировали, осуществляя ПЦР кДНК головного мозга взрослого человека (Clontech), используя аминоконцевой олигонуклеотидный праймер: 5' GAATTCAGATCTACCATGAGCGATGTTACCATTGTG 3' (SEQ ID NO:8); и олигонуклеотидный праймер на карбоксильном конце: 5' TCTAGATCTTATTCTCGTCCACTTGCAGAG 3' (SEQ ID NO:9). Указанные праймеры включали 5'-EcoRI/BglII-сайт и 3'-XbaI/BglII-сайт в целях клонирования. Полученный в результате ПЦР-продукт клонировали в сайтах EcoRI и XbaI pGEM4Z (Promega). В целях экспрессии/очистки добавляли метку «middle-T» к 5'-концу полноразмерного клона Akt3, используя ПЦР-праймер: 5' GGTACCATGGAATACATGCCGATGGAAAGCGATGTTACCATTGTGAAG 3' (SEQ ID NO:10). Полученный в результате ПЦР-продукт содержал 5'-KpnI-сайт, который давал возможность клонирования в рамке с содержащим биотиновую метку экспрессирующим вектором клеток насекомых, pS2neo.

Ген Akt2 человека амплифицировали в ПЦР с кДНК тимуса человека (Clontech), используя аминоконцевой олигонуклеотидный праймер: 5' AAGCTTAGATCTACCATGAATGAGGTGTCTGTC 3' (SEQ ID NO:11); и олигонуклеотидный праймер на карбоксильном конце: 5' GAATTCGGATCCTCACTCGCGGATGCTGGC 3' (SEQ ID NO:12). Указанные праймеры включали 5'-HindIII/BglII-сайт и 3'-EcoRI/BamHI-сайт в целях клонирования. Полученный в результате ПЦР-продукт субклонировали в HindIII/EcoRI-сайтах pGem3Z (Promega). В целях экспрессии/очистки добавляли метку «middle-T» к 5'-концу полноразмерного Akt2, используя ПЦР-праймер: 5' GGTACCATGGAATACATGCCGATGGAAAATGAGGTGTCTGTCATCAAAG 3' (SEQ ID NO:13). Полученный в результате ПЦР продукт субклонировали в векторе pS2neo, как описано выше.

ПРИМЕР 2

Экспрессия изоформ Akt человека и ΔPH-Akt1

ДНК, содержащую клонированные гены Akt1, Akt2, Akt3 и ΔPH-Akt1 в экспрессирующем векторе pS2neo, очищали и использовали для трансфекции клеток Drosophila S2 (ATCC) способом с использованием фосфата кальция. Отбирали пулы резистентных к антибиотику клеток (G418, 500 мкг/мл). Клетки размножали до объема 1,0 л (~7,0×106/мл), добавляли биотин и CuSO4 до конечной концентрации 50 мкМ и 50 мМ, соответственно. Клетки выращивали в течение 72 часов при 27°C и собирали центрифугированием. Клеточную массу замораживали при -70°C и хранили до использования.

ПРИМЕР 3

Очистка изоформ Akt человека и ΔPH-Akt1

Клеточную массу из одного литра клеток S2, описанную в примере 2, лизировали обработкой ультразвуком с 50 мл 1% CHAPS в буфере A: (50 мМ трис pH 7,4, 1 мМ EDTA, 1 мМ EGTA, 0,2 мМ AEBSF, 10 мкг/мл бензамидина, по 5 мкг/мл лейпептина, апротинина и пепстатина, 10% глицерин и 1 мМ DTT). Растворимую фракцию очищали на колонке с белком G-сефарозой Fast flow (Pharmacia), нагруженной 9 мг/мл моноклонального антитела против middle-T и элюировали 75 мкМ пептидом EYMPME (SEQ ID NO:14) в буфере A, содержащем 25% глицерина. Фракции, содержащие Akt/PKB, объединяли и оценивали чистоту белка с использованием SDS-ПААГ. Очищенный белок оценивали количественно с использованием протокола по Бредфорду. Очищенный белок быстро замораживали в жидком азоте и хранили при -70°C.

Akt и Akt с делециями плекстрин-гомологичного домена, очищенные из клеток S2, требовали активации. Akt и Akt с делециями плекстрин-гомологичного домена активировали (Alessi et al. Current Biology 7: 261-269) в реакционной смеси, содержащей 10 нМ PDK1 (Upstate Biotechnology, Inc.), липосомы (10 мкМ фосфатидилинозитол-3,4,5-трифосфат - Metreya, Inc, 100 мкМ фосфатидилхолин и 100 мкМ фосфатидилсерин - Avanti Polar lipids, Inc.) и буфер для активации (50 мМ трис pH 7,4, 1,0 мМ DTT, 0,1 мМ EGTA, 1,0 мкМ микроцистин-LR, 0,1 мМ АТФ, 10 мМ MgCl2, 333 мкг/мл БСА и 0,1 мМ EDTA). Реакционную смесь инкубировали при 22°C в течение 4 часов. Аликвоты быстро замораживали в жидком азоте.

ПРИМЕР 4

Анализы киназы Akt

Активированные изоформы Akt и конструкции с делециями плекстрин-гомологичного домена анализировали, используя полученный из GSK биотинилированный пептидный субстрат. Степень фосфорилирования пептида определяли гомогенной флуоресценцией с временным разрешением (HTRF), используя связанное с хелатом лантанида (Lance) моноклональное антитело, специфичное по отношению к фосфопептиду, в комбинации со связанным со стрептавидином флуорофором аллофикоцианином (SA-APC), который будет связываться с остатком биотина на пептиде. В том случае, когда Lance и APC находятся близко друг к другу (т.е. связаны с одной и той же молекулой фосфопептида), имеет место нерадиоактивный перенос энергии от Lance к APC с последующим испусканием света от APC при 665 нм.

Материалы, необходимые для анализа:

A. Активированный изофермент Akt или конструкция с делетированным плекстрин-гомологичным доменом.

B. Пептидный субстрат Akt: GSK3α (S21), пептид №3928 биотин-GGRARTSSFAEPG (SEQ ID NO:15), Macromolecular Resources.

C. Меченое Lance моноклональное антитело против фосфо-GSK3α (Cell Signaling Technology, клон №27).

D. SA-APC (Prozyme № в каталоге PJ25S, партия №896067).

E. Планшеты для микротитрования с U-образным дном Microfluor®B (Dynex Technologies, № в каталоге 7205).

F. Анализатор HTRF в микропланшетах Discovery®, Packard Instrument Company.

G. 100 X смесь ингибиторов протеаз (PIC): 1 мг/мл бензамидина, 0,5 мг/мл пепстатина, 0,5 мг/мл лейпептина, 0,5 мг/мл апротинина.

H. 10X буфер для анализа: 500 мМ HEPES, pH 7,5, 1% ПЭГ, мМ EDTA, 1 мМ EGTA, 1% БСА, 20 мМ β-глицеринфосфат.

I. Буфер для гашения: 50 мМ HEPES pH 7,3, 16,6 мМ EDTA, 0,1% БСА, 0,1% тритон X-100, 0,17 нМ Lance-меченое моноклональное антитело, клон №27, 0,0067 мг/мл SA-APC.

J. Рабочий раствор АТФ/MgCl2: 1X буфер для анализа, 1 мМ DTT, 1X PIC, 125 мМ KCl, 5% глицерин, 25 мМ MgCl2, 375 мкМ АТФ.

K. Рабочий раствор с ферментом: 1X буфер для анализа, 1 мМ DTT, 1X PIC, 5% глицерин, активный Akt. Конечные концентрации фермента выбирали так, чтобы анализ проходил в линейном диапазоне ответа.

L. Рабочий раствор с пептидом: 1X буфер для анализа, 1 мМ DTT, 1X PIC, 5% глицерин, 2 мкм биотинилированного пептида GSK3 №3928.

Реакционную смесь составляли добавлением 16 мкл рабочего раствора АТФ/MgCl2 в соответствующие лунки 96-луночного планшета для микротитрования. Добавляли ингибитор или наполнитель (1,0 мкл), затем 10 мкл рабочего раствора с пептидом. Реакцию начинали добавлением 13 мкл рабочего раствора с ферментом и перемешиванием. Реакции давали возможность протекать в течение 50 мин и затем останавливали добавлением 60 мкл буфера для гашения HTRF. После остановки реакции реакционные смеси инкубировали при комнатной температуре в течение по меньшей мере 30 мин и затем регистрировали на приборе Discovery.

Способ анализа на покрытых стрептавидином планшетах Flash Plate:

Стадия 1

1 мкл раствора тестируемого соединения в 100% ДМСО добавляли к 20 мкл 2X-раствора субстрата (20 мкМ пептида GSK3, 300 мкМ АТФ, 20 мМ MgCl2, 20 мккюри/мл [γ33P]АТФ, 1X буфер для анализа, 5% глицерин, 1 мМ DTT, 1X PIC, 0,1% БСА и 100 мМ KCl). Реакции фосфорилирования инициировали добавлением 19 мкл 2X-раствора фермента (6,4 нМ активной Akt/PKB, 1X буфер для анализа, 5% глицерин, 1 мМ DTT, 1X PIC и 0,1% БСА). Затем реакционные смеси инкубировали при комнатной температуре в течение 45 минут.

Стадия 2

Реакцию останавливали добавлением 170 мкл 125 мМ EDTA. По 200 мкл реакционной смеси после остановки реакции переносили в планшет, покрытый стрептавидином Flashplate® PLUS (NEN Life Sciences, № в каталоге SMP103). Планшет инкубировали в течение ≥10 минут при комнатной температуре на встряхивателе для планшетов. Содержимое каждой лунки аспирировали и лунки 2 раза промывали 200 мкл TBS на лунку. Затем лунки промывали 3 раза по 5 минут 200 мкл TBS на лунку, при инкубации планшетов при комнатной температуре на встряхивающей платформе на стадии промывки.

Планшеты закрывали пленкой и осуществляли счет с использованием счетчика Packard TopCount с подходящими параметрами для счета [33P] в планшетах Flashplates.

Способ анализа на покрытых стрептавидином фильтрующих планшетах:

Стадия 1

Осуществляли ферментативные реакции, которые описаны выше для стадии 1 анализа на покрытых стрептавидином планшетах Flash Plate.

Стадия 2

Реакцию останавливали добавлением 20 мкл 7,5 М гидрохлорида гуанидина. По 50 мкл реакционной смеси после остановки реакции переносили в покрытый стрептавидином фильтрующий планшет (планшет для улавливания биотина SAM2TM, Promega, № в каталоге V7542) и инкубировали на фильтре в течение 1-2 минут перед тем, как применить вакуум.

Затем планшет промывали, используя вакуумный коллектор, следующим образом: 1) 4×200 мкл/лунку 2M NaCl; 2) 6×200 мкл/лунку 2M NaCl с 1% H3PO4; 3) 2×200 мкл/лунку дистиллированной H2O; и 4) 2×100 мкл/лунку 95% этанола. Затем мембранам давали возможность полностью высохнуть на воздухе перед добавлением сцинтиллятора.

Дно планшета герметично закрывали белой подкладочной пленкой, добавляли 30 мкл/лунку Microscint 20 (Packard Instruments, № в каталоге 6013621). Сверху планшет закрывали прозрачной заклеивающей пленкой и затем осуществляли счет в планшете, используя счетчик Packard TopCount с подходящими параметрами для [33P] и жидкий сцинтиллятор.

Способ анализа на планшете с фосфоцеллюлозным фильтром

Стадия 1

Ферментативные реакции осуществляли, как описано для стадии 1 анализа, на покрытых стрептавидином планшетах Flash Plate (выше), используя KKGGRARTSSFAEPG (SEQ ID NO:16) в качестве субстрата вместо биотин-GGRARTSSFAEPG.

Стадия 2

Реакцию останавливали добавлением 20 мкл 0,75% H3PO4. По 50 мкл реакционной смеси после остановки реакции переносили в фильтрующий планшет (UNIFILTERTM, сильный катионообменник Whatman P81, белые полистироловые 96-луночные планшеты, Polyfiltronics, № в каталоге 7700-3312) и инкубировали на фильтре в течение 1-2 минут перед применением вакуума.

Затем планшет промывали, используя вакуумный коллектор, следующим образом: 1) 9×200 мкл/лунку 0,75% H3PO4; и 2) 2×200 мкл/лунку дистиллированной H2O. Дно планшета герметично закрывали белой подкладочной пленкой, затем добавляли 30 мкл/лунку Microscint 20. Сверху планшет закрывали прозрачной заклеивающей пленкой и затем осуществляли счет в планшете, используя счетчик Packard TopCount с подходящими параметрами для [33P] и жидкий сцинтиллятор.

Анализ PKA:

Для каждого отдельного анализа PKA использовали следующие компоненты:

A. 5X буфер для анализа PKA (200 мМ трис pH 7,5, 100 мМ MgCl2, 5 мМ β-меркаптоэтанол, 0,5 мМ EDTA).

B. 50 мкМ маточный раствор Kemptide (Sigma), разбавленный водой.

C. 33P-АТФ, приготовленный разбавлением 1,0 мкл 33P-АТФ [10 мкюри/мл] в 200 мкл 50 мкМ маточного раствора немеченного АТФ.

D. 10 мкл 70 нМ маточного раствора каталитической субъединицы PKA (UBI, № в каталоге 14-114), разбавленной в 0,5 мг/мл БСА.

E. рабочий раствор PKA/Kemptide: равные объемы 5X-буфера для анализа PKA, раствора Kemptide и каталитической субъединицы PKA.

Реакционную смесь готовили в 96-луночном планшете для анализа с глубокими лунками. Ингибитор или наполнитель (10 мкл) добавляли к 10 мкл раствора 33P-АТФ. Реакцию инициировали добавлением 30 мкл рабочего раствора PKA/Kemptide в каждую лунку. Реакционные смеси перемешивали и инкубировали при комнатной температуре в течение 20 мин. Реакции останавливали добавлением 50 мкл 100 мМ EDTA и 100 мМ пирофосфата натрия и перемешиванием.

Продукт ферментативной реакции (фосфорилированный Kemptide) собирали на 96-луночных фильтрующих планшетах с фильтрами из фосфоцеллюлозы p81 (Millipore). Чтобы подготовить планшет, через каждую лунку фильтрующего планшета p81 фильтровали 75 мМ фосфорную кислоту. Лунки опустошали через фильтр, подводя вакуум ко дну планшета. В каждую лунку добавляли фосфорную кислоту (75 мМ, 170 мкл). Аликвоты по 30 мкл из каждой реакционной смеси после остановки реакции PKA добавляли в соответствующие лунки фильтрующего планшета, содержащие фосфорную кислоту. Пептид улавливали на фильтре после подвода вакуума и фильтры 5 раз промывали 75 мМ фосфорной кислотой. После последней промывки фильтрам давали возможность высохнуть на воздухе. В каждую лунку добавляли сцинтилляционную жидкость (30 мкл) и производили счет фильтров на счетчике TopCount (Packard).

Анализ PKC:

Для каждого анализа PKC использовали следующие компоненты:

A. 10X-буфер для коактивации PKC: 2,5 мМ EGTA, 4 мМ CaCl2.

B. 5X-буфер для активации PKC: 1,6 мг/мл фосфатидилсерина, 0,16 мг/мл диацилглицерина, 100 мМ трис pH 7,5, 50 мМ MgCl2, 5 мМ β-меркаптоэтанол.

C. 33P-АТФ, приготовленный разбавлением 1,0 мкл 33P-АТФ [10 мкюри/мл] в 100 мкл 100 мкМ маточного раствора немеченного АТФ.

D. Основной белок миелина (350 мкг/мл, UBI), разбавленный водой.

E. PKC (50 нг/мл, UBI № в каталоге 14-115), разбавленный в 0,5 мг/мл БСА.

F. рабочий раствор PKC/основной белок миелина, приготовленный смешиванием 5 объемов каждого буфера для коактивации PKC и основного белка миелина с 10 объемами каждого буфера для активации PKC и PKC.

Реакционные смеси для анализа готовили в 96-луночном планшете для анализа с глубокими лунками. Ингибитор или наполнитель (10 мкл) добавляли к 5,0 мкл 33P-АТФ. Реакции инициировали добавлением рабочего раствора PKC/основной белок миелина и перемешиванием. Реакционные смеси инкубировали при 30°C в течение 20 мин. Реакции останавливали добавлением 50 мкл 100 мМ EDTA и 100 мМ пирофосфата натрия и перемешиванием. Фосфорилированный основной белок миелина собирали на мембранах PVDF в 96-луночных фильтрующих планшетах и количественно оценивали посредством сцинтилляционного счета.

Соединения согласно настоящему изобретению, описанные на схемах и в таблицах, тестировали в описанных выше анализах и обнаружили, что они имеют IC50≤50 мкМ против одной или нескольких Akt1, Akt2 и Akt3.

ПРИМЕР 5

Основанные на клетках анализы для определения ингибирования Akt/PKB

Клетки (например, LnCaP или линия опухолевых клеток PTEN(-/-) с активированной Akt/PKB) высевали на чашки диаметром 100 мм. Когда клетки сливались в монослой примерно на 70-80%, культуральную среду заменяли 5 мл свежей среды и в раствор добавляли тестируемое соединение. Контроли включали необработанные клетки, клетки, обработанные наполнителем, и клетки, обработанные либо LY294002 (Sigma), либо вортманин (Sigma) в концентрации 20 мкМ или 200 нМ, соответственно. Клетки инкубировали в течение 2, 4 или 6 часов и среду удаляли, клетки промывали PBS, собирали и переносили в центрифужную пробирку. Клетки осаждали и снова промывали PBS. Наконец, осадок клеток ресуспендировали в лизирующем буфере (20 мМ трис pH 8, 140 мМ NaCl, 2 мМ EDTA, 1% тритон, 1 мм Na-пирофосфат, 10 мМ β-глицеринфосфат, 10 мМ NaF, 0,5 мМ NaVO4, 1 мкМ микроцистин и 1x смесь ингибиторов протеаз), помещенном на лед, в течение 15 минут и осторожно встряхивали, чтобы лизировать клетки. Лизат центрифугировали в настольной ультрацентрифуге Beckman при 100000×g при 4°C в течение 20 мин. Белок в надосадке количественно оценивали, используя стандартный протокол Бредфорда (BioRad) и хранили при -70°C вплоть до использования.

Белки иммунопреципитировали (IP) из очищенных лизатов следующим образом. Для определения Akt1/PKBI лизаты смешивали с Santa Cruz sc-7126 (D-17) в NETN (100 мМ NaCl, 20 мМ трис pH 8,0, 1 мМ EDTA, 0,5% NP-40) и добавляли белок-A/G-агарозу (Santa Cruz sc-2003). Для определения Akt2/PKBβ лизаты смешивали в NETN с анти-Akt2-агарозой (Upstate Biotechnology №16-174), и для определения Akt3/PKBK лизаты смешивали в NETN с анти-Akt3-агарозой (Upstate Biotechnology №16-175). IP инкубировали в течение ночи при 4°C, промывали и разделяли в SDS-ПААГ.

Вестерн-блоты использовали для анализа общей Akt, pThr308-Akt1, pSer473-Akt1 и соответствующих сайтов фосфорилирования на Akt2 и Akt3 и находящихся ниже в каскаде мишеней Akt, используя специфичные антитела (Cell Signaling Technology): антитело против общей Akt (№ в каталоге 9272), антитело против фосфосерин-473-Akt (№ в каталоге 9271) и антитело против фосфотреонин-308-Akt (№ в каталоге 9275). После инкубации с соответствующим первым антителом, разбавленным в PBS + 0,5% обезжиренного сухого молока (NFDM), при 4°C в течение ночи блоты промывали, инкубировали с меченным пероксидазой хрена (HRP) вторым антителом в PBS + 0,5% NFDM в течение 1 часа при комнатной температуре. Белки выявляли с использованием реагентов ECL (Amersham/Pharmacia Biotech RPN2134).

ПРИМЕР 6

Стимулируемая херегулином активация Akt

Клетки MCF7 (линия клеток рака молочной железы человека, которая является PTEN+/+) высевали по 1×106 клеток на чашку диаметром 100 мм. Когда клетки сливались в монослой на 70-80%, культуральную среду заменяли 5 мл бессывороточной среды и инкубировали в течение ночи. На следующее утро добавляли соединение и клетки инкубировали в течение 1-2 часов, затем добавляли херегулин (чтобы индуцировать активацию Akt) на 30 минут и клетки анализировали, как описано выше.

ПРИМЕР 7

Ингибирование опухолевого роста

Эффективность in vivo ингибитора роста злокачественных клеток можно подтвердить, используя несколько протоколов, известных в данной области.

Линии опухолевых клеток человека, в которых наблюдается нарушение регуляции пути P13K (например, LnCaP, PC3, C33a, OVCAR-3, MDA-MB-468, A2780 или т.п.), инъецировали подкожно в левый бок самкам мышей nude 6-10-недельного возраста (также использовали самцов мышей [10-14-недельного возраста] для ксенотрансплантатов опухоли простаты [LnCaP и PC3]) (Harlan) в 0 день. Мышей случайным образом распределяли по группам обработки наполнителем, соединением или комбинированной обработки. Ежедневное подкожное введение начинали в 1 день и продолжали в течение эксперимента. Альтернативно тестируемое ингибирующее соединение можно вводить с помощью насоса для непрерывной инфузии. Соединение, комбинацию соединений или наполнитель вводили в общем объеме 0,2 мл. Опухоли вырезали и взвешивали, когда у всех обработанных наполнителем животных наблюдали поражения диаметром 0,5-1,0 см, обычно через 4-5,5 недель после инъекции клеток. Рассчитывали среднюю массу опухолей в каждой группе обработки для каждой линии клеток.

ПРИМЕР 8

Анализ пятен в планшетах Multiplex

Данный способ относится к иммуноанализу типа «сэндвич», используемому для выявления множества фосфорилированных белков в одной и той же лунке 96-луночного планшета. Лизаты клеток инкубировали в 96-луночных планшетах, на которых разные улавливающие антитела помещали в виде пространственно раздельных пятен в одной и той же лунке. Добавляли специфичные к фосфорилированию поликлональные антитела кролика и комплекс выявляли с использованием антитела против иммуноглобулина кролика, меченного электрохемилюминесцентной меткой.

96-луночные планшеты LNCaP +/- соединения:

Центрифугировали в центрифуге Beckman J6 при 1200 об/мин в течение 10 мин, среду аспирировали. Добавляли 50 мкл/лунку: TBS (Pierce №28376-20 мМ трис pH 7,5, 150 мМ NaCl) + 1% тритон X-100 + ингибиторы протеаз и фосфатаз. Закрывали пленкой, помещали в морозильную камеру при -70°C вплоть до полного замораживания. Блокировали планшеты Multiplex (Meso Scale Discovery, Gaithersburg, MD) 3% блокатором A в 1X трис-буфере для промывки, 150 мкл/лунку. Закрывали с помощью приспособления для заклеивания планшетов, инкубировали на встряхивателе Micromix при комнатной температуре 2 часа (минимум). Промывали 1X RCM 51 (TTBS). Размораживали планшеты с клеточным лизатом на льду, добавляли 40 мкл лизата/лунку в блокированные планшеты. Закрывали с помощью приспособления для заклеивания планшетов, инкубировали на встряхивателе Micromix при 4°C O/N. Промывали 1X RCM 51. Разбавляли вторые антитела в 1% блокаторе A в 1X трис-буфере для промывки: анти-фосфо-AKT (T3O8), анти-фосфо-туберин (T1462), отдельно или в комбинации. Добавляли по 25 мкл/лунку, закрывали планшет с помощью приспособления для заклеивания планшетов, инкубировали на встряхивателе Micromix при комнатной температуре 3 часа. Промывали 1X RCM 51. Разбавляли Ru-GAR в 1% блокаторе A в 1X трис-буфере для промывки. Добавляли по 25 мкл/лунку, закрывали с помощью приспособления для заклеивания планшетов, инкубировали на встряхивателе Micromix при комнатной температуре в течение 1 часа. Промывали 1X RCM 51. Разбавляли 4X-буфер для регистрации T до 1X водой, добавляли 200 мкл разбавленного буфера для регистрации/лунку.

Регистрировали в устройстве Sector 6000 Imager.

Ингибиторы протеаз и фосфатаз:

Микроцистин-LR, Calbiochem №475815 до конечной концентрации 1 мкМ (маточный раствор = 500 мкМ)

Calbiochem №524624, 100 X набор I

Calbiochem №524625, 100 X набор II

Calbiochem №539134, 100 X набор III

Анти-фосфо-AKT (T308):

Cell Signaling Technologies №9275

Анти-фосфотуберин (T 1462):

Covance, аффинно очищенные (кролики МС 2731/2732)

Ru-GAR = рутенилированные антитела козы против иммуноглобулина кролика

10X трис-буфер для промывки, блокатор A и 4X буфер T для промывки

10X RCM 51 (10X TTBS, RCM 51)

1X = 20 мМ трис pH 7,5, 140 мМ NaCl, 0,1% твин-20

ПРИМЕР 9

Основанный на клетках анализ (in-vivo)

Данный способ относится к основанному на клетках (in vivo) анализу активности сериновой/треониновой киназы Akt. Активированная эндогенная Akt способна фосфорилировать специфичный пептидный субстрат Akt (GSK3β), который биотинилирован. Регистрацию осуществляют гомогенной флуоресценцией с временным разрешением (HTRF), используя связанное с криптатом европия [Eu(K)] антитело, специфичное к фосфопептиду, и связанный со стрептавидином флуорофор XL665, который будет связываться с остатком биотина на пептиде. Когда [Eu(K)] и XL665 находятся рядом друг с другом (т.е. связаны с одной и той же молекулой фосфопептида) имеет место нерадиоактивный перенос энергии от Eu(K) к XL665 с последующим испусканием света от XL665 при 665 нм.

Анализ можно использовать для выявления ингибиторов всех трех изоферментов Akt (Akt1, Akt2 и Akt3) из множества разных видов, если к каждому из них существуют антитела.

МАТЕРИАЛЫ И РЕАГЕНТЫ

A. 96-луночные планшеты для микротитрования культур клеток с плоским дном, Corning Costar, № в каталоге 3598.

B. 96-луночные планшеты, покрытые белком A Reacti-Bind, Pierce, № в каталоге 15130.

C. 96-луночные планшеты, покрытые белком G Reacti-Bind, Pierce, № в каталоге 15131.

D. Встряхиватель Micromix 5.

E. Планшеты для микротитрования с U-образным дном Microfluor® B, Dynex Technologies, № в каталоге 7205.

F. Устройство для помывки 96-луночных планшетов, Bio-Tek Instruments, № в каталоге EL 404.

G. Анализатор HTRF в микропланшетах Discovery®, Packard Instrument Company.

БУФЕРНЫЕ РАСТВОРЫ

A. Буфер для лизиса клеток при анализе IP киназы: 1X TBS; 0,2% твин 20; 1X смесь ингибиторов протеаз III (исходный раствор является 100X, Calbiochem, 539134); 1X смесь ингибиторов фосфатаз I (исходный раствор является 100X, Calbiochem, 524624); и 1X смесь ингибиторов фосфатаз II (исходный раствор является 100X, Calbiochem, 524625).

B. 10X буфер для анализа: 500 мМ Hepes pH 7,5; 1% ПЭГ; 1 мМ EDTA; 1 мМ EGTA; и 20 мМ β-глицерофосфат.

C. Буфер для анализа IP киназы: 1X буфер для анализа; 50 мМ KCl; 150 мкМ АТФ; 10 мМ MgCl2; 5% глицерин; 1 мМ DTT; 1 таблетка смеси ингибиторов протеаз на 50 мл буфера для анализа; и 0,1% БСА.

D. Раствор субстрата GSK3β: буфер для анализа IP киназы и 500 нМ биотинилированный пептид GSK3β.

E. Буфер Lance: 50 мМ Hepes pH 7,5, 0,1% БСА и 0,1% тритон X-100.

F. Буфер для остановки Lance: буфер Lance и 33,3 мМ EDTA.

G. Буфер для регистрации Lance: буфер Lance, 13,3 мкг/мл SA-APC и 0,665 нМ EuK-Ат против фосфо(Ser-21)GSK3β.

Многостадийный анализ иммунопреципитации киназы Akt

1 день

A. Стадия посева клеток C33a: Высевали 60000 клеток C33a/лунку в 96-луночный планшет для микротитрования.

B. Клетки инкубировали в течение ночи при 37°C.

2 день

D. Стадия добавления соединения: Соединения добавляли в свежей среде (альфа-MEM/10% FBS, комнатная температура) в описанный выше 96-луночный планшет и инкубировали в течение 5 часов в инкубаторе для культур тканей.

E. Стадия лизиса клеток: Среду аспирировали и добавляли 100 мкл буфера для лизиса клеток для анализа IP киназы.

F. 96-луночный планшет для микротитрования замораживали при -70°C (Примечание: указанная стадия может быть осуществлена в течение минимум 1 часа или в течение ночи).

3 день

G. Стадия с использованием 96-луночного планшета, покрытого белком A/G: добавляли соответствующую концентрацию α-Akt-антитело (Akt1, Akt2 или Akt3) в 100 мкл PBS в следующие лунки:

α-Akt1 (20 нг/лунку/100 мкл) B2»»»»B10/ряды B-G/планшет Akt1
α-Akt2 (50 нг/лунку/100 мкл) B2»»»»B10/ряды B-G/планшет Akt2
IgG кролика (150 нг/лунку/100 мкл) B11-G11 на каждом планшете (Akt1 и Akt2)

H. Инкубировали в холодном помещении (+4°C) в течение 4 часов на Micromix 5 (форма 20; положение 2) (Примечание: положение зависит от того, какой прибор Micromix 5 используют).

I. Аспирировали раствор α-Akt-антитела и в каждую лунку добавляли 100 мкл PBS.

J. Стадия иммунопреципитации Akt: К 100 мкл PBS со стадии (I) добавляют 5 мкл размороженного лизата клеток в случае планшетов для Akt1 и 10 мкл размороженного лизата клеток в случае планшетов для Akt2. Примечание: лизат клеток размораживали на льду. Размороженный лизат перемешивали пипетированием вверх и вниз 10 раз перед переносом в планшеты с антителами. Планшеты с лизатом клеток хранили на льду. После переноса лизата клеток в планшеты с антителами планшеты с лизатами клеток повторно замораживали при -70°C.

K. Инкубировали в холодном помещении (+4°C) в течение ночи на встряхивателе Micromix 5 (форма 20, положение 3).

4 день

L. Стадия промывки планшета для иммунопреципитации: 96-луночные планшеты промывали 1 раз TTBS (RCM 51, 1 раз = 2 цикла), используя устройство для промывки 96-луночных планшетов. Лунки заполняли TTBS и инкубировали в течение 10 минут. 96-луночные планшеты промывали 2 раза TTBS. (Примечание: заливают устройства для промывки планшетов перед использованием: 1) проверяют емкости для буфера, убеждаясь, что они заполнены, и 2) опустошают контейнеры для отходов.

M. Стадия ручной помывки планшетов: Добавляли 180 мкл буфера для анализа IP киназы.

N. Начало ферментативной реакции Akt: Добавляли надосадок. Добавляли 60 мкл раствора субстрата GSK3β.

O. Инкубировали в течение 2,5 часов на встряхивателе Micromix 5 при комнатной температуре. Примечание: Время инкубации должно быть установлено так, чтобы отношение колонка 10/колонка 11 было не >10.

P. Объединяли 30 мкл буфера для регистрации Lance с 30 мкл буфера для остановки Lance (всего 60 мкл/лунку) и добавляли в 96-луночные черные планшеты с U-образным дном Microfluor.

Q. Останавливали ферментативную реакцию Akt: переносили 40 мкл смеси для ферментативной реакции Akt из покрытого белком A/G 96-луночного планшета со стадии (O) в 96-луночные черные планшеты с U-образным дном Microfluor со стадии (P).

U. Инкубировали при комнатной температуре в течение 1-2 часов на встряхивателе Micromix 5 (форма 20, положение 3), затем регистрировали на анализаторе микропланшетов Discovery, используя программу для Akt.

Буфер для лизиса клеток для анализа IP киназы

100 мкл на лунку.

8 мл (1 планшета) 45 мл (6 планшетов)
1Х TBS 7744 мкл NA
Твин 20 20 мкл NA
1Х смесь ингибиторов протеаз III 80 мкл NA
1Х смесь ингибиторов фосфатаз I 450 мкл
1Х смесь ингибиторов фосфатаз II 80 мкл 450 мкл
Микроцистин LR (500X)
80 мкл 90 мкл

Буфер для анализа IP киназы

100 мкл на лунку.

8 мл (1 планшета) 50 мл (3 планшета)
10Х буфер для анализа 800 мкл 5 мл
1 М KCl 400 мкл 2,5 мл
250 мМ АТФ 4,8 мкл 30 мкл
1М MgCl2 80 мкл 500 мкл
Глицерин 400 мкл 2,5 мл
1М DTT 8 мкл 50 мкл
Смесь ингибиторов протеаз 1 таблетка/50 мл 1
10% БСА 80 мкл 500 мкл
Дистиллированная Н2О 6227,2 мкл 38,9 мл

Раствор субстрата GSK3β

60 мкл на лунку.

5 мл (1 планшета) 7 мл
Буфер для анализа IP киназы 5 мл -
1 мМ пептитд GSK3β 2,5 мкл 3,5 мкл

Буфер для остановки Lance

30 мкл на лунку.

3 мл (1 планшета) 5 мл 5 мл
1Х буфер Lance 2800,2 мкл
EDTA 0,5 M 199,8 мкл

Буфер для регистрации Lance

30 мкл на лунку.

3 мл (1 планшета) 5 мл
SA-APC (1 мг/мл в дистиллированной деионизированной Н2О) 40 мкл 66,7 мкл
EuK Ат фосфо (Ser 21)GSK3β (680 нМ), разбавленный 1/1133 в буфере Lance 2,7 мкл 4,5 мкл

1. Соединение формулы Е

в котором пунктирная линия представляет собой необязательно двойную связь;
R1 выбран из Н, оксогруппы, SH, NH2, (C=O)NH2, С36циклоалкил, фенил, необязательно замещенный ОН, CN, галогеном, С36циклоалкилом, фенокси, гидроксиС16алкилом или группой NR7R8, где R7 означает водород, a R8 означает (С=O)С16алкил;
С16алкил, необязательно замещенный 1-2 раза галогеном, С16перфторалкилом, S(O)2C1-C6алкилом, ОН, CN, группой NR7R8, где R7 означает водород или C1-C6алкил, a R8 означает Н, C1-C6алкил, гидроксиС16алкил, (C=O)C1-C6алкил, (С=O)ОС16алкил, 4-6-членным гетероциклилом, выбранным из группы, состоящей из азетидинила, пирролидинила, морфолинила, пиперидинила, замещенного аминокарбонилом, и пиперазинила, необязательно замещенного С16алкилом, 5-членным гетероарилом, выбранным из группы, состоящей из тетразолила или имидазолила;
5-членный гетероарил, содержащий 1-2 атома азота и один атом кислорода или серы в качестве гетероатомов, причем гетероарил с одним атомом азота и одним атомом кислорода замещен С16алкилом;
5-членный гетероарил, содержащий 2-3 атома азота в качестве гетероатома, необязательно замещенный C16алкилом, С36циклоалкилом, фенилом, бензилом, пиридинилом, трифторалкилом или кетогруппой, или 5-членный гетероарил, содержащий 1-2 атома азота в качестве гетероатомов, сконденсированный с бензольным кольцом;
6-членный гетероарил, содержащий 1-2 атома азота в качестве гетероатомов и выбранный из группы, состоящий из пиридинила, необязательно замещенного амино или гидрокси группой, оксидопиридинила, пиримидинила, пиразинила, пиридазинона или дигидропиридазинона;
конденсированную гетероциклическую систему, состоящую из двух 5- или 5-6-членных колец и содержащую 2-4 атома азота и атом серы в качестве гетероатомов, выбранную из группы, состоящей из имидазопиримидинила, пиразолопиримидинила, триазолопиримидинила, пиразолопиридинила, имидазопиридинила, необязательно замещенного С16алкилом или галогеном;
5-членный гетероарил, содержащий два атома азота, один атом серы или один атом азота и один атом кислорода, сконденсированный с гидрированным бензольным кольцом;
R3 выбран из С36циклоалкила, замещенного NH2 или группой NHR8, где R8 означает (С=O)С16алкил, где алкил замещен пиридинилом, хинолинилом или оксохиназолинилом, С16алкил, замещенный NH2, ОН, группой NR7R8, где R7 означает водород, a R8 означает С36циклоалкил, необязательно замещенный гидрокси, С16алкилом, замещенным галогеном, гидрокси, диС16алкиламино, фенилом, замещенным гидрокси, пиридинилом, замещенным гидрокси или C16алкокси, имидазолилом, замещенным С16алкилом, группой (C=O)NR7R8, где R7 означает водород, a R8 означает фенил, замещенный гидрокси, группу (С=O)С16алкил, где алкил необязательно замещен NH2, ОН, CN, фенилом, замещенным гидрокси, пиридинилом, необязательно замещенным галогеном, 1Н-индазолилом, оксадиазолилом, морфолинилом, пиразинилом, пиримидинилом, замещенным гидрокси, триазолилом, замещенным фенилом, оксохиназолинилом, бензоксазолилом, бензимидазолилом, группой (С=O)ОС16алкилом, группой NHR8, где R8 означает (С=O)ОС16алкил или (С=O)фенил, замещенный гидрокси, или
R7 означает группу (C=O)C1-C6алкил, необязательно замещенный NH2, оксохиназолинилом, группой NHR8, где R8 означает (С=O)ОС16алкил, или
R7 и R8, вместе взятые с атомом азота, с которым они связаны, образуют 6-членный цикл, замещенный группой (C=O)NH2 или 5-членным гетероарилом, содержащим 2-3 атома азота в качестве гетероатомов, который дополнительно замещен пиридинилом;
или его фармацевтически приемлемая соль.

2. Соединение формулы J

в которой пунктирная линия представляет собой необязательно двойную связь; R1 выбран из Н, оксогруппы, SH, NH2, (C=O)NH2, С36циклоалкил, фенил, необязательно замещенный ОН, CN, галогеном, С36циклоалкилом, фенокси, гидроксиС16алкилом или группой NR7R8, где R7 означает водород, a R8 означает (С=O)С16алкил;
С16алкил, необязательно замещенный 1-2 раза галогеном, С16перфторалкилом, S(O)2C1-C6алкилом, ОН, CN, группой где R7 означает водород или С16алкил, a R8 означает Н, С16алкил, гидроксиС1-C6алкил, (C=O)C1-C6алкил, (С=O)ОС16алкил, 4-6-членным гетероциклилом, выбранным из группы, состоящей из азетидинила, пирролидинила, морфолинила, пиперидинила, замещенного аминокарбонилом, и пиперазинила, необязательно замещенного С16алкилом, 5-членным гетероарилом, выбранным из группы, состоящей из тетразолила или имидазолила;
5-членный гетероарил, содержащий 1-2 атома азота и один атом кислорода или серы в качестве гетероатомов, причем гетероарил с одним атомом азота и одним атомом кислорода замещен С16алкилом;
5-членный гетероарил, содержащий 2-3 атома азота в качестве гетероатома, необязательно замещенный С16алкилом, С36циклоалкилом, фенилом, бензилом, пиридинилом, трифторалкилом или кетогруппой, или 5-членный гетероарил, содержащий 1-2 атома азота в качестве гетероатомов, сконденсированный с бензольным кольцом;
6-членный гетероарил, содержащий 1-2 атома азота в качестве гетероатомов и выбранный из группы, состоящей из пиридинила, необязательно замещенного амино или гидрокси группой, оксидопиридинила, пиримидинила, пиразинила, пиридазинона или дигидропиридазинона;
конденсированную гетероциклическую систему, состоящую из двух 5- или 5-6-членных колец и содержащую 2-4 атома азота и атом серы в качестве гетероатомов, выбранную из группы, состоящей из имидазопиримидинила, пиразолопиримидинила, триазолопиримидинила, пиразолопиридинила, имидазопиридинила, необязательно замещенного С16алкилом или галогеном;
5-членный гетероарил, содержащий два атома азота, один атом серы или один атом азота и один атом кислорода, сконденсированный с гидрированным бензольным кольцом;
R3′ и R3′′ независимо выбраны из Н; (С=O)С16алкила, необязательно замещенного 6-членным гетероциклилом, содержащим атом азота и кислорода, 5-6-членным гетероарилом, содержащим 1-3 атома азота и необязательно атом кислорода и замещенным С16алкилом, галогеном, гидрокси, фенилом, замещенным гидрокси, группой NR7R8, где R7 означает водород, a R8 означает (С=O)ОС16алкил, (С=O)фенил, замещенный гидрокси; С16алкила, необязательно замещенного гидрокси, галогеном, группой (C=O)NR7R8, где R7 означает водород, a R8 означает фенил, замещенный гидрокси; ди(С16алкила)амино; С36циклоалкила, необязательно замещенного гидрокси; (С16алкил)фенила, необязательно замещенного гидрокси; (С=O)гетероарила, где гетероарил означает 5-6-членное кольцо, содержащее атом азота или атом кислорода и необязательно замещенное пиридинилом, морфолинилом, конденсированную гетероциклическую систему, состоящую из двух 5-6-членных колец и содержащую 1-2 атома азота или атом кислорода, или серы, выбранную из группы, состоящей из хинолинила, оксохиназолинила, бензоксазолила, замещенного оксо, бензимидазолила, индазолила, тиено[2,3-d]пиримидинила, замещенного оксо; (С16)алкилгетероциклила, содержащего один или два атома азота, необязательно замещенного С16алкилом, гидрокси, С16алкокси; или
R3′ и R3′′ вместе взятые с атомом азота, с которым они связаны, могут образовывать пиперидин или пирролидин, которые необязательно могут быть замещены 5-членным гетероарилом, содержащим 2-3 атома азота в качестве гетероатома, необязательно замещенным (C=O)NH2, пиридинилом, триазолилом, необязательно замещенным пиразинилом;
R4 и R5 независимо означают Н, С16алкил; или R4 и R5 вместе взятые могут образовывать (С37)циклоалкил;
или его фармацевтически приемлемая соль.

3. Соединение, которое выбрано из:
9-фенил-8-(4-{[4-(5-пиридин-2-ил-1Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амина;
9-фенил-8-(4-{[4-(5-пиридин-2-ил-1Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ола;
9-фенил-8-(4-{[4-(4-пиридин-2-ил-1Н-имидазол-1-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амина;
9-фенил-8-(4-{[4-(5-пиридин-2-ил-1Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-тиола;
3-метил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-1Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
9-фенил-8-(4-{[4-(5-пиридин-2-ил-1Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-(хлорметил)-9-фенил-8-(4-{[4-(4-пиридин-2-ил-1Н-имидазол-1-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-[(4-метилпиперазин-1-ил)метил]-9-фенил-8-(4-{[4-(5-пиридин-2-ил-1Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
2-({[9-фенил-8-(4-{[4-(5-пиридин-2-ил-1Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метил}амино)этанола;
8-(4-аминометилфенил)-9-фенил-[1,2,4]триазоло[3,4-f][1,6]нафтиридин-3-ола;
1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
4-(3-метил-9-фенил-[1,2,4]триазоло[3,4-f][1,6]нафтиридин-8-ил)бензиламина;
8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-амина;
1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамина;
9-фенил-8-{4-[4-(5-пиридин-2-ил-4Н-[1,2,4]триазол-3-ил)-пиперидин-1-илметил]фенил}-[1,2,4]триазоло[3,4-f][1,6]нафтиридина;
9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-(1Н-1,2,3-триазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-(1Н-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
трет-бутил[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метилкарбамата;
[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанола;
5-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]-2,4-дигидро-3Н-1,2,4-триазол-3-она;
3-(3-метил-1Н-1,2,4-триазол-5-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-имидазо[2,1-b][1,3]тиазол-6-ил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-[1,2,4]триазоло[1,5-а]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-имидазо[1,2-а]пиридин-2-ил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)-3-(1Н-1,2,4-триазол-5-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-(1Н-бензимидазол-6-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-(1,5-диметил-1Н-пиразол-3-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-имидазо[1,2-а]пиримидин-2-ил-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
5-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]пиридин-2-амина;
9-фенил-3-пиразоло[1,5-а]пиримидин-3-ил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-(5-метил-1Н-пиразол-3-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]пиридин-2-амина;
4-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]фенола;
3-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]фенола;
2-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]фенола;
1-{4-[3-(5-оксо-4,5-дигидро-1Н-1,2,4-триазол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пиперидин-4-карбоксамида;
1-[4-(3-имидазо[1,2-а]пиридин-2-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пиперидин-4-карбоксамида;
9-фенил-8-(4-{[4-(5-пиразин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
9-фенил-8-(4-{[4-(5-пиримидин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил)фенил)-3-(1Н-1,2,3-триазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-(1-метил-1Н-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиримидин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-(1-метил-1Н-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-(1-метил-1Н-имидазол-4-ил)-9-фенил-8-(4-{[4-(5-пиразин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
N-[2-(4-метил-1Н-имидазол-2-ил)этил]-N-{4-[3-(1-метил-1Н-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}амина;
N1-(2-гидроксифенил)-N3-{4-[3-(1-метил-1Н-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-бета-аланинамида;
1-{4-[3-(1-метил-1Н-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пиперидин-4-карбоксамида;
5-[({4-[3-(1-метил-1Н-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}амино)метил]пиридин-2-ола;
N1,N1,2,2-тетраметил-N3-{4-[3-(1-метил-1Н-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пропан-1,3-диамина;
3-гидрокси-2,2-диметил-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амина;
2-фтор-3-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амина;
2,2-дифтор-3-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амина;
3-дигидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амина;
4-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]циклогексанамина;
4-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]циклогексанамина;
3-гидрокси-2,2-диметил-N-{4-[3-(1-метил-1Н-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пропан-1-амина;
3-гидрокси-2,2-диметил-N-[4-(9-фенил-3-[1,2,4]триазоло[1,5-а]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амина;
3-гидрокси-2,2-диметил-N-[4-(9-фенил-3-пиразоло[1,5-а]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропан-1-амина;
3-гидрокси-2,2-диметил-N-{4-[9-фенил-3-(1Н-1,2,3-триазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пропан-1-амина;
трет-бутил{[8-(4-{[(3-гидрокси-2,2-диметилпропил)амино]метил}фенил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метил}карбамата;
N-{4-[3-(аммониометил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-3-гидрокси-2,2-диметилпропан-1-амина;
[9-фенил-8-(4-{[4-(5-пиразин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанола;
N3-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-N1-(2-гидроксифенил)-бета-аланинамида;
(8-{4-[(циклогексиламино)метил]фенил}-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил)метанола;
N3-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-N1-(4-гидроксифенил)-бета-аланинамида;
[9-фенил-8-(4-{[4-(5-пиридин-3-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанола;
1-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}пиперидин-4-карбоксамида;
{8-[4-(1-аминоциклопропил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метанола;
1-[4-(9-фенил-3-пиридин-4-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
1-{4-[3-(1-оксидопиридин-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-[4-(3,9-дифенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
1-{4-[3-(4-фторфенил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}бензонитрила;
4-(9-фенил-3-пиримидин-4-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензиламина;
1-{4-[3-(1-оксидопиридин-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
5-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}пиридин-2-ола;
1-[4-(9-фенил-3-пиридин-3-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
4-(9-фенил-3-пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензиламина;
1-[4-(9-фенил-3-пиридин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
1-[4-(9-фенил-3-пиразин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
1-{4-[9-фенил-3-(1Н-1,2,4-триазол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[9-фенил-3-(1,3-тиазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[9-фенил-3-(1Н-пиразол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[3-(3-метил-1Н-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[3-(3-метил-1Н-1,2,4-триазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[3-(1-метил-1Н-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[9-фенил-3-(1,2,5-тиадиазол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[9-фенил-3-(1,2,3-тиадиазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-[4-(9-фенил-3-пиразоло[1,5-а]пиримидин-3-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метанамина;
{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метанола;
1-{4-[9-фенил-3-(2,2,2-трифторэтил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[9-фенил-3-(1Н-тетразол-1-илметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-карбоксамида;
1-{4-[3-(1Н-имидазол-1-илметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-(4-{3-[(метилсульфонил)метил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамина;
{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}ацетонитрила;
2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}этанола;
N-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)ацетамида;
4-[3-(2-метилимидазо[1,2-а]пиридин-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина;
1-[4-(9-фенил-3-пиразоло[1,5-а]пиридин-3-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
1-[4-(3-имидазо[1,2-а]пиридин-2-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-1,2-бензилоксазол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-[4-(3-имидазо[2,1-b][1,3]тиазол-6-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
1-{4-[3-(1-метил-1Н-имидазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[3-(1-метил-1Н-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
4-[3-(1-метил-5-фенил-1Н-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина;
1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-1-бензотиен-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[3-(1-изопропил-1Н-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[9-фенил-3-(1,4,5,6-тетрагидроциклопента[с]пиразол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-(4-{9-фенил-3-[(2S)-пирролидин-2-ил][1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамина;
4-[3-(1-аминоэтил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина;
1-{4-[3-(1Н-имидазол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-[4-(3-циклопропил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
1-{4-[9-фенил-3-(трифторметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[3-(5-метил-1Н-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[3-(1,5-диметил-1Н-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
4-[3-(1Н-индол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина;
1-{4-[3-(1-метил-1Н-имидазол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[3-(3-метил-2Н-3лямбда5-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
4-[3-(6-хлоримидазо[1,2-а]пиридин-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина;
1-{4-[3-(1Н-бензимидазол-2-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
4-[3-(5-циклопропил-4Н-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина;
1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-1Н-индазол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
4-[9-фенил-3-(3-фенил-1Н-пиразол-5-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина;
1-(4-{9-фенил-3-[3-(трифторметил)-1Н-пиразол-5-ил][1,2,4]триазоло[3,4-f]1,6-нафтиридин-8-ил}фенил)метанамина;
1-[4-(9-фенил-3-пиразоло[1,5-а]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
1-{4-[3-(1-бензил-1Н-пиразол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-[4-(9-фенил-3-[1,2,4]триазоло[1,5-а]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
4-[9-фенил-3-(1-фенил-1Н-пиразол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина;
1-{4-[9-фенил-3-(4,5,6,7-тетрагидро-2-бензотиен-1-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[9-фенил-3-(5,6,7,8-тетрагидроимидазо[1,2-а]пиридин-2-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}пропан-2-амина;
1-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}этан-1,2-диола;
4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}имидазолидин-2-она;
(2R)-2-амино-2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}этанола;
(2R)-2-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-2-(метиламино)этанола);
1-{4-[3-(5-этилизоксазол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
5-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-2,4-дигидро-3Н-1,2,4-триазол-3-она;
6-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-4,5-дигидропиридазин-3(2Н)-она;
6-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}пиридазин-3(2Н)-она;
N-(4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}фенил)ацетамида;
1-{4-[3-(4-феноксифенил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[3-(1Н-бензимидазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
(4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}фенил)метанола;
4-[3-(4-циклогексилфенил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина;
4-{8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}-1,3-дигидро-2Н-имидазол-2-она;
1-{4-[3-(4-метил-1Н-имидазол-5-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
4-[9-фенил-3-(1-пропил-1Н-имидазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина;
1-{4-[3-(1-изопропил-1Н-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[3-(1-бутил-1Н-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-[4-(3-имидазо[1,2-а]пиримидин-2-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
5-({[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}метил)пиридин-2-ола;
1-(6-метоксипиридин-3-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]метанамина;
N-[(2-метоксипиримидин-5-ил)метил]-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амина;
1-[4-(3-этил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
1-[4-(9-фенил-3-пропил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанамина;
N-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамида;
4-({[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}метил)фенола;
1-[9-фенил-8-(4-{[4-(5-пиридин-2-ил-4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил]метанамина;
9-фенил-3-(1Н-1,2,3-триазол-4-ил)-8-(4-{[4-(4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
1-{4-[3-(1Н-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[9-фенил-3-(3Н-1лямбда4,3-тиазол-5-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[9-фенил-3-(1Н-пиразол-3-ил)-2Н-4лямбда5-[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-{4-[9-фенил-3-(1,3-тиазол-4-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
4-[9-фенил-3-(пирролидин-1-илметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина;
1-{4-[3-(азетидин-1-илметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
1-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)пиперидин-4-карбоксамида;
1-{4-[3-(морфолин-4-илметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанамина;
2-[({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)амино]этанола;
1-(4-{3-[(4-метилпиперазин-1-ил)метил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил}фенил)метанамина;
4-[9-фенил-3-(пиперазин-1-илметил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензиламина;
N-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)-N-метиламина;
N-({8-[4-(аминометил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ил}метил)-N,N-диметиламина;
[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]метанола;
{4-[3-(1-метил-1Н-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}метанола;
1-[4-(9-фенил-3-[1,2,4]триазоло[1,5-а]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанола;
9-фенил-8-(4-{[4-(4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-метил-9-фенил-8-(4-{[4-(4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
9-фенил-8-(4-{[4-(4Н-1,2,4-триазол-3-ил)пиперидин-1-ил]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-3-ола;
1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропанамина;
1-{4-[3-(1-метил-1Н-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}циклопропанамина;
1-[4-(9-фенил-3-[1,2,4]триазоло[1,5-а]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропанамина;
1-{4-[9-фенил-3-(5,6,7,8-тетрагидроимидазо[1,2-а]пиридин-2-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}циклопропанамина;
1-[4-(9-фенил-3-пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропанамина;
1-{4-[3-(1,5-диметил-1Н-пиразол-3-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}циклопропанамина;
(1R)-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамина;
(1R)-1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамина;
(1R)-1-{4-[9-фенил-3-(5-пиридин-2-ил-1Н-пиразол-3-ил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этанамина;
(1R)-1-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этанамина;
(1R)-1-{4-[3-(1-метил-1Н-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этанамина;
(1R)-1-[4-(9-фенил-3-[1,2,4]триазоло[1,5-а]пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамина;
(1R)-1-[4-(3-имидазо[2,1-b][1,3]тиазол-6-ил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамина;
(1R)-1-[4-(9-фенил-3-пиримидин-2-ил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этанамина;
(1R)-1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]пропан-1-амина;
2-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]пропан-2-амина;
2-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]пропан-2-амина;
3-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридина;
N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-5-пиридин-4-ил-2-фурамида;
N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-5-пиридин-3-ил-2-фурамида;
N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-5-пиридин-3-ил-1Н-пиррол-3-карбоксамида;
2-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамида;
трет-бутил(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)карбамата;
4-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)морфолина;
2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтанамина;
4-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридина;
2,4-дигидрокси-6-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиримидина;
2-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридина;
3-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)пиридина;
N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-2-пиразин-2-илацетамида;
3-метил-9-фенил-8-[4-({[(пиридин-3-иламино)карбонил]амино}метил)фенил][1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
2-(2-гидроксифенил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамида;
2-(3-гидроксифенил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамида;
2-(4-гидроксифенил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамида;
2-(3,4-дигидроксифенил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамида;
N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-2-фенилацетамида;
3-метил-9-фенил-8-(4-{[(пиридин-3-илкарбонил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
2-гидрокси-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]бензамида;
2-(4-гидроксифенил)-2-метил-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропанамида;
метил-4-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-4-оксобутаноата;
2-гидрокси-N-(2-{[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]амино}-2-оксоэтил)бензамида;
N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-2-(5-фенил-4Н-1,2,4-триазол-3-ил)ацетамида;
3-метил-9-фенил-8-(4-{[(хинолин-3-илкарбонил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]-2-(4-оксохиназолин-3(4Н)-ил)ацетамида;
N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]2-(2-оксо-1,3-бензоксазол-3(2Н)-ил)ацетамида;
8-(4-{[(1Н-бензимидазол-1-илацетил)амино]метил}фенил)-3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
8-(4-{[(1Н-бензимидазол-2-илацетил)амино]метил}фенил)-3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
2-(4-метил-1,2,5-оксадиазол-3-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамида;
2-(1Н-индазол-1-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамида;
2-(5,6-диметил-4-оксотиено[2,3-d]пиримидин-3(4Н)-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамида;
3-метил-8-[4-({[(6-морфолин-4-илпиридин-3-ил)карбонил]амино}метил)фенил]-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
2-(6-хлорпиридин-3-ил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамида;
3-циано-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]пропанамида;
3-метил-9-фенил-8-(4-{[(3-пиридин-3-илпропаноил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-(1-метил-1Н-имидазол-4-ил)-9-фенил-8-(4-{[(пиридин-3-илацетил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
9-фенил-3-пиразоло[1,5-а]пиримидин-3-ил-8-(4-{[(пиридин-3-илацетил)амино]метил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
N-(3-гидрокси-2,2-диметилпропил)-N-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил]ацетамида;
N-(3-гидрокси-2,2-диметилпропил)-N-{4-[3-(1-метил-1Н-имидазол-4-ил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]бензил}-2-(4-оксохиназолин-3(4Н)-ил)ацетамида;
трет-бутил{2-[[4-(3-{[(трет-бутоксикарбонил)амино]метил}-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)бензил](3-гидрокси-2,2-диметилпропил)амино]-2-оксоэтил}карбамата;
3-метил-9-фенил-8-(4-{1-[(пиридин-3-илацетил)амино]циклопропил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
3-метил-9-фенил-8-(4-{1-[(хинолин-3-илкарбонил)амино]циклопропил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
N-{1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]циклопропил}-2-(4-оксохиназолин-3(4Н)-ил)ацетамида;
3-(1-метил-1Н-имидазол-4-ил)-9-фенил-8-(4-{1-[(пиридин-3-илацетил)амино]циклопропил}фенил)[1,2,4]триазоло[3,4-f]-1,6-нафтиридина;
N-{(1R)-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}-2-пиридин-3-илацетамида;
N-{(1R)-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}ацетамида;
N-((1R)-1-{4-[3-(гидроксиметил)-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил]фенил}этил)-2-пиридин-3-илацетамида;
N-{1-метил-1-[4-(9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}ацетамида; и
N-{1-метил-1-[4-(3-метил-9-фенил[1,2,4]триазоло[3,4-f]-1,6-нафтиридин-8-ил)фенил]этил}ацетамида;
или его фармацевтически приемлемая соль или стереоизомер.

4. Фармацевтическая композиция, обладающая ингибирующим действием активности сериновой/треониновой киназы Akt, содержащая фармацевтический носитель и диспергированное в нем терапевтически эффективное количество соединения по п.3.

5. Применение соединения по п.3 для получения лекарственного средства, применимого для лечения или профилактики злокачественной опухоли у млекопитающего, нуждающегося в таком лечении.



 

Похожие патенты:

Изобретение относится к производному 5-замещенного 7-амино-[1,3]тиазоло[4,5-d]пиримидина формулы (I) и его оптическим изомерам и фармацевтически приемлемым солям, где R1 представляет собой СН3 или СН3СН2 ; R2 представляет собой Н, 2-F, 2-Cl, 3-F, 3-ОСН 3, 3-CN, 3-CF3, 3-CONH2 или 3-SO 2CH3; R3 представляет собой Н или СН3; R4 представляет собой Н или СН 3; и R5 представляет собой Н; или, когда R 4 представляет собой СН3, R5 представляет собой Н или F.

Изобретение относится к производным азола формулы I в которой А представляет S, О; W является -(С=O)-; Х являются идентичными или различными и представляют =C(-R)- или =N-; Y представляет -О- или -NR1-; R представляет водород, галоген, (С1-С6)-алкил, нитро; R1 представляет водород; R2 представляет (C5-C 16)-алкил, (С1-С4)-алкил-фенил, где фенил может быть необязательно моно- или полизамещен (С1 -С6)-алкилом; R3 представляет водород; или R2 и R3 вместе с несущим их атомом азота могут образовывать моноциклическую насыщенную 6-членную кольцевую систему, причем отдельные члены этой кольцевой системы могут быть заменены на 1 группу из следующего ряда: -CHR5-, -NR5-; R5 представляет (С1-С6 )-алкил, трифторметил; и к его физиологически приемлемым солям.

Изобретение относится к соединению, представленному следующей формулой [I-D1] или к его фармацевтически приемлемой соли: где каждый символ определен в формуле изобретения.

Изобретение относится к производным 5,7-дизамещенного [1,3]тиазоло[4,5-d]пиримидин-2(3Н)-она формулы (I), где R 1 представляет собой СН3 или СН3СН 2; R2 представляет собой Н, 3-CN, 2-CF3 , 2-F, 3-F, 3-CF3, 3-CONH2 или 3-SO 2CH3; R3 представляет собой Н; R 4 представляет собой Н или СН3; и R5 представляет собой Н; или, когда R4 представляет собой СН3, R5 представляет собой Н или F; и его фармацевтически приемлемым солям.

Изобретение относится к новым соединениям, которые обладают ингибирующими свойствами в отношении РI3-киназы общей формулы (1) где R1 выбран из группы, включающей -NHRc, -NHC(O)Rc, -NHC(O)ORc , -NHC(O)NRcRc и -NHC(O)SRc, R2 обозначает остаток, необязательно замещенный одним или двумя заместителями R4, выбранный из группы, включающей C1-С6алкил, С3-С8 циклоалкил, 5-6-членный гетероциклоалкил с одним гетероатомом, выбранным из азота и серы, фенил, бензил и 5-6-членный гетероарил, включающий 1-2 атома азота, R3 обозначает необязательно замещенный одним или несколькими заместителями Rе и/или Rf остаток, выбранный из группы, включающей фенил и 5-6-членный гетероарил с 1-3 гетероатомами, выбранными из азота и кислорода, R4 обозначает остаток, выбранный из группы, включающей Ra, Rb, и замещенный одним или несколькими идентичными или разными заместителями R c и/или Rb, Ra в каждом случае независимо выбран из группы, включающей C1-С6алкил, фенил, 4-7-членный гетероциклоалкил с 1-2 гетероатомами, выбранными из азота и кислорода, и 9-членный гетероарил с одним атомом азота в качестве гетероатома, Rb в каждом случае независимо выбран из группы, включающей =O, -ORс, -NRc Rc, галоген, -СF3, -CN, -S(O)Rc , -C(O)Rc, -C(O)ORc, -C(O)NRc Rc, -C(O)N(Rg)NRcRc , -N(Rg)C(O)Rc, -N(Rg)S(O) 2Rc, -N(Rg)S(O)2NR cRc, -N(Rg) C(O)ORc и -N(Rg)C(O)NRcRc, Rc в каждом случае независимо обозначает водород или необязательно замещенный одним или двумя идентичными или разными заместителями Rd и/или Re остаток, выбранный из группы, включающей C1-С6алкил, С3-С 8циклоалкил, С6-C9арил, 4-7-членный гетероциклоалкил с 1-2 гетероатомами, выбранными из азота и кислорода, и 5-6-членный гетероарил с 1-2 гетероатомами, выбранными из азота, кислорода и серы, Rd в каждом случае независимо обозначает водород или необязательно замещенный одним или двумя идентичными или разными заместителями Re и/или Rf остаток, выбранный из группы, включающей C1-С6алкил, С3-С8циклоалкил, фенил, 4-7-членный гетероциклоалкил с 1-2 гетероатомами, выбранными из азота и кислорода, и 5-10-членный гетероарил с одним атомом азота, Re в каждом случае независимо выбран из группы, включающей =O, -ORf, -SRf, -NRfRf, -CN, -S(O) 2Rf, -C(O)Rf, -C(O)ORf , -С(O)NRfRf и -OC(O)Rf, R f в каждом случае независимо обозначает водород или необязательно замещенный одним или двумя идентичными или разными заместителями Rg остаток, выбранный из группы, включающей C 1-С6алкил, С3-С8циклоалкил, фенил и 4-7-членный гетероциклоалкил с 1-2 гетероатомами, выбранными из азота и кислорода, и 5-6-членный гетероарил с одним гетероатомом, выбранным из азота и серы, Rg в каждом случае независимо обозначает водород, C1-С6алкил, С3 -С8циклоалкил и 4-7-членный гетероциклоалкил с одним азотом в качестве гетероатома, а также к их фармакологически безвредным кислотно-аддитивным солям.

Изобретение относится к конденсированному гетероциклическому производному, представленному формулой (I): где кольцо А представляет 5-членный моноциклический гетероарил, содержащий 1 или 2 гетероатома, выбранных из N или S; RA представляет низшую алкильную группу, необязательно замещенную гидроксильной группой, COW1, COOW1 или CONW2W3, в которых W1-W 3 независимо представляют атом водорода или низшую алкильную группу; m представляет целое число 0 или 2; кольцо В представляет бензольное кольцо или тиофеновое кольцо; RB представляет атом галогена, цианогруппу, низшую алкильную группу или OW 4, в которой W4 представляет атом водорода или низшую алкильную группу; n представляет целое число 0-2; Е 1 представляет атом кислорода; Е2 представляет атом кислорода; U представляет ординарную связь или низшую алкиленовую группу; Х представляет группу, представленную Y, -CO-Y, -SO 2-Y, -S-L-Y, -O-L-Y, -CO-L-Y, -SO-L-Y, -SO2-L-Y, -S-Z или -O-Z, в которой L представляет низшую алкиленовую группу, необязательно замещенную галогеном или гидроксигруппой; Y представляет группу, представленную Z или -NW7W8, где W7 и W8 независимо представляют атом водорода, низшую алкильную группу или Z, при условии, что W7 и W8 не являются одновременно атомами водорода, или W7 и W8 могут связываться вместе с соседним атомом азота с образованием циклической аминогруппы; Z представляет циклоалкильную группу, необязательно конденсированную с фенилом и необязательно замещенную фенильной группой, необязательно замещенной галогеном или алкокси группой; 6-8-членную гетероциклоалкильную группу, имеющую 1 гетероатом, выбранный из атома азота или кислорода, необязательно конденсированную с фенилом и необязательно замещенную фенилом; фенильную группу, необязательно замещенную заместителем, выбранным из группы, состоящей из атома галогена, цианогруппы, алкильной группы, необязательно замещенной атомом галогена гидроксигруппой или алкоксигруппой, алкоксигруппы, необязательно замещенной атомом галогена, гидроксигруппой, алкоксигруппой, алкоксикарбонилокси группой или ацилокси группой, алкилтио группы, карбоксигруппы и алкоксикарбонильной группы; пиридил; или к его фармацевтически приемлемой соли.

Изобретение относится к новой кристаллической форме соединения формулы (I), которое обладает свойствами антагониста Р2т и может найти применение для профилактики артериальных тромботических осложнений у пациентов при заболеваниях коронарной артерии, цереброваскулярным и периферическим сосудистым заболеванием.

Изобретение относится к соединению формулы 2: и к его фармацевтически приемлемым солям и их смесям, где значения радикалов R, M, Q, Z, W, D описаны в п.1 формулы изобретения.

Изобретение относится к новым соединениям формулы I' или их фармацевтически приемлемым солям, обладающим ингибирующим действием в отношении киназ Тес или c-Met. .

Изобретение относится к соединениям формулы (I) или их фармацевтически приемлемым солям, сольватам или таутомерам, где заместитель М выбран из групп D1 и D2, имеющих структурные формулы, приведенные ниже, и R1, Е, А и X соответствуют определениям, приведенным в формуле изобретения.

Изобретение относится к соединениям, содержащим N-гетероарильный остаток, который связан через кислород, серу или азот или через метиленовый мостик и кислород, серу или азот с конденсированным циклическим остатком, и к применению их в лекарственных средствах для лечения заболеваний, связанных с NAD(P)H-оксидазами, и для ингибирования активации тромбоцитов.

Изобретение относится к новым 5,7-диаминозамещенным пиразоло[1,5-а]пиримидинам, выбранным из конкретных соединений, например, указанных ниже, обладающих свойствами ингибиторов циклин-зависимых киназ, таких как CDK2.
Наверх