Новые карбосилановые дендримеры, их получение и применение



Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение
Новые карбосилановые дендримеры, их получение и применение

 


Владельцы патента RU 2422474:

ДЕНДРИКО, С.Л. (ES)

Изобретение относится к карбосилановым дендримерам, способу их получения и их применению. Предложены новые дендримеры, концы ветвей которых включают первичные, вторичные, третичные и четвертичные аминогруппы, способ их получения, композиция на их основе и варианты применения дендримеров. Технический результат - получение новых карбосилановых дендримеров, имеющих широкий диапазон применения в медицине, являющихся технологичными и биосовместимыми. Предложенные дендримеры могут быть использованы для транспорта анионных молекул в крови, таких как молекулы нуклеиновых кислот, включая молекулы ODN и RNAi, и других анионных лекарственных средств, с которыми они могут взаимодействовать, тем самым защищая их от взаимодействия с белками в плазме и/или усиливая степень их проникновения в целевые клетки. Дендримеры могут быть использованы для связывания анионных молекул с поверхностями, а также могут быть введены в качестве активных компонентов для предотвращения или лечения болезней, вызываемых вирусами, такими как ВИЧ или гепатит С, или прионами, жизненный цикл которых дендример способен нарушать. 14 н. и 158 з.п. ф-лы, 19 табл., 35 ил.

 

Область техники, к которой относится изобретение

Изобретение касается трехмерных молекул, называемых дендримерами, а именно тех из типа карбосиланов с концевыми фрагментами, которые содержат первичные, вторичные, третичные или четвертичные аминогруппы, способов их получения и их применения. Среди областей, где возможно их использование, на первый план выдвигается применение их в качестве носителей для нуклеиновых кислот и прочих фармакологически активных молекул с отрицательным зарядом, так как это позволяет увеличить полупериод названных лекарственных средств и их биологическую усвояемость и сократить дозу, необходимую для достижения желаемого биологического действия. Еще одной областью применения дендримеров согласно изобретению являются предотвращение или лечение болезней, вызываемых микроорганизмами, чьи структуру и/или жизненный цикл они нарушают.

Уровень техники

Дендримеры привлекли к себе повышенное внимание в последние годы благодаря возможности их использования в чрезвычайно разнообразных областях, таких как катализ на наноуровне, химические сенсоры, мономолекулярные мицеллы, имитация ферментативной активности, инкапсулирование молекул, распознавание на молекулярном уровне, диагностические средства, а также в качестве переносчиков для транспорта генов и лекарственных средств. Прекрасные обзоры, которые охватывают все эти области применения, опубликованы в литературе[1,31-38].

Одну из областей, где дендримеры были исследованы с наибольшей полнотой, представляет Генная Терапия (введение генного материала в клетку в терапевтических целях). До настоящего времени наиболее широко применяемыми переносчиками в транспорте нуклеиновых кислот были вирусные векторы. Однако использование вирусных векторов было связано с появлением некоторых проблем, таких как неблагоприятные иммунологические эффекты, лимфопролиферативные эффекты, связанные с нарушением регуляции онкогенов в человеческом геноме[2], и т.д. В попытках разрешить эти проблемы были разработаны другие типы невирусных переносчиков, такие как катионные липосомы, полимеры и также, как уже было упомянуто, дендримеры. Каждая из этих катионных систем формирует электростатические комплексы с нуклеиновыми кислотами, которые называются, соответственно, липоплексы, полиплексы или дендриплексы.

Применение липосом в качестве агентов трансфекции было первоначально описано в 1987 году[3]. Метод, наиболее употребимый для распределения генов, представлял собой инкапсулирование в катионных липидах, кстати, некоторые из этих производных, такие как CytofectinTM или LypofectinTM, доступны в продаже. Однако эти производные проявляют также побочные действия, такие как воспалительная реакция легких, и такие проблемы, как неудачная трансфекция в присутствии сыворотки[4].

Что касается общепринятых деградируемых полимеров, то применение их в качестве переносчиков имеет основным недостатком их термодинамическую нестабильность, которая создает активные частицы с очень коротким полупериодом in vivo[5].

Наибольшее преимущество дендримеров в области невирусных переносчиков состоит в единообразной структуре и в возможности самыми разнообразными способами модифицировать их скелет и поверхность, что позволяет точно охарактеризовать комплекс (нуклеиновая кислота/вектор) и систематически изучить способ трансфекции. Первая публикация, в которой было описано применение древовидно-разветвленных молекул как агентов трансфекции, появилась в 1993 году и представляла использование дендримеров, названных РАМАМ[6] (полиамидоамин), и с тех пор было проведено огромное количество исследований[7,39,40]. Применение этих дендримеров в качестве переносчиков основано на том факте, что при физиологическом значении рН некоторые из концевых групп протонируются, сообщая РАМАМ-дендримеру результирующий положительный заряд, хотя некоторые аминогруппы все же остаются непротонированными. Хорошие результаты трансфекции были также достигнуты с этими дендримерами, в особенности с дендримерами шестой и седьмой генераций, однако эффективность этого способа может быть повышена на два или три порядка величины, когда используются РАМАМ-дендримеры, активированные тепловой обработкой, как в случае с SuperfectTM или PolyfectTM.

Еще один класс потенциальных агентов трансфекции представляют дендримеры, которые содержат атомы фосфора[8], синтезированные Majoral и др. вплоть до двенадцатой генерации. В этом случае поверхность дендримеров была функционализирована протонированными или метилированными третичными аминами и была протестирована в качестве агентов трансфекции гена люциферазы клеток 3Т3. Эффективность увеличивается по мере нарастания генерации дендримера вплоть до достижения постоянной величины между третьей и пятой генерациями. Далее, мы должны подчеркнуть, что эти дендримеры проявляют лучшую эффективность трансфекции в присутствии сыворотки.

Наконец, другие макромолекулы, такие как полипропиленимин - (PPI)[9] или полилизин-дендримеры[10,41], проявились как системы для транспорта ДНК или олигодезоксинуклеотидов (ODN). Например, дендримеры из низших генераций PPI показали явную способность к in vitro трансфекции при низкой токсичности, хотя использовать более высокие генерации оказалось невозможным ввиду нарастания их токсичности.

Со своей стороны, олигонуклеотиды (ODN) исследуются в медицинских областях применения в различных направлениях. Так, например, антисмысловые олигонуклеотиды (ODNs) представляют собой короткие синтетические последовательности (15-30 оснований в длину) ДНК или аналогов, которые являются комплементарными (или антисмысловыми) целевой последовательности (последовательность РНК или последовательность ДНК, комплементарная таковой, из которой могла быть транскрибирована эта РНК), предназначенные для препятствования биологическим актам, таким как транскрипция, трансляция или явления расщепления и сплайсинга[11]. Эти молекулы предназначены для взаимодействия в качестве комплементарных последовательностей целевой информационной РНК, препятствуя синтезу белков путем деградации информационной РНК (mRNA) действием рибонуклеазы (RNase) или вмешательством в считывание рибосомой. Это называется «антисмысловой терапией». Антисмысловые олигонуклеотиды (ODNs) были использованы в разнообразных областях с 1978 года (противораковая терапия и инфекционная болезнь, главным образом), и до нынешнего времени, когда, после периода сомнений, антисмысловые олигонуклеотиды (ODNs) проявили свое значение как мощный инструмент в Молекулярной Биологии, в особенности после утверждения Американским Управлением по контролю за продуктами и лекарствами (FDA) антивирусного препарата Formivirsen[12], антисмыслового ODN, показанного при офтальмологической инфекции цитомегаловирусом (CMV) в контексте ВИЧ-инфекции. Еще один антисмысловый ODN, GEM231, постулирован как молекула с потенциальной возможностью применения против различных неоплазий[13]. Этот подход также исследуется на предмет возможности его применения в изотопной маркировке опухолей с использованием Позитронной Эмиссионной Томографии[14]. Более того, существует тип антисмыслового ODN, который, как предполагается, может действовать на уровне клеточной ДНК: они представляют собой сформированные в виде тройной спирали олигонуклеотиды (ODNs), некоторые из каковых предназначены для использования их в области ВИЧ-инфекций[15].

Еще одна, совершенно иная область состоит в использовании олигонуклеотидов (ODN), содержащих много неметилированных CpG-последовательностей, в качестве иммуномодуляторов. Эти последовательности управляют иммунной реакцией на Th1 профиль, характеризуемой усиленной секрецией Интерферона, фактора некроза опухоли, интерлейкина-2 и прочих факторов, которые усиливают способность иммунной системы удалять такие болезнетворные микроорганизмы, как вирусы и бактерии. Эти олигонуклеотиды (ODN) взаимодействуют с рецепторами на поверхности лимфоцитов, подобными таковым из семейства Toll-подобных рецепторов. Они исследуются для усиления иммунного ответа у иммунодефицитных пациентов и в контексте аллергических заболеваний, характеризуемых Th2-балансом, с целью сведения этого профиля к Th1[16].

Одна из главных проблем терапии с использованием ODN состоит в достижении уровней, достаточных для того, чтобы добиться терапевтического действия. Необходимо вводить большие количества олигонуклеотидов (ODN) для достижения биологического эффекта, так как они проявляют сильную склонность к связыванию с белками плазмы, такими как альбумин[17]. Связывание с белками плазмы и другими белками клеточной поверхности также считается ответственным за некоторые токсические действия олигонуклеотидов (ODN) in vivo (активация каскада комплемента, гемолиз, тромбоцитопения и т.д.)[18]. Поэтому считается, что применение переносчика, который предотвращает вышеупомянутое связывание с белками, могло бы обеспечить создание более высоких уровней активных олигонуклеотидов (ODN), более того, увеличить их полупериод и снизить их токсичность.

Проблема взаимодействия с белками и их связывания с ними существует также и для многих других субстанций, таких как лекарственные препараты, так как белки в общем (и белки плазмы в частности: альбумин, гликопротеины, липопротеины) содержат функциональные группы, которые потенциально способны взаимодействовать с веществами, присутствующими в среде, включая введенные лекарственные препараты. Это связывание является определяющим фактором распределения названных лекарственных средств при условии, что связанная доля лекарственного средства ввиду утраты способности к переносу не формирует часть сосудисто-тканевого баланса («резервуар»), не участвует в метаболизме, не выводится из организма и не оказывает никакого действия (если иное не определено вышеназванным связыванием).

Связывание белков плазмы (РРВ), без сомнения, составляет самый важный и определяющий фактор распределения лекарственных препаратов, так как связывание с тканевыми белками, в общем, сильно сокращено. Между прочим, это обусловлено тем фактом, что концентрация белков в плазме гораздо более высокая, чем интерстициальная концентрация в тканях, чьи белки, кроме того, обладают очень малой подвижностью и менее способны связывать субстанции, каковое свойство которых особенно значительно в случае альбумина, преобладающего белка в плазме в нормальных условиях, и с которым связываются, главным образом, кислотные лекарственные средства (хотя и некоторые щелочные тоже), в то время как кислые гликопротеины связывают эти щелочные лекарственные субстанции.

Кислотные лекарственные препараты (альбумин) Щелочные лекарственные препараты (альбумин-I1 кислый гликопротеин)
Аспирин Хлордиазепоксид
Фуросемид Диазепам
Пенициллин Лидокаин
Фенитоин Хинин
Толбутамид Амитриптилин
Варфавин

Поскольку структура альбумина с точки зрения связывания лекарственного средства является довольно сложной, могут быть определены две главных точки связывания, или локусы.

ТОЧКА I («для вартавина») ТОЧКА II («для диазепама»)
Хлортиазид Бензодиазепины
Фуросемид Ибупрофен
Налидиксовая кислота Клоксациллин
Салициловая кислота Салициловая кислота
Толбутамид Толбутамид
Индометацин Индометацин

Поэтому проблема связывания с белками плазмы затрагивает не только олигонуклеотиды (ODN), но также почти все общеупотребительные лекарственные препараты. Многих из этих проблем тоже можно было бы избежать применением переносчиков. Представляется вполне ясным, что переносчик, разрабатываемый для этой цели, должен иметь ряд характеристик, таких как:

- нетоксичный;

- неаллергенный (за исключением использования для вакцинации);

- биосовместимый;

- имеющий функциональные группы, пригодные для обеспечения химической фиксации;

- с ограниченным накоплением в организме;

- сохраняющий активность комплекса «лекарственное средство/олигонуклеотид (ODN)» вплоть до достижения зоны действия.

Более того, представляется очевидным, что разрабатываемый переносчик должен со временем высвобождать олигонуклеотид (ODN) или транспортируемое лекарственное средство с тем, чтобы оно смогло выполнить свое действие. В этом аспекте разработка переносчиков, которые обеспечивали бы контролируемое высвобождение олигонуклеотида (ODN) или определенных лекарственных препаратов, была бы очень желательной, чтобы добиться стабильно поддерживаемых уровней активной субстанции в организме с постепенно реализуемым действием их. По всем этим причинам, применение дендримеров представляет возможность, которая удовлетворяет желаемым требованиям, поскольку они могут действовать в качестве переносчиков активных субстанций, каковые могли бы защищать последние от разложения ферментами плазмы и от взаимодействия с белками, с которыми они могли бы связываться, тем самым повышая их уровни в крови и обеспечивая более высокую и/или более продолжительную активность. Олигонуклеотиды (ODNs), в частности, подобно многим обсуждаемым здесь лекарственным средствам, являются анионными молекулами (с отрицательным зарядом), по каковой причине применение в качестве их переносчиков дендримеров с группами, которые облегчают взаимодействие с ними, и, в особенности, таких дендримеров, которые имеют катионную природу при физиологическом значении рН, представляет собой весьма подходящий выбор, чтобы гарантировать стабильность комплекса в способе его транспорта. Поэтому изобретение разрабатывает новые дендримеры, а именно карбосиланового типа, и раскрывает варианты их использования, среди прочих, в качестве переносчиков для транспорта олигонуклеотидов (ODNs) и других представляющих интерес анионных молекул в крови и/или прочих жидкостях организма. Это включает новую область, так как до сих пор не было опубликовано никаких исследований относительно применения дендримеров с карбосилановой структурой, растворимых в воде, в качестве переносчиков, хотя было опубликовано сообщение о биосовместимости in vitro карбосилановых дендримеров, составленных из поли(этиленоксида)[21]. Более того, только три синтетических исследования катионных карбосилановых дендримеров были опубликованы до настоящего времени[22-24], но ни один из них не соответствует представленным в изобретении.

Среди лекарственных препаратов, для которых дендримеры могут действовать как переносчики, интересную группу составляют цитотоксические лекарственные средства, предназначенные для опухолевых клеток[73, 74]. Если рассматривать эту цель, то дендримеры могут быть направлены на опухолевые клетки с фолиевой кислотой, сверхэкспрессия рецепторов которой имеет место в опухолевых клетках, по каковой причине эти дендримеры имели бы преимущество в их поглощении названными клетками по сравнению с нормальными клетками. Недавно РАМАМ-дендримеры, модифицированные фолатом на их поверхности, были использованы в качестве переносчиков изотопа бора 10В в бор-нейтроннозахватной терапии рака[75]. Далее, РАМАМ-дендримеры, конъюгированные с цисплатином, действуют как макромолекулярный переносчик платины, противоопухолевый препарат, который высвобождается из дендример-платинового комплекса в контролируемой форме, приводя к более значительному накоплению последнего в солидных опухолях, и при меньшей токсичности, чем у свободного цисплатина[76]. Еще одна альтернатива контролируемого высвобождения состоит в создании ковалентных связей между дендримером и лекарственным средством с тем, чтобы это были биодеградируемые связи при физиологическом значении рН, как было испытано на дендримерах с первичными аминогруппами на поверхности и частично модифицированных 1-бромацетил-5-фторурацилом с образованием лабильной амидной связи, которая гидролизуется in vitro при физиологическом значении рН, в контролируемом режиме выделяя 5-фторурацил, мощный противоопухолевый препарат.

Другие представляющие интерес субстанции, для транспорта которых дендримеры могут быть применимыми, являются такими, которые становятся токсичными после их облучения благодаря in situ образованию небольших количеств кислорода в синглетном состоянии, каковой оказывает вредоносное физиологическое влияние[69]. Были опубликованы статьи о дендримерах, несущих фоточувствительные лекарственные препараты, например, с 5-аминолевулиновой кислотой на периферии, с предположением о перспективности этих дендримерных агентов в лечении кератиноцитарных опухолей[70]. Как возможные средства лечения солидных опухолей, дендримеры были оценены по полиарилэфирным дендримерам, содержащим протопорфирин как фотосенсибилизатор[71].

Дополнительная группа лекарственных препаратов, для которых дендримеры могли быть предложены как интересные переносчики, составлена такими лекарственными средствами, как нестероидные противовоспалительные препараты, которые проявляют побочные действия, такие как желудочно-кишечные альтерации или почечная токсичность, которых можно избежать, поскольку они вводятся трансдермальным путем, вместо классических орального или парентерального путей. Есть сведения, которые показывают, что если присутствие дендримеров, связанных с введенными лекарственными препаратами, ведет к кожным изменениям, которые увеличивают ее проницаемость[72], то это становится хорошей возможностью использования их в трансдермальной доставке лекарственных средств.

Поливалентность функциональных групп на поверхности дендримеров означает огромное разнообразие молекул, которые они могут транспортировать, даже включая дендримеры с различными функциональными группами: они представляют собой кластерные тектодендримеры, которые исследуются благодаря огромным потенциальным возможностям применения их в биомедицинских областях.

Потенциальные возможности дендримеров для транспорта лекарственных средств основываются не только на использовании возможных взаимодействий с внешней поливалентной поверхностью дендримера, но и на том факте, что структура дендримеров может быть использована для заключения в нее молекул, которые желательно транспортировать. Примером использования полостей дендримерной структуры является так называемый «дендритный бокс»[68], в котором PPI-дендример модифицирован на поверхности фенилаланиновыми группами, которые защищают внешний каркас, делая его более плотным. В способе роста дендримера молекулы различной величины инкапсулируются внутри него. Дендример может нести различное число молекул в зависимости от их размера. Когда дендример обрабатывают муравьиной кислотой, внешний каркас раскрывается, позволяя высвободить заключенные внутри молекулы.

Еще одна группа молекул, для которых дендримеры предположительно могут быть пригодными переносчиками, представляет собой молекулы с низкой молекулярной массой (такие как пептиды), против которых желательно вызывать иммунный ответ в организме, но которые, ввиду их малого размера, едва ли аллергенны или вызывают слабую реакцию после инъекции индивиду, которого желательно лечить. Эта проблема может быть разрешена путем увеличения их молекулярной массы, либо с помощью полимеризации, либо связыванием с переносчиком с высокой молекулярной массой (традиционно с белком). Дендримеры, которые имеют очень четко определенную структуру и многие функциональные группы, способны связывать антигены на своей периферии, чем представляют хорошую альтернативу для производства вакцин, которые имеют точно определенные иммуногены и которые обеспечивают высокую воспроизводимость. В этой области были разработаны МАР (мультиантигенный пептид) дендримеры[57,58], которые представляют собой клинообразные конструкции, сформированные последовательными генерациями лизиновых фрагментов. Эти дендримеры содержат большое количество первичных аминогрупп, которые могут быть связаны с низкомолекулярными антигенами, в целях повышения их иммуногенности, исключая необходимость применения белков-переносчиков. МАР-структуры, которые содержат Т и В клетки, стимулирующие пептиды Plasmodium falciparum, были использованы для генерирования иммунных ответов на этих паразитов[59]. Далее, было показано, что МАР-структуры действуют через антигенпрезентирующие клетки тем же путем, что и антигены, производные из внутриклеточных структур (например, такие как вирус), приводя к сильной иммунной реакции, включая выработку цитотоксических Т-клеток[60]. Дендримеры согласно изобретению, которые на концах своих ветвей имеют фрагменты, которые содержат аминогруппы, также могут быть использованы для вакцинации либо путем связывания ими низкомолекулярных антигенов с помощью аминогрупп, находящихся в фрагментах на концах их ветвей, либо тем, что вышеназванные фрагменты, которые содержат по меньшей мере одну аминогруппу, сами по себе представляют низкомолекулярные антигены, такие как антигены пептидной природы.

МАР-структуры были также использованы для транспорта непептидных антигенов, таких как углеводы, гаптены и т.д., в плане вакцин. Углеводы, в частности, представляют собой класс молекул, важных в биологическом распознавании. Гликодендримеры, полученные прививанием изотиоцианата маннозы, сиаловой кислоты или лактозы к концевым аминогруппам РАМАМ-дендримеров или лизиновых дендримеров, были использованы как антигены для вакцин[64,65]. В гликодендримерах с ассоциированным Т-антигенным дисахаридом βGal 1-3 αGalNAc, его способность связывания лектина (белок, который связывает углеводы) была также протестирована на специфичность к галактозе[66], с намерением использовать их для детектирования опухолей, которые экспрессируют Т-антигенные рецепторы, и направлять в них лекарственные средства. Кроме того, гликодендримеры могут быть использованы для усиления аффинности к лектинам, которые связаны с углеводом. Были найдены такие гликозилированные дендримеры[67], которые могут представлять интерес для применения в качестве микробных антиадгезинов, антагонистов токсинов, или в качестве противовоспалительных, противовирусных и противораковых лекарственных средств, так как лектин-углеводные взаимодействия были описаны в многочисленных случаях в иммунной системе (в ситуациях, которые ведут к активации клетки), в вирусных и бактериальных инфекциях, в отношении раковых заболеваний и роста клеток и т.д. Короче говоря, гликозилированные дендримеры могут имитировать природные гликоконъюгаты и эффективно взаимодействовать с природными рецепторами углеводов, давая характеристические эффекты взаимодействия с ними.

В дополнение к возможности использования их свойств для применения в качестве переносчиков, еще одна область, имеющая отношение к нуклеиновым кислотам, которые в настоящее время привлекают повышенное внимание, состоит в изготовлении микрочипов, которые содержат упорядоченные наборы последовательностей ДНК или РНК. При изготовлении этих микрочипов дендримеры выступают в качестве одной из альтернатив для поверхностей со стеклянным покрытием и реализуют свою способность к взаимодействию с нуклеиновыми кислотами, чтобы фиксировать названные молекулы на поверхности микрочипов[63]. Прочность связи между последовательностями нуклеотидов и дендримерами согласно изобретению делает их пригодными для использования их способности фиксировать нуклеиновые кислоты, чтобы служить в качестве подложки для производства этих ДНК- или РНК-микрочипов.

Наконец, существует также необходимость найти альтернативные способы борьбы с различными болезнетворными микроорганизмами, нарушая их жизненный цикл, и это та область, в которой дендримеры проявили себя как интересная альтернатива. Некоторые ранее описанные дендримеры показали себя способными ингибировать инфекцию, вызванную различными вирусами, препятствуя как попаданию вируса в клетку, так и последующим стадиям репродукции вируса. Это имеет место, например, в случае с простым герпесом (Herpes Simplex), инфицирование которым ингибируется in vitro действием дендримеров, модифицированных полилизином[50,51]. Репродукция вируса иммунодефицита человека (HIV) также была достигнута как на уровне поглощения клеткой, так и на последующих стадиях, в этом случае - применением ковалентно модифицированных РАМАМ-дендримеров, которые показали, что они способны интерферировать с обратной транскриптазой и интегразой вируса[19,52]. На основе этих свойств были разработаны вагинальные гели для предотвращения болезней, переносимых половым путем, имеющие составы на базе дендримеров, как в случае VivaGelTM (Starpharma), активным ингредиентом которого является полилизиновый дендример, функционализированный нафталиндисульфонатными фрагментами, которые представляются эффективными в профилактике ВИЧ благодаря способности связывать поверхностный гликопротеин gp120 вируса. Несмотря на то, что в разработке противовирусных дендримеров существует предпочтение для таких систем, которые имеют на своей поверхности группы, имитирующие таковые, какие присутствуют на клеточной поверхности и какие, поэтому, способны конкурировать с клетками за связывание с вирусом, создан также дендример с поверхностными амидными группами, который действует как ингибитор респираторно-синцитиального вируса, как представляется, благодаря образованию водородных связей между периферическими группами дендримера и белком слияния вируса, и поэтому предполагается, что дендримеры, функционализированные другими группами, способными образовывать водородные мостики с вирусными белками, будучи вовлеченными во взаимодействие на клеточной поверхности, также способны интерферировать с различными вирусами, подавляя вызываемую ими инфекцию.

В других случаях дендримеры были использованы в качестве антибактериальных средств или для разрушения клеточных мембран некоторых грибков. Когда они создаются для этой цели, существует предпочтение для дендримеров с катионными группами на их поверхности, такими как аминные и тетраалкиламмониевые группы, которые облегчают прилипание дендримеров к бактериальной мембране, вызывая лизис бактерии. Это касается полипропилениминных (PPI) дендримеров с третичными алкиламмониевыми группами на их поверхности, которые показали распространенную бактериальную активность против как грамположительных, так и грамотрицательных бактерий[53,54]. Эти дендримеры имеют более высокую бактерицидную способность, чем другие гиперразветвленные полимеры. Дендримеры согласно изобретению, также функционализированные фрагментами, которые содержат аминогруппы, представляют вариант, который также может быть использован для разрушения клеточных мембран бактерий или грибков.

Было также сообщено, что дендримеры обладают свойствами, которые позволяют им действовать как денатуранты белков. Некоторые типы дендримеров действуют путем снижения диэлектрической постоянной и вязкости воды и разупорядочивания ее регулярной структуры в результате реорганизации молекул воды на поверхности дендримера. Это ведет к нарушению гидрофобных взаимодействий, которое весьма дестабилизирует многие третичные структуры белков, вызывая их денатурацию: это называется «хаотропным (разобщающим)» эффектом, которым обладают денатурирующие агенты, такие как мочевина или гидрохлорид гуанидина. Очень интересная область, в которой предполагается использовать эту способность денатурировать белки, представляет собой применение для растворения прионных белков, таких как PrPSc [20]. Прионные белки способны принимать патогенную структурную организацию и вызывать смертельные невропатии, называемые губчатыми энцефалопатиями (болезнь Кройцфельдта-Якоба, болезнь коровьего бешенства», скрейпи у овец и пр.). Эти белки образуют агрегаты, которые локализуются в мозгу пораженных индивидов и растворимы только в растворителях, которые содержат детергенты как хаотропные агенты (типично шестимолярный раствор гидрохлорида гуанидина). Однако эти агрегаты могут быть переведены в растворимое состояние катионными дендримерами, такими как дендримеры PPI и РАМАМ: дендримеры более высокой генерации с бульшим количеством аминогрупп на поверхности являются наиболее эффективными. Поэтому новые дендримеры согласно изобретению, также функционализированные фрагментами, которые содержат аминогруппы, представляют новые соединения, употребимые как для растворения прионных агрегатов, так и в терапии других заболеваний, в развитии которых также происходит формирование патогенных белковых агрегатов, и, например, агрегатов амилоидных белков, которые возникают при болезни Альцгеймера[55,56].

Короче говоря, дендримеры представляют собой синтетические полимеры с хорошими свойствами для их использования в биологических областях: они предсказуемо ведут себя в растворе, они могут быть в широких пределах модифицированы для несения многообразных лигандов с биологической активностью, они могут преодолевать биологические барьеры и могут быть приготовлены с минимальными структурными дефектами. Поэтому их применение исследуется в разнообразных профилактических и терапевтических стратегиях, включая использование их для транспорта различных лекарственных средств, трансфекции олигонуклеотидных или полинуклеотидных молекул, разработки вакцин, введения в качестве антибактериальных, противогрибковых, противовирусных лекарственных препаратов или даже для снятия симптомов болезней различной этиологии, развитие которых включает формирование белковых агрегатов, таких как агрегаты прионного происхождения или отложения амилоидных белков, характерные для болезни Альцгеймера. Дендримеры согласно настоящему изобретению включают интересные альтернативы для этих областей биомедицины.

ОБЩЕЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Изобретение описывает новые разветвленные карбосилановые дендримеры с концевыми фрагментами на концах их ветвей, которые содержат первичные, вторичные, третичные или четвертичные аминогруппы, которые отвечают любой из формул:

если они представляют собой первую генерацию;

если они представляют собой вторую генерацию;

если они представляют собой третью генерацию;

или соответствующим аналогичным формулам в случае более высоких генераций, в которых формула, соответствующая каждой генерации i, должна быть результатом замещения Xp в формуле, соответствующей предшествующей генерации, новым блоком типа:

,

преобразуя группу, связанную с тем же атомом кремния, что и этот замещающий блок, и переходя с обозначения (Ri-1)3-p к обозначению (Ri-1)3-z,

формулы, в которых:

Alq1, Alq2, Alq3, …, Alqi представляют алкиленовые фрагменты из 2 до 4 атомов углерода, которые выбраны независимо друг от друга согласно длине ветвей в каждой генерации;

R1, R2, R3, …, Ri-1, Ri представляют фрагменты, которые выбраны независимо друг от друга из метила и фенила;

Х представляет фрагмент, который содержит по меньшей мере одну первичную, вторичную, третичную или четвертичную аминогруппу;

р представляет собой целое число, которое варьирует между 1 и 3;

m, n, …, z представляют собой целые числа, которые варьируют независимо между 1 и 3.

В предпочтительном варианте осуществления изобретения все фрагменты R1, R2, R3, …, Ri-1, Ri являются идентичными и соответствуют метильным группам.

В еще одном предпочтительном варианте осуществления изобретения фрагменты Alq1, Alq2, Alq3, …, Alqi выбираются из этиленового и пропиленового фрагментов. В еще одном более предпочтительном варианте выполнения изобретения все вышеназванные фрагменты идентичны и соответствуют пропиленовым фрагментам.

В еще одном из предпочтительных вариантов осуществления изобретения целые числа m, n, …, z одинаковы между собой и имеют значение 2.

В наиболее предпочтительном варианте осуществления изобретения все фрагменты R1, R2, R3, …, Ri-1, Ri являются идентичными и соответствуют метильным радикалам; фрагменты Alq1, Alq2, Alq3, …, Alqi идентичны друг другу и соответствуют пропиленовым фрагментам, и целые числа m, n, …, j одинаковы между собой и имеют значение 2.

Х представляет любой фрагмент, который содержит первичную, вторичную, третичную или четвертичную аминогруппу. Среди прочих, предпочтительны те фрагменты, в которых Х представляет либо -OCH2CH2N(CH3)2, -OCH2-(C6H3)-3,5-(OCH2CH2N(CH3)2)2, либо -OCH2CH2N(CH3)CH2CH2N(CH3)2, либо группу -CH2CH2(CH2)eNH2, в которой «е» представляет собой целое число от 0 до 2, в каковом случае предпочтительнее, чтобы оно принимало значение 1. Предпочтительными вариантами выполнения изобретения также являются такие, в которых Х представляет кватернизованные формы предыдущих фрагментов -OCH2CH2N+(CH3)3I-, -OCH2-(C6H3)-3,5-(OCH2CH2N+(CH3)3I-)2, -OCH2CH2N(CH3)CH2CH2N+(CH3)3I- или -CH2CH2CH2N+H3Cl-.

Когда Х представляет -OCH2CH2N(CH3)2, -OCH2-(C6H3)-3,5-(OCH2CH2N(CH3)2)2 или -OCH2CH2N(CH3)CH2CH2N(CH3)2, или их кватернизованные формы -OCH2CH2N+(CH3)3I-, -OCH2-(C6H3)-3,5-(OCH2CH2N+(CH3)3I-)2 либо -OCH2CH2N(CH3)CH2CH2N+(CH3)3I-, то является в особенности предпочтительным, что все ветви имеют концевые фрагменты, которые содержат аминогруппы, и что индекс «р» принимает значения 1 или 2, с тем, чтобы каждая ветвь заканчивалась бы, соответственно, единичным концевым фрагментом или двумя концевыми фрагментами. Когда Х представляет -CH2CH2CH2NH2 или его кватернизованную форму -CH2CH2CH2N+H3Сl-, то является в особенности предпочтительным, что все ветви имеют концевые фрагменты, которые содержат аминогруппы, и что «р» принимает значение 1, с тем чтобы каждая ветвь завершалась бы единичным аминным фрагментом.

Объем правовой охраны изобретения также включает случаи, в которых Х представляет антигенный фрагмент, который содержит по меньшей мере одну аминогруппу. Частным случаем вышесказанного должна быть ситуация, в которой антигенный фрагмент представляет собой пептид.

Изобретение также касается способа получения вышеназванных карбосилановых дендримеров, способ, который включает стадии:

а) получение скелета карбосиланового дендримера следующими стадиями:

а1) получение базового исходного карбосиланового дендримера формулы:

Si[(CH2)aCH=CH2]4,

где “а” варьирует между 0 и 2 согласно длине, желаемой для ветвей,

введением SiCl4 в реакцию с BrMg(CH2)aCH=CH2;

a2) получение карбосиланового дендримера первой генерации, прекурсора для дендримера высшей генерации, введением базового исходного карбосиланового дендримера из стадии а1) в реакцию с HSi(R1)3-mClm, с тем чтобы получить дендример следующей формулы:

,

где m варьирует между 1 и 3, и оно эквивалентно числу ветвей, которые могут быть созданы в следующей генерации, или числу концевых функциональных групп, которыми могут быть замещены Cl-группы,

R1 представляет фенильный или метильный радикал;

а3) по выбору, получение карбосиланового дендримера второй генерации, прекурсора дендримера высшей генерации, введением производного с концевыми Si-Cl связями, полученного в стадии а2), повторно в реакции стадий а1) и а2), то есть

i) создание новых ветвей введением соответствующего производного с концевыми Si-Cl связями в реакцию с BrMg(CH2)bCH=CH2, где “b” варьирует между 0 и 2 согласно длине, желательной для этих ветвей, и может быть равным индексу «а» или отличаться от него;

ii) введение скелета карбосиланового дендримера новой генерации, полученного в стадии i), в реакцию с HSi(R2)3-nCln, где “n” варьирует между 1 и 3 и может быть равным индексу «m» предыдущей генерации или отличаться от него, и R2 представляет фенильный или метильный радикал;

а4) по выбору, получение карбосилановых дендримеров последующих генераций как прекурсоров дендримеров высших генераций введением производного с концевыми Si-Cl связями, соответствующего предшествующей генерации, в целевые реакции, с повторением стадии а3) i) с использованием реагента BrMg(CH2)сCH=CH2 и повторением стадии а3) ii) с использованием реагента HSi(R3)3-zClz, реагенты, в которых «с» варьирует между 0 и 2, и “z” варьирует между 1 и 3;

а5) получение конечного скелета карбосиланового дендримера, в который на стадии b) будут введены фрагменты, которые содержат по меньшей мере одну аминогруппу, с использованием в стадии а2), а3) или в повторении i) стадии а4), в зависимости от того, относится ли дендример к первой, второй генерации или генерации i, соответственно, реагента HSi(Ri)3-pClp, где «р» варьирует между 1 и 3, и Ri представляет фенильный или метильный радикал;

b) получение карбосиланового дендримера с концевыми фрагментами с первичными, вторичными или третичными аминогруппами, согласно одному из следующих путей:

b1) проведение алкоголиза концевых Si-Cl связей карбосиланового дендримера, полученного в стадии а5), реакцией его с первичным, вторичным или третичным аминоспиртом в присутствии избытка щелочи;

b2) полученный ранее карбосилановый дендример с концевыми Si-H связями, в который позднее будут введены фрагменты, содержащие по меньшей мере одну первичную, вторичную или третичную аминогруппу, проводится через стадии:

i) получение производного карбосиланового дендримера любой генерации с концевыми Si-H связями введением соответствующего карбосиланового дендримера с Si-Cl связями во взаимодействие с реагентом, способным передавать гидридные группы, с тем чтобы часть или все из атомов Cl были замещены атомами Н;

ii) введение карбосиланового дендримера со связями Si-H в присутствии катализатора гидросилилирования в реакцию с соединением, которое содержит первичную, вторичную или третичную аминогруппу и которое имеет на одном конце двойную углерод-углеродную связь, с тем чтобы соединение соединилось с дендримером тем концом, где находится двойная связь;

с) по выбору, получение карбосиланового дендримера с концевыми фрагментами с кватернизованными аминогруппами реакцией дендримера, полученного в стадии b), с A-Hal реагентом, в котором А представляет водород, алкил с числом атомов углерода от 1 до 10 или арил, и Hal представляет Cl, Br, I.

В предпочтительном варианте осуществления способа согласно изобретению индексы a, b, …, k, соответствующие реагентам BrMg(CH2)aCH=CH2, BrMg(CH2)bCH=CH2, …, BrMg(CH2)kCH=CH2, идентичны друг другу и имеют значение 0, для каковой цели использованный реагент представляет собой винильное производное BrMg-CH=CH2, и ветви имеют длину в 2 атома углерода.

В еще одном предпочтительном варианте выполнения способа согласно изобретению индексы a, b, …, k, соответствующие реагентам BrMg(CH2)aCH=CH2, BrMg(CH2)bCH=CH2, …, BrMg(CH2)kCH=CH2, идентичны друг другу и имеют значение 1, для каковой цели использованный реагент представляет собой аллильное производное BrMg-СН2-CH=CH2, и ветви имеют длину в 3 атома углерода.

В еще одном предпочтительном варианте выполнения способа согласно изобретению все радикалы R1, R2, …, Ri идентичны и соответствуют метильным группам.

В еще одном предпочтительном варианте осуществления изобретения индексы n, m, …, j, соответствующие реагентам общей формулы HSi(R2)3-nCln, преимущественно выбираются из 1 и 2. В отдельном варианте выполнения предыдущего случая число ветвей, сформированных в каждой генерации, всегда одинаково и равно 2, по каковой причине реагент HSi(R2)3-nCln, будучи использованным для создания прекурсора, который приводит к дендримеру новой генерации, должен быть во всех случаях HSi(R2)2Cl, преимущественно HSi(СН3)2Cl, что соответствует значению “n”, равному 1.

В наиболее предпочтительном варианте осуществления изобретения все радикалы R1, R2, …, Ri идентичны и соответствуют метильным группам, тогда как индексы a, b, …, k, соответствующие реагентам BrMg(CH2)aCH=CH2, BrMg(CH2)bCH=CH2, …, BrMg(CH2)kCH=CH2, идентичны друг другу и имеют значение 1, для каковой цели ветви карбосилановых дендримеров должны иметь длину в 3 атома углерода, и ветви, созданные в каждой новой генерации, должны быть 2, для каковой цели HSi(СН3)2Cl всегда должен быть использован для создания прекурсора новой генерации. Напротив, когда используется реагент HSi(R2)3-nCln, приводя к карбосилановому дендримеру с концевыми Si-Cl связями, из которого получается карбосилановый дендример согласно изобретению с аминогруппами в ветвях, предпочтительно, чтобы значение “n” выбиралось из 1 и 2, поэтому возможно применение HSi(СН3)2Cl и Si(СН3)Cl2 в зависимости от того, желательно ли иметь число концевых групп, присутствующих в каждой ветви, равным 1 или 2, соответственно.

В варианте осуществления изобретения аминоспирт, использованный для получения карбосилановых дендримеров согласно изобретению из соответствующих производных с концевыми Si-Cl связями, избирается среди N,N-диметилэтаноламина (CH2OH-CH2-N(CH3)2), 2-[(2-диметиламиноэтил)метил]аминоэтанола (CH2OH-CH2-N(CH3)-CH2-CH2-N(CH3)2) или 3,5-бис(диметиламиноэтокси)бензилового спирта (CH2OH-(C6H3)-(O-CH2-CH2-N(CH3)2)2). В предпочтительном варианте осуществления изобретения карбосилановый дендример с Si-Cl связями обрабатывается избранным аминоспиртом, взятым в соответствующем стехиометрическом количестве, в диэтиловом эфире и в присутствии избытка триэтиламина, с тем чтобы каждая из Si-Cl связей была преобразована в Si-O связь, в соответствие с чем последняя соединяется с фрагментом, соответствующим использованному аминоспирту. В еще одном варианте осуществления изобретения карбосилановый дендример, полученный из любого из предыдущих аминоспиртов, впоследствии кватернизуется обработкой его йодистым метилом CH3I в диэтиловом эфире.

В еще одном варианте выполнения изобретения соединение, которое содержит первичную, вторичную или третичную аминогруппу, которое имеет двойную углерод-углеродную связь на одном конце и которое вводится в реакцию с карбосилановым дендримером с Si-H связями, представляет собой первичный алкиленамин формулы CH2=CH-(CH2)e-NH2, где индекс «е» варьирует между 0 и 2. В предпочтительном варианте выполнения изобретения первичным алкиленамином является такой, в котором индекс «е» имеет значение 1, то есть аллиламин, CH2=CH-CH2-NH2. В еще одном варианте осуществления изобретения карбосилановый дендример с концевыми фрагментами -СH2-СH2-СH2-NH2, полученный реакцией с аллиламином, кватернизуется добавлением HCl в диэтиловом эфире.

В еще одном варианте осуществления изобретения соединение, которое содержит первичную, вторичную или третичную аминогруппу, которое имеет двойную углерод-углеродную связь на одном конце и которое вводится в реакцию с карбосилановым дендримером с Si-H связями, представляет собой соединение, которое включает алкенильный фрагмент на одном конце (CH2=CH-(CH2)e-, где «е» варьирует опять между 0 и 2, и аминогруппу (первичную, вторичную или третичную) на другом отличном конце, соединение дополнительно включает радикал -Ra- между алкинильным фрагментом CH2=CH-(CH2)e и аминогруппой. В предпочтительном варианте осуществления такового использованное соединение представляет собой 4-аллил-2-метокси-1-(N,N-диметиламиноэтокси)бензол, (CH2=CH-CH2)C6H3(OMe){O(CH2)2NMe2}.

В предпочтительных вариантах осуществления способа согласно изобретению карбосилановые дендримеры с Si-H связями на их концах, с которыми реагируют соединения, которые содержат по меньшей мере одну первичную, вторичную или третичную аминогруппу и которые имеют двойную углерод-углеродную связь на одном конце, получаются в стадии b2)i) с использованием LiAlH4 в качестве реагента, способного передавать гидридные группы, которые позволяют преобразовать часть или все из Si-Cl связей в Si-H связи, хотя применение аналогичных реагентов включено в рамки способа согласно изобретению, среди которых могут быть названы NaH или NaBH4. В вышеназванных предпочтительных вариантах осуществления связывание соединений, которые содержат по меньшей мере одну первичную, вторичную или третичную аминогруппу на конце, в которых они имеют двойную углерод-углеродную связь, проводится с использованием катализатора Карштедта[28] для катализирования реакции, хотя в рамки способа согласно изобретению включено применение других катализаторов гидросилилирования, которые позволяют провести желаемое связывание, таких как катализатор Спирса[61,62].

В еще одном дополнительном аспекте изобретение касается фармацевтических композиций, которые содержат карбосилановые дендримеры согласно изобретению. В варианте выполнения изобретения композиция содержит по меньшей мере один карбосилановый дендример согласно изобретению вместе с по меньшей мере одной другой молекулой, анионной или полианионной. В отдельном варианте осуществления предыдущего случая полианионная молекула представляет собой олигодезоксирибонуклеотид (ODN) или двухспиральную молекулу ДНК. В еще одном конкретном варианте осуществления предыдущего случая полианионная молекула представляет собой молекулу РНК, одноцепочечную или двухцепочечную, которая предпочтительно содержит комплементарные участки, ассоциированные между собой, которые позволяют использование названной РНК в качестве интерференционной РНК (RNAi). В дальнейшем варианте выполнения анионная молекула представляет собой лекарственное средство с тенденцией к ассоциации с белками плазмы или клеточными мембранами, которое находится в контакте с ними или чувствительно к деградации любым из этих белков.

В варианте реализации, отличном от предыдущего, карбосилановый дендример представлен в изобретении как активная субстанция со способностью нарушать жизненный цикл патогенных микроорганизмов. В отдельном варианте выполнения такового патогеном является вирус, который может быть вирусом ВИЧ. В еще одном конкретном варианте осуществления патогенный микроорганизм представляет собой бактерию или грибок, клеточная стенка или мембрана которых чувствительна к изменениям при действии названного дендримера.

В еще одном дополнительном варианте осуществления карбосилановый дендример представлен в изобретении как активная субстанция со способностью нарушать формирование или облегчать растворение белковых агрегатов, возникающих при развитии патологических способов, таких как энцефалопатии, вызываемые прионами, или дегенеративных способов, таких как болезнь Альцгеймера.

В дальнейшем варианте выполнения, отличном от предшествующих, карбосилановый дендример согласно изобретению представлен в фармацевтической композиции связанным в ней с пептидом или любой антигенной частицей и предназначен для индуцирования иммунного ответа, который предохраняет или защищает индивида, которому он введен, против заболевания, вызываемого организмом, в котором присутствуют названные пептид или антигенная частица.

Дендримеры согласно изобретению и композиции, которые содержат их, могут быть введены обычными путями введения, лекарственным электрофорезом, трансдермальным путем, инъекцией или ингаляцией. Они также пригодны для формирования пленок для покрытия протезных конструкций или каркаса стентов с тем, чтобы из них производилось контролируемое высвобождение по меньшей мере одного дендримера согласно изобретению или по меньшей мере одной субстанции, присутствующей в той же композиции, как и названный дендример.

В еще одном аспекте изобретения карбосилановые дендримеры используются для фиксации молекул анионного или полианионного характера на поверхностях. В варианте осуществления изобретения молекулы могут представлять собой последовательности нуклеиновых кислот, и поверхности, на каковых они фиксируются, являются подложками, используемыми для микрочипов, на которых фиксируются последовательности нуклеотидов.

В дальнейшем дополнительном аспекте изобретение касается применения карбосилановых дендримеров согласно изобретению в качестве переносчиков для транспорта анионных субстанций в крови, которые защищают названные субстанции от их взаимодействия с белками плазмы или с клеточными мембранами, с которыми они контактируют, и которые способны связывать названные анионные субстанции или разрушать их. Конкретным случаем такого может быть ситуация, когда субстанция с анионным характером при значении рН крови является лекарственным средством.

В дальнейшем дополнительном аспекте изобретение касается применения карбосилановых дендримеров согласно изобретению в качестве лекарственных средств для ослабления или устранения симптомов болезни, вызываемой микроорганизмом, жизненный цикл которого способен нарушать дендример согласно изобретению.

В еще одном дополнительном аспекте изобретение касается применения карбосилановыых дендримеров согласно изобретению в качестве трансфекционных переносчиков молекул анионного или полианионного характера, с которыми они связаны. В конкретном таком случае может быть ситуация, когда полианионная молекула представляет собой олигодезоксирибонуклеотид (ODN) или молекулу РНК, одноцепочечную или двухцепочечную, которая преимущественно содержит комплементарные участки, ассоциированные между собой, которые позволяют использовать названную РНК в качестве интерференционной РНК (RHAi). В особенности предпочтительно, что клетки для трансфекции представляют собой клетки нервной системы или производные из них клеточные линии.

Изобретение теперь описывается более подробно с привлечением нижеприведенных фигур и примеров, представленных в разделе подробного описания изобретения.

Краткое описание фигур

Фиг. 1 показывает структуру некоторых карбосилановых дендримеров согласно изобретению с некватернизованными аминными группами, таковые синтезированы в примерах 7, 11, 2, 5 на фиг. 1а и таковые синтезированы в примерах 13 и 14 на фиг. 1b.

Фиг. 2 показывает структуру некоторых карбосилановых дендримеров согласно изобретению с кватернизованными аминными группами, таковые синтезированы в примерах 22, 26, 19 и 27 на фиг. 2а и таковые синтезированы в примерах 28 и 29 на фиг. 2b.

Фиг. 3 показывает картины гель-электрофореза для формирования комплекса между ODN и дендримером IM8 (с GF в геле а) и с различными ODN в геле b), ClNH4 (с), NN и Phe (d) и IM16 (гель е, который также содержит образцы IM8).

Фиг. 4 показывает картины гель-электрофореза комплексов, образуемых между ODN и дендримерами Phe, ClNH4 (гель А), NN (гель В) и IM8 и IM16 (гель С) при различных значениях рН.

Фиг. 5 показывает развитие дендримерных комплексов согласно изобретению и ODN РРТ (дендриплекс олигонуклеотида с фосфоротиоатом) при выдерживании в водном растворе в течение 0, 6 или 24 часов.

Фиг. 6 показывает картину гель-электрофореза образцов дендримерных комплексов и ODN TAR (N,N,N,N-тетраметил-D-тартарамид) в присутствии альбумина и SDS (додецилсульфонат натрия). Левая часть представляет собой пятно белков с красителем Paragon Blue, и правая часть представляет собой фотографию пятна образцов ДНК с красителем бромид этидия.

Фиг. 7 показывает развитие образцов дендримеров согласно изобретению и ODN при инкубировании в присутствии полной среды в течение 40 минут (40 мин), 4 часов (4Н) и 17 часов (17Н).

Фиг. 8 показывает картину гель-электрофореза образцов дендримеров и ODN в присутствии человеческой сыворотки. Левая часть показывает фотографию, полученную в ультрафиолетовом свете на образцах ДНК, и правая часть показывает пятно белков в геле с красителем Paragon Blue.

Фиг. 9а показывает картины гель-электрофореза, проявленные красителем бромид этидия, соответственно смесям дендримеров и ODN после 0 часов (0Н), 4 часов (4Н) и 24 часов (24Н).

Фиг. 9b показывает пятно белка в геле соответственно 4 часам, проявление которого красителем бромид этидия показано на фиг. 9а.

Фиг. 10 показывает картину гель-электрофореза образцов комплексов между плазмидой Nf-kappaB-luc и дендримером IM8.

Фиг. 11 показывает картину гель-электрофореза для испытаний образования комплекса между RNAi и дендримером (IM8) согласно изобретению.

Фиг. 12 показывает график с результатами митохондриальной активности для концентраций 1, 5, 10, 20 и 100 мкМ (μМ) после инкубации клеток с дендримерами IM8, IM16, ClNH4, NN, Phe и SF, которые имеют соответствующий им столбец для каждой концентрации, указанной в нижней части, в порядке вышеприведенного перечисления.

Фиг. 13 показывает график с результатами выделения гемоглобина после инкубации эритроцитов с дендримерами IM8, IM16, NN, Phe и s, при концентрациях 1, 5, 10 и 20 мкМ (μМ). Каждый столбец соответствует дендримеру, размещенному в порядке вышеприведенного перечисления, и каждая группа столбцов отвечает концентрации, показанной в порядке повышения.

Фиг. 14 показывает график с процентной долей летальности клеток, инкубированных с различными дендриплексами и дендримерами согласно изобретению и проявленных красителем трипановый голубой.

Фиг. 15 показывает результаты проточного цитометрического анализа, в которой процентные доли клеток сравниваются по размеру и сложности соответственно клеткам в состоянии апоптоза-некроза с живыми клетками. Ось Х представляет размер, и ось Y - сложность, размытое пятно из темных клеток отвечает клеткам в состоянии апоптоза-некроза. Часть А соответствует PMBC-клеткам (периферийные кровяные мононуклеарные клетки), обработанным CBS-дендримерами (карбосилановыми), и часть В отвечает PMBC-клеткам, обработанным дендримерами РАМАМ-типа.

Фиг. 16 показывает изображение процентных долей живых клеток и клеток в апоптозе, полученное после проточного цитометрического анализа PMBC-клеток, обработанных CBS-дендримерами (А) или обработанных дендримерами РАМАМ-типа (В).

Фиг. 17 показывает пятна клеток, окрашенных красителем для живых клеток DAPI, инкубированных с: 1: контроль; 2: ODN + IM8; 3: ODN + IM16; 4: ODN + SF; 5: ODN; 6: IM8; 7: IM16; 8: SF.

Фиг. 18 показывает фотографии, снятые после 72 часов инкубации клеток с IM8-ODN, через 0, 30, 60, 90, 120 и 150 секунд.

Фиг. 19 показывает график с результатами, полученными в сцинтилляционном счетчике в лимфопролиферативном тесте, при стимулировании клеток различными CBS-дендримерами, РНА (полигидроксиалканоатом, ПГА) и с контролем (С).

Фиг. 20 показывает клеточную локализацию ODN, которым были подвергнуты трансфекции РВМС, после: А: 1 часа; В: 3 часов; С: 24 часов.

Фиг. 21 показывает анализ флуоресценции в клетках, которые были подвергнуты трансфекции ODN. Фиг. 21а показывает в ординатах значения флуоресценции, полученные в каждой точке на протяжении линии, которая представляет усредненное сечение по XY, верхний график соответствует голубой флуоресценции, средний отвечает зеленой, и нижний - красной. Фиг. 21B показывает подобный анализ флуоресценции, снятый в зоне интереса (ROI), очерчивающей ядро, где анализируются голубая флуоресценция (верхний график) и зеленая флуоресценция (нижний график).

Фиг. 22 показывает картину флуоресценции, полученную после трансфекции фосфотиоатом (РРТ) или дендриплексами согласно изобретению. 1: Контроль; 2: РРТ; 3: РРТ + IM8; 4: РРТ + NN; 5: РРТ + Phe; 6: РРТ + IM16.

Фиг. 23 показывает картину флуоресценции, полученную после трансфекции дендриплексом ClNH4 и РРТ.

Фиг. 24 показывает гистограмму флуоресценции в срединной плоскости XY клетки, обработанной РРТ + NN, где верхний график показывает в ординатах интенсивность зеленой флуоресценции, которая обнаруживается по всей плоскости, средний график представляет аналогичный анализ, соответствующий красной флуоресценции, и нижний график показывает аналогичный анализ, соответствующий голубой флуоресценции.

Фиг. 25 показывает график, полученный расчетом числа копий ДНК вируса ВИЧ в соответствии с количеством клеток, при различных концентрациях NN-дендримера до и после инфицирования.

Фиг. 26а показывает картину полос, полученную при воздействии микромолярных концентраций (μМ) NN-дендримера, которые показаны на дорожках электрофореза в акриламид/бисакриламиде.

Фиг. 26b показывает картину полос, полученную при электрофорезе образцов NN-дендримера, инкубированных без лекарственного средства (Ctrl), или образцов названного дендримера, инкубированных с метотрексатом в соотношении «дендример/молекулы лекарственного средства» 1/8 (дорожки маркированы как «1»), 1/4 (дорожки маркированы как «2»), 1/2 (дорожки маркированы как «3») или 1/1 (дорожки маркированы как «4»).

Фиг. 26с показывает картину полос, полученную при электрофорезе образцов NN-дендримера, инкубированных без лекарственного средства (Ctrl), или образцов названного дендримера, инкубированных с различными единицами гепарина: 10U (дорожки маркированы как «1»), 1U (дорожки маркированы как «2»), 0,5U (дорожки маркированы как «3») или 0,1U (дорожки маркированы как «4»).

Фиг. 26d показывает картину полос, полученную при электрофорезе образцов NN-дендримера, инкубированных без лекарственного средства (Ctrl), или образцов названного дендримера, инкубированных с инсулином в соотношении «дендример/молекулы лекарственного средства» 1/3 (дорожки маркированы как «1»), 1/1,5 (дорожки маркированы как «2»), 4/1 (дорожки маркированы как «3») или 10/1 (дорожки маркированы как «4»).

Фиг. 27а показывает картину полос, полученную при воздействии микромолярных концентраций (μМ) NN16-дендримера, которые показаны на дорожках электрофореза в акриламид/бисакриламидном геле.

Фиг. 27b показывает картину полос, полученную при электрофорезе образцов NN16-дендримера, инкубированных без лекарственного средства (Ctrl), или образцов названного дендримера, инкубированных с метотрексатом в соотношении «дендример/молекулы лекарственного средства» 1/16 (дорожки маркированы как «1»), 1/8 (дорожки маркированы как «2»), 1/4 (дорожки маркированы как «3») или 1/2 (дорожки маркированы как «4»).

Фиг. 27с показывает картину полос, полученную при электрофорезе образцов NN16-дендримера, инкубированных без лекарственного средства (Ctrl), или образцов названного дендримера, инкубированных с различными единицами гепарина: 10U (дорожки маркированы как «1»), 1U (дорожки маркированы как «2»), 0,5U (дорожки маркированы как «3») или 0,1U (дорожки маркированы как «4»).

Фиг. 27d показывает картину полос, полученную при электрофорезе образцов NN16-дендримера, инкубированных без лекарственного средства (Ctrl), или образцов названного дендримера, инкубированных с инсулином в соотношении «дендример/молекулы лекарственного средства» 1/3 (дорожки маркированы как «1»), 1/1,5 (дорожки маркированы как «2»), 4/1 (дорожки маркированы как «3») или 10/1 (дорожки маркированы как «4»).

Фиг. 28а показывает картину полос, полученную при воздействии микромолярных концентраций (μМ) IM16-дендримера, которые показаны на дорожках электрофореза в акриламид/бисакриламидном геле.

Фиг. 28b показывает картину полос, полученную при электрофорезе образцов IM16-дендримера, инкубированных без лекарственного средства (Ctrl), или образцов названного дендримера, инкубированных с метотрексатом в соотношении «дендример/молекулы лекарственного средства» 1/16 (дорожки маркированы как «1»), 1/8 (дорожки маркированы как «2»), 1/4 (дорожки маркированы как «3») или 1/2 (дорожки маркированы как «4»).

Фиг. 28с показывает картину полос, полученную при электрофорезе образцов IM16-дендримера, инкубированных без лекарственного средства (Ctrl), или образцов названного дендримера, инкубированных с различными единицами гепарина: 10U (дорожки маркированы как «1»), 1U (дорожки маркированы как «2»), 0,5U (дорожки маркированы как «3») или 0,1U (дорожки маркированы как «4»).

Фиг. 28d показывает картину полос, полученную при электрофорезе образцов IM16-дендримера, инкубированных без лекарственного средства (Ctrl), или образцов названного дендримера, инкубированных с инсулином в соотношении «дендример/молекулы лекарственного средства» 1/3 (дорожки маркированы как «1»), 1/1,5 (дорожки маркированы как «2»), 4/1 (дорожки маркированы как «3») или 10/1 (дорожки маркированы как «4»).

Фиг. 29 показывает картину полос, полученную при электрофорезе образцов IM16-дендримера, инкубированных без лекарственного средства (дорожки маркированы как «D») или инкубированных с инсулином (дорожки маркированы как «C»), где величина рН приведена в цифровом значении, показанном на дорожках. Каждая из двух фотографий, которые представлены в чертеже, справа и слева, соответствует различному гелю, полученному в одних и тех же условиях электрофореза.

Фиг. 30 показывает графики из полос, в которых, в ординатах, показано значение фактора пролиферации, с указанием контрольного образца («С-«), полученных инкубированием U87-MG клеток (верхний график, маркированный как «А») или SK-N-MC клеток (нижний график, маркированный как «В»), с соединениями, которые обозначены под каждой полосой, при указанных концентрациях. С-: негативный контроль, соответствующий образцам, инкубированным только с культуральной средой, без добавленных соединений.

Фиг. 31 показывает графики из полос, в которых, в ординатах, показано значение показателя жизнеспособности, рассчитанного в виде процентной доли относительно таковой для контроля («С-«), полученных при выполнении испытаний с МТТ в U87-MG клетках, инкубированных с соединениями, которые обозначены под полосами, при указанных концентрациях и объемах, в течение периодов 24 часов (24Н) (верхний график, маркированный как «А»), 3 суток (3D) (средний график, маркированный как «В»), или 7 суток (7D) (нижний график, маркированный как «С»). Dextr: декстран; Spfect: Superfect.

Фиг. 32 показывает график из полос, в которых, в ординатах, показано значение показателя цитотоксичности, выраженного в виде процентной доли относительно таковой для контроля («С-«), полученных после количественного анализа лактатдегидрогеназы (LDH) в надосадочной жидкости клеточной культуры U87-MG, инкубированных в течение 24 часов (24Н) с соединениями, обозначенными под полосами, при указанных концентрациях и объемах. Dextr: декстран; Spfect: Superfect. DMEM: значение, соответствующее культуральной среде без клеток.

Фиг. 33 показывает график из полос, в которых, в ординатах, показано значение процентной доли относительно контроля («С») соответственно результатам, полученным при выполнении испытаний с МТТ (верхний график, маркированный как «А») или количественного анализа лактатдегидрогеназы (LDH) в супернатанте культуры (нижний график, маркированный как «В») в клетках SK-N-MC, инкубированных в течение 24 часов (24Н) с соединениями, которые обозначены под полосами, при указанных концентрациях и объемах. Dextr: декстран; Spfect: Superfect. DMEM: значение, соответствующее культуральной среде без клеток

Фиг. 34а показывает графики, полученные в проточном цитометре при анализе клеток U87-MG, инкубированных с антисмысловым (anti-rev) олигонуклеотидом, маркированным флуоресцеином (Oligo-FITC) в отсутствие дендримера (график, маркированный как «Ctrl», контроль), или комплексами, образованными между олигонуклеотидом и NN-дендримером в пропорциях, которые приводят к соотношениям «отрицательный заряд/положительный заряд», обозначенным на каждом графике: 1:1, 1:2, 1:4 и 1:8.

Фиг. 34b показывает графики, полученные в проточном цитометре при анализе клеток U87-MG, инкубированных с антисмысловым (anti-rev) олигонуклеотидом, маркированным флуоресцеином (Oligo-FITC) в отсутствие дендримера (график, маркированный как «Ctrl», контроль), или комплексами, образованными между олигонуклеотидом и NN16-дендримером в пропорциях, которые приводят к соотношениям «отрицательный заряд/положительный заряд», обозначенным на каждом графике: 1:1, 1:2, 1:4 и 1:8.

Фиг. 35 показывает графики, полученные в проточном цитометре при анализе клеток SK-N-MC, инкубированных с антисмысловым (anti-rev) олигонуклеотидом, маркированным флуоресцеином (Oligo-FITC) в отсутствие дендримера (график, маркированный как «Ctrl», контроль), или с комплексами, образованными между олигонуклеотидом и NN16-дендримером в пропорциях, которые приводят к соотношениям «отрицательный заряд/положительный заряд», обозначенным на каждом графике: 1:1, 1:2, 1:4 и 1:8.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Изобретение описывает новые разветвленные карбосилановые дендримеры с первичными, вторичными, третичными или четвертичными аминогруппами, которые отвечают формулам:

в случае таковых первой генерации;

в случае таковых второй генерации;

в случае таковых третьей генерации;

или соответствующим аналогичным формулам в случае более высоких генераций, в которых формула, соответствующая каждой генерации i, должна быть результатом замещения Xp в формуле, соответствующей предшествующей генерации, новым блоком типа:

,

переводя группу, связанную с тем же атомом кремния, что и этот замещающий блок, с обозначения (Ri-1)3-p к обозначению (Ri-1)3-z,

формулы, в которых:

Alq1, Alq2, Alq3, …, Alqi представляют алкиленовые фрагменты из 2 до 4 атомов углерода, которые выбраны независимо друг от друга согласно длине ветвей в каждой генерации;

R1, R2, R3, …, Ri-1, Ri представляют метильную и фенильную группы;

Х представляет фрагмент, который содержит по меньшей мере одну первичную, вторичную, третичную или четвертичную аминогруппу;

р представляет собой целое число, которое варьирует между 1 и 3;

m, n, …, z представляют собой целые числа, которые варьируют независимо между 1 и 3.

В наиболее предпочтительном варианте осуществления изобретения все фрагменты R1, R2, R3, …, Ri-1, Ri идентичны и соответствуют метильным радикалам; фрагменты Alq1, Alq2, Alq3, …, Alqi идентичны друг другу и соответствуют пропиленовым фрагментам, и целые числа m, n, …,j идентичны друг другу и имеют значение 2. В этих условиях дендримеры, которые соответствуют этому варианту выполнения изобретения, также могут быть представлены общей формулой iG-(X p ) m, где i: обозначает номер генерации дендримера;

X: указывает природу функциональных групп, присутствующих на периферии дендримера;

p: обозначает число функциональных групп в каждой ветви;

m: обозначает число концевых функциональных групп в дендримере;

G: представляет скелет карбосиланового дендримера, который, согласно генерации, должен соответствовать следующим формулам:

скелеты, где заключительные концы SiMe3 (Me=CH3) должны быть преобразованы в SiMe2X в общей формуле дендримера в случае, если «р» равно 1, и в SiMeX2 в случае, если «р» равно 2.

Х представляет фрагмент, который содержит первичную, вторичную, третичную или четвертичную аминогруппу.

Как использовано в изобретении, термин дендример касается трехмерной макромолекулы с древовидной конструкцией.

Термин «генерация» касается числа повторяющихся стадий, которые необходимы для получения дендримера.

Термин «карбосилановый дендример» касается древовидной молекулы с карбосилановым скелетом.

Термин «гидросилилирование» касается присоединения связей Si-H к двойным С=С связям.

Как употребляется в изобретении, термин «антигенная частица» касается частицы, которая связана с молекулой и которая способна индуцировать иммунный ответ у индивида, которому введена молекула, которая содержит связанную частицу.

Как употребляется в изобретении, термин «пептид» касается линейной цепи из двух или более аминокислот, которые связываются при формировании связи амидного типа между карбоксильной группой аминокислоты и аминогруппой соседней аминокислоты.

Как указано ранее, изобретение также касается способа получения дендримеров согласно изобретению. Эти кремнийорганические дендримеры различных генераций могут быть приготовлены с высокими выходами с использованием общеизвестных реакций, в дивергентных способах[25,42,43,44,45,46,]. Эти дендримеры чрезвычайно многосторонни, что дает им преимущества перед прочими производными: i) возможно модифицировать длину ветвей с использованием винильных или аллильных реагентов Гриньяра в стадии метатезиса; ii) возможно варьировать число ветвей в каждой генерации, заменяя, например, HSiCl3 на HSiCH3Cl2; iii) возможно внедрять огромное разнообразие функциональных групп на периферию дендримера. Более того, карбосилановые дендримеры отличаются огромной химической инертностью, что очень полезно для дополнительной цели этого изобретения при использовании их как переносчиков для транспорта анионных молекул (таких как ODN и различные анионные лекарственные средства) в крови, их защиты от взаимодействий с белками плазмы и их поглощения клеткой для выполнения своей функции.

Как было отмечено, в предпочтительном варианте выполнения изобретения все ветви различных генераций одинаковы и являются результатом применения аллильного производного BrMg-CH2-CH=CH2, пока ветви, созданные в каждой генерации, также те же самые во всех случаях и равны 2 при использовании HSiCH3Cl2. В тех условиях способ дивергентного синтеза, использованного для генерирования различных карбосилановых дендримеров, может быть схематизирован вплоть до второй генерации в следующем пути

Как только получен скелет, соответствующий прекурсору дендримера желаемой генерации, могут быть приготовлены производные с концевыми связями Si-Cl или Si-H, из которых формируются карбосилановые дендримеры с концевыми фрагментами, которые содержат аминогруппы согласно изобретению. Более подробно способ изложен ниже.

Получение карбосилановых дендримеров с концевыми аминогруппами

Первая стадия в синтезе этих производных состоит в получении дендримерных прекурсоров, которые содержат концевые связи Si-Cl или Si-H. Синтез этих дендримеров уже был описан в литературе[25,42,43,44,45,46,] и проводится с высокими выходами. В приведенных ниже примерах в настоящем подробном изложении, дендримеры наращиваются до третьей генерации, но методология получения дендримеров высших генераций аналогична, для каковой цели названные дендримеры высших генераций и их получение также включены в рамки изобретения.

В случае предпочтительного варианта выполнения изобретения, в котором ветви каждой генерации имеют одинаковый размер и соответствуют трехуглеродным цепям и в котором новые ветви формируются в каждой генерации, оставляя метил связанным с Si атомом в четвертой валентности, которая должна быть оставлена для насыщения, реакционная схема, которая должна вести к образованию различных прекурсоров карбосилановых дендримеров с концевыми связями Si-Cl или Si-H, должна быть представлена Схемой 1:

Схема 1

Вторая стадия состоит в присоединении различных аминогрупп к поверхности этих дендримеров с использованием известной реакционной способности связей Si-Cl или Si-H. С этой целью можно следовать двумя альтернативными маршрутами, в зависимости от природы концевых групп, присутствующих в карбосилановом дендримере.

1. Путь алкоголиза связей Si-Cl

Этот способ использует различные аминоспирты в присутствии основания, такого как триэтиламин, добавляемого для удаления хлороводорода, который выделяется в этой реакции. Термин «аминоспирт» касается различных аминов, которые содержат спиртовую функциональную группу, подобно примерам, описанным нижеприведенными формулами:

N,N-диметилэтаноламин 2-[2-(диметиламиноэтил)метил]аминоэтанол
3,5-бис(Диметиламиноэтокси)бензиловый спирт

В настоящем изобретении применение этих трех аминов предпочтительно, но способ согласно изобретению позволяет функционализировать периферию дендримера любыми другими аминами, которые имеют спиртовую функциональную группу, восприимчивую к условиям описанного здесь способа алкоголиза, функционализация любым из этих аминов и полученные карбосилановые дендримеры с аминными функциями также включены в рамки изобретения.

Обработка карбосилановых дендримеров, которые содержат концевые связи Si-Cl, стехиометрическим количеством N,N-диметилэтаноламина в диэтиловом эфире и в присутствии избытка триэтиламина ведет к формированию карбосилановых дендримеров с концевыми аминогруппами. В обобщенном виде эта стадия воспроизведена в Схеме 2.

Схема 2

Применение этой реакционной схемы приводит к соединениям 1G-[Si(OCH2CH2NMe2)]4 (1), 1G-[Si(OCH2CH2NMe2)2]4 (2), 2G-[Si(OCH2CH2NMe2)]8 (3), 2G-[Si(OCH2CH2NMe2)2]8 (4), 3G-[Si(OCH2CH2NMe2)]16 (5), 3G-[Si(OCH2CH2NMe2)2]16 (6), способ синтеза которых объясняется более подробно в примерах 1-6, которые описаны ниже.

Замена N,N-диметилэтаноламина другими производными аминоспиртов, такими как 3,5-(OCH2CH2NМe2)2-(C6H3)CH2OH или Me2NCH2CH2N(Me)CH2CH2OH, ведет к реакциям, подобным описанным выше, для получения дендримеров. Эта реакция воспроизведена в Схеме 3:

Схема 3

Применение этой реакционной схемы приводит к соединениям 1G-[Si(OCH2-(C6H3)-3,5-(OCH2CH2NMe2)2]4 (7), 2G-[Si(OCH2-(C6H3)-3,5-(OCH2CH2NMe2)2]8 (8), 3G-[Si(OCH2-(C6H3)-3,5-(OCH2CH2NMe2)2]16 (9), 1G-[Si(OCH2CH2N(Me)CH2CH2NMe2)]4 (10), 2G-[Si(OCH2CH2N(Me)CH2CH2NMe2)]8 (11), 3G-[Si(OCH2CH2N(Me)CH2CH2NMe2)]16 (12), способ синтеза которых объясняется более подробно в примерах 1-6, которые описаны ниже.

Кватернизация йодистым метилом MeI

Попытки кватернизовать концевые аминогруппы дендримеров 1-12 стехиометрическим количеством или небольшим избытком HCl не привели к ожидаемому результату ввиду постепенного гидролиза связей Si-O. Однако обработка этих дендримеров избытком MeI в диэтиловом эфире приводит к количественной кватернизации аминогрупп за несколько часов, вызывая выпадение осадка йодных солей аммониевых катионов в виде белых гигроскопичных твердых веществ с высокими выходами. Эта реакция представлена в Схеме 4.

Схема 4

Этим путем были выделены и охарактеризованы перечисленные ниже дендримеры: 1G-[Si(OCH2CH2NMe3+I-)]4 (16), 1G-[Si(OCH2CH2NMe3+I-)2]4 (17), 2G-[Si(OCH2CH2NMe3+I-)]8 (18), 2G-[Si(OCH2CH2NMe3+I-)2]8 (19), 3G-[Si(OCH2CH2NMe3+I-)]16 (20), 3G-[Si(OCH2CH2NMe3+I-)2]16 (21), 1G-[Si(OCH2-(С6Н3)-3,5-(ОСН2СН2NMe3+I-)2)]4 (22), 2G-[Si(OCH2-(C6H3)-3,5-(OCH2CH2NMe3+I-)2)]8 (23), 3G-[Si(OCH2-(С6Н2)C6H3)-3,5-(OCH2CH2NMe3+I-)2)]16 (24), 1G-[Si(OCH2CH2N(Me)CH2CH2NMe3+I-)]4 (25), 2G-[Si(OCH2CH2N(Me)CH2CH2NMe3+I-)]8 (26), 3G-[Si(OCH2CH2N(Me)CH2CH2NMe3+I-)]16 (27).

Их синтезы и метод охарактеризования подробно показаны ниже в примерах 16-27, которые описаны позже. Подробности, приведенные здесь, показывают, что кватернизация диметиламиногрупп проходит не полностью для некоторых из дендримеров третьей генерации, конкретно 21, 24 и 27: только около 90% концевых групп этих комплексов были кватернизованы. Это имеет место даже в присутствии избытка MeI и обусловливает гораздо большую длительность реакции.

В случае дендримеров 10 и 11 первой и второй генераций, соответственно, добавление избытка MeI до стехиометрического количества, необходимого для кватернизации всех атомов азота, присутствующих в макромолекулах, ведет к образованию дендримеров 35 (1G-[Si(O(CH2)2N+(Me)2(CH2)2NMe3+2I-)]4 и 36 (2G-[Si(O(CH2)2N+(Me)2(CH2)2NMe3+2I-)]8), синтез и метод охарактеризования которых описаны, соответственно, в примерах 48 и 49.

2. Путь гидросилилирования концевых связей Si-H

Обработка карбосилановых дендримеров, которые содержат концевые связи Si-H, аллиламином (CH2=CH-CH2-NH2) в присутствии катализатора Карштедта[28] ведет к образованию карбосилановых дендримеров с концевыми аминогруппами 1G-[SiCH2CH2CH2NH2]4 (13), 2G-[SiCH2CH2CH2NH2]8 (14), 3G-[SiCH2CH2CH2NH2]16 (15) с практически количественными выходами. Реакция, которой они получаются, показана в Схеме 5.

Схема 5

Эти дендримеры термически стабильны и растворимы в органических растворителях. Их структура и чистота были подтверждены элементным анализом (H, C, N), ЯМР-спектроскопией (1H, 13C и 29Si) и масс-спектрометрией (электроспрей или метод MALDI-TOF MS). Их синтез и охарактеризование подробно показаны в примерах 13-15, которые описаны ниже.

Этот способ также применим для синтеза карбосилановых дендримеров, которые имеют другие различные концевые фрагменты на концах своих ветвей, которые также содержат аминогруппы, заменяя аллиламин в реакции другим соединением, которое содержит аминогруппу и которое также содержит концевой атом углерода, который составляет двойную связь с соседним атомом углерода, с тем чтобы один из концов названного соединения имел концевой фрагмент CH2=CH-, который ведет к соединению, связанному со скелетом дендримера группой -СН2-. Названное соединение может быть просто алкиленамином, например, первичным с формулой CH2=CH-(CH2)e-NH2, в которой индекс «е» варьирует между 0 и 2 (соответственно случай, в котором е=1, отвечает аллиламину), или более сложными соединениями, которые также включают алкенильный фрагмент на одном конце (СН2=СН-(СН2)е-) и аминогруппу (первичную, вторичную, третичную или четвертичную) на другом ином конце, соединение дополнительно включает фрагмент -Ra- между алкенильным фрагментом СН2=СН-(СН2)е- и аминогруппой. Примеры 44 и 45 детализируют синтез и охарактеризование дендримеров 31 (1G-[Si((CH2)2С6H3(OМe)(O(CH2)2NMe2))]4) и 32 (2G-[Si((CH2)2С6H3(OМe)(O(CH2)2NMe2))]8), которые содержат на концах своих ветвей фрагменты, производные из одного из названных соединений, в особенности некоммерческий продукт (СН2=CH-СН26H3(OМe){O(CH2)2NMe2}, предварительный синтез которого описан в примере 44.

Кватернизация хлороводородом HCl

Кватернизация дендримеров с концевыми -NH2 группами, 13-15, может быть выполнена добавлением HCl (1М раствор в Et2O) в диэтиловом эфире в качестве растворителя (Схема 6).

Схема 6

Ионные производные 1G-[SiCH2CH2CH2NH3+Cl-]4 (28), 2G-[SiCH2CH2CH2NH3+Cl-]8 (29), 3G-[SiCH2CH2CH2NH3+Cl-]16 (30) были получены согласно реакции, показанной в Схеме 6. Названные соединения выпадают в осадок в виде белых твердых веществ и легко очищаются путем испарения в вакууме растворителя и избыточного HCl, использованных в реакции.

Эти дендримеры термически стабильны и растворимы в ДМСО, МеОН и Н2О. Их строение и чистота были подтверждены, как для вышеописанных дендримеров, элементным анализом (H, C, N), ЯМР-спектроскопией (1H, 13C и 29Si) и масс-спектрометрией (электроспрей или метод MALDI-TOF MS).

Кватернизация йодистым метилом MeI

Кватернизация дендримеров 31 и 32 с концевыми группами -NМе2 была проведена согласно Схеме 4, в которой, в случае дендримеров 31 и 32, радикал R должен соответствовать фрагменту -[(CH2)2С6H3(OМe)(O(CH2)2NMe2)]. Поэтому дендримеры 31 и 32 были обработаны метилйодидом (сокращенно MeI) в диэтиловом эфире (Et2O), как описано в примерах 46 и 47, тем самым образовав дендримеры 33 и 34.

Примеры синтеза карбосилановых дендримеров с концевыми аминогруппами

Следует понимать, что примеры, приведенные ниже, являются только иллюстрацией предмета изобретения и не предполагают каких-либо ограничений любым путем.

Интегральные значения сигналов в 1Н-ЯМР спектрах дендримеров, которые описаны, представляют только четвертую часть от всего числа атомов водорода.

Примеры от 1 до 30, которые приведены ниже, описывают синтез карбосилановых дендримеров с концевыми аминогруппами, которые исходят из дендримерных прекурсоров (1G-Cl4, 1G-Cl8, 1G-H4, 2G-Cl8, 2G-Cl16, 1G-H8, 3G-Cl4, 1G-Cl8, 1G-H4), предварительно синтезированных согласно уже известным методикам, показанным в Схеме 1. Как уже отмечалось, названные дендримерные прекурсоры служат «скелетами», из которых формируются карбосилановые дендримеры согласно изобретению, с концевыми аминогруппами, реакцией их с соединениями, которые приводят к лигандам, которые преобразованы на концах ветвей дендримеров. Соединения, использованные для синтеза дендримеров, описанных в Примерах от 1 до 30, были такими: аллиламин (CH2=CH-CH2-NH2) (приобретен у фирмы Sigma Aldrich), N,N-диметилэтаноламин (CH2OH-CH2-N(CH3)2) (приобретен у фирмы Sigma Aldrich) или 2-[(2-(диметиламиноэтил)метил]аминоэтанол (CH2OH-CH2-N(CH3)-CH2-CH2-N(CH3)2) (приобретен у фирмы Sigma Aldrich), или 3,5-бис(диметиламиноэтокси)бензиловый спирт (CH2OH-(C6H3)-(O-CH2-CH2-N(CH3)2)2), это последнее соединение, которое не было приобретено в какой-либо коммерческой фирме, и его было необходимо предварительно синтезировать, как описано в Примере 7. Подробности реакций, в которых эти соединения были использованы с образованием карбосилановых дендримеров согласно изобретению, а также кватернизация их с образованием дополнительных дендримеров согласно изобретению, описаны ниже в Примерах от 1 до 30.

Примеры 1-12

- Пример 1: Синтез 1G-[Si(OCH 2 CH 2 NMe 2 )] 4 (1)

Небольшой избыток NEt3 (0,86 мл, 6,2 ммол) и N,N-диметилэтаноламин (0,6 мл, 5,97 ммол) были добавлены к раствору 1G-Cl4 дендримера (0,85 г, 1,49 ммол) в эфире (50 мл). Реакционная смесь была выдержана при постоянном перемешивании в течение 1 часа при комнатной температуре, после удаления в вакууме избытка NEt3 и растворителя был получен остаток, который был экстрагирован эфиром (30 мл). Полученная суспензия была профильтрована через целит для удаления аммониевой соли NEt3.HCl, образованной в реакции, и фильтрат был высушен с образованием соединения 1 в виде светло-желтого масла (0,98 г, 84%).

1Н-ЯМР (CDCl3): δ 3,64 (2H, т, CH2O), 2,40 (2H, т, CH2N), 2,22 (6H, с, NMe2), 1,31 (2H, м, SiCH2CH 2CH2SiO), 0,60 (2H, м, SiCH2CH2CH 2SiO), 0,53 (2H, м, SiСH 2СН2СН2SiO), 0,067 (6H, с, OSiMe2). 13C{1H}-ЯМР (CDCl3): δ 61,5 (CH2N), 60,8 (CH2O), 46,1 (NMe2), 21,3 (SiCH2CH2CH2SiO), 18,1, 17,4 (SiСН2СН2СН2SiО), -1,7 (OSiMe2). 29Si{1H}-ЯМР (CDCl3): δ 0,49 (G0-Si), 17,62 (G1-Si). Элементный анализ для С36Н88N4O4Si5: Вычислено %: C, 55,33; H, 11,35; N, 7,17. Найдено %: C, 55,16; H, 11,22; N, 7,06.

- Пример 2: Синтез 1G-[Si(OCH 2 CH 2 NMe 2 ) 2 ] 4 (2)

Дендример первой генерации 2 был получен согласно методике, подобной описанной для 1, исходя из 1G-Cl8 (0,54 г, 0,87 ммол), N,N-диметилэтаноламина (0,7 мл, 6,94 ммол) и NEt3 (1,0 мл, 7,2 ммол). Этим путем 2 был приготовлен в виде бесцветного масла (0,75 г, 80%).

1Н-ЯМР (CDCl3): δ 3,74 (4H, т, СН3O), 2,43 (4Н, т, CH2N), 2,23 (12Н, с, NMe2), 1,31 (2H, м, SiCH2CH 2CH2SiO), 0,63 (2H, м, SiCН2СН2СH 2SiО), 0,52 (2H, м, SiCH 2CH2CH2SiO), 0,09 (3H, с, OSiMe), 13C{1H}-ЯМР (CDCl3): δ 61,4 (CH2N), 60,7 (CH2O), 46,2 (NMe2), 18,7 (SiCH2CH2CH2SiO), 17,7, 17,2 (SiCH2CH2CH2SiO), -4,4 (OSiMe). 29Si{1H}-ЯМР (CDCl3): δ 0,47 (G0-Si), -3,65 (G1-Si). Элементный анализ для C48H116N8O8Si5: Вычислено %: C, 53,68; H, 10,89; N, 10,43. Найдено %: C, 53,54; H, 11,33; N, 10,06. МАСС-СПЕКТР MALDI-TOFF-MS: m/z 1095,8 [M+H]+ (Вычислено, 1095,8).

- Пример 3: Синтез 2G-[Si(OCH 2 CH 2 NMe 2 )] 8 (3)

Дендример второй генерации 3 был получен согласно методике, подобной описанной для 1, исходя из 2G-Cl8 (0,27 г, 0,18 ммол), N,N-диметилэтаноламина (0,15 мл, 1,47 ммол) и NEt3 (0,25 мл, 1,79 ммол). Этим путем 3 был приготовлен в виде бесцветного масла (0,31 г, 90%).

1Н-ЯМР (CDCl3): δ 3,64 (4H, т, CH2O), 2,41 (4H, т, CH2N), 2,23 (12H, с, NMe2), 1,30 (6H, м, SiCH2CH 2CH2SiO и SiCH2CH 2CH2Si перекрываются), 0,65 (4H, м, SiCH2CH2CH 2SiO), 0,53 (8H, м, фрагмент CH2Si), 0,07 (12H, с, OSiMe2), -0,09 (3H, с, SiMe). 13C{1H}-ЯМР (CDCl3): δ 61,5 (CH2N), 60,8 (CH2O), 46,1 (NMe2), 21,1 (SiCH2CH2CH2SiO), 18,6-17,9 (фрагмент групп -CH2-), -1,9 (OSiMe2), -4,9 (SiMe). 29Si{1H}-ЯМР (CDCl3): δ 0,93 (G1-Si), 17,6 (G2-Si), G0-Si не наблюдается. Элементный анализ для C88H212N8O8Si13. Вычислено %: C, 56,35; H, 11,39; N, 5,97. Найдено %: C, 55,98; H, 11,20; N, 5,78.

- Пример 4: Синтез 2G-[Si(OCH 2 CH 2 NMe 2 ) 2 ] 8 (4)

Дендример второй генерации 4 был получен согласно методике, подобной описанной для 1, исходя из 2G-Cl16 (0,48 г, 0,30 ммол), N,N-диметилэтаноламина (0,48 мл, 4,77 ммол) и NEt3 (0,7 мл, 5,02 ммол). Этим путем 4 был приготовлен в виде бесцветного масла. (0,66 г, 90%).

1Н-ЯМР (CDCl3): δ 3,75 (8H, т, CH2O), 2,44 (8H, т, CH2N), 2,24 (24H, с, NMe2), 1,34 (6H, м, SiCH2CH 2CH2SiO и SiCH2CH 2CH2Si перекрываются), 0,64 (4H, м, SiCH2CH2CH 2SiO), 0,51 (8H, м, фрагмент CH2Si), 0,09 (6H, с, OSiMe), -0,10 (3H, с, SiMe). 13C{1H}-ЯМР (CDCl3): δ 61,4 (CH2N), 60,7 (CH2O), 46,2 (NMe2), 18,6 (SiCH2CH2CH2SiO), 17,7-17,0 (фрагмент групп -CH2-), -4,4 (OSiMe), -4,8 (SiMe). 29Si{1Н}-ЯМР (CDCl3): δ 0,9 (G1-Si); -3,5 (G2-Si); G0-Si не наблюдается. Элементный анализ для C112H268N16O16Si13: Вычислено %: C, 54,67; H, 10,98; N, 9,11. Найдено %: C, 54,20; H 10,37; N 9,59.

- Пример 5: Синтез 3G-[Si(OCH 2 CH 2 NMe 2 )] 16 (5)

Дендример третьей генерации 5 был получен согласно методике, подобной описанной для 1, исходя из 3G-Cl16 (0,20 г, 0,06 ммол), N,N-диметилэтаноламина (0,10 мл, 0,99 ммол) и NEt3 (0,16 мл, 1,14 ммол). Этим путем 5 был приготовлен в виде светло-желтого масла (0,18 г, 74%).

1Н-ЯМР (CDCl3): δ 3,65 (8H, т, CH2O), 2,42 (8H, т, CH2N), 2,24 (24H, с, NMe2), 1,23 (14H, м, SiСН2СH 2СН2SiO и SiCH2CH 2CH2Si перекрываются), 0,64 (8H, м, SiCH2CH2CH 2SiO), 0,53 (20H, м, фрагмент CH2Si), 0,068 (24H, с, OSiMe2), -0,10 (9H, с, SiMe). 13C{1H}-ЯМР (CDCl3): δ 61,5 (CH2N), 60,8 (CH2O), 46,1 (NMe2), 21,1 (SiCH2CH2 CH2SiO), 18,6-17,9 (фрагмент групп -CH2-), -1,82 (OSiMe2), -4,8 (SiMe), 29Si{1H}-ЯМР (CDCl3): δ 0,95 (G2-Si); 17,95 (G3-Si) G0-Si и G1-Si не наблюдается. Элементный анализ для C198H460N16O16Si29. Вычислено %: C, 56,74; H, 11,41; N, 5,51. Найдено %: C, 56,17; H, 11,28; N,5,34.

- Пример 6: Синтез 3G-[Si(OCH 2 CH 2 NMe 2 ) 2 ] 16 (6)

Дендример третьей генерации 6 был получен согласно методике, подобной описанной для 1, исходя из 3G-Cl32 (0,19 г, 0,05 ммол), N,N-диметилэтаноламина (0,17 мл, 1,68 ммол) и NEt3 (0,24 мл, 1,79 ммол). Этим путем 6 был приготовлен в виде светло-желтого масла (0,20 г, 72%).

1Н-ЯМР (CDCl3): δ 3,75 (16H, т, CH2O), 2,44 (16H, т, CH2N), 2,24 (48H, с, NMe2), 1,32 (14H, м, SiCH2CH 2CH2SiO и SiCH2CH 2CH2Si перекрываются), 0,66 (8H, м, SiCH2CH2CH 2SiO), 0,53 (20H, м, фрагмент SiCH2), 0,07 (12H, с, OSiMe), -0,10 (18H, с, SiMe). 13C{1H}-ЯМР (CDCl3): δ 61,4 (CH2N), 60,7 (CH2O), 46,1 (NMe2), 18,4-17,4 (фрагмент групп -CH2-), -4,7 (OSiMe2), -5,2 (SiMe). Элементный анализ для C240H572N32O32Si29. Вычислено %: C, 55,08; H, 11,02; N, 8,56. Найдено %: C, 56,11; H, 11,89; N, 8,13.

- Пример 7: Синтез 1G-[Si(OCH 2 -(C 6 H 3 )-3,5-(OCH 2 CH 2 NMe 2 ) 2 )] 4 (7)

7.1. Синтез 3,5-(OCH 2 CH 2 NMe 2 ) 2 -(C 6 H 3 )-CH 2 OH

С целью синтеза дендримеров 7, 8 и 9 (исходных дендримеров, в свою очередь для получения дендримеров 22, 23 и 24) необходимо предварительно синтезировать соединение, которое позднее используется в качестве лиганда, 3,5-(OCH2CH2NMe2)2-(C6H3)-CH2OH. Для этого к раствору 3,5-дигидроксибензилового спирта (1,47 г, 10,39 ммол) в ацетоне, как растворителе, были добавлены 2 эквивалента гидрохлорида 2-хлор-N,N-диметиламиноэтана (2,98 г, 20,78 ммол), 4,5 эквивалента К2СО3 (6,43 г, 46,75 ммол), краун-эфир 18-Corona-6 (0,54 г, 2 ммол) и небольшое количество (на кончике шпателя) йодида калия KI. Реакционная смесь выдерживалась при кипячении с обратным холодильником в течение 48 ч. После удаления растворителя в вакууме остаток был экстрагирован CH2Cl2/H2O (2×50 мл). Органическая фаза была высушена над MgSO4 в течение 1 ч. Смесь затем была профильтрована, и растворитель был удален в вакууме с образованием светло-желтого масла, которое было промыто гексаном (2×10 мл) для удаления краун-эфира 18-Corona-6. Тем самым целевое соединение было приготовлено в виде светло-желтого масла (1,53 г, 50%).

1Н-ЯМР (CDCl3): δ 6,48 (2H, м, С6 H 3), 6,36 (1H, м, С6 H 3), 4,57 (2H, с, СH 2ОН), 3,99 (4H, т, СH 2О-С6Н3), 2,65 (4H, т, CH 2N), 2,60 (1H, с, СН2ОH ), 2,28 (12H, с, NMe2). 13C{1H}-ЯМР (CDCl3): δ 159,9 (C6H3, Сипсо-связанный с OCH2CH2NMe2), 143,8 (C6H3, Сипсо-связанный с CH2OH), 105,1 и 100,6 (C6H3), 65,8 (CН2О-С6Н3), 64,9 (CH2OH), 58,2 (CH2N), 45,8 (NMe2). Элементный анализ для C15H26N2O3. Вычислено %: C, 63,80; H, 9,28; N, 9,92. Найдено %: C, 63,50; H, 9,17; N, 9,83.

Это соединение было использовано для синтеза дендримеров 7, 8 и 9, который описан ниже.

7.2. Синтез дендримера 7

Небольшой избыток NEt3 (0,12 мл, 0,87 ммол) и 3,5-(OCH2CH2NMe2)2-(C6H3)-CH2OH (0,22 г, 0,378 ммол) были добавлены к раствору 1G-Cl4 дендримера (0,11 г, 0,19 ммол) в эфире (30 мл). Реакционная смесь была выдержана при постоянном перемешивании в течение 1 часа при комнатной температуре, после удаления в вакууме избытка NEt3 и растворителя был получен остаток, который был экстрагирован эфиром (2×20 мл). Полученная суспензия была профильтрована через целит для удаления аммониевой соли NEt3.HCl, образованной в реакции, и фильтрат был высушен с образованием соединения 7 в виде светло-желтого масла (0,23 г, 80%).

1Н-ЯМР (CDCl3): δ 6,45 (2H, м, C6H3); 6,36 (1H, м, C6H3); 4,56 (2H, с, CH2OSi); 3,99 (4H, т, СH 2О-С6Н3); 2,66 (4H, т, CH2N); 2,28 (12H, с, NMe2); 1,33 (2H, м, SiСН2СH 2СН2SiO); 0,68 (2H, м, SiСН2СН2СH 2SiO); 0,55 (2H, м, SiCH 2СН2СН2SiO); 0,08 (6H, с, SiMe2). 13C{1H}-ЯМР (CDCl3): δ 159,8 (C6H3, Сипсо-связанный с OCH2CH2NMe2); 143,2 (C6H3, Сипсо-связанный с CH2OSi); 104,9 и 100,2 (C6H3); 65,9 (CH2O-C6H3); 64,6 (CH2OSi); 58,2 (CH2N); 45,8 (NMe2), 21,2 (SiCH2 CH2CH2SiO); 17,9, 17,2 (SiСН2 СH2СН2SiO); -1,89 (SiMe2). Элементный анализ для C80H148N8O12Si5. Вычислено %: C, 61,81; H, 9,60; N, 7,21. Найдено %: C, 62,10; H, 9,82; N, 7,3.

- Пример 8: Синтез 2G-[Si(OCH 2 -(C 6 H 3 )-3,5-(OCH 2 CH 2 NMe 2 ) 2 )] 8 (8)

Дендример второй генерации 8 был получен согласно методике, подобной описанной для 7, исходя из 2G-Cl8 (0,27 г, 0,19 ммол), NEt3 (0,22 мл, 1,62 ммол) и 3,5-(OCH2CH2NMe2)2-(C6H3)-CH2OH (0,43 г, 1,52 ммол). Этим путем 8 был приготовлен в виде светло-желтого масла. (0,54 г; 82%).

1Н-ЯМР (CDCl3): δ 6,45 (4H, м, C6H3); 6,36 (2H, м, C6H3); 4,56 (4H, с, CH2OSi); 3,99 (8H, т, СH2О-С6Н3); 2,67 (8H, т, CH2N); 2,29 (24H, с, NMe2); 1,33 (6H, м, SiСН2СH 2СН2SiO и SiCН2СH 2СН2Si), 0,69 (4H, м, SiCН2СН2СH 2SiО), 0,55 (8Н, м, СH 2 связанный с Si), 0,09 (12Н, с, OSIMe2), -0,09 (3H, с, SiMe). 13C{1H}-ЯМР (CDCl3): δ 159,0 (C6H3, Сипсо-связанный с OCH2CH2NMe2); 143,3 (C6H3, Сипсо-связанный с CH2OSi); 104,8 и 100,1 (C6H3); 65,9 (CH2O-C6H3); 64,6 (CH2OSi); 58,3 (CH2NMe2); 45,9 (NMe2), 21,2 (SiCH2CH2CH2SiO); 17,9, 17,2 (SiCH2CH2CH2SiO и перекрывающиеся сигналы SiCH2CH2CH2Si); -1,7 (OSiMe2), -4,9 (SiMe). 29Si{1H}-ЯМР (CDCl3): δ 0,93 (G1-Si), 18,7 (G2-Si), G0-Si не наблюдается. Элементный анализ для C176H332N16O24Si13. Вычислено %: C, 61,78; H, 9,78; N, 6,55. Найдено %: C, 62,51; H, 9,90; N, 6,75.

- Пример 9: Синтез 3G-[Si(OCH 2 -(C 6 H 3 )-3,5-(OCH 2 CH 2 NMe 2 ) 2 )] 16 (9)

Дендример третьей генерации 9 был получен согласно методике, подобной описанной для 7, исходя из 3G-Cl16 (0,072 г, 0,022 ммол); NEt3 (0,060 мл, 0,43 ммол) и 3,5-(OCH2CH2NMe2)2-(C6H3)-CH2OH (0,101 г, 0,358 ммол). Этим путем 9 был приготовлен в виде светло-желтого масла (0,110 г; 69%).

1Н-ЯМР (CDCl3): δ 6,46 (8H, м, C6H3); 6,35 (4H, м, С6Н3); 4,56 (8Н, с, CH2OSi); 3,97 (16Н, т, CH2O-C6H3); 2,67 (16H, т, CH2N); 2,28 (48H, с, NMe2); 1,33 (14H, м, SiCН2СН2СН2SiО и SiCН2СН2СН2Si), 0,69 (8H, м, SiCН2СН2СH 2Si), 0,55 (18Н, м, CH2 связанный с Si), 0,09 (24H, с, OSiMe2), -0,09 (9H, с, SiMe). 13C{1H}-ЯМР (CDCl3): δ 160,0 (C6H3, Сипсо-связанный с OCH2CH2NMe2); 143,2 (C6H3, Сипсо-связанный с CH2OSi); 104,3 и 100,8 (C6H3); 65,9 (CH2O-C6H3); 64,6 (CH2OSi); 58,3 (CH2NMe2); 45,8 (NMe2), 21,1 (SiCH2CH2CH2SiO); 17,8, 17,2 (SiCH2CH2CH2SiO и перекрывающиеся сигналы SiCH2CH2CH2Si); -1,8 (OSiMe2), -4,9 (SiMe). Элементный анализ для C368H700N32O48Si29. Вычислено %: C, 61,76; H, 9,86; N, 6,26. Найдено %: C, 62,43; H, 9,90; N, 6,80.

- Пример 10: Синтез 1G-[Si(O(CH 2 ) 2 N(Me)(CH 2 ) 2 NMe 2 )] 4 (10)

Небольшой избыток NEt3 (0,5 мл, 3,58 ммол) и 2-{[(2-диметиламино)этил]метиламино}этанола (0,35 мл, 2,19 ммол) были добавлены к раствору 1G-Cl4 дендримера (0,31 г, 0,54 ммол) в эфире (30 мл). Реакционная смесь была выдержана при постоянном перемешивании в течение 12 ч при комнатной температуре, после удаления в вакууме избытка NEt3 и растворителя был получен остаток, который был экстрагирован эфиром (2×20 мл). Полученная суспензия была профильтрована через целит для удаления аммониевой соли NEt3.HCl, образованной в реакции, и фильтрат был высушен с образованием соединения 10 в виде бесцветного масла (0,3 г, 57%).

1Н-ЯМР (CDCl3): δ 3,64 (2H, т, CH2O), 2,51 (4H, м, CH 2N(Me)), 2,35 (2H, т, СH 2N(Ме)2), 2,26 (3H, с, NMe); 2,19 (6H, с, NMe2), 1,29 (2H, м, SiCН2СH 2СН2SiO), 0,62 (2H, м, SiCH2CH2CH 2SiO), 0,59 (2H, м, SiCH 2СН2СН2SiO), 0,05 (6H, с, SiMe2). 13C{1H}-ЯМР (CDCl3): δ 60,8 (CH2O), 59,9 и 56,2 (CH2N(Me)CH2), 57,5 (СH 2N(Ме)2), 45,9 (NMe2), 43,3 (NMe), 21,2 (SiCH2CH2CH2SiO), 17,8 (SiCH2CH2 CH2SiO), 17,2 (SiCH2 CH2CH2SiO), -2,0 (SiMe2). 29Si{1H}-ЯМР (CDCl3): δ 0,49 (G0-Si), 17,59 (Gi-Si). Элементный анализ для C48H116N8O4Si5. Вычислено %: C, 57,09; H, 11,58; N, 11,10. Найдено %: C, 57,60; H, 11,72; N, 11,20.

- Пример 11: Синтез 2G-[Si(O(CH 2 ) 2 N(Me)(CH 2 ) 2 NMe 2 )] 8 (11)

Дендример третьей генерации 11 был получен согласно методике, подобной описанной для 10, исходя из 2G-Cl8 (1,12 г, 0,77 ммол), NEt3 (1 мл, 7,17 ммол) и 2-{[2-диметиламино)этил]метиламино}этанола (1 мл, 6,16 ммол). Этим путем 11 был приготовлен в виде светло-желтого масла (1,3 г, 72%).

1Н-ЯМР (CDCl3): δ 3,65 (4H, т, CH2O), 2,51 (8H, м, СH 2М(Ме)), 2,30 (4H, т, СH 2N(Ме)2), 2,26 (6H, с, NMe), 2,20 (12H, с, NMe2), 1,31 (6H, м, SiCН2СH 2СН2SiO и SiCН2СH2СН2Si, 0,63 (4H, м, SiCН2СН2СH 2SiO), 0,59 (8H, м, SiCH2), 0,06 (12H, с, SiMe2), -0,10 (3H, с, SiMe). 13C{1H}-ЯМР (CDCl3): δ 60,8 (CH2O), 59,9 и 56,2 (CH2N(Me)CH2), 57,5 (CH 2N(Me)2), 45,9 (NMe2), 43,3 (NMe), 21,2 (CH2SiO), 18,7-17,9 (SiCH2CH2CH2SiO и SiCH2CH2CH2Si), -1,79 (OSiMe2), -4,8 (SiMe). 29Si{1H}-ЯМР (CDCl3): δ 0,38 (G0-Si), 0,93 (G1-Si), 17,58 (G2-Si). Элементный анализ для C112H226N16O8Si13. Вычислено %: C, 57,67; H, 11,58; N, 9,61. Найдено %: C, 57,20; H, 11,40; N, 9,52

- Пример 12: Синтез 3G-[Si(O(CH 2 ) 2 N(Me)(CH 2 ) 2 NMe 2 )] 16 (12)

Дендример третьей генерации 12 был получен согласно методике, подобной описанной для 10, исходя из 3G-Cl16 (0,49 г, 0,152 ммол), NEt3 (0,40 мл, 2,86 ммол) и 2-{[(2-диметиламино)этил]метиламино}этанола (0,39 мл, 2,43 ммол). Этим путем 12 был приготовлен в виде светло-желтого масла (0,51 г, 67%).

1Н-ЯМР (CDCl3): δ 3,65 (8H, т, СH2О), 2,51 (16H, м, СH 2N(Ме)), 2,36 (8H, т, -СH 2N(Ме)2), 2,26 (12H, с, NMe), 2,21 (24H, с, NMe2), 1,30 (14H, м, SiCН2СH 2СН2SiO и SiCН2СH 2СН2Si), 0,63 (8H, м, SiCН2СН2СH2SiO), 0,53 (18Н, м, SiCH2), 0,06 (24H, с, SiMe2), -0,10 ( 9H, с, SiMe). 13C{1H}-ЯМР (CDCl3): δ 60,8 (CH2O), 60,0 и 56,2 (CH2N(Me)CH2), 57,4 (CH2N(Me)2), 45,9 (NMe2), 43,3 (NMe), 21,1 (CH2SiO), 18,7-17,8 (SiCH2 CH2CH2SiO и SiCH2 CH2CH2SiSi), -1,9 (OSiMe2), -4,8 (SiMe). 29Si{1H}-ЯМР (CDCl3): δ 0,93 (G1-Si и G2-Si), 17,58 (G3-Si). Элементный анализ для C240H572N32O16Si29. Вычислено %: C, 57,91; H, 11,58; N, 9,0. Найдено %: C, 57,32; H, 11,38; N,8,72.

Эти дендримеры получаются в виде прозрачных маслянистых продуктов коричневого цвета, с высокими выходами. Все они растворимы в общеупотребительных органических растворителях, нерастворимых в воде.

Спектроскопические и аналитические характеристики производных 1-12 согласуются с предложенными структурами, которые показаны в фиг. 1а. Так, сигналы, соответствующие карбосилановому скелету в 1Н-ЯМР спектрах предшествующих дендримеров, имеют химические сдвиги для аналогичных ядер в различных генерациях, хотя сигналы уширяются и становятся более мультиплетными по мере повышения генерации дендримера. Эти характеристики, главным образом, были обусловлены двумя факторами: структура полимерного типа у этих производных, которая сообщает ядрам в разных генерациях очень малые различия в их химическом окружении, и ограничение подвижности соответствующих протонов в наиболее удаленных от центра слоях по мере повышения генерации[26].

Эти спектры показывают три группы сигналов, которые относятся к метиленовым группам. В ветвях SiCH2CH2CH2Si центральные метиленовые группы проявляются при 1,30 млн-1, тогда как сигналы метиленовых групп, непосредственно связанных с атомами кремния, локализуются при 0,61 и 0,51 млн-1. Сигнал с центром при 0,61 млн-1 был отнесен к группам CH2SiO-, тогда как сигнал с центром при 0,51 млн-1 приписывается метиленовой группе, основываясь на возрастании интегральной интенсивности этого последнего сигнала при повышении генерации дендримера и результатах 1D 1H-TOCSY и NOESY экспериментов. В 13С-ЯМР спектрах метиленовые группы внутренней части ветвей SiCH2CH2CH2Si дают сигналы в интервале 21,3-17,4 млн-1. Полное отнесение этих сигналов было сделано с помощью HMQC экспериментов. Наконец, фрагменты -SiMe2- и -SiMe- легко различимы во всех производных и генерациях. Спектры 29Si-ЯМР также находятся в согласии с предложенными структурами, хотя в этих спектрах проявляются только атомы кремния, находящиеся в самой глубине дендримеров первой генерации.

Что касается охарактеризования концевых групп этих дендримеров, то здесь, на примерах, охарактеризование этих групп описано в производных 1-6. Охарактеризование части соединений было сделано подобным способом, и подробности относительно каждого из них отражены в экспериментальной части этой работы.

В дендримерах 1-6 триплетный сигнал для внешнего фрагмента -OCH2CH2NMe2 наблюдается с локализацией при 3,64 (для дендримеров 1, 3 и 5) и 3,74 млн-1 (для дендримеров 2, 4 и 6), который отнесен к -ОСН2- группам, и еще один триплетный сигнал при 2,43 млн-1 во всех случаях соответствует группам -CH2N-. Слабопольный сдвиг, наблюдаемый для сигналов, соответствующих группам -ОСН2- в дендримерах 2, 4 и 6, согласуется с присутствием двух атомов кислорода, связанных с атомом кремния в этих производных, хотя этот эффект незаметен для групп -CH2N-. Метильные группы, связанные с атомом азота, во всех случаях проявляются сигналами при 2,23 и 46,1 млн-1 в ЯМР 1Н и 13С, соответственно.

Охарактеризование этих соединений было выполнено с помощью масс-спектрометрии (электроспрей или метод MALDI-TOF MS) с использованием 1,8,9-тригидроксиантрацена (дитранола) в качестве матрицы. Однако обнаружить пики молекулярных ионов было невозможно для второй и третьей генераций, и этот факт был описан для многих других дендримеров с высокой молекулярной массой[27,46-49].

Примеры 13-15

Пример 13. - Синтез 1G-[Si(CH 2 ) 3 NH 2 ] 4 (13)

Аллиламин (1,5 мл, 19,99 ммол) и две капли катализатора Карштедта (3-3,5% Pt) были добавлены к раствору дендримера 1G-H4 (0,54 г, 1,23 ммол) в минимальном количестве тетрагидрофурана (ТГФ) (1 мл). Реакционная смесь нагревалась до 120°С в вакуумированной ампуле в течение 4 ч, эта реакционная смесь была высушена для удаления растворителя и избытка аллиламина, полученный остаток был растворен в CH2Cl2 и был профильтрован через целит и активированный уголь. Полученный раствор был высушен путем вакуумного удаления растворителя с получением соединения 13 в виде бесцветного масла (0,90 г; 83%). Структура этого дендримера представлена в фиг. 1b.

1Н-ЯМР (CDCl3): δ 2,63 (2H, т, CH2N), 1,34 (4H, м, SiCH2CH 2CH2N и SiCH2CH 2CH2Si), 1,13 (2H, с, NH2), 0,54-0,44 (8H, м, CH2 связанный с Si), -0,06 (6H, с, SiMe2), 13C{1H}-ЯМР (CDCl3): δ 45,7 (CH2N), 28,3 (SiCH2CH2CH2N), 20,2, 18,6, 17,6, (SiCH2CH2CH2Si), 12,4 (SiCH2CH2CH2N), -3,3 (SiMe2). 29Si{1H}-ЯМР (CDCl3): δ 0,50 (G0-Si), 1,96 (Gi-Si). Элементный анализ для С32Н80N4Si5. Вычислено %: C, 58,14; H, 12,21; N, 8,48. Найдено %: C, 57,63; H, 12,27; N, 8,78. Масс-спектр, электроспрей: m/z z=1 661.25 а.е.м. [M+H]+. (Вычислено 661,52 а.е.м.).

Пример 14: Синтез 2G-[Si(CH 2 ) 3 NH 2 ] 8 (14)

Дендример второй генерации 14 был получен согласно методике, подобной описанной для 13, исходя из 2G-H8 (0,42 г, 0,36 ммол), аллиламина (2 мл, 26,7 ммол), 1 мл ТГФ и двух капель катализатора Карштедта. Этим путем 14 был получен в виде бесцветного масла (0,32 г, 55%). Структура этого дендримера представлена в фиг. 1b.

1Н-ЯМР (CDCl3): δ 2,63 (4H, т, CH2N), 1,41-1,28 (6H, м, SiCH2CH 2CH2Si и SicН2СH 2СН2N), 0,54-0,44 (20H, м, CH2 связанный с Si), -0,06 (12H, с, SiMe2), -0,10 (3H, с, SiMe). 13C{1H}-ЯМР (CDCl3): δ 45,7 (CH2N), 28,4 (SiCH2CH2CH2N), 20,2, 18,6, 17,6, (SiCH2CH2CH2Si), 12,5 (SiCH2CH2CH2N), -3,1 (SiMe2), -4,8 (SiMe). 29Si{1H}-ЯМР (CDCl3): δ 0,92 (G1-Si); 2,00 (G2-Si). Элементный анализ для C80H196N8Si13. Вычислено %: C, 58,75; H, 12,08; N, 6,85. Найдено %: C, 58,16; H, 11,95; N, 6,58. Масс-спектр, электроспрей: m/z z=1 не наблюдается, для z=2 (m/z +1) 818,44 а.е.м. [М+Н]+. (Вычислено Z=2 818,8 а.е.м.).

Пример 15: Синтез 3G-[Si(CH 2 ) 3 NH 2 ] 16 (15)

Дендример третьей генерации 15 был получен согласно методике, подобной описанной для 13, исходя из 3G-H16 (0,100 г, 0,037 ммол), аллиламина (2 мл, 26,7 ммол), 1 мл ТГФ и двух капель катализатора Карштедта. Этим путем 15 был получен в виде бесцветного масла (0,085 г, 64%).

1Н-ЯМР (CDCl3): δ 2,63 (8H, т, CH 2N), 1,41-1,28 (22H, м, SiCH2CH 2CH2Si и SiCН2СH 2СН2N), 0,54-0,44 (36H, м, СH2 связанный с Si), -0,06 (24H, с, SiMe2), -0,10 (9H, с, SiMe). 13C{1H}-ЯМР (CDCl3): δ 45,7 (CH2N), 28,4 (SiCH2CH2CH2N), 20,2, 18,6, 17,6, (Si SiCH2 CH2CH2Si), 12,5 (SiCH2CH2CH2N), -3,1 (SiMe2), -4,8 (SiMe). 29Si{1H}-ЯМР (CDCl3): δ 0,92 (G1-Si и G2-Si); 2,00 (G3-Si). Элементный анализ для C176H428N16Si29. Вычислено %: C, 58,98; H, 12,04; N, 6,25. Найдено %: C, 58,06; H, 11,84; N, 6,48.

Примеры 16-27

Пример 16. - Синтез 1G-[Si(OCH 2 CH 2 NMe 3+ I - )] 4 (16)

0,4 мл двумолярного (2М) раствора MeI в эфире (0,8 ммол) были добавлены к раствору 1 (0,12 г, 0,15 ммол) в эфире (10 мл). Реакционная смесь выдерживалась при постоянном перемешивании в течение 48 ч при комнатной температуре, затем она была высушена для удаления избытка MeI. Полученный остаток был промыт Et2O (2×5 мл) и высушен в вакууме с образованием соединения 16 в виде бесцветного твердого вещества (0,20 г, 96%).

1Н-ЯМР (ДМСО): δ 3,94 (2H, м, CH2O), 3,43 (2H, м, CH2N), 3,09 (9H, с, NMe3+), 1,29 (2H, м, SiCH2CH 2CH2SiO), 0,66 (2H, м, SiCH2CH2CH 2SiO), 0,56 (2H, м, CH2Si), 0,11 (6H, с, OSIMe2). 13C{1H}-ЯМР (ДМСО): δ 65,8 (CH2N), 55,8 (CH2O), 52,6 (NMe3+), 19,7 (SiCH2CH2CH2SiO), 16,9, 16,1 (SiCH2CH2CH2SiO), -2,6 (OSiMe2). Элементный анализ для C40H100N4O4Si5I4 Вычислено %: C, 35,61; H, 7,47; N, 4,15. Найдено %: C, 36,67; H, 7,65; N, 4,42.

Пример 17. - Синтез 1G-[Si(OCH 2 CH 2 NMe 3+ I - ) 2 ] 4 (17)

Дендример первой генерации 17 был получен согласно методике, подобной описанной для 16, исходя из 2 (0,17 г, 0,16 ммол) и 0,80 мл 2М раствора MeI в эфире (1,6 ммол). Этим путем 17 был приготовлен в виде бесцветного твердого вещества (0,29 г, 86%).

1Н-ЯМР (ДМСО): δ 4,12 (4H, м, CH2O), 3,54 (4H, м, CH2N), 3,17 (18H, с, NMe3+), 1,29 (2H, м, SiCH2CH 2CH2SiO), 0,75 (2H, м, SiCH2CH2CH 2SiO), 0,54 (2H, м, SiCH 2СН2СН2SiО), 0,20 (3H, с, OSiMe). 13C{1H}-ЯМР (ДМСО): δ 65,8 (CH2N), 56,0 (CH2O), 52,7 (NMe3+), 17,3 (SiCH2CH2CH2SiO), 16,5, 15,9 (SiCH2CH2CH2SiO), -5,3 (OSiMe). Элементный анализ для C56H140N8O8Si5I8. Вычислено %: C, 30,44; H, 6,39; N, 5,07. Найдено %: C, 31,47; H, 6,47; N, 5,19.

Пример 18. - Синтез 2G-[Si(OCH 2 CH 2 NMe 3+ I - )] 8 (18)

Дендример второй генерации 18 был получен согласно методике, подобной описанной для 16, исходя из 3 (0,25 г, 0,13 ммол) и 0,6 мл 2М раствора MeI в эфире (1,2 ммол). Этим путем соединение 18 было приготовлено в виде бесцветного твердого вещества (0,35 г, 87%).

1Н-ЯМР (ДМСО): δ 3,96 (4H, м, CH2O), 3,45 (4H, м, CH2N), 3,11 (18H, с, NMe3+), 1,29 (6H, м, SiCH2CH 2CH2SiO и SiCН2СH 2СН2Si), 0,65 (4H, м, SiCН2СН2СH 2SiO), 0,52 (8H, м, фрагмент SiCH2), 0,11 (12H, с, OSiMe2), -0,10 (3H, с, SiMe). 13C{1H}-ЯМР (ДМСО): δ 6 65,7 (CH3N), 55,9 (CH2O), 52,6 (NMe3+); 19,7, 17,5, 16,9 и перекрывающиеся сигналы (фрагмент групп -CH2-), -2,5 (OSiMe2), -5,3 (SiMe). Элементный анализ для C96H236N8O8Si13I8. Вычислено %: C, 38,29; H, 7,9; N, 3,72. Найдено %: C, 38,87; H, 8,32; N, 3,79.

Пример 19. - Синтез 2G-[Si(OCH 2 CH 2 NMe 3+ I - ) 2 ] 8 (19)

Дендример второй генерации 19 был получен согласно методике, подобной описанной для 16, исходя из 4 (0,10 г, 0,04 ммол) и 0,5 мл 2М раствора MeI в эфире (1,0 ммол). Этим путем соединение 19 было приготовлено в виде бесцветного твердого вещества (0,17 г, 87%).

1Н-ЯМР (ДМСО): δ (м.д.) 4,13 (8H, м, CH2O), 3,56 (8H, м, CH2N), 3,19 (36H, с, NMe3+), 1,28 (6H, м, SiН2СH 2СН2SiO и SiCH2CH 2CH2Si), 0,72 (4H, м, SiCН2СН2СH 2SiO), 0,55 (8H, м, фрагмент SiCH2), 0,21 (6H, с, OSiMe), -0,08 (3H, с, SiMe). 13C{1H}-ЯМР (ДМСО): δ 65,7 (CH2N), 56,0 (CH2O), 52,7 (NMe3+), 19,2, 17,2, 16,4 и перекрывающиеся сигналы (фрагмент групп -CH2-), -5,2 (OSiMe), -5,6 (SiMe). Элементный анализ для C128H316N16O16Si13I16. Вычислено %: C, 32,49; H, 6,73; N, 4,74. Найдено %: C, 33,32; H, 7,03; N, 4,72.

Пример 20. - Синтез 3G-[Si(OCH 2 CH 2 NMe 3+ I - )] 16 (20)

Дендример третьей генерации 20 был получен согласно методике, подобной описанной для 16, исходя из 5 (0,12 г, 0,03 ммол) и 0,4 мл 2М раствора MeI в эфире (0,8 ммол). Этим путем соединение 20 было приготовлено в виде бесцветного твердого вещества (0,16 г, 83%).

1Н-ЯМР (ДМСО): δ 3,96 (8H, м, CH2O), 3,47 (8H, м, CH2N), 3,13 (36H, с, NMe3+), 1,28 (14H, м, SiCH2CH 2CH2SiO и SiCН2СH2СН2Si), 0,65 (8H, м, SiCН2СН2СH2SiO), 0,52 (20H, м, фрагмент SiCH2), 0,10 (24H, с, OSiMe2), -0,08 (9H, с, SiMe). 13C{1H}-ЯМР (ДМСО): δ 65,8 (CH2N), 55,9 (CH2O), 52,6 (NMe3+), 19,7, 17,2, 16,0 и перекрывающиеся сигналы (фрагмент групп -CH2-), -2,7 (OSiMe2), -5,5 (SiMe). Элементный анализ для C96H236N8O8Si13I8. Вычислено %: C, 39,43; H, 8,08; N, 3,54. Найдено %: C, 39,19; H, 8,19; N, 3,68.

Пример 21. - Идентификация 3G-[Si(OCH 2 CH 2 NMe 3+ I - ) 2 ] 16 (21)

Дендример третьей генерации 21 был получен согласно методике, подобной описанной для 16, исходя из 6 (0,060 г, 0,012 ммол) и 0,2 мл 2М раствора MeI в эфире (0,4 ммол). Спектр 1Н-ЯМР содержит уширенные сигналы и показывает, что примерно 90% концевых аминогрупп были кватернизованы, по каковой причине соединение 21 не удалось выделить в чистом состоянии.

1Н-ЯМР (ДМСО): δ 4,16 (16H, м, OCH2), 3,60 (16H, м, CH2N), 3,22 (72H, с, NMe3+I-), 1,27 (14H, м, SiCH2CH2CH2SiO и SiCH2CH2CH2Si), 0,52 (26H, м, SiCH2CH2CH2SiO и фрагмент групп -CH2-), 0,07 (24H, ушир.с, SiMe2), сигнал, соответствующий SiMe, не наблюдался, так как он оказался перекрывающимся с предыдущим сигналом.

Пример 22.- Синтез 1G-[Si(OCH 2 -(C 6 H 3 )-3,5-(OCH 2 CH 2 NMe 3+ I - ) 2 )] 4 (22)

Дендример первой генерации 22 был получен согласно методике, подобной описанной для 16, исходя из 7 (0,1 г, 0,06 ммол) и 0,35 мл 2М раствора MeI в эфире (0,7 ммол). Этим путем соединение 22 было приготовлено в виде бесцветного твердого вещества (0,14 г, 90%).

1Н-ЯМР (ДМСО): δ 6,55 (3H, м, C6H3); 4,58 (2H, с, CH2OSi); 4,42 (4H, т, СH 2О-С6Н3); 3,77 (4H, т, CH2N); 3,18 (18H, с, NMe3+); 1,35 (2H, м, SiCН2СH 2СН2SiO), 0,70 (2H, м, SiCH2CH2CH 2SiO), 0,57 (2H, м, SiCH 2CH2CH2SiO), 0,08 (6H, с, SiMe2). 13C{1H}-ЯМР (ДМСО): δ 157,8 (C6H3, Сипсо-связанный с OCH2CH2NMe2); 143,2 (C6H3, Сипсо-связанный с CH2OSi); 104,9 и 99,6 (C6H3); 63,5 (CH2NMe2); 63,0 (CH2OSi); 61,3 (CH2O-C6H3); 52,7 (+NMe3), 19,9 (SiCH2CH2CH2SiO); 16,9, 16,1 (SiСH 2СH 2СН2Si); -2,4 (SiMe2). Элементный анализ для C88H172I8N8O12Si5. Вычислено %: C, 39,29; H, 6,44; N, 4,17. Найдено %: C, 38,90; H, 6,24; N, 4,09.

Пример 23.- Синтез 2G-[Si(OCH 2 -(C 6 H 3 )-3,5-(OCH 2 CH 2 NMe 3+ I - ) 2 )] 8 (23)

Дендример второй генерации 23 был получен согласно методике, подобной описанной для 16, исходя из 8 (0,08 г, 0,023 ммол) и 0,20 мл 2М раствора MeI в эфире (0,4 ммол). Этим путем соединение 23 было приготовлено в виде бесцветного твердого вещества (0,11 г, 85%).

1Н-ЯМР (ДМСО): δ 6,58 (6H, м, C6H3); 4,58 (4H, с, СH 2ОSi); 4,44 (8H, т, СH 2О-С6Н3); 3,79 (8H, т, СH 2N); 3,20 (30Н, с, NMe3+); 1,33 (6H, м, SiCH2CH 2CH2SiO и SiCН2СH 2СН2Si), 0,67(4H, м, SiCН2СН2СH 2SiO), 0,54 (8H, м, СH 2 связанный с Si), 0,07 (12H, с, OSiMe2), -0,07 (3H, с, SiMe). 13C{1H}-ЯМР (ДМСО): δ 157,9 (C6H3, Сипсо-связанный с OCH2CH2NMe2); 143,2 (C6H3, Сипсо-связанный с CH2OSi); 105,2 и 99,6 (C6H3); 63,5 (CH2NMe2); 63,0 (CH2OSi); 61,4 (CH2O-C6H3); 52,7 (NMe3+), 19,8 (SiCH2CH2CH2SiO); 17,5, 16,8 (SiCH 2СH 2СН2SiО и перекрывающиеся сигналы и SiCH2OI2CH2Si); -2,4 (OSiMe2); -5,5 (SiMe). Элементный анализ для C192H380I16N16O24Si13. Вычислено %: C, 40,51; H, 6,73; N, 3,94. Найдено %: C, 41,20; H, 7,02; N, 4,10.

Пример 24.- Синтез 3G-[Si(OCH 2 -(C 6 H 3 )-3,5-(OCH 2 CH 2 NMe 3+ I - ) 2 )] 16 (24)

Дендример третьей генерации 24 был получен согласно методике, подобной описанной для 16, исходя из 9 (0,084 г, 0,012 ммол) и 0,25 мл 2М раствора MeI в эфире (0,5 ммол). Этим путем соединение 24 было приготовлено в виде бесцветного твердого вещества (0,080 г, 72%).

1Н-ЯМР (ДМСО): δ 6,57 (12H, м, C6H3); 4,58 (8H, с, CH2OSi); 4,44 (16H, т, СH 2О-С6Н3); 3,78 (16H, т, CH2N); 2,28 (72H, с, NMe3+); 1,33 (14H, м, SiCН2СH 2СН2SiO и SiCН2СH 2СН2Si), 0,69 (8H, м, SiCH2СН2СH 2SiO), 0,55 (18Н, м, СН2 связанный с Si), 0,08 (24Н, с, OSiMe2), -0,08 (9H, с, SiMe). 13C{1H}-ЯМР (CDCl3): δ 158,0 (C6H3, Сипсо-связанный с OCH2CH2NMe2); 143,2 (C6H3, Сипсо-связанный с CH2OSi); 104,9 и 100,12 (C6H3); 63,4 (CH2O-C6H3); 63 (CH2OSi); 61,4 (CH2NMe2); 52,7 (NMe3+3), 19,9 (SiCH2CH2CH2SiO); 17,5, 16,8 (SiCH2CH2CH2SiO и перекрывающиеся сигналы SiCH2CH2CH2Si); -2,3 (OSiMe2), -5,5 (SiMe). Элементный анализ для C384H748I16N32O48Si29. Вычислено %: C, 48,92; H, 8; N, 4,75. Найдено %: C, 47,60; H, 7,02; N, 4,35.

Пример 25.- Идентификация 1G-[Si(O(CH 2 ) 2 N(Me)(CH 2 ) 2 NMe 3+ I - )] 4 (25)

Дендример первой генерации 25 был получен согласно методике, подобной описанной для 16, исходя из 10 (0,043 г, 0,047 ммол) и 0,094 мл 2М раствора MeI в эфире (0,188 ммол). Этим путем соединение 25 было приготовлено в виде бесцветного твердого вещества. Это соединение не было выделено чистым, наблюдались смеси вследствие неселективного способа кватернизации, в котором могли участвовать оба атома азота, хотя соединение 25 является главным компонентом этой смеси.

1Н-ЯМР (ДМСО): δ 3,98 (2H, м, OCH2CH2N(Me)CH2CH 2NMe3+I-), 3,60 (2Н, т, ОСH 2СН2N(Ме)СН2СН2NМе3+I-), 3,42 (2Н, м, OCH2CH2N(Me)CH 2CH2NMe3+I-), 3,11 (9Н, с, NMe3+I-), 2,76 (2Н, м, ОСН2СH 2N(Ме)СН2СН2Nме3+I-), 2,21 (3Н, с, NMe), 1,30 (2Н, м, SiCH2CH 2CH2SiO), 0,61 (2Н, м, SiCН2СН2СH 2SiО), 0,53 (2Н, м, SiCH 2СН2СН2Si), 0,04 (6Н, с, SiMe2). 13C{1H}-ЯМР (CDCl3): δ 64,8 (OCH2CH2N(Me)CH2CH2NMe3+I-), 61,0 (ОСН2СН2N(Ме)СН2 CH2NМез+I-), 59,5 (OCH2CH2N(Me)CH2CH2NMe3+I-), 58,3 (OCH2CH2N(Me)CH2CH2NMe3+I-), 52,2 (NMe3+I-), 41,3 (NMe), 20,0 (SiCH2CH2CH2SiO), 16,9 и 16,1 (SiCH2CH2CH2SiO), -2,5 (SiMe2).

Пример 26.- Идентификация 2G-[Si(O(CH 2 ) 2 N(Me)(CH 2 ) 2 NMe 3+ I - )] 8 (26)

Дендример второй генерации 26 был получен согласно методике, подобной описанной для 16, исходя из 11 (0,19 г, 0,08 ммол) и 0,34 мл 2М раствора MeI в эфире (0,68 ммол). Этим путем соединение 26 было приготовлено в виде светло-желтого твердого вещества. Это соединение не было выделено чистым, наблюдались смеси вследствие неселективного способа кватернизации, в котором могли участвовать оба атома азота, хотя соединение 26 является главным компонентом этой смеси.

1Н-ЯМР (ДМСО): δ 4,02 (4H, м, ОСН2СН2N(Ме)СН2СH 2NMе3+I-), 3,60 (4H, т, ОСH 2СН2N(Ме)СН2СН2NMе3+I-), 3,42 (4H, м, ОСН2СН2N(Ме)СH 2СН2NMе3+I-), 3,11 (18H, с, NMe3+I-), 2,76 (4H, м, ОСН2СH 2N(Ме)СН2СН2NМе3+I-), 2,21 (6H, с, NMe), 1,30 (4H, м, SiCН2СH 2СН2SiO и SiCН2СH2СН2Si), 0,59 (4H, м, SiCН2СН2СH2SiO), 0,51 (8Н, м, фрагмент групп -CH2-), 0,03 (12H, с, SiMe2), -0,11 (3H, с, SiMe). 13C{1H}-ЯМР (CDCl3): δ 64,9 (OCH2CH2N(Me)CH2CH2NMe3+I-), 61,0 (ОСН2СН2N(Ме)СН2СН2 NMе3+I-), 59,6 (OCH2CH2N(Me)CH2CH2NMe3+I-), 58,3 (OCH2CH2N(Me)CH2CH2NMe3+I-), 52,3 (NMe3+I-), 41,3 (NMe), 20,0-16,8 (группы -СН2- карбосиланового скелета), -2,5 (SiMe2), -5,5 (SiMe).

Пример 27.- Идентификация 3G-[Si(O(CH 2 ) 2 N(Me)(CH 2 ) 2 NMe 3+ I - )] 16 (27)

Дендример третьей генерации 27 был получен согласно методике, подобной описанной для 16, исходя из 20 (0,084 г, 0,017 ммол) и 0,13 мл 2М раствора MeI в эфире (0,27 ммол). Этим путем соединение 27 было приготовлено в виде светло-желтого твердого вещества. Это соединение не было выделено чистым, наблюдались смеси вследствие неселективного способа кватернизации, в котором могли участвовать оба атома азота, хотя соединение 27 является главным компонентом этой смеси.

1Н-ЯМР (ДМСО): δ 3,99 (8H, м, ОСН2СН2N(Ме)СН2СH 2NMе3+I-); 3,60 (8H, т, ОСH 2СН2N(Ме)СН2СН2NМе3+I-), 3,44 (8H, м, OCH2CH2N(Me)CH 2CH2NMe3+I-), 3,12 (36H, с, NMe3+I-), 2,76 (8H, м, ОСН2СH2N(Ме)СН2СН2NМе3+I-), 2,22 (12H, с, NMe), 1,28 (14H, м, SiCН2СH 2СН2SiO и SiCН2СH 2СН2Si), 0,51 (26H, м, SiCH2CH2CH 2SiО и фрагмент групп -СH 2-), 0,03 (24H, с, SiMe2), -0,11 (9H, с, SiMe). 13C{1H}-ЯМР (CDCl3): δ 64,9 (OCH2CH2N(Me)CH2CH2NMe3+I-), 61,0 (OCH2CH2N(Me)CH2CH2NMe3+I-), 59,6 (ОСН2СН2N(Ме)СН2СН2NMе3+I-), 58,3 (OCH2CH2N(Me)CH2CH2NMe3+I-), 52,3 (NMe3+I-), 41,3 (NMe), 20,0-16,8 (группы -СН2- карбосиланового скелета), -2,5 (SiMe2), -5,5 (SiMe).

В случае дендримеров третьей генерации 21, 24 и 27, кватернизация диметиламиногрупп является неполной, как продемонстрировано 1Н-ЯМР спектрами, из которых можно приблизительно оценить, что около 90% концевых диметиламиногрупп в этих комплексах были кватернизованы, даже в присутствии избытка MeI и при оставлении реакционной смеси на более длительные периоды времени.

Все эти ионные производные нерастворимы в типичных органических растворителях, но растворимы в ДМСО, МеОН и Н2О.

Спектроскопическая и аналитическая информация о производных 16-27 согласуется с предложенными структурами, которые показаны в фиг. 2а. Сигналы, которые появляются в 1Н-ЯМР спектрах этих производных, снятых в ДМСО как растворителе при комнатной температуре, являются уширенными по сравнению с таковыми для их прекурсоров в обычных органических растворителях. Этот факт был ранее описан для других водорастворимых карбосилановых дендримеров, и он был объяснен эффектом диполярного уширения как следствия сокращения подвижности некоторых из этих преимущественно гидрофобных дендримеров[29].

1Н- и 13С-ЯМР спектры дендримеров 16-27 имеют картины резонанса, идентичные с таковыми для их прекурсоров 1-12, для карбосиланового скелета, хотя нарастание уширения сигналов наблюдается с повышением генерации.

Как и для дендримеров с концевыми аминогруппами, для этих производных здесь подробно описано отнесение сигналов внешних групп только для производных 16-21, с выполнением отнесения в части производных подобным образом.

Внешние группы SiOCH2CH2NMe3+I- проявляются широкими мультиплетами с центрами при 3,94 (для дендримеров 16, 18 и 20) или 4,12 млн-1 (для дендримеров 17, 19 и 21), определимыми по сигналам метиленовых протонов -ОСН2- групп, и при 3,45 (для дендримеров 16, 18 и 20) или 3,56 млн-1 (для дендримеров 17, 19 и 21), которые отнесены к протонам фрагмента -CH2N-. Кватернизация аминогрупп приводит к слабопольному сдвигу на 0,3-0,4 млн-1 сигнала -ОСН2-, тогда как метиленовые протоны -CH2N- групп сдвигаются приблизительно на 1 млн-1. Метильные группы, непосредственно связанные с атомами азота, дают 1Н- и 13С-ЯМР сигналы с центрами при 3,18 и 52,6 млн-1, соответственно, что предполагает слабопольный сдвиг относительно сигналов, наблюдаемых в дендримерах с концевыми аминогруппами 1-6. Эти вариации находятся в соответствии с присутствием положительного заряда на атоме азота в дендримерах с концевыми аммонийными группами 16-21.

Примеры 28-30

Пример 28.- Синтез 1G-[Si(CH 2 ) 3 NH 3+ Cl - ] 4 (28)

1,2 мл (1,2 ммол) одномолярного (1М) раствора HCl в Et2O было добавлено к раствору соединения 13 (0,17 г, 0,26 ммол) в 40 мл Et2O. Реакционная смесь выдерживалась при комнатной температуре и постоянном перемешивании в течение 2 ч, после чего наблюдалось появление белого осадка. Растворитель и избыток HCl удаляются в вакууме, и этим путем 28 получается в виде белого твердого вещества с количественным выходом. Структура этого дендримера представлена в фиг. 2b.

1Н-ЯМР (D2O): δ 2,74 (2H,т, CH2N), 1,45 (2H, м, SiCН2СH 2СН2N), 1,19 (2H, м, SiCН2СH 2СН2Si), 0,38 (6H, т, CH2Si), -0,19 (6H, с, SiMe2). 13C{1H}-ЯМР (D2O): δ 42,0 (CH2N), 21,3 (SiCH2CH2CH2N), 18,8, 18,0, 16,6 (SiCH2CH2CH2Si), 11,2 (SiCH2CH2CH2N), -4,4 (SiMe2). Элементный анализ для С32Н84Н4Сl4Si5. Вычислено %: C, 47,61; H, 10,49; N, 6,94. Найдено %: C, 48,57; H, 10,46; N, 6,82.

Пример 29.- Синтез 2G-[Si(CH 2 ) 3 NH 3+ Cl - ] 8 (29)

Дендример второй генерации 29 был получен согласно методике, подобной той, какая описана для 28, исходя из 14 (0,09 г, 0,05 ммол) и 0,6 мл 1М раствора HCl в эфире (0,06 ммол). Этим путем соединение 29 было приготовлено в виде светло-желтого твердого вещества (0,06 г; 55%). Структура этого дендримера представлена в фиг. 2b.

1Н-ЯМР (D2O): δ 2,74 (2H, т, CH2N), 1,47 (2H, м, SiCH 2 CH 2 CH2 N), 1,16 (4H, м, SiCН2СH 2СН2Si, 0,38 (16H, т, CH2Si), -0,19 (6H, с, SiMe2), -0,22 (3H, с, SiMe). 13C{1H}-ЯМР (D2O): δ 42,0 (CH2N), 21,8 (SiCH2CH2CH2N), 2,5-17,0 (SiCH2CH2CH2Si), 12,01 (SiCH2CH2CH2N), 3,23 (SiMe2), -4,2 (SiMe2). Элементный анализ для C80H204N8Cl8Si13. Вычислено %: C, 49,86; H, 10,67; N, 5,81. Найдено %: C, 49,79; H, 10,18; N,5,76.

Пример 30.- Синтез 3G-[Si(CH 2 ) 3 NH 3+ Cl - ] 16 (30)

Дендример третьей генерации 30 был получен согласно методике, подобной той, какая описана для 28, исходя из 15 (0,060 г, 0,018 ммол) и 0,30 мл 1М раствора HCl в эфире (0,30 ммол). Этим путем 30 был приготовлен в виде светло-желтого твердого вещества (0,054 г, 78%).

1Н-ЯМР (D2O): δ 2,74 (8H, т, СH 2N), 1,45 (8H, м, SiCН2СH 2СН2N), 1,20 (14H, м, SiCН2СH 2СН2Si) 0,39 (36H, м, СH 2 связанный с Si), -0,19 (24H, с, SiMe2), -0,10 (9H, с, SiMe). 13C{1H}-ЯМР (CDCl3): δ 42,0 (CH2N), 21,3 (SiCH2CH2CH2N), 18,9, 17,9, 16,5, (SiCH2CH2CH2Si), 11,3 (SiCH2CH2CH2N), -4,4 (SiMe2), -4,8 (SiMe). Элементный анализ для C176H444N16Si29. Вычислено %: C, 55,44; H, 11,74; N, 5,88. Найдено %: C, 56,16; H, 11,98; N,6,01.

Исследования биосовместимости новых дендримеров, охарактеризование связи с полианионами и белками плазмы и биологическое поведение дендриплексов

Как показано ранее, один из аспектов изобретения состоит в фармацевтических композициях, которые содержат по меньшей мере один дендример согласно изобретению, либо вместе с еще одной/другой субстанцией(ями) анионного характера, представляющей/представляющими фармацевтический интерес, который сопровождает ее в качестве переносчика для облегчения транспорта в кровотоке до целевых клеток, в которых она/они проявляет/проявляют свой эффект, защищая ее/их от взаимодействия с белками плазмы, с которыми они могли бы связаться или которые могли бы повлиять на их стабильность, либо как активная субстанция со способностью вмешиваться в жизненный цикл микроорганизма, вызывающего болезнь, чье воздействие может быть предотвращено, уменьшено или устранено одним или более дендримерами согласно изобретению. В одном из предпочтительных вариантов осуществления этого аспекта изобретения эта(эти) молекула(молекулы) анионного характера, для которой/которых один или более дендримеров согласно изобретению служат переносчиком, представляет собой олигодезоксирибонуклеотид (ODN), преимущественно антисмысловый ODN, или двухцепочечная молекула ДНК большой длины или интерференционная РНК. Применение дендримера согласно изобретению или композиций, которые содержат их, для предупреждения или лечения заболеваний, вызываемых болезнетворными микроорганизмами или генетическими нарушениями, также относится к аспектам изобретения.

Поэтому было решено протестировать биосовместимость новых предложенных дендримеров, охарактеризовать их связывание с полианионами и белками плазмы и проанализировать биологическое поведение комплексов дендриплексного типа, образованных между дендримерами согласно изобретению и избранными полианионами. Дендримеры, которые были избраны для проведения этих испытаний, таковы.

Дендримеры:

IM8:
2G-[Si(OCH2CH2NMe3+I-)]8 (18)
Молекулярная масса Mw = 3011 г/моль; 8 положительных зарядов
IM16:
2G-[Si(OCH2CH2NMe3+I-)2]8 (19)
Молекулярная масса Mw = 4731,59 г/моль; 16 положительных зарядов
Phe:
2G-[Si(ОСН2-(С6Н3)-3,5-(ОСН2СН2NMe3+I-)2)]8 (23)
Молекулярная масса Mw = 5692,80 г/моль; 16 положительных зарядов
NN:
2G-[Si(O(CH2)2N(Me)(CH2)2NMe3+I-)]8 (26)
Молекулярная масса Mw = 3468,08 г/моль; 8 положительных зарядов
CINH4:
2G-[Si(CH2)3NH3+Cl-]8 (29)
Молекулярная масса Mw = 1927,6 г/моль; 8 положительных зарядов
SF (Superfect® (активированный РАМАМ-дендример, Квиген, Кроули, Великобритания), 140 концевых аминогрупп, молекулярная масса Mw = 35000

G4: РАМАМ-дендример четвертой генерации; фирма Aldrich Chemical Co., Милуоки, Висконсин, США); 140 концевых аминогрупп; молекулярная масса Mw = 14215

Два последних дендримера, Superfect и G4, являются коммерческими РАМАМ-дендримерами, которые используются для сравнения с карбосилановыми дендримерами согласно изобретению.

Физико-химические свойства дендримеров (CBS): растворимость в воде

Все карбосилановые дендримеры согласно изобретению являются водорастворимыми при концентрации, употребляемой для исходных растворов (2 мг/мл) при спокойном перемешивании, без необходимости нагревания.

Для выполнения экспериментов все использованные CBS были ресуспендированы при данной исходной концентрации (2 мкг/мкл ≡ 2 мг/мл).

Пример 31: Образование комплекса между CBS и ODN

- Использованные ODN

Использованные олигонуклеотидные последовательности представляли собой антисмысловые последовательности (комплементарные), направленные против РНК вируса ВИЧ. Длина варьировала от 15 до 28 оснований с фосфоротиолатной природой. Конкретные использованные ODN и их последовательности показаны ниже в Таблице 1.

Таблица 1
Использованные ODN
Наименование Антисмысловые последовательности 5'-3' Число оснований Молекулярная масса, г/моль
A) GF антисмысловый
(anti-gag)
CTCTCGCACCCATCTCTCTCCTTCT (SEQ ID NO:1) 25 8112,5
B) RF
антисмысловый
(anti-Rev)
TCGTCGCTGTCTCCGCTTCTTCCTGCCA (SEQ ID NO:2) 28 9086,0
C) PPT
анти-иРНК
AATTTTCTTTTCCCCCCT
(SEQ ID NO:3)
18 5841,0
D) PPT-TFO
триплекс-формирующий олигонуклеотид
TTTTCTTTTGGGGGG
(SEQ ID NO:4)
15 4867,5
e) TAR
антисмысловый
(anti-TAR)
GCTCCCGGGCTCGACC
(SEQ ID NО:5)
16 5192,0

Некоторые из ODN были использованы с флуоресцентными метками на 5'конце. Это обозначается добавлением буквы “F” к их символу. Так, “GF” означает anti-gag олигонуклеотид ODN с флуоресцентной меткой на 5' конце, тогда как “RF” означает anti-Rev олигонуклеотид ODN с флуоресцентной меткой на конце 5'.

Все использованные ODN были ресуспендированы при концентрации 1 мкг/мкл.

- Индикация комплексов в агарозных гелях

Применение агарозных гелей для исследования формирования комплексов между дендримерами РАМАМ-типа и ДНК плазмы или в форме ODN с помощью изотопной маркировки их известно. Основываясь на этом типе подходов, были предприняты попытки приготовить гели, которые позволяли бы изучать их свойства без применения, насколько возможно, радиоактивных изотопов.

Различные концентрации агарозы были использованы, чтобы показать миграцию ODN и дендриплексов, имея в виду малый размер использованных ODN. Наконец, 3%-ная концентрация агарозы в буфере ТАЕ 1х была избрана как наилучшая. Миграция нефлуоресцентных ODN сравнивалась с флуоресцентными ODN, оба типа мигрировали на одинаковую высоту, но последний значительно усиливал воспринимаемый сигнал. Используя их, можно было избежать изотопной маркировки ODN. Для приготовления этих гелей была изготовлена двойная лунка, чтобы обеспечить загрузку объемов 60 мкл, из которых 50 мкл представляли собой объем смеси образцов в среде RPMI и 10 мкл составлял буфер с глицерином. В качестве размерного маркера был использован лэддер из 100 пар оснований (фирмы Gibco BRL®).

- Образование комплексов

Для формирования комплексов во всех выполненных тестах как на гелях, так и на клетках, было принято во внимание соотношение между числом положительных и отрицательных зарядов в названном комплексе. Как сообщалось различными авторами в исследованиях с РАМАМ-дендримерами, необходимо, чтобы формируемый комплекс имел избыток положительного заряда для облегчения его связывания с гликопротеинами клеточной мембраны, заряженными отрицательно, тем самым запуская способ эндоцитоза. Подобным образом, избыток положительного заряда добавляется для обеспечения формирования комплекса дендример-ДНК. Поэтому комплексы между CBS-дендримерами и различными нуклеиновыми кислотами были сформированы в избыточном числе положительных зарядов (вносимых дендримером CBS) по сравнению с отрицательными зарядами (вносимых олигонуклеотидом ODN). Тем не менее, были протестированы различные соотношения зарядов с выполнением расчетов, основанных на числе дендримерных зарядов (фиксированном) и числе отрицательных зарядов от ODN (также фиксированном). Соотношение положительных/отрицательных зарядов, равное 2/1, было зафиксировано как достаточное во всех дендримерах для формирования комплексов с общим положительным зарядом, хотя в некоторых экспериментах был создан баланс равного числа отрицательных зарядов и положительных зарядов или же избыток отрицательных зарядов.

Для SF было использовано зарядовое отношение, предложенное изготовителем, и для G4 РАМАМ был использован молярный избыток 100 к 1 в пользу дендримера РАМАМ-типа, согласно сведениям, предложенным Сато и коллегами (Sato et al., Clin. Cancer Res., 2001, Nov., 7(11), pp. 3606-3612).

Во всех тестах для формирования комплекса был использован объем 60 мкл с употреблением фенольного красного без RPMI-сыворотки как среды-носителя.

- Электрофорез образованных комплексов

Для испытания формирования комплексов были использованы дендримеры согласно изобретению IM8, ClNH4, NN, Phe и IM16.

Результаты электрофореза, проведенного с образцами, полученными при смешении различных ODN и различных дендримеров, показаны на фиг. 3. Образцы, введенные в различные гели, которые там обозначены, таковы:

IM8

- Фиг. 3а. Образование комплекса между IM8 и ODN GF. Образцы, подвергнутые электрофорезу, были следующими:

Дорожка 1: лэддер из 100 пар оснований
Дорожка 2: 4 мкл GF+ 4,52 мкл IM8+ 91,48 мкл RPMI (+/-)=2/l
Дорожка 3: 4 мкл GF+ 9,03 мкл IM8+ 86,97 мкл RPMI (+/-)=4/l
Дорожка 4: 4 мкл GF+ 45,2 мкл IM8+ 50,8 мкл RPMI (+/-)=20/1
Дорожка 5: 4 мкл GF+ 90,4 мкл IM8+ 5,6 мкл RPMI (+/-)=40/1
Дорожка 6: 4 мкл GF+ 96 RPMI
Дорожка 7: 4,52 мкл IM8+ 95,48 мкл RPMI
Дорожка 8: 9,03 мкл IM8+ 90,97 мкл RPMI
Дорожка 9: 45,2 мкл IM8+ 54,8 мкл RPMI
Дорожка 10: 90,4 мкл IM8+ 9,6 мкл RPMI

Результаты электрофореза показыват, что IM8 способен удерживать ДНК. Чем выше заряд, тем сильнее комплекс мигрирует к отрицательному полюсу, пока не достигает предела, при котором уже несущественно, насколько увеличен положительный заряд (количество дендримера), и уже больше не мигрирует (вероятно, все молекулы ДНК уже сформировали комплекс с CBS-IM8, или поскольку размер пор в геле не позволяет этого).

- Фиг. 3b. Электрофорез образцов с IM8 и олигонуклеотидами ODN различных размеров (зарядовое отношение 2/1). Образцы, подвергнутые электрофорезу, были следующими:

Дорожка 1: лэддер из 100 пар оснований
Дорожка 2: RF: 4,5 мкл+ 56 мкл RPMI
Дорожка 3: RF: 4,5 мкл+ 5,3 мкл IM8+ 50 мкл RPMI
Дорожка 4: PPT 3 мкл+ 57 мкл RPMI
Дорожка 5: PPT 3 мкл+ 3,4 мкл IM8+ 54 мкл RPMI
Дорожка 6: PPT-TFO 2,5 мкл + 58 мкл RPMI
Дорожка 7: PPT-TFO 2,5 мкл + 2,8 мкл IM8+ 55 мкл RPMI
Дорожка 8: TAR 2,6 мкл + 57 мкл RPMI
Дорожка 9: TAR 2,6 мкл + 3 мкл IM8 + 55 мкл RPMI

- Результаты электрофореза показывают, что IM8 был способен поддерживать миграцию всех ODN. Это является первым признаком того, что длина олигонуклеотидов ODN не является определяющим фактором формирования комплекса.

ClNH4

- Фиг. 3с. Образование комплекса между ClNH4 и ODN RF. Образцы, подвергнутые электрофорезу, были следующими:

Дорожка 1: RPMI контрольная среда
Дорожка 2: RF 4,5 мкл + 3,3 мкл ClNH4 + 52 мкл RPMI (+/-)= 2
Дорожка 3: RF 4,5 мкл + 55 мкл RPMI
Дорожка 4: RF 2,25 мкл + 3,3 мкл ClNH4 + 55 мкл RPMI (+/-)= 4
Дорожка 5: RF 2,25 мкл + 58 мкл RPMI
Дорожка 6: RF 1,28 мкл + 3,3 мкл C1NH4 + 56 мкл RPMI (+/-)= 7
Дорожка 7: RF 1,28 мкл + 58 мкл RPMI
Дорожка 8: 3,3 мкл ClNH4 + 57 мкл RPMI
Дорожка 9: лэддер из 100 пар оснований

Согласно полученным результатам, ClNH4 способен удерживать ДНК также при всех оцененных зарядовых отношениях.

NN и Phe

- Фиг. 3d. Образование комплекса между ODN RF и дендримерами NN или Phe. Образцы, подвергнутые электрофорезу, были следующими:

Дорожка 1: 4,5 мкл RF + 6 мкл G2 NN + 50 мкл RPMI (+/-)= 2
Дорожка 2: 4,5 мкл RF + 21 мкл G2 NN + 35 мкл RPMI (+/-)= 7
Дорожка 3: 1,3 мкл RF + 6 мкл G2 NN + 53 мкл RPMI (+/-)= 7
Дорожка 4: 2,25 мкл RF + 3 мкл G2 NN + 55 мкл RPMI (+/-)= 2
Дорожка 5: 2,25 мкл RF + 10,5 мкл G2 NN + 48 мкл RPMI (+/-)= 7
Дорожка 6: 0,64 мкл RF + 3 мкл G2 NN + 56 мкл RPMI (+/-)= 7
Дорожка 7: 2,25 мкл RF + 57 мкл RPMI
Дорожка 8: 4,5 мкл RF + 5 мкл G2 Phe + 55 мкл RPMI (+/-)= 2
Дорожка 9: 4,5 мкл RF + 17,5 мкл G2 Phe + 38 мкл RPMI (+/-)= 7
Дорожка 10: 1,3 мкл RF + 5 мкл G2 Phe + 54 мкл RPMI (+/-)= 7
Дорожка 11: 2,25 мкл RF + 2,5 мкл G2 Phe + 55 мкл RPMI (+/-)= 2
Дорожка 12: 2,25 мкл RF + 8,75 мкл G2 Phe + 50 мкл RPMI (+/-)= 7
Дорожка 13: 0,64 мкл RF + 2,5 мкл G2 Phe + 57 мкл RPMI (+/-)= 7

Результаты этого электрофореза также демонстрируют, что как NN, так и Phe также способны формировать комплексы с ODN.

IM16

- Фиг. 3е. Образование комплекса между ODN РРТ, дендримерами IM8 и IM16 и соответствующим мономером, из которого был образован дендример. Образцы, подвергнутые электрофорезу, были следующими:

Дорожка 1: лэддер из 100 пар оснований
Дорожка 2: PPT 2,57 мкл + 3 мкл IM8 + 54 мкл RPMI
Дорожка 3: PPT 2,57 мкл + 2,35 мкл IM16 + 55 мкл RPMI
Дорожка 4: PPT 2,57 мкл + 1,8 мкл мономер + 55 мкл RPMI
Дорожка 5: PPT 2,57 мкл + 57 мкл RPMI

На дорожке, по которой двигался образец, который содержал ODN и дендример IM16, последний также способен удерживать ДНК.

Поэтому дендримеры CBS второй генерации были способны поддерживать миграцию ДНК к положительному полюсу, что является показателем образования электростатического связывания CBS и ODN во всех случаях: низкая генерация дендримера CBS не является помехой для удержания ДНК. Дендримеры без ДНК в своей части эмитируют слабый, почти неразличимый сигнал.

- Исследование сохранности дендримера в образованном комплексе

Способ синтеза дендримеров CBS, использованный в работе, начинается с исходного ядра общей структуры, который завершается функционализацией по периферии применением различных функциональных групп, которые являются такими, какие сообщают дендримерам положительный заряд и определяют различия между ними, тогда как ядро имеет неполярную природу. Поскольку некоторые из связей с функциональными группами, использованными для дендримерного ядра, могут быть нестабильными в водном растворе, были проведены испытания для определения, остается ли ДНК в агарозном геле и, тем самым, может ли быть сохранен сформированный комплекс между CBS и ДНК при полной структуре дендримера, или, напротив, концевые функциональные группы, которые ответственны за удержание ДНК, покидают частицу дендримерного остова. Для этого были использованы гели, в которых были сформированы комплексы между олигонуклеотидами ODN и цельными CBS, и комплексы, образованные предположительно между олигонуклеотидами ODN и концевыми функциональными группами, которыми был функционализирован карбосилановый скелет, в этом случае кватернизованным диметилэтаноламином. Как уже отмечалось ранее, те положительно заряженные молекулы, которые связаны с дендримером как концевые функциональные группы, являются теми фрагментами, которые сообщают дендримеру его заряд. В качестве контроля были сравнены смеси дендримеров с ODN, мономеров с ODN и олигонуклеотиды ODN сами по себе. Соответствующий гель показан на фиг. 3е, которая уже упоминалась, где образцы, которые сравниваются и подвергаются электрофорезу, таковы:

Контроль 1: лэддер из 100 пар оснований
Дорожка 2: Контроль со средой RPMI без дендримера или олигонуклеотида
Дорожка 3: PPT 2,57 мкл + 3 мкл IM8 + 54 мкл RPMI
Дорожка 4: PPT 2,57 мкл + 2,35 мкл IM16 + 55 мкл RPMI
Дорожка 5: PPT 2,57 мкл + 1,8 мкл мономер + 55 мкл RPMI
Дорожка 6: PPT 2,57 мкл + 57 мкл RPMI

Результаты этого теста ясно показывают, что полностью завершенная дендримерная структура необходима для удержания ДНК, а мономеры, несмотря на их положительный заряд, неспособны удерживать ДНК. Поэтому при этих концентрациях дендримерные структуры были сохранены невредимыми.

Пример 32: Стабильность дендриплексов при различных значениях рН

Исследования стабильности были проведены на комплексах при различных значениях рН, чтобы определить, как изменения рН могут влиять на комплекс, поскольку существуют различные анатомические, тканевые или клеточные локализации, в которых величина рН смещена в кислотную или щелочную область. Примерами являются желудочная кислотная среда, щелочные панкреатические секреты в тонкой кишке или, на клеточном уровне, эндосомо-лизосоматические отношения, где величина рН меняется от физиологической рН (7,35-7,45) до кислотной рН около 4. Поэтому интересно знать, в каком интервале значений рН может быть сохранен ДНК-комплекс с различными использованными дендримерами CBS. Комплексы были сформированы согласно обычному способу, и объемы были добавлены с избытком различных растворов при различных рН.

Поэтому для каждого из дендримеров Phe, ClNH4, NN, IM8 и IM16, согласно Примеру 31, были приготовлены 7 растворов дендриплексов, образованных с фосфоротиоатом (РРТ), с зарядовым отношением 2/1 и с различными значениями рН: 2,8; 2,7; 4,7; 5,7; 6,4; 7,4; 8.

Полученные результаты показаны в электрофорезных гелях, которые представлены на фиг. 4, в которой высота полосы нормальной миграции ODN показана стрелками в нижней части гелей. Образцы были размещены слева направо по порядку возрастания величины рН. Никаких образцов не было образовано в лунках, обозначенных крестиком (х).

В сответствии с полученными результатами, в то время как комплексы, образованные между дендримерами ClNH4 и Phe и ODN, были стабильны при всех испытанных величинах рН, комплексы, сформированные между NN и ODN, были лабильными при кислотном рН (ниже чем 5,7), как показано появлением сигнала в зоне миграции ODN в лунках, обозначенных стрелками в геле, соответствующем фиг. 4b. В случае IM8 и IM16 происходило нечто подобное: комплексы IM8-ODN диссоциируют при рН<4,7; комплексы, образованные IM16, диссоциируют при рН<5,7. Однако при щелочном рН все комплексы были стабильными, так как никаких сигналов не появлялось в дорожках, соответствующих величинам рН 7,4 и рН 8.

Это означает, что в кислотной среде (желудок, эндосома-лизосома) комплекс между CBS NN, CBS IM8 и CBS IM16 с ODN будет постепенно высвобождать последний. Этот факт был бы хорошим для тех вариантов применения, в которых требуется контролируемое выделение рН-зависимого ODN. Это также значит, что если дендример внутри клетки еще был связан с ODN, то комплекс должен разрушиться по достижении эндосомо-лизосомного пузырька. Напротив, в щелочной среде (соки тонкой кишки) он должен сохраняться стабильным.

Пример 33: Стабильность дендриплексов в водном растворе с течением времени

Различные образцы дендриплексов были приготовлены в водном растворе, будучи сформированными между ODN РРТ и дендримерами IM8, IM16 и NN при зарядовом отношении 2/1, согласно примеру 31, и электрофорез был проведен после разных отрезков времени с момента приготовления образцов, а именно 0 часов, 6 часов и 24 часа. В течение этих периодов дендриплексы выдерживались в условиях, которые имитируют физиологические условия: температура 37°С, в 5%-ной атмосфере СО2. Результаты показаны в фиг. 5, в которой гель фиг. 5а соответствует образцу при 0 часов, гель фиг. 5b отвечает образцам после 6 часов, и гель фигуры 5с показывает образцы через 24 часа. В трех случаях, а, b и с, образцы проявляются на дорожках в следующем порядке:

Дорожка 1: лэддер со 100 парами оснований

Дорожка 2: IM8 + РРТ

Дорожка 3: IM16 + РРТ

Дорожка 4: NN + РРТ

Дорожка 5: РРТ

Гели показывают, что имеет место постепенное выделение со временем олигонуклеотида ODN из дендриплексов, сформированных с любым из трех обсуждаемых дендримеров. Это является хорошим признаком для их применения для замедленного высвобождения полианионов.

Пример 34: Стабильность дендриплексов в присутствии белков и детергентов

Связывание с белками плазмы представляет собой одно из препятствий в терапевтическом использовании олигонуклеотидов ODN. Названное связывание снижает биологическую доступность ODN, вынуждая увеличивать дозу, требуемую для его способности оказать желаемое биологическое действие. Этот раздел имеет целью проанализировать влияние присутствия белков в среде на стабильность комплекса и оценить возможность любым путем защитить ODN от связывания с белками плазмы. Эти исследования были проведены на CBS NN с анализом поведения дендриплексов, сформированных в присутствии бычьего сывороточного альбумина (BSA) и анионного детергента PBS.

Были проведены расчеты, необходимые для создания соотношения «дендример/ODN», равного 2/1, и приготовлены следующие образцы, с целью подвергнуть дендриплексы действию присутствующих в различных концентрациях бычьего сывороточного альбумина, полной среды для культивирования с эмбриональной телячьей сывороткой или полной АВ человеческой сыворотки. Приготовленные различные смеси были протестированы на миграцию ДНК и белка в том же 3%-ном агарозном геле с красителем бромид этидия в его составе. Во-первых, была снята фотография геля, экспонированного в ультрафиолетовом свете и затем проявленного 0,5%-ным раствором красителя Paragon Blue (натриевая соль 8-амино-7-(3-нитрофенилазо)-2-(фенацил)-1-нафтол-3,6-дисульфоновой кислоты, фирма Beckman Coulter®) в течение 20 минут (краситель использован, чтобы показать присутствие белков), и гель в завершение был обесцвечен промыванием 10%-ной ледяной уксусной кислотой, с последующим фотографированием цифровой камерой. Результаты показаны на фиг. 6, в которой часть «а» соответствует пятну с Paragon Blue, и часть “b” представляет фотографию геля, снятую в ультрафиолетовом свете. Образцы показаны в следующем порядке:

Дорожка 0: лэддер из 100 пар оснований
Дорожка 1: 2,60 мкл TAR + 3,47 мкл NN + 25 мкл RPMI
Дорожка 2: 2,60 мкл TAR + 3,47 мкл NN + 25 мкл RPMI + 30 мкл PBS-BSA 2%
Дорожка 3: 2,60 мкл TAR + 3,47 мкл NN + 25 мкл RPMI + 30 мкл PBS-BSA 5%
Дорожка 4: 2,60 мкл TAR + 3,47 мкл NN + 25 мкл RPMI + 30 мкл PBS-BSA 10%
Дорожка 5: 2,60 мкл TAR + 3,47 мкл NN + 25 мкл RPMI + 30 мкл SDS 0,5 %
Дорожка 6: 2,60 мкл TAR + 3,47 мкл NN + 25 мкл RPMI + 30 мкл SDS 1%
Дорожка 7: 2,60 мкл TAR + 3,47 мкл NN + 25 мкл RPMI + 30 мкл SDS 2%
Дорожка 8: 2,60 мкл TAR + 3,47 мкл NN + 25 мкл RPMI + 30 мкл полная среда для культивирования
Дорожка 9: 2,60 мкл TAR + 27 мкл RPMI + 30 мкл PBS-BSA 10%
Дорожка 10: 2,60 мкл TAR + 27 мкл RPMI

В первую очередь, наблюдается, что во всех лунках (за исключением обработанных SDS (додецилсульфонат натрия, ДСН)) темные полосы появляются на полпути между свободным ODN и лункой: они представляют собой комплексы красителя Paragon Blue с бромфеноловым голубым, присутствующим во введенном буфере. Более того, во всех дорожках, в которых присутствует альбумин, появляется пятно, соответствующее его проявлению.

В согласии с результатами, показанными в гелях, могут быть сделаны следующие выводы:

а) ODN образует комплексы с альбумином, которым соответствует полоса в геле, проявленная красителем бромид этидия, которая была обозначена в их окружении.

b) Альбумин в повышающихся концентрациях не способен диссоциировать комплекс (2,3,4). Более того, альбумин и не должен бы извлекать ODN из дендример-ДНК-комплекса, поскольку в противном случае он мигрировал бы до самого края.

с) Комплекс диссоциирует в присутствии анионного детергента (SDS) при всех испытанных концентрациях.

Пример 35: Стабильность NN-ODN дендриплекса в присутствии сыворотки

С намерением проследить стабильность дендриплексов в присутствии сыворотки во времени, был выполнен тест, в котором к образцам была добавлена полная среда для культивирования, которая содержала 10% эмбриональной телячьей сыворотки (FCS). Были приготовлены следующие образцы с TAR в качестве ODN:

1. TAR 2,59 мкл + NN 3,47 мкл + 54 мкл RPMI (+/-)=2/1 + 100 мкл полной среды для культивирования
2. TAR 2,59 мкл + NN 1,73 мкл + 55 мкл RPMI (+/-)=1/1
3. TAR 2,59 мкл + NN 0,86 мкл + 57 мкл RPMI (+/-)=0,5
4. TAR 2,59 мкл + 54 мкл RPMI

Как показано, через 20 минут после приготовления к образцам 1, 2 и 3 были добавлены 100 мкл полной среды для культивирования. Из каждого из этих образцов были взяты аликвоты по 45 мкл через 40 минут, 4 часа и 17 часов, и они были подвергнуты электрофорезу в агарозном геле. Образцы были помещены в гель в порядке следования их нумерации слева направо, с предварительным помещением лэддера со 100 парами оснований (100 bp) в качестве маркера. В последней точке (17 часов) только комплекс с отношением 2/1 был протестирован на ODN без NN. Результаты показаны на фиг. 7, в которой они представлены обозначенными временем на каждой из лунок, соответствующих образцам с TAR+NN с отношением 2/1.

Из ранее упомянутых подробностей могут быть выведены следующие наблюдения:

а) через 40 минут наблюдается, что только зарядовое отношение 2/1 способно полностью удержать ODN, но 1/1 и тем более 0,5/1 отношение этого не может;

b) через 17 часов NN-дендример высвобождает ODN, который мигрирует к аноду;

с) нет помех от белков полной среды для стабильности комплекса. С другой стороны, высвобожденный ODN мигрирует на том же самом уровне, как и ODN сам по себе, который показывает, что ODN не образует комплексы с любым из белков, присутствующих в среде (10%-ная эмбриональная телячья сыворотка, антибиотик и L-глутамин).

Короче говоря, в присутствии 10%-ной FCS комплекс и ODN ведут себя так, как если бы среда, использованная для смесей, содержала бы только RPMI, не образуя комплексов с белками плазмы, и NN высвобождает ODN через 17 часов.

Затем было проверено, как комплекс и ODN ведут себя в присутствии человеческой сыворотки. Для этого были выполнены исследования с человеческой сывороткой АВ.

В первую очередь, поведение ODN без дендримера было проверено в присутствии человеческой сыворотки. Для выполнения этого образцы со следующими составами были подвергнуты электрофорезу:

Дорожка 0: лэддер из 100 пар оснований
Дорожка 1: Контроль (сыворотка АВ)
Дорожка 2: 2,6 мкл TAR + 17 мкл RPMI + 40 мкл сыворотка АВ
Дорожка 3: 2,6 мкл TAR + 37 мкл RPMI + 20 мкл сыворотка АВ
Дорожка 4: 2,6 мкл TAR + 47 мкл RPMI + 10 мкл сыворотка АВ
Дорожка 5: 2,6 мкл TAR + 57 мкл RPMI

Электрофорезные гели, полученные после 20-минутной выдержки для эффективного взаимодействия ODN с белками сыворотки перед помещением образцов в гель, показаны на фиг. 8. На ней часть «а» показывает фотографию, сделанную в УФ свете, с появлением полос, проявленных красителем бромид этидия, и часть “b” показывает тот же гель, обработанный красителем Paragon Blue®. Локализация полос, соответствующих ODN в части «а» на той же высоте, как и белковых полос в части “b”, демонстрирует связывание ODN белками человеческой сыворотки.

Во вторую очередь, было проверено влияние присутствия белков человеческой сыворотки на ODN-NN-дендриплекс. Была предпринята попытка проверить, будет ли дендример защищать ODN от связывания с белками; для выполнения этого дендриплексы, ODN и дендримеры без ДНК были инкубированы с тремя концентрациями человеческой сыворотки АВ: через 20 минут после проведения смешения ODN, дендримера и RPMI без сыворотки к смеси были добавлены 100 мкл RPMI, либо чистой, либо с сывороткой АВ с концентрацией 5%, 10% или 20%. Электрофорез был выполнен через 0 часов, 4 часа и 24 часа на смеси дендримера и ODN, с помещением образцов в следующем порядке:

0 часов
...20 минут => 100 мкл RPMI
Дорожка 1. 2,43 мкл PPT-TFO + 3,25 мкл NN + 54 мкл RPMI чистый
Дорожка 2. 2,43 мкл PPT-TFO + 3,25 мкл NN + 54 мкл PRMI 5%
Дорожка 3. 2,43 мкл PPT-TFO + 3,25 мкл NN + 54 мкл RPMI 10%
Дорожка 4. 2,43 мкл PPT-TFO + 3,25 мкл NN + 54 мкл RPMI 20%
Дорожка 5. 2,43 мкл PPT-TFO + 57 мкл RPMI 5%
Дорожка 6. 2,43 мкл PPT-TFO + 57 мкл RPMI 10%
Дорожка 7. 2,43 мкл PPT-TFO + 57 мкл RPMI 20%
Дорожка 8. 2,43 мкл PPT-TFO + 57 мкл RPMI чистый
4 часа
...20 минут => 100 мкл RPMI
Дорожка 1. Контроль (60 мкл RPMI) 20%
Дорожка 2. 2,43 мкл PPT-TFO + 3,25 мкл NN + 54 мкл RPMI чистый
Дорожка 3. 2,43 мкл PPT-TFO + 3,25 мкл NN + 54 мкл PRMI 5%
Дорожка 4. 2,43 мкл PPT-TFO + 3,25 мкл NN + 54 мкл RPMI 10%
Дорожка 5. 2,43 мкл PPT-TFO + 3,25 мкл NN + 54 мкл RPMI 20%
Дорожка 6. 2,43 мкл PPT-TFO + 57 мкл RPMI 5%
Дорожка 7. 2,43 мкл PPT-TFO + 57 мкл RPMI 10%
Дорожка 8. 2,43 мкл PPT-TFO + 57 мкл RPMI 20%
Дорожка 9. 2,43 мкл PPT-TFO + 57 мкл RPMI чистый
Дорожка 10. 3,25 мкл NN + 57 мкл RPMI 5%
Дорожка 11. 3,25 мкл NN + 57 мкл RPMI 10%
Дорожка 12. 3,25 мкл NN + 57 мкл RPMI 20%
24 часа
...20 минут => 100 мкл RPMI
Дорожка 1. Контроль (60 мкл RPMI) 20%
Дорожка 2. 2,43 мкл PPT-TFO + 3,25 мкл NN + 54 мкл RPMI чистый
Дорожка 3. 2,43 мкл PPT-TFO + 3,25 мкл NN + 54 мкл RPMI 5%
Дорожка 4. 2,43 мкл PPT-TFO + 3,25 мкл NN + 54 мкл RPMI 10%
Дорожка 5. 2,43 мкл PPT-TFO + 3,25 мкл NN + 54 мкл RPMI 20%
Дорожка 6. 2,43 мкл PPT-TFO + 57 мкл RPMI 5%
Дорожка 7. 2,43 мкл PPT-TFO + 57 мкл RPMI 10%
Дорожка 8. 2,43 мкл PPT-TFO + 57 мкл RPMI 20%
Дорожка 9. 2,43 мкл PPT-TFO + 57 мкл RPMI чистый
Дорожка 10. 3,25 мкл NN + 57 мкл RPMI 5%
Дорожка 11. 3,25 мкл NN + 57 мкл RPMI 10%
Дорожка 12. 3,25 мкл NN + 57 мкл RPMI 20%

Результаты фотографирования гелей в ультрафиолетовом свете показаны на фиг. 9а. Фиг. 9b, в своей части, показывает проявление красителем Paragon Blue геля, соответствующего четырехчасовым образцам.

Результаты показывают, что NN+РРТ-TFO-дендриплекс без сыворотки ведет себя как обычно, высвобождая ODN через 24 часа. После 0 и 4 часов: NN+РРТ-TFO в присутствии сыворотки дает картину электрофореза, отличную от РРТ-TFO в присутствии сыворотки. Последний дает вытянутый и диффузный сигнал, в то время как дендриплекс высвобождает ODN в лунку (за исключением того, когда сыворотка составляет 20%, которая дает слабые выход ODN и связывание с белками). Гели белков наблюдаются (из которых гели, соответствующие 4-часовым образцам, были показаны в качестве примеров, хотя результаты были сходными в гелях для 0 часов и 24 часов), они мигрируют к положительному полюсу (окраска, которая отличает их от лунки); но интересно наблюдать в ВЕ геле, что белки образуют комплекс с ODN, когда он индивидуален, без дендримеров. Белки перемещаются на одинаковую высоту во всех экспериментальных условиях, независимо от присутствия дендримера (который не управляет удержанием белка в лунке, не формируя комплекса с белком). Присутствие белка не оказывает влияния на извлечение ODN из ODN-дендримерного комплекса; через 24 часа комплекс начинает выделять ODN, но он не мигрирует ниже подобно контрольному ODN без сыворотки, а вместо этого немедленно удерживается в своей миграции белками, давая тот же самый удлиненный и диффузный сигнал, как и ODN без дендримера NN с сывороткой.

Поэтому представляется, что существует период между 4 и 24 часами, в котором дендример может защищать ODN от связывания с белками. После этого времени он высвобождает его. Это должно давать ODN время быть связанным с дендримером при прохождении из внутрисосудистого во внесосудистое пространство, с уверенностью, что дендример должен позднее высвободить ODN в контролируемом режиме, спустя время, дающее ему благоприятную возможность выполнить свою функцию. Главным белком сыворотки является альбумин, который имеет два отрицательных домена, каковые сообщают ему общий отрицательный заряд, но он имеет также и положительный заряд, который связывает его с ODN. Гидрофобные участки дендримера CBS, вероятно, не взаимодействуют с гидрофобными участками альбумина. Названное взаимодействие необходимо для создания устойчивой связи между дендримером и белком, и по этой причине они не образуют комплексов; однако электростатическая связь между дендримером и ODN защищает последний от связывания с положительно заряженным участком альбумина.

Пример 36: Способность формировать комплексы с крупноразмерными ДНК

Предварительные испытания были проведены с плазмидами с CBS IM8, каковой способен к формированию комплексов с использованной плазмидой, Nf-kappaB-luc. В форме, подобной предыдущим экспериментам, электрофорез был проведен с различными образцами, помещая их на маркер типа лэддера, который измеряет до 5000 пар оснований в лунке, предшествующей ему. Образцы были следующими:

Дорожка 1. 1 мкл p + 0,58 мкл IM8 (+/-)= 2/1 + 28 мкл RPMI
Дорожка 2. 1 мкл p + 1,74 мкл IM8 (+/-)= 6/1 + 28 мкл RPMI
Дорожка 3. 1 мкл p + 2,9 мкл IMS (+/-)= 10/1 + 27 мкл RPMI
Дорожка 4. 1 мкл p + 29 мкл IM8 (+/-)= 100/1+ 0 мкл RPMI
Дорожка 5. 1 мкл p (0,43 мкл p)
Дорожка 6. 2 мкл p,
где р = плазмида.

Фотография электрофореза показана на фиг. 10. Она демонстрирует, что зарядовое отношение А (+/-)=6/1 не оказывает влияния на поддержание миграции ДНК.

Пример 37. Способность образовывать комплексы с малыми интерферирующими РНК (siRNA)

Предварительные испытания были также проведены для оценки удерживающей способности малых интерферирующих РНК (siRNA). Нижеприведенная анти-CD4 siRNA была использована для этой цели:

5'-GAUCAAGAGACUCCUCAGUdGdA-3' (SEQ ID NO:6),

поставляемая фирмой Ambion, Inc. Использованный гель представлял собой матричный гель, гель, приготовленный из смеси 25 или 50% агарозы и линейного акриламида, полученной после нагревания и последующей маркировки образцов красителем бромид этидия. В этом случае, конкретно, был использован гель из 50% матрицы, 0,7% агарозы и 50% буфера ТАЕ 2Х.

Образцы, подвергнутые электрофорезу, были следующими:

Дорожка 1: RPMI

Дорожка 2: 1 мкл siRNA + 1,58 мкл IM8 + 48 мкл RPMI (+/-)=2

Дорожка 3: 1 мкл siRNA + 4,74 мкл IM8 + 44 мкл RPMI (+/-)=6

Дорожка 4: 1 мкл siRNA + 49 мкл RPMI

Фотография электрофорезного геля, показанная на фиг. 11, вновь демонстрирует, что образование комплекса позитивно.

Испытания токсичности

Токсичность различных дендримеров была изучена пятью различными, но взаимодополняющими методами, которые представляют подробности о функциональности клеток, проницаемости мембран и внешнем виде клеток.

Различные методики были использованы, чтобы оценить жизнеспособность в различных аспектах: целостность мембраны (проявление красителем трипановый голубой), апоптоз (маркировка анексином-V-PE и DAPI), некроз (маркировка 7-AAD), МТТ-реагент (он оценивает митохондриальную токсичность), оценка размера и сложности клеток с помощью проточной цитометрии, микроскопия in vivo для оценки подвижности клеток. Эти методики были применены для изучения токсичности ODN, дендримеров и дендриплексов в периферийных кровяных мононуклеарных клетках (РВМС). Дополнительно, токсичность дендримеров для эритроцитов была оценена гемолитическим тестом.

Пример 38: Тесты на РВМС

- Протестированные дендримеры

Была протестирована токсичность дендримеров IM8, IM16, ClNH4, NN, Phe и коммерческих контрольных SF (Superfect) и G4. Различные количества были взяты каждого из них с тем, чтобы конечные концентрации, с которыми клетки были инкубированы, составляли 1 мкМ, 5 мкМ, 10 мкМ, 20 мкМ и 100 мкМ.

- Получение периферийных кровяных мононуклеарных клеток (РВМС)

Кровь была взята от взрослых доноров или из пуповины здоровых новорожденных. Названная кровь была разбавлена наполовину фосфатным буфером (PBS), и смесь была подвергнута градиентному центрифугированию (фиколл-градиент). После названного центрифугирования РВМС-гало было извлечено, и были проведены два последующих цикла промывки-центрифугирования. Полученные в результате клетки РВМС были ресуспендированы в полной культуральной среде с 10% FCS, антибиотиками и глутамином.

- Инкубация с клетками

100 мкл 10%-ной полной среды с эмбриональной телячьей сывороткой, антибиотиками и глутамином были добавлены к объему в 60 мкл RPMI с соответствующим испытуемым дендримером. 160 мкл были затем добавлены к клеткам, высеянным в 340 мкл, тем самым доведением до конечного объема 500 мкл. Клетки были инкубированы этим путем в течение 48 часов, и затем было оценено влияние дендримеров на инкубацию путем визуального обследования и путем оценки митохондриальной активности.

- Результаты визуального обследования

Наблюдения, сделанные при визуальном обследовании, показаны ниже в Таблице 2.

Таблица 2
Результаты визуального обследования РВМС, инкубированных с дендримерами
1 мкМ 5 мкМ 10 мкМ 20 мкМ 100 мкМ
IM8 хорошо хорошо Ослабление двойного лучепреломления, усиление летальности Смерть большого числа клеток Очень мало живых клеток
IM16 хорошо хорошо Клеточные агрегаты + Клеточные агрегаты ++ Клеточные агрегаты +++
ClNH4 хорошо Агрегаты + Многочисленные части мембран Немного клеток с признаками смерти Крупные коричневые комки клеток
NN хорошо хорошо Гораздо лучший внешний вид, чем с предыдущим CBS при этой концентрации Число клеток сокращается, но внешний вид улучшен по сравнению с предыдущим CBS при этой концентрации Очень мало клеток, но с лучшим внешним видом, чем с предыдущим CBS при этой концентрации
Phe хорошо хорошо хорошо Мало клеток Отдельные клетки
SF Агрегаты ++ Агрегаты ++++ Не испытывался Не испытывался Не испытывался
G4 хорошо Агрегаты + Агрегаты ++ Агрегаты +++
Сильная летальность
Крупные темные агрегаты

Из визуального наблюдения сделан вывод, что наименее токсичными дендримерами для лимфоцитов были CBS NN и Phe, два РАМАМ-дендримера, в наименьшей степени токсичных в испытаниях.

- Митохондриальная активность: МТТ

Кривая митохондриальной активности была выведена относительно концентрации дендримеров через 48 часов. Эта методика была использована, чтобы продемонстрировать внутриклеточные вредоносные воздействия на внутренность клеток. Это - колориметрический тест, основанный на селективной способности жизнеспособных клеток восстанавливать бромид 3-(4,5-диметилтиазол-2ил)-2,5-дифенилтетразолия (МТТ) до формазана, образующего нерастворимые кристаллы. Через 48 часов инкубации РВМС с различными концентрациями дендримеров в пластине с 96 лунками (100000 на лунку) надосадочная жидкость, которая содержала дендример, была удалена, и она была заменена 200 мкл культуральной среды без сыворотки или фенолового красного (Optimem). Чтобы избежать потери клеток в этой стадии и впоследствии формазана, методика была модифицирована тем, что высевание РВМС проводилось в фибронектине полной человеческой плазмы (Sigma®) при концентрации 5-10 мкг/мл, с тем чтобы в течение 4 часов инкубации они фиксировались на дне лунки. В дополнение к 200 мкл Optimem, 20 мкл фильтрованного МТТ были добавлены для обеспечения их стерильности (Thiazolyl Blue, Sigma®) в фосфатном буфере PBS с рН 7,4 при концентрации 5 мг/мл для достижения конечной концентрации на лунку в 0,5 мг МТТ/мл. Через 4 часа инкубации при 37°С в атмосфере с 5% СО2 пластина была центрифугирована при 2000 об/мин, и надосадочная жидкость с избытком МТТ, который не прореагировал, была затем удалена. Кристаллы формазана наблюдались в фазовоконтрастном микроскопе и позднее были растворены в 200 мкл диметилсульфоксида (ДМСО). Пластина была подвергнута перемешиванию при 700 об/мин в мешалке-нагревателе фирмы Eppendorf® для обеспечения правильного растворения названных кристаллов. Концентрация формазана ([A]) была определена спектрометрически с использованием плейт-ридера при длине волны 570 нм с реперной длиной волны 690 нм. Спектрофотометр был откалиброван на ноль с использованием Optimen без клеток. Относительная жизнеспособность клеток (%) в отношении контроля (необработанные клетки) была рассчитана на основе митохондриальной активности по этой формуле: [A] test/[A] control×100. Каждая концентрация дендримера была протестирована в триплетах, согласно инструкциям АТСС. Полученные результаты показаны ниже в Таблице 3.

Таблица 3
Жизнеспособность клеток после инкубации с дендримерами согласно тесту с МТТ
1 мкМ 5 мкМ 10 мкМ 20 мкМ 100 мкМ
IM8 98 60 18 12 10
IM16 94 99 63 37 11
ClNH4 65,5 47 40 16 14
NN 87 68 66 32 9
Phe 83 77 71 54 14
SF 11 11

Из испытаний с МТТ можно сделать вывод, что клетки, которые показали повышенную митохондриальную жизнеспособность после обработки возрастающими концентрациями CBS или SF, были теми, которые были обработаны CBS IM16, CBS NN и CBS Phe. Однако, если данные рассмотреть в совокупности со всеми результатами визуального обследования, то следует вывод, что, в то время как IM16 ведет к образованию агрегатов, NN и Phe этого не делают, так что последние более совместимы с лимфоцитами.

Пример 39. Испытания на эритроцитах

Визуальное обследование было проведено для выявления наличия/отсутствия гемагглютинации и для количественного определения выделения гемоглобина (гемолитический тест) спектрофотометрическим путем. Дендример ClNH4 был исключен из списка дендримеров предыдущего Примера 38, так как результаты показали большую токсичность для лимфоцитов, и результаты были сравнены с таковыми, полученными для дендримера РАМАМ-типа четвертой генерации.

Эритроциты были получены после отделения от РВМС с использованием того же градиентного фиколл-центрифугирования, упомянутого в предыдущем Примере. Они были разбавлены фосфатным буфером PBS, чтобы их можно было рассмотреть по отдельности. Клетки были ресуспендированы в 500 мкл фосфатного буфера PBS и были высеяны в 24-луночную пластинку (300000 на лунку). В качестве позитивного контроля были использованы клетки, обработанные 0,2%-ным Triton X-100. Негативный контроль: PBS (пустой). Эритроциты были инкубированы с различными концентрациями дендримеров. Наличие гемагглютинации, количество клеток и выделение гемоглобина в час были оценены извлечением 100 мкл надосадочной жидкости и спектрофотометрическим измерением оптической плотности с использованием плейт-ридера при длине волны 550 нм с реперной длиной волны 690 нм.

- Визуальное обследование

Наблюдения, сделанные при визуальном обследовании, показаны ниже в Таблице 4.

Таблица 4
Визуальное обследование эритроцитов, инкубированных с дендримерами
1 мкМ 5 мкМ 10 мкМ 20 мкМ
IM8 хорошо Ag+ Ag+ Нет клеток
IM16 хорошо Ag++ Агглютинация++, но больше клеток, чем с IM8 Нет клеток
NN хорошо хорошо Ag+/- Нет клеток
Phe Ag+ AgW Ag+++ Есть клетки, но очень агглютинированные
G4 Ag+ Ag++ Веретенообразные клетки Есть клетки, но они веретенообразные
Ag = агглютинация

- Количественное определение выделения гемоглобина через 1 час

100%-ный гемолиз в контроле с Triton X-100 (все клетки, обработанные Тритоном, были убиты и разрушены). 7%-ный гемолиз в негативном контроле необработанных клеток. Каждая лунка выражена в процентном отношении к O.D. (оптической плотности) Triton X-100, который рассматривается как 100%; в дополнение к этому вычтено 7% контроля. Тем самым были получены результаты, показанные ниже в Таблице 5.

Таблица 5
Процентное отношение выделения гемоглобина после инкубации с дендримерами
IM8 IM16 NN Phe G4
l мкМ 34,8 11,000 6,6 8,000 8,4
5 мкМ 28 22,000 15 12,000 0
10 мкМ 79 55,000 75 31,000 0
20 мкМ 84 82,000 83 53,000 0

При 5 мкМ NN и Phe слегка превышают 10% токсичности, которая рассматривается как точка отсечки для эритротоксичности. Что случилось, что Phe индуцирует гемагглютинацию, а NN - нет. Как любопытную подробность следует отметить, что IM16 вызывает меньший гемолиз и оставляет большее число клеток в лунке, чем IM8 (в согласии с тем, что наблюдалось для МТТ в лимфоцитах), но индуцирует агглютинацию. Все индуцируют агглютинацию, за исключением NN. РАМАМ G4 индуцирует агглютинацию и появление изменений в эритроцитах, но не гемолиз.

Порядок гемагглютинации от большей к меньшей таков:

G4 > Phe > IM16 > IM8 > NN

В целом же лунка, в которой клетки имели лучший внешний вид, а также почти незаметный гемолиз, была с дендримером NN.

Если токсичность, найденную на лимфоцитах и эритроцитах, рассматривать в совокупности, то дендримером, который демонстрировал лучший профиль биосовместимости, был NN.

Пример 40. Токсичность комплексов ODN + дендример в сравнении с отдельным дендримером

Токсичность других дендримеров, таких как РАМАМ, модифицируется (снижается), когда они образуют комплексы с ДНК. В следующих экспериментах была сделана попытка выяснить, что происходит с CBS в плане токсичности при его связывании с ODN.

Время оценки этого обстоятельства составило 72 часа. Токсичность была оценена по РВМС, выделенным тем же способом, какой описан в Примере 38.

Во всех случаях было использовано следующее зарядовое отношение: (+/-)=2/1

Концентрации дендримеров, использованные в этих экспериментах для обеспечения зарядового отношения 2/1 (+/-), были:

IM8: 2,96 мкг = 3,93 мкМ

IM16: 2,35 мкг = 1,99 мкМ

ClNH4: 1,92 мкг = 3,98 мкМ

Phe: 2,8 мкг = 1,96 мкМ

NN: 3,42 мкг = 3,94 мкМ

SF: 0,68 мкМ

G4: 100 мкМ

В качестве ODN был использован РРТ следующим образом:

[ODN РРТ] в комплексе с CBS: 2,57 (0,88 мкМ)

[ODN РРТ] в комплексе с SF: 0,34 мкМ

[ODN РРТ] в комплексе с G4: 1 мкМ

- Образование комплекса

Объем образования комплекса в 60 мкл был применен во всех тестах с использованием RPMI с феноловым красным без сыворотки в качестве среды-носителя. Соответствующие количества ODN или дендримера были использованы для достижения зарядового отношения (+/-)=2, положительный заряд был сообщен дендримером и отрицательный - ODN. Расчеты были выполнены, основываясь на числе зарядов дендримера (фиксированном) и числе отрицательных зарядов ODN (также фиксированном).

Как только ODN и CBS были добавлены в среду RPMI, период времени 20 минут был выждан для обеспечения образования комплекса.

В случае с SF комплексы были сформированы согласно инструкциям изготовителя.

- Инкубация с клетками

После периода времени, необходимого для надежного образования комплекса, 100 мкл 10%-ной FCS полной среды, антибиотиков и глутамина были добавлены к 60 мкл RPMI с ODN и дендримером. 160 мкл были затем добавлены к клеткам, высеянным в 340 мкл, тем самым доведением до конечного объема 500 мкл. Клетки были инкубированы с названными комплексами либо со смесью равного объема, которая содержала ODN без CBS, смесью, которая содержала отдельный дендример, либо со смесью, которая содержала только RPMI + полную среду, которая была использована в качестве негативного контроля. Клетки и/или надосадочная жидкость были затем собраны для анализа с помощью проточной цитометрии, конфокальной микроскопии или экстракцией клеточной ДНК.

- Иммунофлуоресцентная и конфокальная микроскопия

После инкубаций со смесями, содержащими флуоресцентные ODN, дендриплексы, дендримеры или RPMI, клетки были обработаны для последующего получения изображений в обычном конфокальном или флуоресцентном микроскопе. Клетки были закреплены поли-L-лизином (PLL) (Sigma®) на предметных стеклах с лунками диаметром 30 мм. Для этого предметные стекла были предварительно инкубированы с 30 мкл PLL в течение 2 часов в инкубаторе при 37°С и в атмосфере с 5% СО2. После этой инкубации избыток PLL был смыт фосфатным буфером PBS. Клетки из каждого цикла обработки, которые требовалось закрепить в PLL, были дважды промыты PBS и были маркированы в течение 1 минуты 0,8%-ным трипановым голубым (Sigma®), чтобы затем выявить жизнеспособные клетки. Они были вновь дважды промыты PBS. В это время клетки были добавлены в лунку (100000 на лунку) и размещены на PLL в течение 1 часа в инкубаторе при 37°С и в атмосфере с 5% СО2. После этого часа избыток объема был смыт PBS, и клетки были обработаны свежеприготовленным 3%-ным раствором параформальдегида (PFA) (в пределах 2 недель его употребления) в течение 10 минут. После этих 10 минут избыток PFA был смыт PBS, и клетки были маркированы антителами, маркированными флуорохромами и DAPI. Первой была окрашена клеточная мембрана, а затем ядро. Было проведено предварительное титрование антител, использованных для определения наилучших концентраций для применения в нашем тесте. В первую очередь были использованы первичные мышиные антитела к человеку CD45 (BD®); 30 мкл антител были добавлены в каждую лунку при разбавлении 1 мкг/мл; это было инкубировано в течение 30 минут, и затем избыток был смыт PBS. Затем, вторичные козьи антитела к мышиному IgG-IgM были использованы (тяжелые и легкие цепи), конъюгированные в Texas-Red (Jackson ImmunoResearch®), 30 мкл на лунку при разбавлении 1/130 стока (концентрация стока 1,4 мг/мл). Клетки были инкубированы в течение последующих 30 минут, и они были затем промыты PBS. Наконец, клеточные ядра были окрашены с использованием DAPI (Vysys®), 10 мкл на лунку, в течение 10 минут, затем дважды промыты PBS. Инкубации с антителами и DAPI были выполнены при комнатной температуре. Антитела были разбавлены в день употребления, чтобы избежать их распада с течением времени, и были центрифугированы при 12000 об/мин перед их применением, чтобы удалить присутствующие агрегаты. Разбавление каждой порции антител было выполнено в блокирующей среде для уменьшения неспецифической маркировки (PBS с 1% бычьего сывороточного альбумина). Наконец, препарат был приготовлен с использованием специальной среды для флуоресценции (DACO Cytomation Fluorescent Mounting Medium®) с антифэдингом (предназначенным для защиты образца от повреждения, вызванного лазером). Он был осмотрен, и изображения были сняты с использованием конфокального микроскопа Leica TCS SP2 с применением различных возбуждающих лазерных линий: 405, 488 и 514 нм и использованием линз для оптической фазово-контрастной конфокальной микроскопии. После съемки изображений они были проанализированы с помощью программного обеспечения Leica®.

In vivo конфокальная микроскопия. Чтобы испытать жизнеспособность клеток после различных обработок олигонуклеотидами ODN, дендриплексами и дендримерами, которым были подвергнуты РВМС, и исследовать явления, такие как захват ими флуоресцентного ODN, или оценить движение подвергнутых трансфекции клеток, была использована техника in vivo конфокальной микроскопии. Так, 2,5-см кристаллы были затравлены с фибронектином полной человеческой плазмы (Sigma®) при использовании концентрации 5-10 мкг/мл с инкубацией с фибронектином в течение 1 часа при 37°С. После смыва избытка фибронектина с кристалла с помощью PBS были использованы клетки РВМС, предварительно промытые PBS, и они были инкубированы при 37°С и в атмосфере с 5% СО2 в течение 30 минут. Избыточные незакрепленные клетки были удалены промыванием PBS. Вся работа с кристаллом была выполнена расположением его на несвязывающей поверхности (стерилизованная металлическая фольга) в стерильной чашке Петри и в боксе с ламинарным потоком воздуха. Наконец, кристалл был помещен в камеру для in vivo конфокальной микроскопии, в которой клетки содержались при 37°С и в атмосфере с 5% СО2. Перед началом каждого эксперимента in vivo клетки оставлялись в камере для успокоения на 30 минут. После этого периода клетки были обработаны по-разному.

1. Добавление флуоресцентного ODN или дендриплексов с флуоресцентным ODN и оценка интернализации таковых в клетки.

2. Оценка подвижности клеток после различных воздействий дендримеров, дендриплексов или олигонуклеотидов ODN.

Для этого через временные интервалы (каждые 30 секунд, 1 минута или 2 минуты) были сделаны последовательные снимки клеток, вырезая из них средний план, включающий ядра. После сбора всех изображений они были смонтированы для представления картины способа.

- Окрашивание красителем трипановый голубой

Эта техника оценивает проницаемость клеточных мембран для красителя трипановый голубой (сокращенно TB). Живые клетки этот краситель не впускают.

Для выполнения теста был приготовлен раствор 0,8% трипановый голубой (Sigma), и клеточный осадок, полученный после центрифугирования в течение 1 минуты, был обработан с двумя последовательными циклами центрифугирования-промывки клеток PBS. Клетки были рассмотрены в оптическом микроскопе, и позитивные клетки были сосчитаны на предмет наличия трипановый голубой (голубые клетки, убитые) в отношении к процентному содержанию негативных клеток (живых клеток). Для этого было выбрано широкое поле с по меньшей мере 100 клетками. Полученные результаты показаны ниже в Таблице 6.

Таблица 6
Процентная доля клеток, окрашенных трипановым голубым
TB+ (%) TB+ (%)
Контроль 12,2 PPT 11,9
PPT+IM8 11,5 IM8 17,1
PPT+IM16 14,9 IM16 18,5
PPT+CLNH4 15,8 C1NH4 15,7
PPT+Phe 10,7 Phe 11,3
PPT+NN 13,6 NN 10,6
PPT+SF 72 SF 100
PPT+G4 80,5 G4 100
n = 100 клеток на отсчет

Самая большая процентная доля летальности соответствовала РАМАМ, как формирующим комплекс с ODN, так и отдельного. CBS не показали увеличения процентной доли TB-позитивных клеток в отношении к необработанным контрольным клеткам, и различия были едва заметны, когда клетки были обработаны CBS-ODN или только CBS.

- Проточно-цитометрический тест

Процентные доли клеток с размером и сложностью, соответствующими клеткам в апоптозе-некрозе, были сравнены с живыми клетками. Для этого размер (FW) и сложность (SD) были оценены проточной цитометрией. Чтобы сделать это, была очерчена одна область вокруг клеток с FW и SD, соответствующими клеткам в апоптозе-некрозе, и другая вокруг клеток с FW и SD, соответствующими живым клеткам. Процентные доли клеток, присутствующих на каждом предметном стекле, были сравнены. Полученные графики показаны на фиг. 15, в которой Х-оси представляют размер (FW), и Y-оси отвечают сложности (SD).

Часть А показывает популяцию клеток PBMC-типа, обработанную CBS-дендримерами, и часть В - популяцию, обработанную дендримером РАМАМ-типа. Размытое пятно темных клеток соответствует клеткам в апоптозе-некрозе. Живые клетки представлены серым тоном. Процентные доли в цифровом выражении были получены соответственно каждому из типов клеток, приведя к значениям, показанным в Таблице 7.

Таблица 7
Процентные доли живых клеток и клеток в апоптозе-некрозе
Живые клетки (%) Апоптоз-некроз (%) Живые клетки (%) Апоптоз-некроз (%)
Контроль 69 27 PPT 71 23
PPT+IM8 71 24 IM8 59 36
PPT+IM16 72 22 IM16 67 28
PPT+ClNH4 78 17 ClNH4 71 26
PPT+Phe 72 22 Phe 61 33
PPT+NN 73 21 NN 70 24
PPT+SF 24 70 SF 12 82
PPT+G4 4 84 G4 4 85

Эти результаты графически представлены на фиг. 14, которая показывает процентную долю мертвых клеток черным цветом и процентную долю живых клеток серым цветом. Первая полоса (С) соответствует контролю.

Самые большие процентные доли летальности соответствовали РАМАМ, как формирующему комплекс с ODN, так и самому по себе. С другой стороны, CBS не показывали большей процентной доли апоптоза-некроза в отношении контрольных необработанных клеток, и едва заметные различия наблюдались, когда клетки были обработаны CBS-ODN или только ODN.

- Окрашивания красителем DAPI

В качестве дополнительного теста для проверки жизнеспособности клеток был использован краситель для живых клеток DAPI (Vysys®), с использованием 10 мкл на лунку в течение 10 минут с последующим двукратным промыванием PBS. Клеточные ядра в апоптозе или некрозе показывают уменьшенный размер ядер, конденсацию хроматина и ядерную фрагментацию.

Фиг. 17 показывает результаты, полученные со следующими образцами: 1: Контроль; 2: ODN + IM8; 3: ODN + IM16; 4: ODN + SF; 5: ODN; 6: IM8; 7: IM16; 8: SF.

Клетки, обработанные либо CBS-ODN-комплексами, либо самими CBS, обнаружили круглые ядра с однородно распределенным хроматином и внешним видом, подобным таковому у необработанных контрольных клеток. Лунки, обработанные SF (4 и 8), показали отчетливое истощение клеток, затруднившее анализ.

- Видеокартины

Самое четкое подтверждение, что клетки живы, представляют их движения. Живые клетки показывают кратковременные клеточные выпячивания, двигаясь на поверхности кристалла, затравленного с фибронектином. Клетки, обработанные CBS, показали картины движения, подобные таковым для необработанных клеток.

В качестве Примера, фиг. 18 показывает последовательность фотографий, снятых через 72 часа инкубации клеток с CBS IM8-ODN. Некоторые подробности движения обозначены стрелками.

В заключение, концентрации дендримеров, использованные при формировании комплексов, демонстрируют, что они были должным образом биосовместимыми, клетки, показывающие сходную жизнеспособность, когда были обработаны CBS-ODN-комплексами и когда обработаны только дендримерами.

Антигенная способность

Когда кто-то хочет определить профиль биосовместимости новой молекулы, очень важно знать, может ли она оказаться неспецифическим аллергическим стимулом. Это стало бы недостатком, так как иммунная система клетки может распознать названную молекулу как чужеродный элемент, против которого она может инициировать ответ, который, скорее всего, был бы вредным для организма. Для этого было проведено изучение пролиферации лимфоцитов в присутствии различных CBS с целью сравнения способности стимуляции лимфоцитов, какую они имеют по сравнению с классическими сильнодействующими стимулами, такими как фитогемагглютинин (РНА).

Пример 41. Пролиферативный тест

Чтобы оценить антигенную способность CBS-дендримеров, был выполнен пролиферативный тест. Эксперимент был подготовлен в триплетах в 96-луночной плоскодонной пластине (100000 клеток на лунку в 200 мкл полной человеческой АВ среде с антибиотиками, глутамином и 10% АВ сыворотки). Эксперимент содержал лунку негативного контроля пролиферации (необработанные клетки), лунку, обработанную дозой обычного применения (2 мкМ) каждого дендримера для теста, еще одну лунку с увеличенной дозой, очень близкой к цитооксичности (5 мкМ), и еще одну лунку позитивного контроля пролиферации, обработанную 1 мкг/мл фитогемагглютинина. Через 5 суток инкубации при 37°С в атмосфере с 5% СО2 100 мкл надосадочной жидкости были удалены с последующим добавлением 100 мкл среды с изотопным интеркалирующим агентом ДНК, тритированным тимидином (приготовленным с 10% АВ среды и тимидина 1/100). Пластина была затем профильтрована с использованием харвестера для пропускания ее содержимого через фильтр, который был оставлен высыхать на ночь (примерно на 16 часов). После этого периода лист Methylex®, содержащий сцинтилляционную среду, был расплавлен нагреванием, и он был прочитан в гамма-камере для оценки числа импульсов (чем больше импульсов, тем больше пролиферация). Результаты, которые показаны ниже в Таблице 8, выражены как импульсы тритированного тимидина в минуту (cpm). Каждый результат каждой концентрации был получен в трех повторениях, значение, которое указано в таблице, является усредненным из трех. РНА и контроль были протестированы 12 раз.

Таблица 8
Подсчет числа импульсов в лимфопролиферативном тесте
Антигенный стимул Измерение сцинтилляционных импульсов
Дендримеры 2 мкМ 5 мкМ
IM8 144 импульсов в минуту 149 импульсов в минуту
IM16 175 cpm 141 импульсов в минуту
NN 145 cpm 160 импульсов в минуту
Phe 146 cpm 170 импульсов в минуту
Контроль 146 импульсов в минуту
PHA 10267 импульсов в минуту

Фиг. 19 показывает графическое представление этой информации.

Как можно сделать вывод из этого теста, CBS дендримеры не являются антигенными стимулами для PBMC при любой из испытанных концентраций.

Трансфекционные тесты

Была оценена способность ODN проходить через плазменные и ядерные мембраны PBMC, и названная способность была сравнена с таковой, которую названный ODN представлял, образуя комплекс с различными CBS. Дендримеры согласно изобретению были сравнены с дендримерами РАМАМ-типа с использованием конфокальной микроскопии.

Пример 42. Трансфекционный тест

- Получение PBMC клеток и инкубация с образцами

Был использован тот же способ, разъясненный в предыдущих примерах.

- Предварительная обработка клеток

За два дня до обработки олигонуклеотидом ODN или дендриплексами, PBMC были стимулированы фитогемагглютинином в дозе от 1 до 2 мкг/мл и интерлейкином-2 (IL-2) в дозе 100 IU/мл, при концентрации клеток от 3 до 5 миллионов на миллилитр. В день обработки клетки были ресуспендированы при концентрации от 300000 до 500000 клеток на 340 мкл. Однако, имея в виду, что конечный объем после соответствующих последующих обработок был 500 мкл, IL-2 был добавлен для поддержания активации клеток в ходе эксперимента в дозе 50 IU/мл, рассчитанной по тем 500 мкл, которые должны были составить конечный объем.

- Конфокальная микроскопия

Был использован метод, описанный выше в других Примерах.

- Результаты, полученные с ODN

Испытания были выполнены с каждым из ODN последовательностей от SEQ ID NO:1 до SEQ ID NO:5. ODN, вопреки ранее опубликованному, показали неожиданную способность проходить через плазменные мембраны, а также через ядерные мембраны. Этот способ является зависящим от времени. Так, через 3 часа ODN был найден в клеточной цитоплазме и через 24 часа в ядре. Пример этого можно наблюдать на фиг. 20, где можно увидеть фотографии, снятые через 1, 3 или 24 часа с момента старта трансфекции с ODN RF.

Картина флуоресценции диффузная, без образования агрегатов.

Ядерная локализация является даже более ясной, если провести XY-сечение клетки и проанализировать имеющуюся флуоресценцию. Тест этого типа можно видеть на фиг. 21. Когда данная флуоресценция наблюдается по всей линии средней плоскости (Фиг. 21А), голубая флуоресценция, представленная в верхнем графике (ядра), и зеленая флуоресценция, представленная в среднем графике (ODN), совместно локализуются под красным сигналом, представленным в нижнем графике (мембрана). Когда подобный анализ был выполнен, но с выделением зоны интереса (ROI) (Фиг. 21В), очерченной вокруг ядра по всем различным секциям Z-оси, это показывает, как зеленый (нижний график) совместно локализуется с голубым (верхний график), и это представляется вне цитоплазмы, пока не достигнет мембраны.

Результаты были одинаковыми, независимо от длины испытанных ODN (от 15 до 28 оснований).

- Результаты, полученные с ODN + CBS дендримерами

Трансфекционные испытания были выполнены с использованием ODN РРТ с образованием дендриплексов с различными дендримерами согласно изобретению. Конкретно, следующие образцы были использованы для трансфекции: 1: Контроль; 2: РРТ; 3: РРТ + IM8; 4: РРТ + NN; 5: РРТ + Phe; РРТ + IM16.

Результаты, полученные через 48 часов, показаны на фиг. 22.

Все дендримеры, за исключением ClNH4, давали картину, подобную таковой для ODN без CBS, то есть диффузную, ядерную и цитоплазматическую. Некоторые из комплексов достигли более высоких результатов в произвольных единицах флуоресценции, чем ODN без CBS (таковые с NN и Phe) в некоторых выполненных экспериментах, но это не было воспроизведено со статистической значимостью в различных экспериментах с повторениями до 7 сравнительных серий между комплексами и ODN как таковым. Образец РРТ с ClNH4, однако, привел к картине флуоресценции в агрегатах, которая показана на фиг. 23.

Чтобы продемонстрировать, что это действительно картина цитоплазматической и ядерной флуоресценции, были сделаны гистограммы одиночной клетки в средней плоскости в XY, подобно таковой, выполненной с ODN без CBS. Фиг. 23 показывает в качестве примера один из анализов клетки с РРТ + NN:

Из этих данных можно заключить, что CBS дендримеры, за исключением ClNH4, никоим образом не препятствуют распределению ODN в клетке.

Ингибирование вируса или других биологических агентов дендримерами

Благодаря биосовместимости, показанной в предшествующих экспериментах, дендримеры согласно изобретению были бы пригодными для приготовления лекарственных композиций (парентеральных или оральных) или интерферирующих приспособлений (вагинальные гели, антисептики) для предупреждения и/или лечения биологических агентов, таких как ВИЧ-вирус или другий вирус, такой как гепатит С, или прочих биологических агентов, таких как прионы. С этой целью были разработаны тесты ингибирования ВИЧ-вируса, в которых была исследована эта способность.

Пример 43: Тесты ингибирования ВИЧ

- Приготовление вируса

Были использованы клетки МТ-2 (человеческие Т-лимфоциты, иммортализованные человеческим лимфоцитотропическим вирусом типа I). 20×106 МТ-2 были дважды промыты RPMI 1640 средой, дополненной 10% FSC, и они были перенесены в объем 25 мл при концентрации 2×106 клеток на миллилитр в RPMI среде с 10% FCS. Штамм вируса HIVNL4.3 был затем добавлен в концентрации 1 частицы на клетку (1 MOI). МТ-2 и вирус были выращены в течение по меньшей мере 2 часов при 37°С с перемешиванием культуры каждые 15-30 минут. Наконец, культуры (клетки-вирус) были дважды промыты для удаления вируса, который не интегрировался в геном клеток. Клетки были перенесены и высеяны во 25-см2 флаконах в той же культуральной среде.

Каждые 72-96 часов половина супернатанта была собрана с предосторожностями, чтобы не захватить также клетки. 40×106 МТ-2 были добавлены в той же концентрации в RPMI среде с 10% FCS. Были взяты аликвоты супернатанта, которые хранились в жидком азоте и позднее были оттитрованы.

- Титрование вируса

Изолированный вирусный HIVNL4.3, признанный лабораторный вирусный штамм, был оттитрован в клеточной линии МТ-2. 2×104 МТ-2 клеток были культивированы с полной средой в 96-луночных пластинах, и 40 мкл вирусного препарата были добавлены с различными концентрациями, для которых были сделаны соответствующие разбавления. Все они были размещены в восьми повторениях и выдерживались при 37°С в СО2 атмосфере в течение недели. После этого периода было проведено титрование для выявления цитопатического эффекта и образования синцитиев. Титрование было обсчитано по формуле Спирмена-Кербера[30], которая служит для количественной оценки числа частиц вируса на миллилитр среды в культуре, в которой сериальные разбавления концентрата вируса были высеяны в восьми повторениях для титрования.

- In vitro инфицирование Т-лимфоцитов

Клетки PBMC были стимулированы в течение 48 часов действием 2 мкг/мл РНА и 100 IU IL-2, чтобы индуцировать поликлональную активацию; через 24 часа клетки были промыты PBS. Желаемая концентрация клеток была инкубирована с рассчитанным количеством частиц HIVNL4.3 на клетку, в RPMI среде с 10% FCS в течение 4 часов при 37°С в увлажненной атмосфере с 5% СО2. После этого времени культура клеток была собрана и трижды промыта для удаления вируса, сцепленного с поверхностью клеток, они были помещены вновь в 24-луночную пластину в RPMI среде с 10% FCS и 50 IU/мл IL-2, и они были обработаны различными дендримерами. Культуры были инкубированы при 37°С, и они были выдержаны в увлажненной атмосфере с 5% СО2.

- Ингибирование ВИЧ CBS-дендримерами

Были высеяны 400000 клеток РВМС на лунку в 24-луночной пластине, и они были обработаны NN с концентрациями 1, 3 и 5 мкМ, в одном случае перед их инфицированием, и в еще одном - после инфицирования их при мультиплетности инфицирования 0,4 MOI. Клетки были собраны через 24 часа для экстрагирования ДНК и последующей количественной оценки вирусных копий на клетку (согласно методу детектирования и количественной оценки ДНК ВИЧ в инфицированных клетках, зарегистрированному с патентным номером 2401986 в National Patent Office).

Для устранения влияния возможной токсичности дендримера на число клеток и количество копий вируса, число копий вируса было приведено к процентной доле живых клеток, чтобы получить возможность сделать сравнение между различными концентрациями дендримеров. Тем не менее, дендримеры не индуцировали существенной летальности при использованных концентрациях (количественно выраженных в FW и SD в проточной цитометрии).

Поэтому были сделаны следующие приведения: число копий ДНК ВИЧ/106 клеток на % живых клеток с созданием следующего графика, который показан на фиг. 25, в которой префиксы “pre” или “post” означают введение 1, 3 или 5 мкМ NN до или после инфицирования, и полоса, маркированная «С», соответствует контролю.

Полученные результаты показывают, что дендример проявляет явное препятствование инфицированию клеток PBMC вирусами ВИЧ, как примененный предварительно перед инфицированием, так и после него. Поэтому он должен действовать на стадиях как предынтеграции, так и постинтеграции.

Выводы экспериментов в Примерах 31-43

- Испытанные CBS дендримеры показали хорошую биосовместимость для PBMC при дозах, использованных для транспорта ODN.

- Если данные токсичности на лимфоцитах и эритроцитах рассматривать в совокупности, дендримером, который имеет лучший профиль биосовместимости, является CBS-NN.

- CBS NN, IM8 и IM16 высвобождают ODN со временем, проявляя практически 100%-ное выделение ODN через 24 часа. Эти дендримеры также высвобождают ODN при кислотных значениях рН (<5).

- Испытанные ODN показывают выраженную способность к захвату клетками, проходя как через плазменную, так и ядерную мембрану в почти 100% живых клеток спустя 17 часов после их добавления к клеточной культуре, в присутствии 10% FCS.

- Все испытанные CBS-ODN-дендриплексы (за исключением ClNH4) не препятствуют интернализации ODN и их цитоплазматическому и нуклеарному распределениям.

- CBS-NN защищает ODN от связывания с белками плазмы, эта защита не препятствует последующему постепенному высвобождению ODN с течением времени в водной среде в присутствии названных белков. По этой причине и предыдущим таковым, дендримеры согласно изобретению представляются пригодными для использования их в антисмысловой терапии для ингибирования синтеза белка, уровень которого в общем подходящий для снижения, как это имеет место в ряде нарушений, как туморального, так и вирусного типа, или возникает в любых прочих формах разнообразных болезней человека или животных.

- NN-дендример показывает хорошую способность предотвращать инфицирование лимфоцитов вирусом ВИЧ, которая, наряду с хорошей проявленной биосовместимостью, свидетельствует, что он может быть использован для предупреждения и/или лечения нарушений, вызываемых биологическими агентами, такими как ВИЧ или прочие вирусы, такие как гепатит С, включая другие биологические агенты, такие как прионы.

- CBS Phe и ClNH4 показывают хорошую способность к эффективному и продолжительному фиксированию нуклеиновых кислот, для каковой цели они могут быть пригодными в производстве РНК- или ДНК-микрочипов или других устройств, которые требуют фиксации нуклеиновых кислот, поскольку, более того, благодаря означенной фиксации ДНК (электростатическим путем с фосфатными группами в ДНК) CBS, описанные здесь, оставляют нуклеотидную последовательность открытой для взаимодействия с комплементарными последовательностями других нуклеиновых кислот.

Синтез новых дендримеров

Для повышения универсальности карбосилановых дендримеров согласно изобретению были синтезированы дендримеры в дополнение к тем, синтез которых был описан в Примерах 1-30, как с варьированием исходного соединения, используемого для введения концевых фрагментов в ветвях (Примеры 44-47), так и с повышением концентрации кватернизующего реагента в способах кватернизации аминогрупп дендримеров, синтез которых уже был описан в предыдущих примерах, чтобы обеспечить не только кватернизацию аминогрупп, которые могут содержаться на концах терминальных фрагментов как таковые, но и других аминогрупп, которые могут содержаться в названных концевых фрагментах (Примеры 48-49).

Синтез этих дендримеров описан ниже.

Примеры 44-47

Пример 44. - Синтез 1G-[Si(CH 2 ) 2 C 6 H 3 (OMe)(O(CH 2 ) 2 NMe 2 )] 4 . (31)

Для синтеза этого дендримера и дендримера 32, описанного в следующем примере, был использован 4-аллил-2-метокси-1-(N,N-диметиламино)бензол ((CH2=CH-CH2)C6H3(OМe){O(CH2)2NМe2}), некоммерческое соединение, которое нужно синтезировать перед соответствующей реакцией гидросилилирования.

- Синтез (CH 2 =CH-CH 2 )C 6 H 3 (OМe){O(CH 2 ) 2 NМe 2 }

1 эквивалент ClCH2CH2NМe2H+Cl- (7,02 г, 48,7 ммол), 4 эквивалента К2СО3 (26,93 г, 195 ммол) и краун-эфир 18-Corona-6 (2,57 г, 9,74 ммол) были добавлены к раствору 4-аллил-2-метоксифенола (8,0 г, 48,7 ммол) в ацетоне. Реакционная смесь была подвергнута кипячению с обратным холодильником в течение 48 ч. После удаления растворителя в вакууме было выполнено экстрагирование смесью CH2Cl2/H2O (2×50 мл). Органическая фаза была высушена над MgSO4 в течение 2 ч. Смесь затем была профильтрована, и растворитель был удален с образованием светло-желтого масла, которое было промыто гексаном (2×10 мл) для удаления краун-эфира 18-Corona-6. Соединение было получено этим путем как светло-желтое масло (5,49 г, 48%).

1Н-ЯМР (CDCl3): δ 6,79 (д, 1H, C6H3), 6,68 (м, 2H, C6H3), 5,92 (т, 1H, CH=CH2-CH2-Ph), 5,02 (м, 2H, CH=CH2-CH2-Ph), 4,07 (т, 2H, Ph-O-CH2-CH2-NMe2), 3,81 (с, 3H, CH3O), 2,52 (м, 2H, Si-CH2-CH2-CH2-Ph), 2,74 (т, 2H, Ph-O-CH2-CH2-NMe2), 2,31 (с, 6H, NMe2). RMN-13C{1H}-ЯМР (CDCl3): δ 149,51 (Сипсо-связанный с -O(CH2)2NMe2), 146,55 (Сипсо-связанный с -OMe), 137,59 (Сипсо-связанный с -CH2), 133,17 (CH=CH2-CH2-Ph), 120,37, 113,76, 112,26 (C6H3), 115,58 (CH=CH2-CH2-Ph), 67,39 (Ph-O-CH2-CH2-NMe2), 58,12 (Ph-O-CH2-CH2-NMe2), 55,78 (CH3O), 45,94 (NMe2), 39,76 (Si-CH2-CH2-CH2-Ph).

- Синтез дендримера 31

Продукт (CH2=CH-CH2)C6H3(OМe){O(CH2)2NМe2} (0,9 г, 4,64 ммол) и капля катализатора Карштедта (3-3,5% Pt) были добавлены к раствору дендримера 1G-H4 (0,50 г, 1,16 ммол) в минимальном количестве ТГФ (3 мл). Реакционная смесь нагревалась до 45°С в вакуумированной ампуле в течение 12 ч. Полученный раствор был высушен вакуумным удалением растворителя с получением соединения 31 в виде желтого масла (1,60 г, 100%).

1Н-ЯМР (CDCl3): δ 6,80 (д, 1H, C6H3), 6,65 (м, 2H, C6H3), 4,07 (т, 2H, Ph-O-СH 2-СН2-NМе2), 3,81 (с, 3H, CH3O), 2,74 (т, 2H, Рh-О-СН2H 2-NМе2), 2,52 (м, 2H, Si-CH2-CH2-CH 2-Ph), 2,31 (с, 6H, NMe2), 1,55 (ушир.м, 2H, Si-СН2H 2-СН2-Ph), 1,28 (ушир.м, 2H, Si-СН2H 2-СН2-Si), 0,53 (м, 6H, Si-СH 2-СН2H 2-Si), -0,07 (с, 6H, SiMe2). 13C{1H}-ЯМР (CDCl3): δ 149,40 (Сипсо-связанный с -O(CH2)2NMe2), 146,29 (Сипсо-связанный с -OMe), 136,03 (Сипсо-связанный с - CH2), 120,24, 113,72, 112,30 (C6H3), 67,47 (Ph-O-CH 2-CH2-NMe2), 58,22 (Рh-О-СН2-СH2-NМе2), 55,88 (CH3O), 46,00 (NMe2), 39,67 (Si-СН2-СН2H 2-Рh), 26,26 (SiСН2H 2-СН2-Рh), 20,29, 18,56, 17,53 (Si(CH2)3Si), 15,41 (Si-CH 2-CH2-CH2-Ph), -3,28 (SiMe2). 29Si{1H}-ЯМР (CDCl3): δ (G0-Si) не наблюдается, 1,60 (G1-Si).

- Пример 45: Синтез 2G-[Si(CH 2 ) 2 C 6 H 3 (OMe)(O(CH 2 ) 2 NMe 2 )] 8 (32)

Дендример второй генерации 32 был приготовлен согласно способу, подобному тому, какой описан для 31, исходя из дендримера 2G-H8 (0,32 г, 0,27 ммол), (CH2=CH-CH2)C6H3(OМe){O(CH2)2NМe2}] (0,51 г, 2,17 ммол), 3 мл ТГФ и капли катализатора Карштедта. Этим путем 32 был получен в виде коричневого масла (0,38 г, 50%).

1Н-ЯМР (CDCl3): δ 6,80 (д, 2H, C6H3), 6,66 (м, 4H, C6H3), 4,08 (т, 4H, Ph-O-СH 2-СН2-NМе2), 3,81 (с, 6H, CH3O), 2,74 (т, 4H, Рh-0-СН2H 2-NМе2), 2,52 (м, 4H, Si-СН2-СН2H 2-Рh), 2,30 (с, 12H, NMe2), 1,55 (ушир.м, 4H, Si-СН2H 2-СН2-Рh), 1,28 (ушир.м, 6H, Si-СН2H 2-СН2-Si), 0,53 (ушир.м, 16H, -CH2 связанный с Si), -0,072 (с, 12H, SiMe2), -0,01 (с, 3H, SiMe). 13C{1H}-ЯМР (CDCl3): δ 149,37 (Сипсо-связанный с -O(CH2)2NMe2), 146,29 (Сипсо-связанный с -OMe), 135,98 (Сипсо-связанный с -CH2), 120,24, 113,69, 112,30 (C6H3); 67,44 (Рh-О-СH 2-СН2-ММе2), 58,19 (Рh-О-СН2H 2-NMe2), 55,86 (CH3O), 45,98 (NMe2), 39,65 (Si-СН2-СН2-СH2-Рh), 26,23 (Si-CH2H 2-СН2-Рh), 20,13, 18,81, 18,60 (Si(CH2)3Si), 15,38 (Si-СH 2-СН2-СН2-Рh), -3,25 (SiMe2), -4,93 (SiMe)/ 29Si{1H}-ЯМР (CDCl3): δ 0,1,00 (G1-Si); 1,70 (G2-Si).

- Пример 46: Синтез 1G-[Si((CH 2 ) 2 C 6 H 3 (OMe)(O(CH 2 ) 2 NМe 3+ I - ))] 4 (33)

0,02 мл 2М раствора MeI (0,27 ммол) в диэтиловом эфире были добавлены к раствору дендримера 31 (0,094 г, 0,068 ммол) в эфире (3 мл). Реакционная смесь поддерживалась при постоянном перемешивании в течение 48 ч при комнатной температуре, затем она была высушена для удаления избытка MeI. Полученный остаток был промыт гексаном (2×5 мл) и был высушен в вакууме с образованием дендримера 33 в виде белого твердого вещества (0,10 г, 83%).

1Н-ЯМР (ДМСО): δ 6,94 (д, 1H, C6H3), 6,75 (м, 2H, C6H3); 4,34 (т, 2H, Ph-O-СH 2-СН2-ММе2), 3,74 (с, 3Н, CH3O и т, 2H, Рh-О-СН2H 2-NМе+3 перекрывается), 3,18 (с, 9H, NMe+3), 2,49 (м, 2H, Si-CH2-CH2-CH 2-Ph, перекрывается с сигналом ДМСО), 1,51 (ушир.м, 2H, Si-CH2-CH 2-CH2-Ph), 1,28 (ушир.м, 2H, Si-CH2-CH 2-CH2-Si), 0,91 (м, 2H, Si-CH 2-CH2-CH2-Ph), 0,51 (м, 4H, Si-СH 2-СН2H 2-Si), -0,07 (с, 6H, SiMe2). 13С{1H}-ЯМР (ДМСО): δ 148,6 (Сипсо-связанный с -O(CH2)2NMe2), 144,3 (Сипсо-связанный с -OMe), 135,9 (Сипсо-связанный с - CH2), 119,5, 114,2, 111,9 (C6H3), 63,6 (Рh-О-СH 2-СН2-NMe2), 62,6 (Рh-О-СН2H 2-NМе2), 55,1 (CH3O), 52,7 (NMe+3), 39,0 (Si-CH2-CH2H 2-Рh, перекрывается с сигналом ДМСО), 25,3 (Si-СН2H 2-СН2-Рh), 19,1, 17,6, 16,4, (Si(CH2)3Si), 14,3 (Si-CH 2-CH2-CH2-Ph), -3,7 (SiMe2).

- Пример 47: Синтез 2G-[Si((CH 2 ) 2 C 6 H 3 (OMe)(O(CH 2 ) 2 NМe 3+ I - ))] 8 (34)

Дендример второй генерации 34 был приготовлен согласно способу, подобному тому, какой описан для 33, исходя из 32 (0,38 г, 0,13 ммол) и 0,07 мл 2М раствора MeI (1,04 ммол) в эфире. Этим путем соединение 34 было получено в виде белого твердого вещества (0,45 г, 85%).

1Н-ЯМР (ДМСО): δ 6,94 (д, 2H, C6H3), 6,75 (м, 4H, C6H3), 4,33 (т, 4H, Ph-O-СH 2-СН2-NМе2), 3,74 (с, 6H, CH3O и т, 4H, Ph-O-CH2-CH 2-NMe+3 перекрывается), 3,18 (с, 18H, NMe+3), 3,18 (м, 4H, Si-СН2-СН2H 2-Рh, перекрывается с сигналом ДМСО), 1,50 (ушир.м, 4H, Si-СН2H 2-СН2-Рh), 1,29 (ушир.м, 6H, Si-СН2H 2-СН2-Si), 0,50 (м, 16H, CH 2Si), -0,09 (с, 12H, SiMe2), -0,11 (с, 3H, SiMe). 13C{1H}-ЯМР (ДМСО): δ 148,6 (Сипсо-связанный с -O(CH2)2NMe2), 144,3 (Сипсо-связанный с -OMe), 135,9 (Сипсо-связанный с -CH2), 119,5, 114,3, 111,9 (С6Н3), 63,6 (Ph-O-CH 2-CH2-NMe2), 62,6 (Рh-О-СН2H 2-NMe2), 55,1 (CH3O), 52,7 (NMe+3), 39,0 (Si-CH2-CH2-CH 2-Ph, перекрывается с сигналом ДМСО), 25,3 (Si-СН2H 2-СН2-Рh), 19,0, 17,7, 17,6 (Si(CH2)3Si), 14,3 (Si-СH 2-CH2-CH2-Ph), -3,8 (SiMe2), -5,4 (SiMe).

Примеры 48 и 49

- Пример 48: Синтез 1G-[(Si(O(CH 2 ) 2 N + (Me) 2 (CH 2 ) 2 NМe 3+ 2I - )] 4 (35)

Дендример 35, который имеет все атомы азота в своей структуре кватернизованными, был приготовлен из дендримера первой генерации 25 (0,24 г, 0,24 ммол) и 1,2 мл MeI (2,4 ммол) в диэтиловом эфире как растворителе. Этим путем дендример 35 был получен в виде белого твердого вещества, нерастворимого в диэтиловом эфире (0,49 г, 95%).

1Н-ЯМР (ДМСО-d6): δ 4,00 (2H, т, СH 2О), 3,93 (4H, м, СH 2N(Ме)2+), 3,53 (2H, т, СH 2N(Ме)3+), 3,18 (15H, ушир.с, N(Me)2+ и N(Me)3+), 1,31 (2H, м, SiCН2СH 2СН2SiO), 0,70 (2H, м, SiCН2СН2СH 2SiO), 0,55 (2H, м, SiCH 2СН2СН2SiO), 0,13 (6H, с, OSiMe2). 13C{1H}-ЯМР (ДМСО-d6): δ 64,9 (CH2O), 56,3, 55,9, 55,6 (CH2N(Me)2+ и CH2N(Me)3+), 52,5 (NMe3+ 50,9 (NMe2+), 21,2 (SiCH2CH2CH2SiO), 17,8 (SiCH2CH2CH2SiO), 17,2 (SiCH2CH2CH2SiO), -2,6 (OSiMe2). Элементный анализ для C52Hi128N8O4Si5I8. Вычислено %: C, 39,59; H, 8,18; N, 7,10. Найдено %: C, 38,65; H, 7,98; N, 6,94.

- Пример 49: Синтез 2G-[Si(O(CH 2 ) 2 N + (Me) 2 (CH 2 ) 2 NМe 3+ 2I - )] 8 (36)

Дендример второй генерации 36 был приготовлен согласно способу, подобному тому, какой описан для 35, исходя из 26 (0,11 г, 0,04 ммол) и 0,06 мл MeI (0,91 ммол). Этим путем соединение 36 было получено в виде белого твердого вещества (0,18 г, 86%).

1Н-ЯМР (ДМСО-d6): δ 4,00 (4H, т, СH 2О), 3,93 (8H, м, СH 2N(Ме)2+), 3,59 (4H, т, СH 2N(Ме)3+), 3,21 (30Н, ушир.с, N(Me)2+ и N(Me)3+, 1,35 (6H, м, SiCН2СH 2СН2SiO и SiCН2СH 2СН2Si), 0,72 (4H, м, SiCН2СН2СH 2SiO), 0,56 (8Н, м, 25 SiCH 2), 0,13 (12Н, с, OSiMe2), -0,07 (3Н, с, SiMe). 13C{1H}-ЯМР (ДМСО-d6): δ 64,7 (CH2O), 56,3, 56,0, 55,7 (CH2N(Me)2+ и CH2N(Me)3+), 52,6 (NMe3+), 50,9 (NMe2+), 21,2-17,2 (группы -СН2- карбосиланового скелета), -2,5 (OSiMe2), -5,5 (SiMe). Элементный анализ для C128H316N16O8Si13I16. Вычислено %: C, 33,40; H, 6,92; N, 4,87. Найдено %: C, 32,90; H, 6,75; N, 4,57.

Этот дендример, который используется в тестах, описанных в последующих примерах, получил сокращенное наименование NN16, наименование, под которым он будет упоминаться в последующем. Его структурная формула, молекулярная масса (Mw) и число положительных зарядов такие, как показано ниже:

NN16

2G-[SiO(CН2)2N+(Me)2(CН2)2NMe3+2I-]8 (36)

Молекулярная масса Mw = 4603,56 г/моль

16 положительных зарядов

Тесты на связывание дендримеров с лекарственными средствами

Чтобы протестировать полезность дендримеров согласно изобретению в качестве переносчиков лекарственных средств, которые имеют отрицательный заряд при физиологическом значении рН, были выполнены испытания для проверки, во-первых, способны ли различные дендримеры согласно изобретению к формированию комплексов с разнообразными лекарственными средствами, и, затем, было проверено, обратима ли связь, с выяснением, приводит ли вариация величины рН среды к диссоциации комплекса дендример-лекарственное средство. Этим намеревалось сымитировать, что должно происходить в проверяемых физиологических условиях, с одной стороны, что дендримеры способны к формированию комплексов с лекарственными средствами, которые защищают последние от взаимодействия с белками плазмы или клеточными мембранами в способе транспорта в кровотоке; с другой стороны, в диссоциативных тестах с изменением величины рН была предпринята попытка воспроизвести условия, в которые комплекс дендример-лекарственное средство попал бы внутрь клетки, в которой предполагается, что комплекс дендример-лекарственное средство проникает или может проникать через эндосому, внутренняя часть которой уже в цитоплазме закислена действием транспортной Н+- АТФазы как протонного насоса, создавая среду, в которой дендример должен захватывать часть избыточных протонов и высвобождать транспортируемую молекулу, которая должна быть способной к выполнению своего действия.

Испытания для определения связи дендример-лекарственное средство

Дендримеры, избранные для выполнения тестов, были таковы:

- NN (2G[Si(O(CH2)2N(Me)(CH2)2NMe3+I-)]8 (26))

- NN16 (2G[Si(O(CH2)2N+(Me)2(CH2)2NMe3+2I-)]8 (36))

- IM16 (2G[Si(OCH2СН2NMe3+I-)2]8 (19))

Лекарственные средства, избранные для выполнения тестов, все по меньшей мере с одним отрицательным зарядом при физиологическом значении рН, были таковы:

- Метотрексат (натриевая соль):

1 заряд (-)

Лаборатория-поставщик: Almirall

Поставка: раствор с концентрацией 25 мг/мл

Наполнители: NaCl, NaOH, HCl, водный бидистиллят

- Гепарин (натриевая соль):

Несколько зарядов (-)

Лаборатория-поставщик: Rovi

Поставка: раствор с концентрацией 10 мг/мл (1000 U)

Наполнители: метил-пара-гидроксибензоат, пропил-пара-гидроксибензоат, NaCl, водный бидистиллят

- Инсулин (рекомбинантный человеческий инсулин):

4 заряда (-)

Лаборатория-поставщик: Novo Nordisk

Торговое наименование продукта: Actrapid

Поставка: раствор с концентрацией 3,5 мг/мл(100 U)

Наполнители: ZnCl2, HCl, NaOH, водный бидистиллят

Определение связи и образования комплекса между дендримером и лекарственным средством было выполнено путем оценки задержки в полиакриламидном геле дендримера, связанного с лекарственным средством, относительно свободного дендримера:

- Образование комплекса: тест был выполнен в конечном объеме смеси 30 мкл, который является максимальным объемом, помещаемым в гель. Чтобы сделать это, исходят из необходимого количества дендримера, которое обеспечивает в полной мере идентифицируемую полосу путем окрашивания нитратом серебра в геле, когда проводился электрофорез: 20 мкл раствора с концентрацией 100 мкМ, которые соответствуют 1,2×1015 молекул. Лекарственное средство добавляется в количестве 10 мкл при различных концентрациях для создания избранных (+) или (-) зарядовых отношений, также определяющих количество молекул лекарственного средства, присутствующих в смеси. Инкубация названной смеси была выполнена при 37°С в течение 1 часа, чтобы дать время для формирования более термодинамически стабильного комплекса, хотя для его образования может потребоваться и более длительный период. Формирование каждого комплекса выполнялось в двух повторениях.

- Электрофорез и окрашивание геля: Использованные гели представляли собой 7,5%-ный полиакриламид/бисакриламид, приготовленный с 1,5-молярным Трис рН 8,8. Каждый электрофорез был проведен при 90 В в течение 4 часов, после которых гель был окрашен нитратом серебра и сфотографирован. Для каждого теста со ссылкой на образование комплекса между некоторым дендримером и конкретным лекарственным средством был выполнен предварительный электрофорез в геле, в который был помещен индивидуальный дендример, при различных концентрациях, для проверки его состояния, размещая каждую из концентраций в двух повторениях, после чего был выполнен еще один электрофорез в еще одном геле, в который были помещены предварительно инкубированные комплексы дендример-лекарственное средство, также размещая в парные лунки смеси контроля инкубации, в которые был добавлен дендример, но не лекарственное средство, чтобы иметь возможность проверить наличие задержки в полосах, полученных в дорожках, соответствующих смесям дендримера и лекарственного средства.

Полученные результаты с каждым из протестированных дендримеров и лекарственных средств описаны в Примерах 50-52.

-Пример 50: Испытание связывания лекарственных средств с NN дендримером

NN дендример был растворен в дистиллированной Н2О при начальной концентрации 576 мкМ, и из этого были сделаны разбавления для достижения концентраций в 100 мкМ, 10 мкМ и 1 мкМ. Предшествующие электрофорезы, проведенные с аликвотами растворов, соответствующих каждой из этих концентраций, продемонстрировали, что дендример был в хорошем состоянии во всех из них. Концентрация в 100 мкМ была избрана как концентрация, которая позволяла визуально наблюдать дендример в геле после окрашивания и выявлять возможные задержки в полосе, образованной при электрофорезе не от свободной формы, а от сформированного комплекса с лекарственным средством.

Ниже, испытания связывания с различными лекарственными средствами проводятся следующим образом.

а) Метотрексат

Как уже отмечалось, метотрексат, использованный в этом тесте, представлен в форме водного раствора при концентрации 25 мг/мл, с молекулярной массой Mw = 476,427 г/моль и с 1 (-) зарядом на молекулу. Были приготовлены и инкубированы дендример-метотрексатные смеси, которые отвечали характеристикам, показанным ниже в Таблице 9.

Таблица 9
Характеристики смесей NN дендример-метотрексат
Смесь
1 2 3 4
Зарядовое отношение дендример-лекарственное средство 1+/1- 2+/1- 4+/1- 8+/1-
Молярное отношение дендример-лекарственное средство 1/8 1/4 1/2 1/1
Общее число молекул дендримера и лекарственного средства 1,2×1015 8×1015 1,2×1015 4×1015 1,2×1015 2×1015 1,2×1015 1×1015

Результаты поведения этих смесей при электрофорезе, а также контрольного дендримера без лекарственного средства показаны на фиг. 26b, маркированной как “NN + Met”. Здесь можно наблюдать, как задержки дендримеров создают границу на фоне свободного дендримера во всех отношениях комплексов. Поэтому можно сказать, что комплекс NN-метотрексат сформирован. Задержка не увеличивается, когда помещено больше молекул лекарственного средства (1), и меньшая, когда их меньше (4), но есть и наоборот. Это может быть обусловлено тем фактом, что доступность (+) зарядов дендримера для молекул метотрексата не является свободной, то есть все (+) заряды не могут быть занятыми молекулами метотрексата, так как есть возможность стерических препятствий между ними, так что в присутствии большого числа молекул метотрексата в среде они конкурируют между собой за связывание с (+) зарядами, и поэтому связи не стабилизированы, и результатом этого является комплекс, в котором связано меньшее количество молекул лекарственного средства, чем это теоретически допустимо в единицу времени. Возникало динамическое равновесие.

b) Гепарин

Гепарин, использованный в тесте, представлен в водном растворе, с концентрацией 10 мг/мл (1000U). Поскольку мы не знаем ни его молекулярной массы, ни количества отрицательных зарядов, хотя известно, что есть несколько зарядов, речь идет о связи с дендримером, образованной единицами гепарина. Так, были приготовлены и инкубированы дендример-гепариновые смеси, которые отвечают характеристикам, показанным ниже в Таблице 10.

Таблица 10
Состав NN дендример-гепариновой смеси
Контроль 1 2 3 4
NN
100 мкМ
(1,2 × 1015 молекул)
1,2 × 1015 молекул NN
+
10 единиц (U) гепарина
1,2 × 1015 молекул NN
+
1 единица гепарина
1,2 × 1015 молекул NN
+
0,5 единицы гепарина
1,2 × 1015 молекул NN
+
0,1 единицы гепарина

Результаты поведения этих смесей при электрофорезе, а также контрольного дендримера без лекарственного средства показаны на фиг. 26с, маркированной как “NN + Нер”. Как можно наблюдать на названном чертеже, задержки происходят с дендримерами, инкубированными с гепарином, относительно контроля для всех соотношений дендример-лекарственное средство; действительно, дендример мигрирует меньше, только когда он связан с 0,1U гепарина. Поэтому можно сказать, что комплекс NN-гепарин формируется.

с) Инсулин

Инсулин, использованный в испытании, представлен в водном растворе, с концентрацией 3,5 мг/мл (100 U). Несмотря на то, что известна его молекулярная масса (5825 г/моль) и выявлено в среднем 4 (-) заряда, связывание с дендримером было выполнено, рассчитывая его по единицам инсулина, имея в виду, что это может быть полезным в целях сравнения результатов по дозе свободного инсулина, применяемой в клинической практике. Так, были приготовлены и инкубированы дендример-инсулиновые смеси, кторые отвечали характеристикам, показанным ниже в Таблице 11.

Таблица 11
Характеристики NN дендример-инсулиновых смесей
Смесь
1 2 3 4
Единиц инсулина 1U 0,5U 0,1U 0,05U
Зарядовые отношения дендример-лекарственное средство 8+/12- 8+/6- 32+/4- 80+/4-
Молярные отношения дендример-лекарственное средство 1/3 1/1,5 4/1 10/1
Общее число молекул дендримера и лекарственного средства 1,2×1015 3,6×1015 1,2×1015 1,8×1015 1,2×1015 0,3×1015 1,2×1015 0,1×1015

Результаты поведения этих смесей при электрофорезе, а также контрольного дендримера без лекарственного средства показаны на фиг. 26d, маркированной как “NN + Ins”. В ней можно наблюдать, что задержки происходят с дендримерами, инкубированными с инсулином, относительно контроля для всех соотношений дендример-лекарственное средство; действительно, дендример мигрирует меньше, только когда он связан с 0,1U или 0,05U инсулина. Поэтому можно сказать, что комплекс NN-инсулин формируется.

- Пример 51: Испытание связывания лекарственных средств с NN16 дендримером

Дендример NN16 был растворен в дистиллированной Н2О при начальной концентрации 434 мкМ, и из этого были сделаны разбавления для достижения концентраций в 100 мкМ, 10 мкМ и 1 мкМ. Предшествующие электрофорезы, проведенные с аликвотами растворов, соответствующих каждой из этих концентраций, которым отвечает гель, показанный на фиг. 27а, продемонстрировали, что дендример был в хорошем состоянии во всех из них и что концентрация в 100 мкМ была пригодной для легкого визуального наблюдения дендримера в геле после окрашивания и выявления возможных задержек в полосе, образованной при электрофорезе не от свободной формы, а от сформированного комплекса с лекарственным средством.

Ниже, испытания связывания с различными лекарственными средствами проводятся следующим образом.

а) Метотрексат

Как уже отмечалось, метотрексат, использованный в этом тесте, представлен в форме водного раствора при концентрации 25 мг/мл с молекулярной массой Mw = 476,427 г/моль и с 1 (-) зарядом на молекулу. Были приготовлены и инкубированы дендример-метотрексатные смеси, которые отвечали характеристикам, показанным ниже в Таблице 12.

Таблица 12
Характеристики смесей NN16 дендример-метотрексат
Смесь
1 2 3 4
Зарядовые отношения дендример-лекарственное средство 1+/1- 2+/1- 4+/1- 8+/1-
Молярные отношения дендример-лекарственное средство 1/16 1/8 1/4 1/2
Общее число молекул дендримера и лекарственного средства 1,2×l015 16×1015 1,2×1015 8×1015 1,2×1015 4×1015 1,2×1015 2×1015

Результаты поведения этих смесей при электрофорезе, а также контрольного дендримера без лекарственного средства показаны в Фиг. 27а, маркированной как “NN16 + Met”. В ней можно наблюдать, что задержки, хотя и не очень резко выраженные, происходят с дендримерами, инкубированными с метотрексатом, относительно контроля для всех соотношений дендример-лекарственное средство. Поэтому можно сказать, что комплекс NN16-метотрексат формируется.

b) Гепарин

Как в предшествующем Примере, гепарин, использованный в тесте, представлен в водном растворе, с концентрацией 10 мг/мл (1000U). Поскольку мы не знаем ни его молекулярной массы, ни количества отрицательных зарядов, хотя известно, что есть несколько зарядов, речь идет о связи с дендримером, образованной единицами гепарина. Так, были приготовлены и инкубированы дендример-гепариновые смеси, которые отвечают характеристикам, показанным ниже в Таблице 13.

Таблица 13
Состав NN16 дендример-гепариновых смесей
Контроль 1 2 3 4
NN16
100 мкМ
(1,2 × 1015 молекул)
1,2 × 1015 молекул NN16
+
10 единиц (U) гепарина
1,2 × 1015 молекул NN16
+
1 единица гепарина
1,2 × 1015 молекул NN16
+
0,5 единицы гепарина
1,2 × 1015 молекул NN16
+
0,1 единицы гепарина

Результаты поведения этих смесей при электрофорезе, а также контрольного дендримера без лекарственного средства показаны на фиг. 27с, маркированной как “NN16 + Нер”. Как можно наблюдать на названном чертеже, задержки происходят с дендримерами, инкубированными с гепарином, относительно контроля для всех соотношений дендример-лекарственное средство; действительно, нет никакой миграции в лунках с дендримером-гепарином. Поэтому можно сказать, что комплекс NN16-гепарин формируется.

с) Инсулин

Как и в предыдущем примере, инсулин, использованный в испытании, представлен в водном растворе, с концентрацией 3,5 мг/мл (100U). Несмотря на то, что известна его молекулярная масса (5825 г/моль) и выявлено в среднем 4 (-) заряда, связывание с дендримером было выполнено, рассчитывая его по единицам инсулина, имея в виду, что это может быть полезным в целях сравнения результатов по дозе свободного инсулина, применяемой в клинической практике. Так, были приготовлены и инкубированы дендример-инсулиновые смеси, которые отвечали характеристикам, показанным ниже в Таблице 14.

Таблица 14
Характеристики NN16 дендример-инсулиновых смесей
Смесь
1 2 3 4
Единиц инсулина 1U 0,5U 0,1U 0,05U
Зарядовые отношения дендример-лекарственное средство 16+/12- 16+/6- 64+/4- 160+/4-
Молярные отношения дендример-лекарственное средство 1/3 1/1,5 4/1 10/1
Общее число молекул дендримера и лекарственного средства 1,2×1015 3,6×1015 1,2×1015 1,8×1015 1,2×1015 0,3×1015 1,2×1015 0,1×1015

Результаты поведения этих смесей при электрофорезе, а также контрольного дендримера без лекарственного средства показаны на фиг. 27d, маркированной как “NN16 + Ins”. В ней можно наблюдать, что задержки происходят с дендримерами, инкубированными с инсулином, относительно контроля для всех соотношений дендример-лекарственное средство; действительно, дендример мигрирует меньше, только когда он связан с 0,1U или 0,05U инсулина. Поэтому можно сказать, что комплекс NN16-инсулин формируется.

- Пример 52: Испытание связывания лекарственных средств с IM16 дендримером

Дендример IM16 был растворен в дистиллированной Н2О при начальной концентрации 442 мкМ, и из этого были сделаны разбавления для достижения концентраций в 100 мкМ, 10 мкМ и 1 мкМ. Предшествующие электрофорезы, проведенные с аликвотами растворов, соответствующих каждой из этих концентраций, которым отвечает гель, показанный на фиг. 28а, продемонстрировали, что дендример был в хорошем состоянии во всех из них.

Ниже, испытания связывания с различными лекарственными средствами проводятся следующим образом.

а) Метотрексат

Как уже отмечалось, метотрексат, использованный в этом тесте, представлен в форме водного раствора при концентрации 25 мг/мл, с молекулярной массой Mw = 476,427 г/моль и с 1 (-) зарядом на молекулу. Были приготовлены и инкубированы дендример-метотрексатные смеси, которые отвечали характеристикам, показанным ниже в Таблице 15:

Таблица 15
Характеристики смесей IM16 дендример-метотрексат
Смесь
1 2 3 4
Зарядовые отношения дендример-лекарственное средство 1+/1- 2+/1- 4+/1- 8+/1-
Молярные отношения дендример-лекарственное средство 1/16 1/8 1/4 1/2
Общее число молекул дендримера и лекарственного средства 1,2×l015 16×1015 1,2×1015 8×1015 1,2×1015 4×1015 1,2×1015 2×1015

Результаты поведения этих смесей при электрофорезе, а также контрольного дендримера без лекарственного средства, показаны на фиг. 28b, маркированной как “IM16 + Met”. В ней можно наблюдать, что никаких задержек не происходит с дендримерами, инкубированными с метотрексатом, относительно контроля для всех соотношений дендример-лекарственное средство. Поэтому можно сказать, что комплекс IM16-метотрексат не формируется.

b) Гепарин

Как в Примерах 50 и 51, гепарин, использованный в тесте, представлен в водном растворе, с концентрацией 10 мг/мл (1000 U). Поскольку мы не знаем ни его молекулярной массы, ни количества отрицательных зарядов, хотя известно, что есть несколько зарядов, речь идет о связи с дендримером, образованной единицами гепарина. Так, были приготовлены и инкубированы дендример-гепариновые смеси, которые отвечают характеристикам, показанным ниже в Таблице 16.

Таблица 16
Состав IM16 дендример-гепариновых смесей
Контроль 1 2 3 4
IM16
100 мкМ
(1,2 × 1015 молекул)
1,2 × 1015 молекул IM16
+
10 единиц (U) гепарина
1,2 × 1015 молекул IM16
+
1 единица гепарина
1,2 × 1015 молекул IM16
+
0,5 единицы гепарина
1,2 × 1015 молекул IM16
+
0,1 единицы гепарина

Результаты поведения этих смесей при электрофорезе, а также контрольного дендримера без лекарственного средства показаны на фиг. 28с, маркированной как “IM16 + Нер”. Как можно наблюдать в названном чертеже, полосы, которые появляются в дорожках, соответствующих смесям типа 4 (0,1U гепарина), являются более слабыми, чем таковые, образованные контролем, что показывает, что гепарин связывается с малой частью дендримера. При других отношениях дендример-лекарственное средство гепарин препятствует миграции дендримера. Поэтому можно сказать, что комплекс IM16-гепарин формируется.

с) Инсулин

Как в Примерах 50 и 51, инсулин, использованный в испытании, представлен в водном растворе, с концентрацией 3,5 мг/мл (100U). Несмотря на то, что известна его молекулярная масса (5825 г/моль) и выявлено в среднем 4 (-) заряда, связывание с дендримером было выполнено, рассчитывая его по единицам инсулина, имея в виду, что это может быть полезным в целях сравнения результатов по дозе свободного инсулина, применяемой в клинической практике. Так, были приготовлены и инкубированы дендример-инсулиновые смеси, которые отвечали характеристикам, показанным ниже в Таблице 17.

Таблица 17
Характеристики IM16 дендример-инсулиновых смесей
Смесь
1 2 3 4
Единиц инсулина 1U 0,5U 0,1U 0,05U
Зарядовые отношения дендример-лекарственное средство 16+/12- 16+/6- 64+/4- 160+/4-
Молярные отношения дендример-лекарственное средство 1/3 1/1,5 4/1 10/1
Общее число молекул дендримера и лекарственного средства 1,2×1015 3,6×1015 1,2×1015 1,8×1015 1,2×1015 0,3×1015 1,2×1015 0,1×1015

Результаты поведения этих смесей при электрофорезе, а также контрольного дендримера без лекарственного средства показаны на фиг. 28d, маркированной как “IM16 + Ins”. В ней можно наблюдать, что задержки происходят с дендримерами, инкубированными с инсулином, относительно контроля для всех соотношений дендример-лекарственное средство, хотя в дорожках, соответствующих смесям, которые содержали 0,05U или 0,01U инсулина, задержки происходят только с некоторыми молекулами дендримера: полоса мигрирует, как в контроле, но слабее. Вместо этого, когда инкубация происходит с 0,5U инсулина, задержка значительна, и в дорожке, соответствующей смесям, инкубированным с дендримером при 1U инсулина, вообще нет полос, и это показывает, что формируется комплекс, который не переходит в гель. Поэтому можно сказать, что комплекс IM16-инсулин формируется.

Определение стабильности комплексов дендример-лекарственное средство к величине рН

Когда связывание разнообразных лекарственных средств с дендримерами было подтверждено, была предпринята попытка проверить, обратима ли связь, выяснив, происходит ли диссоциация комплекса дендример-лекарственное средство вследствие изменения величины рН среды, и попытка воспроизвести то, что могло бы происходить в физиологических условиях, для которых предполагалось, что комплекс дендример-лекарственное средство мог бы проникать в клетку через эндосому, внутренняя часть которой была бы закислена по достижении цитоплазмы действием протонных насосов, что могло бы приводить к высвобождению дендримером лекарственного средства и захватом этой частью избытка протонов.

Известно, что значение рН, которое достигается в эндосоме, может составлять от 4,5 до 6,5[77,78,79]. Поэтому величины рН, избранные для выполнения теста, были такими:

5 - 6 - 7,4 - 9 - 10

Испытание поведения комплексов дендример-лекарственное средство, предварительно сформированных при варьировании величины рН среды, было вновь проведено путем оценки задержки в полиакриламидном геле дендримера, связанного с лекарственным средством, относительно свободного дендримера, согласно способу, подобному тому, какой был использован в тестах для определения связи дендример-лекарственное средство, хотя с введением стадии с вариацией рН в способ формирования комплекса перед электрофорезом, и весь способ выполнялся следующим путем:

- Формирование комплекса: Оно было выполнено в конечном объеме смеси 30 мкл, который представляет собой максимальный объем для помещения в гель. Чтобы сделать это, мы исходили из необходимого количества дендримера, которое обеспечивает в полной мере идентифицируемую полосу путем окрашивания нитратом серебра в геле, когда проводился электрофорез: 20 мкл раствора с концентрацией 100 мкМ, которые соответствуют 1,2×1015 молекул. Лекарственное средство добавляется в остальных 10 мкл с выбором для него минимальной концентрации, которая, согласно ранее проведенным тестам образования комплексов, в состоянии обеспечивать наглядную задержку полосы комплекса дендример-лекарственное средство относительно полосы, соответствующей свободному дендримеру; выбор этой концентрации гарантирует, что комплекс дендример-лекарственное средство сформируется. Инкубация смесей дендримеров и лекарственных средств была выполнена при 37°С в течение 1 часа, чтобы дать время для формирования более термодинамически стабильного комплекса, хотя для его образования может потребоваться и более длительный период. Для каждого испытуемого значения рН были инкубированы 2 смеси. Затем были добавлены 10 мкл 0,1М буфера, которые были способны поддерживать величину рН, заданную в каждом тесте, при конечной 0,025-молярной концентрации, которая в них достигается, с последующим выдерживанием каждого образца при 37°С в течение последующих 15 минут.

- Электрофорез и окрашивание геля: Они были выполнены в тех же условиях, описанных в тестах определения связи дендример-лекарственное средство.

- Дендримеры:

Тесты были выполнены с дендримером IM16:

(2G-[Si(OCH2CH2NMe3+I-)2]8 (19).

- Лекарственные средства:

Инсулин был избран для выполнения теста, с добавлением 0,5 единицы (0,5U) к каждой реакционной смеси.

- Буферные растворы

Растворы, приготовленные с различными солями фосфорной кислоты, были избраны в качестве буферных растворов. Чтобы сделать это, были взяты 0,2М растворы каждого из соединений H2PO4Na, HPO4Na2 и PO4Na3, из которых буферные растворы были приготовлены с желаемой для каждого из них величиной рН, все с 0,1М-концентрацией, смешением объемов названных растворов, каковые указаны в Таблице 18, и доливанием водой до 100 мл.

Таблица 18
Состав буферных растворов
Буферный раствор pH Объем H2PO4Na 0,2-молярный (мл) Объем HPO4Na2 0,2-молярный (мл) Объем PO4Na3 0,2-молярный (мл) Конечный объем
(мл)
T5 5 49,3 0,7 - 100
T6 6 43,9 6,1 - 100
T7,4 7,4 11,2 38,8 - 100
T9 9 0,4 49,6 - 100
T10 10 - 49,8 0,2 100

Подробности тестов и результаты описаны ниже.

- Пример 53: Тест рН-стабильности комплексов IM16 дендример-лекарственное средство

Были приготовлены 10 реакционных смесей («С» образцы: комплекс) для формирования комплекса дендример-лекарственное средство, добавляя к каждой из них 20 мкл раствора дендримера с концентрацией 100 мкМ и 10 мкл раствора инсулина, который содержал 0,5U последнего. Для каждой из названных реакционных смесей был приготовлен контрольный образец (“D”: свободный дендример), в который был добавлен дендример, но не лекарственное средство. После 1 часа инкубации к каждому образцу были добавлены 10 мкл буфера с тем, чтобы 20 образцов имели состав и характеристики, показанные ниже в Таблице 19.

Таблица 19
Буфер
Конечная величина рН Тип образца Количество образцов Дендример IM16 (концентрация 100 мкМ) Единицы инсулина Буферный раствор Объем (мкл) Конечная концентрация (моль/л)
5 D (контроль) 2 20 мкл 0,5 T5 10 0,025
С (комплекс) 2 20 мкл 0,5 T5 10 0,025
6 D (контроль) 2 20 мкл 0,5 T6 10 0,025
С (комплекс) 2 20 мкл 0,5 T6 10 0S025
7,4 D (контроль) 2 20 мкл 0,5 T7,4 10 0,025
С (комплекс) 2 20 мкл 0,5 T7,4 10 0,025
9 D (контроль) 2 20 мкл 0,5 T9 10 0,025
С (комплекс) 2 20 мкл 0,5 T9 10 0,025
10 D (контроль) 2 20 мкл 0,5 T10 10 0,025
С (комплекс) 2 20 мкл 0,5 T10 10 0,025

После периода выжидания с момента добавления буфера (15 минут) образцы подвергались электрофорезу и окрашиванию геля, формируя распределение полос, показанное на фиг. 29, в которой образцы представлены распределенными по двум различным гелям. На названном чертеже можно видеть, что при кислотных значениях рН свободный дендример остается стабильным, в то время как в дорожках с комплексом наблюдается появление полос, для которых можно сделать вывод, что происходит частичная диссоциация комплексов, и лекарственное средство высвобождается из дендримера, оставляя последний свободным. При щелочных значениях рН дендример нестабилен и разрушается, что ведет к диссоциации комплекса.

Вывод таков, что комплекс IM16 дендример-лекарственное средство диссоциирует при кислотных значениях рН, что позволяет допустить, что другие комплексы дендример-лекарственное средство также могут проявить подобное поведение.

Поэтому тесты, описанные в Примерах 50-53, подтверждают полезность дендримеров как переносчиков лекарственных средств с отрицательным зарядом в крови и что, более того, связывание обратимо, и высвобождение лекарственного средства становится возможным внутри клетки при кислотном значении рН, которое достигается в поглощающей эндосоме.

Трансфекция клеток, взятых из нервной системы, олигонуклеотидами, транспортируемыми дендримерами

Поскольку тесты, выполненные с PBMC, демонстрируют, что дендример-ODN комплексы могут проникать в клетку и становятся способными диссоциировать в ней, были выполнены тесты для проверки, могут ли дендримеры служить трансфекционными переносчиками ODN или других молекул полианионного характера, таких как RNAi, в клетки, в которых названные молекулы приводят к низкой степени трансфекции, повышая ее. Поэтому были избраны две линии, производные из нервной системы, SK-N-MC (нейробластома: АТСС НТВ10) и U87-MG (астроглиома: ICLC HTL 00013), и было проверено, в первую очередь, что карбосилановые дендримеры согласно изобретению были нетоксичны, поэтому не приводили к пролиферации, после чего было испытано, может ли степень трансфекции ODN в этих клетках быть повышена при пенетрации в них тех комплексов, которые сформированы с дендримерами согласно изобретению. Тесты были выполнены с дендримерами NN (2G-[Si(O(CH2)2N(Me)(CH2)2NМe3+I-)]8 (26)) и NN16 (2G-[Si(O(CH2)2N+(Me)2(CH2)2NМe3+2I-)]8 (36)). Трансфекционные тесты были выполнены с anti-rev RF ODN (SEQ ID NO:2). Культуральной средой была DMEM + 10% бычьей эмбриональной сыворотки.

- Пример 54: Пролиферация клеток SK-N-MC и U-87-MG, инкубированных с дендримерами

Были выполнены различные эксперименты, один с клетками SK-N-MC и еще один с клетками U-87-MG, в которых было изучено действие дендримеров на пролиферацию названных линий. Для этого 7000 соответствующих клеток на лунку были помещены в 96-луночную плашку. Клетки были инкубированы с различными концентрациями (1 мкМ, 5 мкМ и 10 мкМ) либо NN-дендримера, либо NN16-дендримера, в течение 3 суток. В качестве позитивного пролиферативного контроля клетки были инкубированы с 20 мкг/мл LPS, и, в качестве позитивного контроля индукции клеточной смерти, использованные клетки были инкубированы с 7% ДМСО. В качестве негативного контроля были использованы необработанные клетки. Через 3 суток инкубации пролиферация клеток была измерена с использованием пролиферативного теста CellTiter 96 Aqueous One Solution Cell Proliferation от Promega, который позволяет количественно определить пролиферацию клеток по оценке восстановительной способности клеток, определяемой из колориметрического изменения, вызываемого биологическим восстановлением красителя MTS (3-(4,5-диметилтиазол-2-ил)-5-(3-карбоксиметоксифенил)-2-(4-сульфофенил)-2Н-тетразолий в комбинации с электрон-связывающим реагентом PES (этосульфат феназина). Величина оптической плотности при 490 нм, полученная для негативного контроля, была принята за единицу, относительно которой считались доли оптической плотности.

Верхняя часть фиг. 30, маркированная как «А», показывает график с результатами, полученными с U87-MG клетками. Видно, что полосы, соответствующие образцам, инкубированным с дендримерами, показывают пролиферацию клеток, очень сходную с таковой для негативного контроля (С-), по каковой причине можно сказать, что, с одной стороны, дендримеры NN и NN16 не индуцируют пролиферацию, а с другой, клетки не погибают после инкубации их в течение 3 суток с линией клеток U87-MG.

Нижняя часть Фиг. 30, маркированная как «В», показывает график с результатами, полученными на клетках SK-N-MC. В ней можно видеть, что как дендример NN, так и дендример NN16 токсичны для линии клеток SK-N-MC при концентрации 10 мкМ. Напротив, при концентрациях в 1 мкМ и 5 мкМ нет ни токсичности, ни пролиферации клеток.

Пример 55: Изучение токсичности дендримеров в клетках U-87-MG

- Тесты с MTT

Был выполнен тест с клетками U-87-MG, в котором влияние дендримеров на жизнеспособность названных линий было изучено при различных отрезках времени. Чтобы сделать это, 15000 (24 часа инкубации), 7000 (3 суток инкубации) или 1500 (7 суток инкубации) клеток на лунку были помещены в 96-луночные пластины. Клетки были инкубированы с различными концентрациями (1 мкМ, 5 мкМ и 10 мкМ) либо NN-дендримера, либо NN16-дендримера, в течение 24 часов, 3 суток и 7 суток. Были использованы два различных негативных контроля: необработанные клетки (С-) и, дополнительно, клетки, инкубированные с различными концентрациями (1 мкМ, 5 мкМ и 10 мкМ) декстрана, макромолекула которого обычно применяется в качестве негативного контроля цитотоксичности в испытаниях новых биологических материалов. Также были использованы два различных позитивных контроля: клетки, обработанные 7% ДМСО, и клетки, обработанные 1% Triton X-100.

Чтобы иметь возможность провести другие контрольные исследования, была также изучена токсичность коммерческих дендримеров Superfect® и Polyfect® (оба от фирмы Qiagen) через 24 часа, 3 и 7 суток. В случае с Superfect были протестированы три дозы: оптимальная доза, рекомендуемая изготовителем (2,5 мкл), пониженная доза (1,25 мкл) и еще одна повышенная доза (5 мкл). Что касается Polyfect, специально предназначенного для вязких клеток, были протестированы три дозы: оптимальная доза (0,6 мкл), пониженная доза (0,3 мкл) и повышенная доза (1,2 мкл).

После каждого соответствующего времени инкубации был выполнен тест с MTT аналогично описанному в Примере 38. Величина оптической плотности, полученная для необработанных клеток (С-), была принята за единицу, относительно которой считались доли оптической плотности.

Фиг. 31 позволяет наблюдать результаты, полученные с клетками U87-MG. График верхней части, маркированный как «А», соответствует значениям, полученным через 24 часа инкубации; график, размещенный в средней части, маркированный как «В», соответствует значениям, полученным через 3 суток инкубации; наконец, график, расположенный в нижней части, маркированный как «С», соответствует значениям, полученным через 7 суток инкубации.

На названных графиках можно видеть, что клетки, обработанные декстраном, как через 24 часа, так и через 3 и 7 суток имели показатели жизнеспособности, равные или превышающие 0,8.

Коммерческий дендример Superfect через 24 часа инкубации показал сходный показатель жизнеспособности клеток при любых концентрациях, равный 0,7. Это значение снижалось после трех суток даже для пониженной дозы (1,25 мкл), доводя значение показателя до 0,4. Через 7 суток инкубации с Superfect клетки мертвы при любой из трех использованных доз.

Дендример Polyfect имел меньшую токсичность, чем Superfect, при любой из испытанных доз.

Что касается дендримеров согласно изобретению NN и NN16, показатели жизнеспособности, полученные через 24 часа, были сходными между собой и были найдены в интервале от 0,6 до 0,75 относительно негативного контроля. Жизнеспособность клеток через 3 суток, в случае NN-дендримера, снижается с нарастанием концентрации, переходя от значений 0,95 при концентрации 1 мкМ до значений 0,5 при 10 мкМ. Что касается NN16-дендримера, он дает значения, близкие к 0,8 при любой из трех изученных концентраций. Через 7 суток инкубации с карбосилановыми дендримерами U87-MG имеет показатели жизнеспособности, близкие или превышающие таковые для негативного контроля, за исключением случая с NN16 при концентрации 10 мкМ, где показатель жизнеспособности составляет 0,7.

- Измерение концентрации лактатдегидрогеназы (LDH) в супернатанте

Еще одна форма оценки клеточной токсичности, которая может быть вызвана дендримерами, состоит в количественном определении концентрации LDH в надосадочной жидкости клеточной культуры, которая рассматривается как прямое измерение цитотоксичности некоторых соединений или молекул и основана на идее повреждения клеточной мембраны. Поэтому испытание жизнеспособности было проведено на клетках U87-MG подобно таковому для определения с помощью MTT, хотя в этом случае жизнеспособность была определена путем измерения концентрации LDH в супернатанте клеточной культуры через 24 часа инкубации в культуральной среде, к которой были добавлены декстран, коммерческие дендримеры Superfect или Polyfect, дендримеры согласно изобретению NN и NN16, ДМСО или TRiron X-100. Концентрации и объемы каждого из этих соединений были такими же, какие использовались в тесте, выполненном с MTT. Коммерческий набор Cytotoxicity Detection KitPLUS (LDH) от фирмы Roche Applied Science был использован для определения лактатдегидрогеназы согласно инструкциям изготовителя.

Для оценки результатов значение 1 было приписано негативному контролю (необработанные клетки) с расчетом из этого значений цитотоксичности каждого из соединений, с которыми были инкубированы клетки.

Полученные результаты, которые показаны на фиг. 32, демонстрируют, что, как наблюдалось в тесте, выполненном с MTT, Polyfect является коммерческим дендримером, который имеет наименьшую токсичность при любой из концентраций, тогда как Superfect вызывает большие повреждения мембраны по мере возрастания концентрации, приводя к показателям цитотоксичности, в 5 раз превышающим таковую для негативного контроля при максимальной дозе (5 мкл).

Дендримеры NN и NN16 имеют более высокую цитотоксичность по мере нарастания их концентраций. В сравнении их между собой NN16 менее токсичен, чем NN.

Пример 56: Исследования токсичности дендримеров на клетках SK-N-MC

Испытания, аналогичные таковым, какие описаны в Примере 55 для клеток U87-MG, были выполнены на SK-N-MC клетках (оценка жизнеспособности клеток тестами, выполненными с MTT и количественным определением LDH в клеточном супернатанте): клетки были инкубированы с теми же соединениями при тех же концентрациях, хотя в этом случае измерения отдельно с МТТ были выполнены через 24 часа инкубации.

Как в Примере 55, значения оптической плотности, полученные в тесте с МТТ, были индексированы как негативный контроль с получением результатов, показанных в верхней части Фиг. 33 (А).

Согласно этим результатам, клетки, инкубированные с декстраном, показали значения жизнеспособности, равные или превышающие таковые для негативного контроля при любой из использованных концентраций.

Клетки, обработанные дендримером Polyfect, имели показатели жизнеспособности выше 0,7 при любой из трех использованных концентраций, в отличие от того, что имеет место, когда клетки были обработаны дендримером Superfect, который привел к показателям жизнеспособности около 0,5.

Что касается дендримеров согласно изобретению, то наблюдается, что, в отличие от того, что происходит в линии U87-MG, изменения концентраций дендримеров привели к очень сильным вариациям жизнеспособности клеток. Из двух испытанных дендримеров согласно изобретению (NN и NN16), NN16 был дендримером с наименьшей токсичностью.

В тесте с количественным определением LDH значение 1 было приписано негативному контролю с расчетом других показателей цитотоксичности по названному значению и получением результатов, показанных в нижней части Фиг. 33 (В). Полученные результаты подтверждают наблюдения, сделанные в отношении теста с МТТ.

Пример 57: Трансфекция дендример-опосредованных U87-MG и SK-N-MC клеток

100000 клеток на лунку соответствующей клеточной линии были помещены в 24-луночную пластину с 500 мкл среды.

Дендриплексы были сформированы с дендримерами NN и NN16 и флуоресцентным anti-rev антисмысловым олигонуклеотидом в общем объеме 75 мкл среды без сыворотки, в которой anti-rev олигонуклеотид был смешан в концентрации 250 нМ с соответствующим дендримером в различных пропорциях, с тем чтобы были получены различные -заряд/+заряд отношения: 1:1, 1:2, 1:4 и 1:8. Смесь была инкубирована в течение получаса при комнатной температуре и затем была добавлена в соответствующую лунку для инкубирования клеток с дендриплексами.

Через 24 часа инкубации клетки были удалены из лунки, они были дважды промыты PBS, они были инкубированы в течение 1 минуты с кислым глицином для удаления возможных частиц дендриплексов, которые могли оставаться прилипшими к клеточной мембране, и конечная промывка была выполнена PBS. Наконец, клетки были ресуспендированы в 500 мкл PBS, и количество флуоресцентного олигонуклеотида внутри клетки было количественно определено с помощью проточной цитометрии.

Фиг. 34а и 34b показывают результаты, полученные с клеточной линией U87-MG. Графики соответствуют результатам с клетками, инкубированными с олигонуклеотидом без дендримера (Ctrl) или с комплексами, сформированными одним из дендримеров и anti-rev олигонуклеотидом в пропорциях, которые привели к -заряд/+заряд отношениям, обозначенным на каждом графике: 1:1, 1:2, 1:4 и 1:8. Фиг. 34а соответствует тестам с NN-дендримером, тогда как Фиг. 34b соответствует тестам, выполненным с NN16-дендримером. В обоих случаях графики позволяют видеть, что инкубация U87-MG клеток с комплексами, сформированными с увеличенным количеством дендримера, приводит к увеличению трансфекции, переходя от 19%, достигнутых в случае инкубирования клеток только с олигонуклеотидом (Ctrl), до 95%, когда инкубировался дендриплекс, образованный с -заряд/+заряд отношением 1:8, и 97,8% в случае инкубирования дендриплекса, сформированного с NN16 дендримером также с -заряд/+заряд отношением 1:8. Поэтому результаты демонстрируют, что увеличение количества дендримера относительно олигонуклеотида ведет к росту процентной доли подвергнутых трансфекции клеток, достигая точки максимума трансфекции, когда -заряд/+заряд отношение равно 1:8.

Фиг. 35 показывает результаты, полученные на клеточной линии SK-N-MC с NN16-дендримером. В этом случае максимальная трансфекция достигается с дендриплексами, сформированными с -заряд/+заряд отношением 1:4 (82,3%).

Как в одной клеточной линии, так и в другой происходит увеличение процентной доли трансфекции, имеющей место при инкубировании клеток с дендриплексами, относительно таковой, какая получается при инкубировании с отдельным нуклеотидом, особенно когда -заряд/+заряд пропорции составляют 1:4 или 1:8, то есть когда доля дендримера возрастает относительно любого другого олигонуклеотида, составленного рибонуклеотидами или дезоксирибонуклеотидами, это приводит к подобным результатам, хотя оптимальные -заряд/+заряд отношения могли бы быть различными согласно типу подвергаемой трансфекции клетки или конкретного дендримера и олигонуклеотида, которые образуют дендриплекс. В любом случае описанные тесты подтверждают полезность карбосилановых дендримеров согласно изобретению как переносчиков для усиления трансфекции полианионных молекул, таких как олигонуклеотиды, олигодезоксирибонуклеотиды (ODN) или интерференционная РНК (RNAi).

Список литературы

1. M. Fischer, F. Vögtle, Angew. Chem. 1999, 111, 934-955; Angew. Chem. Int. Ed. 1999, 38, 884-905 и приведенные здесь ссылки.

2. Hacein-Bey-Abina S. et al. N Engl J Med. 2003 Jan 16; 348(3):255.

3. P. L. Felgner, t. R. Gadek, M. Holm, R. Roman, H. W. Chan, M. Wenz, J. P. Northrop, G. M. Ringold, M. Danieisen, Proc. Natl. Acad. Sci. USA, 1987, 84, 7413-7417.

4. G McLachlan, B.J. Stevenson, D.J. Davidson, D.J. Porteous. Gene Ther. 2000 Mar; 7(5):384-92.

5. T. V. Chirila, P. E. Rakoczy, K. L. Garret, X. Lou, I. J. Constable, Biomaterials 2002, 23, 321-342.

6. J. Haensler, F. C. Szoka Jr., Bioconjugate Chem. 1993, 4, 372-379.

7. A. U. Bielinska, C. Chen, J. Johnson, J. R. Baker jr., Bioconjugate Chem. 1999, 10, 843-850.

8. C. Loup, M. A. Zanta, A. M. Caminade, J. P. Majoral, B. Meunier, Chem Eur. J. 1999, 5, 3644-3650.

9. B. H. Zinselmeyer, S. P. Mackay, A. G. Schatzlein, I. F. Uchegbu, Pharm. Res. 2002, 19, 960-967.

10. T. Nidome, M. Wakamatsu, A. Wada, T. Hirayama, H. Aoyagi, J. Pep. Sci. 2000, 271-279.

11. R. Hogrefe. Antisense and Nucleic Acid Drug Development, 9, 351-357 1999. Updated 2002.

12. DA Jabs et al. Am J Ophthalmol. 2002 Apr; 133(4):552-6.

13. S. Agrawal et al. Int J Oncol. 2002 M; 21(l):65-72.

14. N. Sato et al. Clin Cancer Res 2001 Nov; 7(l1):3606-12.

15. C. Giovannangeli, et al. Proc. Natl. Acad. Sci. USA. 1997. Jan. Vol. 94, pp. 79-84,

16. D.M. Klinman DM. Expert Opin Biol Ther. 2004 Jun; 4(6):937-46.

17. B. Tavitian. Gut. 2003; 52 (Suppl IV):iv40-iv47.

18. P. Fiset, and A.S. Gounni. Reviews in Biology and Biotechnology Vol.1, No 2, May 2001. pp. 27-33. Антисмысловые ODN-нуклеотиды: проблемы применения и их решения.

19. M Witvrouw et al. Mol Pharmacol. 2000 58:1100-1108.

20. S. Supattapone, H, B, Nguyen, F. E. Cohen, S.B, Prusiner and M. R. Scott. PNAS. 1999. Dec. 7. Vol. 96, Issue 25, 14529-14534.

21. N. Malik, R. Wiwattanapatapee, K. Klopsch, K. Lorenz, H. Frey, J. W. Weener, E. W. Meijer, W. Paulus, R. Duncan, J. Control, Rel. 2000, 65, 133-148.

22. S. W. Krska, D. Seyferth, J. Am. Chem. Soc. 1998, 120, 3604-3612.

23. B. Luhmann, H. Lang, K. Bruning, Phosph. Sulf. Silic. Relat. Element. 2001, 168, 481-484.

24. A. W. Kleij, R. van de Coevering, R. J. M. Klein Gebbink, A. M. Noordman, A. L. Spek, G. van Koten, Chem. Eur. J. 2001, 7, 181-192.

25. A. W. van der Made, P. W. N.M. van Leeuwen, J. Chem. Soc., Chem. Commun. 1992, 1400-1401.

26. K. Lorenz, R. Mülhaupt, H. Frey, U. Rapp, F. J. Mayer-Posner, Macromolecules 1995, 28, 6657-6661.

27. C. Kim, I. Jung, J. Organomet. Chem. 1999, 588, 9-19.

28. Karstedt, B. D. U.S. Patent 1973, 3, 775, 452.

29. S. W. Krska, D. Seyferth, J. Am. Chem. Soc. 1998,120, 3604-3612.

30. Hamilton, M.A., R.C. Russo, у R.V. Thurston, Environ. Sci. Technol. 1977, 11(7): 714-719; Correction 1978, 12(4):417.

31. Dendrimers and other dendritic polymers. Eds. J. M. Fréchet, D. A. Tomalia. Wiley Series in Polymer Science 2001. J. Wiley & Sons, Ltd.

32. Dendrimers and Dendrons: Concepts, Syntheses, Applications. Ed. G.R. Newkome, C.N. Moorefield, F. Vögtle, Wiley-VCH, 2001.

33. G. E. Ossterom, J. N. H. Reek, P. C. J. Kamer, P. W. N. M. van Leeuwen, Angew. Chem. Int. Ed. 2001, 40, 1828-1849.

34. D. Astruc, F. Chardac, Chem. Rev. 2001, 101, 2991-3023.

35. S. M. Grayson, J. M. J. Fréchet, Chem. Rev. 2001, 101, 3819-3867.

36. S. E. Stiriba, H. Frey, R. Haag, Angew. Chem. Int. Ed. 2002, 41, 1329-1334.

37. F. Aulenta, W. Hayes, S. Rannard, Eur. Polym. J. 2003, 39, 1741-1771.

38. U. Boas, P. M. H. Heegaard, Chem. Soc. Rev., 2003, 33, 43-63.

39. J. Dennig, E. Duncan, Rev. Mol. Biotech. 2002, 90, 339-347.

40. J. Dennig, Top. Curr. Chem. 2003, 228, 227-236.

41. M. Ohraki, T. Okuda, A. Wada, T. Hirayama, T. Nidome, H. Aoyagi, Bioconjugate Chem. 2002, 13, 510-517.

42. A. W. van der Made, P. W. N. M. van Leeuwen. J. C. de Wilde, R. A. C. Brandes, Adv. Mater. 1993, 5, 466-468.

43. J. Roovers, P.M. Toporowski, L.L. Zhou, Polym. Prep. (J Am. Chem Soc., Div. Polym. Chem.), 1992, 33, 182.

44. L. L. Zhou, J. Roovers, Macromolecules. 1993, 26, 963-968.

45. D. Seyferth, D. Y. Son, A. L. Rheingold, R. L. Ostrander, Organometallics 1994, 13, 2682-2690.

46. I. Cuadrado, M. Morán, J. Losada, C. M. Casado, C. Pascual, B. Alonso, F. Lobete, en Advances in Dendritic Macromolecules; Eds.; G.R. Newkomone, JAI Press Inc: Greenwich CT, 1999, Vol. 3, pp 151-191.

47. M. Veith, R. Elsässer, R. P. Krüger, Organometallics 1999, 18, 656-661.

48. C. Kim, I. Jung, J Organomet Chem. 2000, 599, 208-215.

49. S. Arévalo, E. de Jesús, F. J. de la Mata, J: C. Flores, R. Gómez, Organometallics 2001, 20, 2583-2592.

50. N. Bourne, et al. Antimicrob Agents Chemother, 2000, 44(9), 2471-2474.

51. Y. Gong, et al., Antiviral Res, 2002, 55(2), 319-329.

52. M. Witvrouw, et al., Med Chem, 2000, 43(5), 778-783.

53. C.Z. Chen, у S.L. Cooper, Biomaterials, 2002, 23, 3359-3368.

54. C.Z. Chen, N.C. Beck-Tan, P. Dhurjati, Т.К. van Dyk, R.A. LaRossa, S.L. Cooper, Biomacromolecules, 2000, 1(3), 473-480.

55. D.J. Selkoe, Science, 1997, 275(5300), 630-631.

56. J. Hardy у DJ Selkoe, Science, 2002, 297, 353-356.

57. K. Sadler, у J.P. Tam, J Biotechnol, 2002, 90(3-4), 195-229.

58. J.C. Spetzler, у J.P. Tam, Pept Res, 1996, 9(6), 290-296.

59. C.A. Moreno, et al., Vaccine, 1999, 18(1-2): 89-99.

60. S. Ota, et al., Cancer Res, 2002, 62(5), 1471-1476.

61. R.A. Benkeser, J. Kang, J. Organomet. Chem., 1980, 185, C9.

62. J.L. Speier, J.A. Webster, G.H. Barnes, J. Amer. Chem. Soc. 1957, 79, 974.

63. V. Le Berre, E. Trévisiol, A. Dagkessamanskaia, S. Sokol, A.M. Caminade, J.P. Majoral, B. Meunier у J. François, Nud. Acids Res., 2003, 31, e88.

64. P. Veprek у J. Jezek, J Pept Sci, 1999, 5(5), 203-220.

65. S. Andre, et al., Chembiochem, 2001, 2(11), 822-830.

66. R. Roy, M.G. Baek, K. Rittenhouse-Olson, J. Am. Chem. Socj., 2001, 123, 1809-1816.

67. R. Roy, Curr. Opin. Struct. Biol ., 1996, 6, 692-702.

68. J.F.G.A. Jansen, E.W. Meijer, E.M.M. de Brabander-van den Berg, Macromol. Symp., 1996, 102, 27-33.

69. T.P. Devasagayam у J.P. Kamat, Indian J Exp Biol, 2002, 40(6), 680-692.

70. S.H. Battah, et al., Bioconjug Chem, 2001, 12(6), 980-988.

71. N. Nishiyama, et al., Bioconjug Chem, 2003, 14(1), 58-66.

72. A.S. Chauhan, S. Sridevi, K.B. Chalasani., A.K. Jain., S.K. Jain, N.K. Jain, P.V. Diwan, J. Control. Rel, 2003, 90, 335-343.

73. K. Kono, M. Liu у J.M. Frechet, Bioconjug Chem, 1999, 10(6), 1115-1121.

74. A. Quintana, et al., Pharm Res, 2002, 19(9), 1310-1316.

75. S. Shukla, et al., Bioconjugate Chem, 2003, 14, 158-167.

76. N. Malik, E.G. Evagorou у R. Duncan, Anticancer Drugs, 1999, 57, 249-257.

77. R.F, Murphy et al., The Journal of Cell Biology, 1984, 98, 1757-1762.

78. O. Seksek et al., The Journal of Biological Chemistry, 1996, 271(26), 15542-15548.

79. http://www.cytochemistry.net/Cell-biology/lysosome.htm.

1. Разветвленный карбосилановый дендример с концевыми фрагментами на концах его ветвей, которые содержат первичные, вторичные, третичные или четвертичные аминогруппы, который отвечает любой из формул:
,
если они представляют собой первую генерацию;
,
если они представляют собой вторую генерацию;
,
если они представляют собой третью генерацию;
или соответствующим аналогичным формулам в случае более высоких генераций, в которых формула, соответствующая каждой генерации i, должна быть результатом замещения Хр в формуле, соответствующей предшествующей генерации, новым блоком типа:
,
преобразуя группу, связанную с тем же атомом кремния, что и этот замещающий блок, и переходя от обозначения (Ri-1)3-p к обозначению (Ri-1)3-z,
формулам, в которых:
Alq1, Alq2, Alq3, Alqi представляют алкиленовые фрагменты из 2 до 4 атомов углерода, которые выбраны независимо друг от друга согласно длине ветвей в каждой генерации;
R1, R2, R3, …, Ri-1, Ri представляют фрагменты, которые выбраны независимо друг от друга из метила и фенила;
X представляет фрагмент, который содержит по меньшей мере одну первичную, вторичную, третичную или четвертичную аминогруппу;
р представляет собой целое число, которое варьирует между 1 и 3;
m, n, …, z представляют собой целые числа, которые варьируют независимо между 1 и 3.

2. Карбосилановый дендример по п.1, в котором фрагменты Alq1, Alq2, Alq3, …, Alqi выбраны независимо из этиленового и пропиленового фрагментов.

3. Карбосилановый дендример по п.2, в котором все фрагменты Alq1, Alq2, Alq3, …, Alqi являются идентичными и соответствуют пропиленовым фрагментам.

4. Карбосилановый дендример по п.1, в котором целые числа m, n, …, z идентичны друг другу и имеют значение 2.

5. Карбосилановый дендример по п.1, в котором все фрагменты R1, R2, R3, …, Ri-1, Ri идентичны и соответствуют метильным группам.

6. Карбосилановый дендример по пп.1-5, в котором фрагменты Alq1, Alq2, Alq3, …, Alqi идентичны друг другу и соответствуют пропиленовым фрагментам; целые числа m, n, …, j идентичны друг другу и имеют значение 2, и все фрагменты R1, R2, R3, …, Ri-1, Ri идентичны и соответствуют метильным группам.

7. Карбосилановый дендример по п.6, в котором концевой фрагмент ветвей, который содержит по меньшей мере одну аминогруппу, связан с дендримером -О- группой, которая формируется из -ОН группы аминоспирта.

8. Карбосилановый дендример по п.7, в котором концевой фрагмент ветвей, который содержит по меньшей мере одну аминогруппу, выбирают из фрагментов -OCH2CH2N(СН3)2, -ОСН2-(С6Н3)-3,5-(OCH2CH2N(CH3)2)2
и -OCH2CH2N(СН3)CH2CH2N(СН3)2.

9. Карбосилановый дендример по п.8, в котором концевой фрагмент ветвей, который содержит по меньшей мере одну аминогруппу, представляет собой фрагмент -OCH2CH2N(СН3)2.

10. Карбосилановый дендример по п.9, в котором индекс «р» принимает значение 1, и каждая ветвь заканчивается одиночным фрагментом -OCH2CH2N(СН3)2.

11. Карбосилановый дендример по п.10, который принадлежит к первой, второй или третьей генерации.

12. Карбосилановый дендример по п.9, в котором индекс «р» принимает значение 2, и каждая ветвь заканчивается двумя фрагментами -OCH2CH2N(СН3)2.

13. Карбосилановый дендример по п.12, который принадлежит к первой, второй или третьей генерации.

14. Карбосилановый дендример по п.8, в котором концевой фрагмент ветвей, который содержит по меньшей мере одну аминогруппу, представляет собой фрагмент
-ОСН2-(С6Н3)-3,5-(OCH2CH2N(CH3)2).

15. Карбосилановый дендример по п.14, в котором индекс «р» принимает значение 1, и каждая ветвь заканчивается одиночным фрагментом -ОСН2-(С6Н3)-3,5-(OCH2CH2N(СН3)2)2.

16. Карбосилановый дендример по п.15, который принадлежит к первой, второй или третьей генерации.

17. Карбосилановый дендример по п.14, в котором индекс «р» принимает значение 2, и каждая ветвь заканчивается двумя фрагментами -ОСН2-(С6Н3)-3,5-(OCH2CH2N(СН3)2)2.

18. Карбосилановый дендример по п.17, который принадлежит к первой, второй или третьей генерации.

19. Карбосилановый дендример по п.8, в котором концевой фрагмент ветвей, который содержит по меньшей мере одну аминогруппу, представляет собой фрагмент -OCH2CH2N(СН3)CH2CH2N(СН3)2.

20. Карбосилановый дендример по п.19, в котором индекс «р» принимает значение 1, и каждая ветвь заканчивается одиночным фрагментом
-OCH2CH2N(СН3)CH2CH2N(СН3)2.

21. Карбосилановый дендример по п.20, который принадлежит к первой, второй или третьей генерации.

22. Карбосилановый дендример по п.19, в котором индекс «р» принимает значение 2, и каждая ветвь заканчивается двумя фрагментами
-OCH2CH2N(СН3)CH2CH2N(СН3)2.

23. Карбосилановый дендример по п.22, который принадлежит к первой, второй или третьей генерации.

24. Карбосилановый дендример по п.6, в котором концевой фрагмент ветвей, который содержит по меньшей мере одну аминогруппу, связан с дендримером -СН2- группой, которая формируется из концевого атома углерода, который был составляющей частью двойной углерод-углеродной связи в соединении, которое содержит по меньшей мере одну аминогруппу, с которой дендример вступает в реакцию для образования концевых фрагментов ветвей.

25. Карбосилановый дендример по п.24, в котором концевой фрагмент ветвей соответствует формуле -СН2СН2(СН2)e-NH2, где «е» представляет собой число между 0 и 2.

26. Карбосилановый дендример по п.25, в котором «е» принимает значение 1, концевой фрагмент ветвей, который содержит по меньшей мере одну аминогруппу, соответствующий формуле -CH2CH2CH2-NH2.

27. Карбосилановый дендример по п.26, в котором индекс «р» принимает значение 1, и каждая ветвь заканчивается одиночным фрагментом -CH2CH2CH2-NH2.

28. Карбосилановый дендример по п.27, в котором карбосилановый дендример принадлежит к первой, второй или третьей генерации.

29. Карбосилановый дендример по п.6, в котором часть или все аминогруппы, присутствующие в концевых фрагментах ветвей, являются кватернизованными.

30. Карбосилановый дендример по п.29, в котором концевой фрагмент ветвей, который содержит по меньшей мере одну кватернизованную аминогруппу, выбран из фрагментов -OCH2CH2N+(CH3)3I-, -ОСН2-(С6Н3)-3,5-(ОСН2СН2N+(СН3)3I-)2 и OCH2CH2N(СН3)CH2CH2N+(СН3)3I-.

31. Карбосилановый дендример по п.30, в котором концевой фрагмент ветвей, который содержит по меньшей мере одну кватернизованную аминогруппу, представляет собой фрагмент -OCH2CH2N+(CH3)3I-.

32. Карбосилановый дендример по п.31, в котором индекс «р» принимает значение 1, и каждая ветвь заканчивается одиночным фрагментом -OCH2CH2N+(СН3)3I-.

33. Карбосилановый дендример по п.32, который принадлежит к первой, второй или третьей генерации.

34. Карбосилановый дендример по п.31, в котором индекс «р» принимает значение 2, и каждая ветвь заканчивается двумя фрагментами -OCH2CH2N+(СН3)3I-.

35. Карбосилановый дендример по п.34, который принадлежит к первой, второй или третьей генерации.

36. Карбосилановый дендример по п.30, в котором концевой фрагмент ветвей, который содержит по меньшей мере одну кватернизованную аминогруппу, представляет собой фрагмент -ОСН2-(С6Н3)-3,5-(OCH2CH2N+(СН3)3I-)2.

37. Карбосилановый дендример по п.36, в котором индекс «р» принимает значение 1, и каждая ветвь заканчивается одиночным фрагментом -ОСН2-(С6Н3)-3,5-(OCH2CH2N+(СН3)3I-)2.

38. Карбосилановый дендример по п.37, который принадлежит к первой, второй или третьей генерации.

39. Карбосилановый дендример по п.36, в котором индекс «р» принимает значение 2, и каждая ветвь заканчивается двумя фрагментами -ОСН2-(С6Н3)-3,5-(OCH2CH2N+(СН3)3I-)2.

40. Карбосилановый дендример по п.39, который принадлежит к первой, второй или третьей генерации.

41. Карбосилановый дендример по п.30, в котором концевой фрагмент ветвей, который содержит по меньшей мере одну кватернизованную аминогруппу, представляет собой фрагмент -OCH2CH2N(СН3)CH2-CH2N+(СН3)3I-.

42. Карбосилановый дендример по п.41, в котором индекс «р» принимает значение 1, и каждая ветвь заканчивается одиночным фрагментом
-OCH2CH2N(СН3)CH2CH2N+(СН3)3I-.

43. Карбосилановый дендример по п.42, который принадлежит к первой, второй или третьей генерации.

44. Карбосилановый дендример по п.41, в котором индекс «р» принимает значение 2, и каждая ветвь заканчивается двумя фрагментами
-OCH2CH2N(СН3)CH2CH2N+(СН3)3I-.

45. Карбосилановый дендример по п.44, который принадлежит к первой, второй или третьей генерации.

46. Карбосилановый дендример по п.29, в котором концевой фрагмент ветвей, который содержит по меньшей мере одну кватернизованную аминогруппу, соответствует формуле -СН2СН2(СН2)е-N+H3Cl-, где «е» представляет собой целое число между 0 и 2.

47. Карбосилановый дендример по п.46, в котором «е» принимает значение 1, концевой фрагмент ветвей, который содержит по меньшей мере одну кватернизованную аминогруппу, соответствующий формуле -CH2CH2CH2-N+H3Cl-.

48. Карбосилановый дендример по п.47, в котором индекс «р» принимает значение 1, и каждая ветвь заканчивается одиночным фрагментом -CH2CH2CH2-N+H3Cl-.

49. Карбосилановый дендример по п.48, в котором карбосилановый дендример принадлежит к первой, второй или третьей генерации.

50. Карбосилановый дендример по п.6, в котором концевой фрагмент, который содержит по меньшей мере одну аминогруппу, формирует часть антигенной частицы.

51. Карбосилановый дендример по п.50, в котором концевой фрагмент образует часть пептида.

52. Способ получения карбосилановых дендримеров, который включает стадии:
а) получение скелета карбосиланового дендримера согласно стадиям:
a1) получение базового исходного карбосиланового дендримера формулы:
Si[(СН2)аСН=СН2]4,
где "а" варьирует между 0 и 2, согласно длине, желаемой для ветвей,
реакцией SiCl4 с BrMg(СН2)аСН=СН2;
а2) получение карбосиланового дендримера первой генерации, прекурсора дендримера высшей генерации, реакцией базового исходного карбосиланового дендримера из стадии a1) с HSi(R1)3-mClm, с тем, чтобы получить дендример следующей формулы:
,
где m варьирует между 1 и 3 и эквивалентно числу ветвей, которое может быть достигнуто в следующей генерации, или числу концевых функциональных групп, которыми могут быть замещены группы Сl;
R1 представляет фенильную или метильную группу;
а3) необязательно, получение карбосиланового дендримера второй генерации, прекурсора дендримера высшей генерации, подвергая производное с Si-Cl концевыми связями, полученное на стадии а2), повторению стадий a1) и а2), то есть,
i) получение новых ветвей реакцией соответствующего производного с Si-Cl концевыми связями с BrMg(СН2)bСН=СН2, где "b" варьирует между 0 и 2, согласно длине, желаемой для этих ветвей, и может быть тем же самым, как индекс «а», или отличным от него;
ii) введение скелета карбосиланового дендримера новой генерации, полученного на стадии i), в реакцию с HSi(R2)3-nСln, где "n" варьирует между 1 и 3 и может быть тем же самым, как индекс "m" в предшествующей генерации, или отличным от него, и R2 представляет фенильную или метильную группу;
а4) необязательно получение карбосилановых дендримеров последующих генераций, прекурсоров дендримеров высших генераций, подвергая производное с Si-Cl концевыми связями, соответствующее предшествующей генерации, повторению стадии a3)i) с использованием реагента BrMg (СН2)cСН=СН2 и повторению стадии a3)ii) с использованием реагента HSi(R3)3-zClz, реагентов, в которых «с» варьирует между 0 и 2, и "z" варьирует между 1 и 3;
а5) получение конечного скелета карбосиланового дендримера, к которому могут быть добавлены фрагменты на стадии b), которые содержат по меньшей мере одну аминогруппу, с использованием на стадии а2), а3) или в повторении i) стадии а4), в зависимости от того, принадлежит ли дендример первой, второй или i генерации, соответственно, реагента HSi(R1)3-рСlр, где «р» варьирует между 1 и 3, и Ri представляет фенильную или метильную группу;
b) получение карбосиланового дендримера с концевыми фрагментами с первичными, вторичными или третичными аминогруппами, согласно одному из следующих путей:
b1) инициирование алкоголиза концевых Si-Cl связей карбосиланового дендримера, полученного на стадии а5), реакцией его с первичным, вторичным или третичным аминоспиртом в присутствии избытка щелочи;
b2) предварительное получение карбосиланового дендримера с концевыми Si-H связями, по которым фрагменты, которые содержат по меньшей мере одну первичную, вторичную или третичную аминогруппу, будут впоследствии связываться, проходя следующие стадии:
i) получение производного с концевыми Si-H связями карбосиланового дендримера любой генерации реакцией соответствующего карбосиланового дендримера с Si-Cl связями с реагентом, способным передавать гидридные группы, с тем, чтобы часть или все из атомов Сl были замещены атомами Н;
ii) реакция карбосиланового дендримера с Si-H связями, в присутствии катализатора гидросилилирования, с соединением, которое содержит первичную, вторичную или третичную аминогруппу и которое имеет двойную углерод-углеродную связь на одном конце, с тем, чтобы соединение связывалось с дендримером тем концом, на котором находится двойная связь;
с) необязательно получение карбосиланового дендримера с концевыми фрагментами с кватернизованными аминогруппами реакцией дендримера, полученного на стадии b), с реагентом А-Hal, в котором А представляет водород, алкил с 1-10 атомами углерода или арил, и Hal представляет Cl, Br, I.

53. Способ получения карбосилановых дендримеров по п.52, в котором индекс «а» исходного реагента равен 1, который представляет собой BrMgCH2CH=CH2.

54. Способ получения карбосилановых дендримеров по п.52, в котором индекс "b" реагента BrMg(СН2)bСН=СН2, использованного для создания новых ветвей на необязательной стадии a3)i), и различные индексы «с» в реагентах BrMg (СН2)cСН=СН2, использованных для получения новых ветвей в каждом из необязательных повторений стадии а4), равны 1, и реагент поэтому представляет собой BrMgCH2CH=CH2.

55. Способ получения карбосилановых дендримеров по пп.53 и 54, в котором реагент BrMgCH2CH=CH2 используют как в исходной стадии a1), так и во всех случаях, в которых новые ветви создаются с помощью необязательной стадии a3)i) или необязательными повторениями стадии а4).

56. Способ получения карбосилановых дендримеров по п.53, в котором как фрагмент R1 реагента HSi(R1)3-mClm на стадии а2), так и фрагмент R2 реагента HSi(R2)3-nСln, использованный для получения производных с концевыми Si-Cl связями на необязательной стадии a3)ii), и последующие фрагменты Ri реагентов HSi(Ri)3-zСlz в необязательных повторениях стадии а4) все являются идентичными друг другу и соответствуют метильным группам.

57. Способ получения карбосилановых дендримеров по п.53, в котором как индекс "m" реагента HSi(R1)3-mClm на стадии а2), так и индекс "n" реагента HSi(R2)3-nСln на необязательной стадии a3)ii), и индексы "z" реагентов HSi(R1)3-zClz в необязательных повторениях стадии а4) все являются идентичными друг другу и равны 2, и во всех случаях используют реагент HSi(Ri)1Cl2.

58. Способ получения карбосилановых дендримеров по пп.56 и 57, в котором:
- как фрагмент R1 реагента HSi(R1)3-mClm на стадии а2), так и фрагмент R2 реагента HSi(R2)3-nСln, использованного для получения производных с концевыми Si-Cl связями на необязательной стадии a3)ii), и последующие фрагменты Ri реагентов HSi(Ri)3-zClz, использованных в необязательных повторениях стадии а4) все идентичны друг другу и соответствуют метильным группам;
- как индекс "m" реагента HSi(R1)3-mClm на стадии а2), так и индекс "n" реагента HSi(R2)3-nСln на необязательной стадии a3)ii), и индексы "z" реагентов HSi(Ri)3-zClz в необязательных повторениях стадии а4), все являются идентичными друг другу и равны 2;
в соответствии с чем на всех стадиях, где концевые Si-Cl связи создаются с намерением обеспечить получение производных высших генераций путем замещения каждого из фрагментов Сl новой ветвью, реагент, который используется, представляет собой HSiCH3Cl2.

59. Способ получения карбосилановых дендримеров по п.52, в котором:
- реагент BrMgCH2CH=CH2 используется как на исходной стадии a1), так и во всех тех случаях, где новые ветви получаются на необязательной стадии a3)i) или произвольными повторениями стадии а4);
- на всех стадиях, в которых концевые Si-Cl связи создаются с намерением обеспечить получение производных высших генераций путем замещения каждого из фрагментов Сl новой ветвью, реагент, который используется, представляет собой HSiCH3Cl2.

60. Способ получения карбосилановых дендримеров по п.59, в котором реагент HSi(Ri)3-рСlр, который используется для получения концевых Si-Cl связей в конечном скелете карбосиланового дендримера, к которому предполагается добавление фрагментов с аминогруппами на стадии b), представляет собой HSi(CH3)2Cl.

61. Способ получения карбосилановых дендримеров по п.60, в котором к конечному скелету карбосиланового дендримера с концевыми Si-Cl связями присоединяются фрагменты, которые содержат по меньшей мере одну аминогруппу на стадии b) согласно пути b1) реакции с аминоспиртом.

62. Способ получения карбосилановых дендримеров по п.61, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями обрабатывается на стадии b1) аминоспиртом, выбранным из N,N-диметилэтаноламина (CH2OH-CH2-N(СН3)2), 2-[(2-диметиламиноэтил)метил] аминоэтанола (CH2OH-CH2-N(СН3)-СН2-СН2-N(CH3)2) или 3,5-бис(диметиламиноэтокси)бензилового спирта (СН2OН-(С6Н3)-(O-CH2-CH2-N(СН3)2)2).

63. Способ получения карбосилановых дендримеров по п.62, в котором предпочтительные стехиометрические количества выбранного аминоспирта используются в расчете на число концевых Si-Cl связей, присутствующих в конечном скелете карбосиланового дендримера, полученного на стадии а).

64. Способ получения карбосилановых дендримеров по п.62 или 63, в котором необязательная стадия с) выполняется путем кватернизации аминогрупп карбосиланового дендримера, полученного на стадии b1), обработкой его избытком CH3I.

65. Способ получения карбосилановых дендримеров по п.62, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями, обработанный на стадии b1) аминоспиртом, был приготовлен проведением стадии а2) совместно со стадией а5) завершения формирования скелета карбосиланового дендримера, с образованием карбосиланового дендримера первой генерации на стадии b).

66. Способ получения карбосилановых дендримеров по п.62, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями, обработанный на стадии b1) аминоспиртом, был приготовлен проведением стадии а3) совместно со стадией а5) завершения формирования скелета карбосиланового дендримера, с образованием карбосиланового дендримера второй генерации на стадии b).

67. Способ получения карбосилановых дендримеров по п.62, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями, обработанный на стадии b1) аминоспиртом, был приготовлен первым проведением стадии а4) совместно со стадией а5) завершения формирования скелета карбосиланового дендримера, с образованием карбосиланового дендримера третьей генерации на стадии b).

68. Способ получения карбосилановых дендримеров по п.59, в котором реагент HSi(Ri)3-рСlр, который используется для получения концевых Si-Cl связей в конечном скелете карбосиланового дендримера, к которому предполагается добавление фрагментов с аминогруппами на стадии b), представляет собой HSiCH3Cl2.

69. Способ получения карбосилановых дендримеров по п.68, в котором к конечному скелету карбосиланового дендримера с концевыми Si-Cl связями фрагменты, которые содержат по меньшей мере одну аминогруппу, присоединяются на стадии b) с последующим проведением пути b1) реакции с аминоспиртом.

70. Способ получения карбосилановых дендримеров по п.69, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями обрабатывается на стадии b1) аминоспиртом, избранным из N, N-диметилэтаноламина (CH2OH-CH2-N(СН3)2), 2-[(2-диметиламиноэтил)метил] аминоэтанола (CH2OH-CH2-N(СН3)-СН2-СН2-N(CH3)2) или 3,5-бис(диметиламиноэтокси)бензилового спирта (СН2OН-(С6Н3)-(O-CH2-CH2-N(СН3)2)2).

71. Способ получения карбосилановых дендримеров по п.70, в котором предпочтительные стехиометрические количества выбранного аминоспирта используются в расчете на число концевых Si-Cl связей, присутствующих в конечном скелете карбосиланового дендримера, полученного на стадии а).

72. Способ получения карбосилановых дендримеров по любому из пп.70 или 71, в котором произвольная стадия с) выполняется кватернизацией аминогрупп карбосиланового дендримера, полученного на стадии b1), обработкой его избытком CH3I.

73. Способ получения карбосилановых дендримеров по п.70, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями, обработанный на стадии b1) аминоспиртом, был приготовлен проведением стадии а2) совместно со стадией а5) завершения формирования скелета карбосиланового дендримера, с образованием карбосиланового дендримера первой генерации на стадии b).

74. Способ получения карбосилановых дендримеров по п.70, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями, обработанный на стадии b1) аминоспиртом, был приготовлен проведением стадии а3) совместно со стадией а5) завершения формирования скелета карбосиланового дендримера, с образованием карбосиланового дендримера второй генерации на стадии b).

75. Способ получения карбосилановых дендримеров по п.70, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями, обработанный на стадии b1) аминоспиртом, был приготовлен первым проведением стадии а4) совместно со стадией а5) завершения формирования скелета карбосиланового дендримера с образованием карбосиланового дендримера третьей генерации на стадии b).

76. Способ получения карбосилановых дендримеров по п.60 или 68, в котором к конечному скелету карбосиланового дендримера с концевыми Si-Cl связями присоединяются фрагменты, которые содержат по меньшей мере одну аминогруппу, на стадии b), с последующим проведением пути b2) реакции с соединением, которое имеет двойную углерод-углеродную связь на одном конце и которое содержит по меньшей мере одну аминогруппу.

77. Способ получения карбосилановых дендримеров по п.76, в котором реагент, способный передавать гидридные группы для преобразования части или всех Si-Cl связей в Si-H связи, представляет собой LiAlH4, и катализатор гидросилилирования, использованный для связывания карбосиланового дендримера с Si-H связями, с соединением, которое содержит первичную, вторичную или третичную аминогруппу на конце, и указанное соединение, которое имеет двойную углерод-углеродную связь, представляет собой катализатор Карштедта.

78. Способ получения карбосилановых дендримеров по п.77, в котором соединение, которое имеет двойную углерод-углеродную связь на одном конце, представляет собой первичный алкиленамин формулы СН2=СН-(СН2)e-NH2, в котором индекс «е» варьирует между 0 и 2.

79. Способ получения карбосилановых дендримеров по п.78, в котором индекс «е» формулы СН2=СН-(СН2)e-NH2 имеет значение 1, и алкиленамин, использованный на стадии b2), представляет собой аллиламин, CH2=CH-CH2-NH2.

80. Способ получения карбосилановых дендримеров по п.79, в котором предпочтительные стехиометрические количества аллиламина используются в расчете на число Si-H связей, присутствующих в скелете карбосиланового дендримера.

81. Способ получения карбосилановых дендримеров по п.79 или 80, в котором необязательная стадия с) выполняется кватернизацией аминогрупп карбосиланового дендримера, полученного на стадии b2), обработкой его НСl.

82. Способ получения карбосилановых дендримеров по п.79, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями, обработанный на стадии b2)i) LiAlH4, был получен проведением стадии а2) совместно со стадией а5) завершения приготовления скелета карбосиланового дендримера, с образованием карбосиланового дендримера первой генерации на стадии b).

83. Способ получения карбосилановых дендримеров по п.79, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями, обработанный на стадии b2)i) LiAlH4, был получен проведением стадии а3) совместно со стадией а5) завершения приготовления скелета карбосиланового дендримера, с образованием карбосиланового дендримера второй генерации на стадии b).

84. Способ получения карбосилановых дендримеров по п.79, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями, обработанный на стадии b2)i) LiAlH4, был получен первым проведением стадии а4) совместно со стадией а5) завершения получения скелета карбосиланового дендримера, с образованием карбосиланового дендримера третьей генерации на стадии b).

85. Композиция, которая содержит по меньшей мере один карбосилановый дендример по любому из пп.1-51.

86. Композиция по п.85, которая дополнительно содержит по меньшей мере одну анионную или полианионную молекулу.

87. Композиция по п.86, в которой полианионная молекула представляет собой последовательность нуклеиновой кислоты или ее производного.

88. Композиция по п.87, в которой последовательность нуклеиновой кислоты или ее производного представляет собой антисмысловую ДНК.

89. Композиция по п.88, в которой по меньшей мере один из присутствующих карбосилановых дендримеров предназначен для действия в качестве переносчика антисмысловой ДНК или ее производного для снижения возможностей взаимодействия антисмысловой ДНК с белками плазмы или с клеточными поверхностями.

90. Композиция по п.89, в которой по меньшей мере один из присутствующих карбосилановых дендримеров предназначен для облегчения контролируемого высвобождения по меньшей мере одной антисмысловой ДНК, присутствующей в нем, или ее производного.

91. Композиция по п.90, в которой по меньшей мере один из присутствующих карбосилановых дендримеров представляет собой дендример, выбранный из (NN), (IM8) и/или (IM16).

92. Композиция по п.91, в которой антисмысловая ДНК имеет последовательность SEQ ID NO:1.

93. Композиция по п.91, в которой антисмысловая ДНК имеет последовательность SEQ ID NO:2.

94. Композиция по п.91, в которой антисмысловая ДНК имеет последовательность SEQ ID NO:3.

95. Композиция по п.91, в которой антисмысловая ДНК имеет последовательность SEQ ID NO:4.

96. Композиция по п.91, в которой антисмысловая ДНК имеет последовательность SEQ ID NO:5.

97. Композиция по п.87, в которой последовательность нуклеиновой кислоты или ее производного представляет собой последовательность двухцепочечной ДНК.

98. Композиция по п.97, в которой последовательность нуклеиновой кислоты или ее производного представляет собой плазмиду или производное ДНК вируса.

99. Композиция по п.86, в которой полианионная молекула представляет собой интерференционную РНК или ее производное.

100. Композиция по п.99, в которой молекула интерференционной РНК содержит последовательность SEQ ID NO:6.

101. Композиция по п.86, в которой анионная молекула представляет собой лекарственное средство с отрицательным зарядом при физиологическом значении pH.

102. Композиция по п.101, в которой лекарственное средство с отрицательным зарядом представляет собой ацетилсалициловую кислоту, индометацин, фуросемид, пенициллин, фенитоин, толбутамид, варфарин, налидиксовую кислоту или хлортиазид.

103. Композиция по п.85, в которой по меньшей мере один из присутствующих карбосилановых дендримеров действует в качестве активной субстанции, предназначенной для предотвращения и/или лечения болезней, вызываемых вирусом, таким как ВИЧ или гепатит С, или прионами, жизненный цикл которых он способен нарушать.

104. Композиция по п.103, в которой болезнь, которую пытаются предотвратить или лечить, вызвана ВИЧ вирусом.

105. Композиция по п.104, в которой присутствует по меньшей мере NN-дендример.

106. Композиция по п.85, в которой по меньшей мере один из присутствующих карбосилановых дендримеров предназначен для действия в качестве активного вещества, предназначенного для предотвращения и/или лечения болезней, вызванных бактерией или грибком, клеточные мембраны или стенки которых чувствительны к изменениям, вызванным указанным дендримером.

107. Композиция по п.85, в которой по меньшей мере один из присутствующих карбосилановых дендримеров действует в качестве активного вещества, предназначенного для препятствования формированию или облегчения растворения белковых агрегатов, которые возникают при болезни Альцгеймера или при энцефалопатиях, вызываемых прионами.

108. Композиция, которая содержит по меньшей мере один карбосилановый дендример по п.50 или 51, предназначенная для индуцирования иммунного ответа, предохраняя или защищая субъекта, которому она введена, от болезни, вызываемой вирусом, таким как ВИЧ или гепатит С, или прионами, жизненный цикл которых дендример способен нарушать.

109. Композиция по любому из пп.86-108, предназначенная для введения ионтофорезом, трансдермальным путем или ингаляцией.

110. Композиция по любому из пп.86-108, предназначенная для введения инъекцией.

111. Композиция по любому из пп.8 6-108, предназначенная для формирования пленок для покрытия протезных структур или ячеек стентов для обеспечения контролируемого высвобождения из них по меньшей мере одного дендримера согласно изобретению или по меньшей мере одного вещества, присутствующего в композиции.

112. Композиция, которая содержит по меньшей мере один карбосилановый дендример по п.85, предназначенная для применения для фиксации молекул нуклеиновой кислоты к поверхностям, таким как подложки микрочипов с нуклеотидными последовательностями.

113. Композиция по п.112, в которой дендример представляет собой (Phe), и/или (CINH4).

114. Применение карбосиланового дендримера по любому из пп.1-51 или композиции по любому из пп.85-96 для изготовления лекарственного средства для предотвращения или лечения болезни, вызываемой вирусом, таким как ВИЧ или гепатит С, или прионами, жизненный цикл которых дендример способен нарушать, симптомы которой могут быть уменьшены или устранены применением антисмысловой ДНК.

115. Применение по п.114, в котором болезнь, которую пытаются предотвратить или лечить, вызвана вирусом ВИЧ.

116. Применение карбосиланового дендримера по любому из пп.1-51 или композиции по любому из пп.85-97 для изготовления лекарственного средства для предотвращения или лечения расстройства или болезни, вызываемых вирусом, таким как ВИЧ или гепатит С, или прионами, жизненный цикл которых дендример способен нарушать, симптомы которых могут быть уменьшены или устранены введением в клетку двухцепочечной ДНК.

117. Применение по п.116, в котором двухцепочечная ДНК способна экспрессировать по меньшей мере один белок в клетке, на которую она направлена.

118. Применение карбосиланового дендримера по любому из пп.1-51 или композиции по любому из пп.85, 99 или 100 для изготовления лекарственного средства для предотвращения или лечения расстройства или болезни, вызываемых вирусом, таким как ВИЧ или гепатит С, или прионами, жизненный цикл которых дендример способен нарушать, симптомы которых могут быть уменьшены или устранены применением одной или более интерференционных РНК.

119. Применение карбосиланового дендримера по любому из пп.1-51 или композиции по любому из пп.85, 101 или 102 для изготовления лекарственного средства для предотвращения или лечения расстройства или болезни, симптомы которых могут быть уменьшены или устранены введением лекарственного средства, которое имеет отрицательный заряд при физиологическом значении pH.

120. Применение карбосиланового дендримера по любому из пп.1-51 или композиции по любому из пп.85, 103, 104 или 105 для изготовления лекарственного средства для предотвращения или лечения расстройства или болезни, вызываемых вирусом, таким как ВИЧ или гепатит С, или прионами, жизненный цикл которых дендример способен нарушать.

121. Применение карбосиланового дендримера по любому из пп.1-51 или композиции по любому из пп.85 или 106 для изготовления лекарственного средства для предотвращения или лечения расстройства или болезни, вызванных бактерией или грибком, клеточные мембраны или стенки которых чувствительны к изменениям, вносимым дендримером.

122. Применение карбосиланового дендримера по любому из пп.1-51 или композиции по любому из пп.85 или 107 для изготовления лекарственного средства, предназначенного для препятствования формированию или облегчения растворения белковых агрегатов, которые возникают при болезни Альцгеймера или при энцефалопатиях, вызванных прионами.

123. Применение карбосиланового дендримера по любому из пп.50 или 51 или композиции по любому из пп.85 или 108 для изготовления лекарственного средства, предназначенного для индуцирования иммунного ответа, который предохраняет или защищает от болезни, вызываемых вирусом, таким как ВИЧ или гепатит С, или прионами, жизненный цикл которых дендример способен нарушать.

124. Карбосилановый дендример по п.24, в котором концевой фрагмент ветвей соответствует формуле -(СН2)2С6Н3(OСН3)О(СН2)2N(СН3)2.

125. Карбосилановый дендример по п.124, в котором индекс «р» принимает значение 1, и каждая ветвь заканчивается одиночным фрагментом
-(СН2)2С6Н3(ОСН3)О(СН2)2N(СН3)2.

126. Карбосилановый дендример по п.125, который относится к первой или второй генерации.

127. Карбосилановый дендример по п.29, в котором концевой фрагмент ветвей, который содержит по меньшей мере одну кватернизованную аминогруппу, представляет собой фрагмент -(СН2)2С6Н3(ОСН3)О(СН2)2N+(СН3)3I-.

128. Карбосилановый дендример по п.127, в котором индекс «р» принимает значение 1, и каждая ветвь заканчивается одиночным фрагментом -(СН2)2С6Н3(ОСН3)О(СН2)2N+(СН3)3I-.

129. Карбосилановый дендример по п.128, который относится к первой или второй генерации.

130. Карбосилановый дендример по п.29, в котором концевой фрагмент ветвей, который содержит по меньшей мере одну кватернизованную аминогруппу, представляет собой фрагмент

131. Карбосилановый дендример по п.130, в котором индекс «р» принимает значение 1, и каждая ветвь заканчивается одиночным фрагментом

132. Карбосилановый дендример по п.131, который относится к первой или второй генерации.

133. Способ получения карбосилановых дендримеров по п.77, в котором соединение, которое имеет двойную углерод-углеродную связь на одном конце, представляет собой (СН2=СН-СН26Н3(ОСН3){O(CH2)2N(CH3)2}.

134. Способ получения карбосилановых дендримеров по п.133, в котором предпочтительные стехиометрические количества (СН2=СН-СН26Н3(ОСН3){О(СН2)2N(СН3)2} используются в расчете на число Si-H связей, присутствующих в скелете карбосиланового дендримера.

135. Способ получения карбосилановых дендримеров по любому из пп.133 или 134, в котором произвольная стадия с) выполняется кватернизацией аминогрупп карбосиланового дендримера, полученного на стадии b2), обработкой его СН3I.

136. Способ получения карбосилановых дендримеров по п.133, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями, обработанный на стадии b2)i) LiAlH4, был получен проведением стадии а2) совместно со стадией а5) завершения получения скелета карбосиланового дендримера, с образованием карбосиланового дендримера первой генерации на стадии b).

137. Способ получения карбосилановых дендримеров по п.133, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями, обработанный на стадии b2)i) LiAlH4, был получен проведением стадии а3) совместно со стадией а5) завершения получения скелета карбосиланового дендримера, с образованием карбосиланового дендримера второй генерации на стадии b).

138. Способ получения карбосилановых дендримеров по п.62, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями обрабатывается на стадии b1) 2-[(2-диметиламиноэтил) метил] аминоэтанолом (CH2OH-CH2-N(СН3)-СН2-СН2-N(CH3)2).

139. Способ получения карбосилановых дендримеров по п.138, в котором предпочтительные стехиометрические количества 2-[(2-диметиламиноэтил)метил] аминоэтанола (CH2OH-CH2-N(СН3)-СН2-СН2-N(CH3)2) используются в расчете на число концевых Si-Cl связей, присутствующих в конечном скелете карбосиланового дендримера, полученного на стадии а).

140. Способ получения карбосилановых дендримеров по п.139, в котором необязательная стадия с) выполняется кватернизацией избытком MeI карбосиланового дендримера, полученного на стадии b1), обработкой его избытком СН3I, каковой избыток рассчитывается относительно стехиометрического количества, необходимого для полной кватернизации как атомов азота, присутствующих в концевых аминогруппах ветвей, так и атомов азота, присутствующих в остальных внутренних аминогруппах, которые также формируют часть фрагментов из аминоспирта, которые составляют концы ветвей скелета карбосиланового дендримера.

141. Способ получения карбосилановых дендримеров по п.140, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями, обработанный на стадии b1) 2-[(2-диметиламиноэтил) метил] аминоэтанолом (CH2OH-CH2-N(СН3)-СН2-СН2-N(СН3)2), был получен проведением стадии а2) совместно со стадией а5) завершения получения скелета карбосиланового дендримера, с образованием карбосиланового дендримера первой генерации на стадии b).

142. Способ получения карбосилановых дендримеров по п.140, в котором конечный скелет карбосиланового дендримера с концевыми Si-Cl связями, обработанный на стадии b1) 2-[(2-диметиламиноэтил) метил] аминоэтанолом (CH2OH-CH2-N(СН3)-СН2-СН2-N(CH3)2), был получен проведением стадии а3) совместно со стадией а5) завершения получения скелета карбосиланового дендримера, с образованием карбосиланового дендримера второй генерации на стадии b).

143. Композиция по п.101, в которой лекарственное средство с отрицательным зарядом представляет собой метотрексат, гепарин или инсулин.

144. Композиция по п.143, в которой присутствующий карбосилановый дендример выбирают из NN, (NN16) или IM16.

145. Композиция по п.144, в которой присутствующий карбосилановый дендример представляет собой NN16, и лекарственное средство представляет собой инсулин.

146. Применение по п.119, в котором лекарственное средство, для изготовления которого используется карбосилановый дендример, содержит метотрексат, гепарин или инсулин.

147. Применение по п.146, в котором лекарственное средство содержит инсулин.

148. Применение по п.146 или 147, в котором карбосилановый дендример, использованный для изготовления лекарственного средства, выбирают из NN, NN16 или IM16.

149. Применение по п.148, в котором карбосилановый дендример, использованный для приготовления лекарственного средства, представляет собой NN16, и лекарственное средство содержит инсулин.

150. Применение карбосиланового дендримера по любому из пп.1-51 для повышения степени трансфекции анионной или полианионной молекулы при физиологическом значении pH, с которой карбосилановый дендример образует комплекс при указанном pH.

151. Применение по п.150, в котором анионная или полианионная молекула представляет собой нуклеиновую кислоту или ее производное.

152. Применение по п.151, в котором нуклеиновая кислота представляет собой антисмысловую ДНК или интерференционную РНК.

153. Применение по п.151 или 152, в котором клетки для трансфекции представляют собой клетки нервной системы или клеточные линии, полученные из нервной системы.

154. Применение по п.153, в котором нуклеиновая кислота, степень трансфекции которой желательно повышать, представляет собой антисмысловую ДНК.

155. Применение по п.154, в котором дендример образует комплекс с антисмысловой ДНК в соотношении отрицательные заряды:положительные заряды, которое варьирует между 1:1 и 1:8.

156. Применение по п.155, в котором дендример выбирают из NN и NN16.

157. Применение по п.153, в котором клетки для трансфекции представляют собой клетки линии U87-MG.

158. Применение по п.157, в котором дендример образует комплекс с антисмысловой ДНК в соотношении отрицательные заряды:положительные заряды 1:8.

159. Применение по п.158, в котором дендример представляет собой NN.

160. Применение по п.158, в котором дендример представляет собой NN16.

161. Применение по п.153, в котором клетки для трансфекции представляют собой клетки линии SK-N-MC.

162. Применение по п.161, в котором дендример образует комплекс с антисмысловой ДНК в соотношении отрицательные заряды:положительные заряды 1:4.

163. Применение по п.162, в котором дендример представляет собой NN16.

164. Набор для повышения степени трансфекции анионной или полианионной молекулы при физиологическом значении pH, который включает по меньшей мере один карбосилановый дендример по любому из пп.1-51, с которым анионная или полианионная молекула способна сформировать комплекс при физиологическом значении pH.

165. Набор по п.164, в котором клетки для трансфекции представляют собой клетки нервной системы или клетки или клеточные линии, производные из нервной системы.

166. Набор по п.165, в котором анионная или полианионная молекула при физиологическом значении pH, степень трансфекции которой желательно повысить, представляет собой нуклеиновую кислоту или ее производное.

167. Набор по п.166, в котором нуклеиновая кислота представляет собой антисмысловую ДНК или интерференционную РНК.

168. Набор по п.166 или 167, в котором нуклеиновая кислота также включена в набор.

169. Набор по п.168, в котором нуклеиновая кислота включена в набор в композиции, отдельной от композиции, часть которой составляет карбосилановый дендример.

170. Набор по п.168, в котором нуклеиновая кислота включена в набор в той же самой композиции, часть которой составляет карбосилановый дендример.

171. Набор по п.170, в котором нуклеиновая кислота включена в набор в той же самой композиции, часть которой составляет карбосилановый дендример, в соотношении отрицательные заряды:положительные заряды, которое варьирует между 1:1 и 1:8.

172. Набор по п.164, в котором карбосилановый дендример выбирают из NN и NN16.



 

Похожие патенты:

Изобретение относится к новому химическому соединению, а именно к rac-N-[2,3-ди(тетрадецилокси)проп-1-ил]пиридиний бромиду, обладающему способностью доставлять нуклеиновые кислоты в клетки млекопитающих: Технический результат: описанное соединение, обладает низкой токсичностью и способно в виде спиртового раствора доставлять нуклеиновые кислоты в клетки млекопитающих.

Изобретение относится к области молекулярной биологии и может быть использовано в медицине. .

Изобретение относится к области молекулярной биологии и биотехнологии и может быть использовано в медицине и в фармацевтической промышленности. .

Изобретение относится к биотехнологии. .

Изобретение относится к способу детектирования и измерения одного или более аналитов в образце. .

Изобретение относится к области генной инженерии и может быть использовано в биотехнологической промышленности. .

Изобретение относится к области биотехнологии, медицины, иммунологии и может быть использовано в фармацевтической промышленности и молекулярной фармакологии. .

Изобретение относится к химии высокомолекулярных соединений, а именно к новым полициклическим поли- и сополиорганоциклокарбосилоксанам с различным размером циклов.
Наверх