Аллель s608l (150c/т) гена nos2, его применение для прогнозирования динамики формирования острого ишемического атеротромботического инсульта, применение в качестве молекулярно-генетического маркера индивидуальной чувствительности ткани мозга к ишемии и способ прогнозирования динамики течения острого ишемического атеротромботического инсульта



Аллель s608l (150c/т) гена nos2, его применение для прогнозирования динамики формирования острого ишемического атеротромботического инсульта, применение в качестве молекулярно-генетического маркера индивидуальной чувствительности ткани мозга к ишемии и способ прогнозирования динамики течения острого ишемического атеротромботического инсульта
Аллель s608l (150c/т) гена nos2, его применение для прогнозирования динамики формирования острого ишемического атеротромботического инсульта, применение в качестве молекулярно-генетического маркера индивидуальной чувствительности ткани мозга к ишемии и способ прогнозирования динамики течения острого ишемического атеротромботического инсульта
Аллель s608l (150c/т) гена nos2, его применение для прогнозирования динамики формирования острого ишемического атеротромботического инсульта, применение в качестве молекулярно-генетического маркера индивидуальной чувствительности ткани мозга к ишемии и способ прогнозирования динамики течения острого ишемического атеротромботического инсульта
Аллель s608l (150c/т) гена nos2, его применение для прогнозирования динамики формирования острого ишемического атеротромботического инсульта, применение в качестве молекулярно-генетического маркера индивидуальной чувствительности ткани мозга к ишемии и способ прогнозирования динамики течения острого ишемического атеротромботического инсульта

 

C12N15 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2423523:

Государственное образовательное учреждение высшего профессионального образования Российский государственный медицинский университет Федерального агенства по здравоохранению и социальному развитию (ГОУ ВПО РГМУ Росздрава) (RU)
Российская Федерация, от имени которой выступает Министерство образования и науки Российской Федерации (RU)

Изобретение относится к биотехнологии и касается аллеля S608L(150C/T) гена NOS2, а также его применения в качестве диагностического маркера для оценки динамики течения острого ишемического атеротромботического инсульта. Изобретение позволяет диагностировать тяжесть течения заболевания и, следовательно, своевременно и адекватно назначать нейропротекторы, избирательно подавляющие фермент 1NOS. 4 н.п. ф-лы, 3 ил., 2 табл.

 

Изобретение относится к биотехнологии и касается аллеля гена NOS2, а именно S608L (150C/T).

Сосудистые заболевания головного мозга и, в частности, ишемический инсульт - одна из наиболее важных и актуальных медицинских проблем нашего общества. Широкое распространение инсульта, высокий процент смертности и тяжелой инвалидизации определяют приоритетность исследований в области изучения патогенеза развития этого заболевания.

Инсульт - это острое нарушение мозгового кровообращения, приводящее к повреждению ткани головного мозга и расстройству его функций. Согласно международным эпидемиологическим исследованиям в мире от инсульта ежегодно умирают 4,7 миллионов человек. В нашей стране инсульт занимает второе место в структуре общей смертности, уступая лишь кардиоваскулярной патологии. Ежегодная смертность от инсульта в России - одна из самых высоких в мире (175 человек на 100000 населения). 80% из выживших после инсульта больных становятся инвалидами, у 50% наступает повторный инсульт в последующие 5 лет жизни.

Существуют различные клинические варианты инсульта, среди которых преобладают ишемические инсульты (80-85%) [Гусев Е.И., Скворцова В.И. Ишемия головного мозга. М.: Медицина, 2001. С.13]. В большинстве случаев ишемический инсульт - это многофакторное заболевание, развитие которого зависит как от внешних причин, так и от индивидуальных генетических особенностей индивидуума. Однако независимо от клинического варианта инсульта, воздействие патогенного фактора на ткань мозга реализуется развитием острой фокальной ишемии.

В настоящее время в изучении генетической предрасположенности инсульта, равно как и других мультифакторных заболеваний, используется анализ генетических ассоциаций, с помощью которого проводится изучение кандидатных генов, участвующих в формировании основных факторов риска сосудистой патологии. В последние несколько лет анализ генетических ассоциаций используется и для изучения аспектов индивидуальной чувствительности мозга к ишемическому повреждению и возможному прогнозированию течения и исхода заболевания.

Избыточная продукция оксида азота (NO) при участии фермента индуцибельной NO-синтазы (iNOS) с последующим образованием токсического соединения пероксинитританиона ONOO- в настоящее время рассматривается как один из важнейших механизмов тканевого повреждения на разных этапах ишемии мозга [Corsani L., Bizzoco E., Pedata F., Gianfriddo M., et al. Inducible nitric oxide synthase appears and is co-expressed with the neuronal isoform in interneurons of the rat hippocampus after transient ischemia induced by middle cerebral artery occlusion // Exp.Neurol. 2008. V.211. P.433-440]. К основным нейротоксическим эффектам ONOO- относят выработку провоспалительных цитокинов, инактивацию ферментов антиоксидантной защиты, участие в окислении белков, что приводит к повреждению и дисфункции клеток, а также фрагментации ДНК [Гусев Е.И., Скворцова В.И., 2001]. Синтез оксида азота из L-аргинина в присутствии кислорода и донора электронов NADPH происходит в организме при участии трех изоформ фермента NO-синтазы - эндотелиальной (eNOS), нейрональной (nNOS) и индуцибельной (iNOS). eNOS и nNOS постоянно синтезируются в эндотелиальных клетках и нейронах соответственно и образуют небольшие количества NO в течение короткого времени (период полураспада этих изоформ исчисляется 3-5 секундами). Индукция iNOS происходит в процессе иммуновоспалительного ответа под влиянием провоспалительных цитокинов в эндотелиоцитах, а также в нейтрофилах, макрофагах, астроцитах и клетках микроглии. Особое внимание привлекает факт относительно поздней экспрессии iNOS на этапе деформирования очага инфаркта [Samdani A.F. и соавт., 1997; Niwa M. и соавт., 2001], что в дальнейшем, возможно, определит избирательное применение селективных ингибиторов фермента в условиях стационаров. Синтез оксида азота при участии iNOS происходит отсрочено, спустя 6-8 часов после индукции фермента, однако его количество в тысячи раз превосходит суммарное количество NO, образованного при участии eNOS и nNOS [Beck K.F., Eberhardt W., Frank S. Huwiler A. et al. Inducible NO synthase: role in cellular signaling // J. Exp.Biol. 1999. V.202. P.645-653]. Экспрессия iNOS в клетках ишемизированной ткани, а также в клетках окружающей потенциально жизнеспособной зоны является одним из факторов, определяющих распространение тканевого повреждения на поздних этапах церебральной ишемии [Скворцова В.И. Участие апоптоза в формировании инфаркта мозга // Инсульт. Приложение Журн. Неврол. и психиатр. 2001. №2. С.12-18]. Участие гена NOS2, кодирующего синтез фермента iNOS, в формировании очага инфаркта мозга было продемонстрировано на различных моделях экспериментальной ишемии с применением нокаутных животных [Iadecola С. и соавт., 1997; Loihl А.К. и соавт., 1999].

В связи с этим представляет интерес анализ полиморфизма гена NOS2 у больных с ишемическим инсультом в остром периоде, когда предполагается реализация нейротоксических эффектов веществ, количество которых может определяться активностью фермента iNOS.

Задачей изобретения является идентификация аллеля гена NOS2, который отвечает за тяжелое течение инсульта и его применение для диагностики течения острого ишемического атеротромботического инсульта и в качестве молекулярно-генетического маркера индивидуальной чувствительности ткани мозга к ишемии.

Для решения поставленной задачи проводили подбор и клиническое обследование пациентов на кафедре фундаментальной и клинической неврологии и нейрохирургии Российского государственного медицинского университета (ГОУ ВПО РГМУ). Основным критерием включения пациентов в исследование было время поступления больных в клинику (не позднее 12 часов с момента развития заболевания). В исследование были включены 80 пациентов с острым ишемическим атеротромботическим инсультом в каротидной системе, поступивших в неврологические клиники РГМУ (ГКБ №20 и ГКБ №31 г.Москвы) за период 2002-2005 гг. Возраст больных составил от 47 до 89 лет (средний возраст 69,8±1,14). В исследование вошли 54 женщины и 26 мужчин.

Все пациенты по этнической принадлежности являются русскими из г. Москвы. Все исследования проводились с информированного согласия больных или их ближайших родственников.

Диагноз каротидного ишемического атеротромботического инсульта основывался на сборе анамнеза развития заболевания, исследовании соматического и неврологического статусов, данных клинико-инструментальных методов исследования (магнитно-резонансной томографии головного мозга, ультразвуковой допплерографии, дуплексного сканирования магистральных артерий головы), исследовании системы свертываемости и реологии крови, липидного спектра крови.

Для проведения молекулярно-генетического анализа были использованы препараты ДНК, полученные из лейкоцитов периферической крови. ДНК выделяли стандартным методом с использованием протеиназы К / фенолхлороформа [Miller S.A., Dykes D.D., Polesky H.F. A simple salting out procedure for extracting DNA from human nucleated cells // Nucleic Acids Res. 1988. V.16. P.1215].

Полиморфные аллели гена NOS2 были исследованы методом полимеразной цепной реакции (ПЦР) с последующей рестрикцией продуктов амплификации. Последовательность и температура отжига праймеров, а также эндонуклеазы рестрикции для каждого анализируемого локуса указаны в таблице 1. Идентификация рестрикционных фрагментов осуществлялась при помощи электрофореза в 6% полиакриламидном геле с последующей окраской бромистым этидием и визуализацией фрагментов в проходящем УФ-свете.

Статистическая обработка результатов исследования проводилась с использованием пакета программ Statistica for Windows 7.0. Соответствие наблюдаемого распределения частот генотипов теоретически ожидаемому равновесному распределению Харди-Вайнберга проверялось по модифицированному критерию χ2, определяемому с помощью программы R×C по алгоритму, описанному D.Roff и P.Bentzen [Roff D.A., Bentzen P. The statistical analysis of mitochondrial DNA polymorphisms: χ2 and the problem of small samples // Mol. Biol. Evol. 1989. V.6. P.539-545]. Анализ связи двух признаков проводился с использованием непараметрического метода корреляции γ. Достоверность различий устанавливалась с помощью критерия Манна-Уитни. Качественные признаки оценивались с помощью критерия χ2 с поправкой Йетса и двустороннего критерия Фишера. В качестве порогового уровня статистической значимости было принято значение 0,05.

Примеры.

Пример 1. Анализ связи полиморфных вариантов гена NOS2 с динамикой объема инфаркта мозга.

При оценке динамики объема очагов инфаркта в абсолютных значениях (в данном случае в см3) вклад изменений исходно малых очагов минимален, и с целью увеличения значимости вклада малых очагов была проведена оценка не только абсолютной динамики объема ишемического очага и тяжести состояния пациентов, выраженной в абсолютных единицах, но и оценка относительной динамики изменения этих двух параметров, выраженной в процентах.

При проведении непараметрического корреляционного анализа выявлена статистически достоверная корреляция между S608L (150С/Т) полиморфизмом гена NOS2 и динамикой объема инфаркта мозга с 1-х по 3-и сутки в абсолютных и относительных значениях (p<0,05), а также достоверная корреляция данного полиморфизма с изменением объема ишемического очага в абсолютных значениях с 7-х по 21-е сутки (p<0,05) (таблица 2).

При проведении дальнейшего анализа с использованием непараметрического критерия Манна-Уитни было выявлено статистически значимое различие в относительной динамике объема инфаркта мозга с 1-х по 3-и сутки между носителями 150С/С и 150С/Т+Т/Т генотипов по S608L (150С/Т) полиморфизму гена NOS2 независимо от исходного объема очага (p=0,03). У больных, гомозиготных по аллелю 150С, отмечается достоверно более выраженное распространение очага инфаркта с 1-х по 3-и сутки, чем у носителей аллеля 150Т. При этом у ряда больных носителей аллеля 150Т, в отличие от гомозигот по 150С аллелю, отмечается уменьшение объема очага в период с 1-х по 3-и сутки (фиг.1).

Выявлено статистически значимое различие в абсолютной динамике инфаркта мозга с 7-х по 21-е сутки у больных с разными генотипами по полиморфизму S608L (150С/Т). У носителей аллеля 150Т отмечается более выраженный регресс объема очага по сравнению с таковым у больных с гомозиготным генотипом 150С/С (p=0,02). При этом ни у одного из носителей Т аллеля, в отличие от С/С гомозигот, не отмечалось увеличения объема очага инфаркта в период с 7-х по 21-е сутки (фиг.2).

Различий по динамике очага инфаркта независимо от исходного объема между больными с разными генотипами по полиморфным локусам - 2447C/G, - 1659С/Т и - 0,7(TTTA)n I/D гена NOS2 выявлено не было.

Также был проведен анализ возможной связи динамики очагов исходно малого (<40 см3), среднего (40-90 см3) и большого (>90 см3) объема с указанными полиморфизмами гена NOS2.

Выявлено высокодостоверное различие в относительной динамике объема исходно малых очагов инфаркта мозга с 1-х по 3-и сутки между носителями 150С/С и 150С/Т+Т/Т генотипов по S608L (150С/Т) полиморфизму гена NOS2 (p=0,005). У больных, гомозиготных по аллелю 150С, отмечалось более выраженное распространение очага инфаркта, чем у носителей аллеля 150Т. При этом у ряда носителей аллеля 150Т, в отличие от гомозигот по 150С аллелю, отмечалось уменьшение объема очага в период с 1-х по 3-и сутки (фиг.3).

Пример 2. Анализ связи полиморфных вариантов гена NOS2 с динамикой тяжести состояния пациентов.

Тяжесть состояния пациентов и степень выраженности у них неврологического дефицита оценивали по шкале Оргогозо: оценка 0 баллов соответствует смерти пациента, 100 баллов - отсутствию неврологического дефекта. Динамика определялась как положительная в случае прибавления минимум пяти баллов по шкале в течение анализируемого периода наблюдения. Динамика считалась отрицательной в случае уменьшения минимум на пять баллов по шкале. Состоянием без динамики считалось отсутствие изменения баллов, а также прирост или уменьшение менее пяти баллов по шкале Оргогозо в течение анализируемого периода.

Ишемический характер инсульта был установлен по данным анамнеза и клинической картины заболевания, данных МРТ - исследования головного мозга. Патогенетический характер инсульта устанавливался в соответствии с критериями TOAST, на основании данных анамнеза и особенностей клинической картины заболевания, данных ультразвуковой допплерографии (УЗДГ) и дуплексного сканирования (ДС) магистральных артерий головы (МАГ), ЭКГ и ЭХО-КГ.

Для оценки изменения объема ишемического повреждения головного мозга всем пациентам проводилась магнитно-резонансная томография (МРТ) головного мозга и МР-морфометрия на 1-е, 3-й, 7-е и 21-е сутки от развития инсульта. Исследования выполняли на магнитно-резонансном томографе "Эллипс" ТМП-150, с индукцией магнитного поля 0,15 Тесла (научно-производственная фирма "A3", Россия). Морфометрическую обработку полученных изображений выполняли с применением программных пакетов "OSIRIS" и "TOMOSOFT-Net"- комплекса прикладных программ томографа "Эллипс", который включает набор последовательностей сканирования, а также среду для редактирования и анализа получаемых изображений.

Молекулярно-генетическое исследование проводилось на базе Отдела Молекулярных Основ Генетики Человека ИМГ РАН. При проведении генетического анализа экстракцию геномной ДНК производили из лейкоцитов свежей незамороженной венозной крови по стандартной методике (9,0 мл крови с добавлением 1,0 мл ЭДТА) с применением экстракции смесью фенол/хлороформ. Прямая ДНК-диагностика полиморфных участков промотерной области - 2447C/G, - 1659С/Т, - 0,7 (TAAA)n I/D и Ser608Leu(C/T) 16-го экзона гена NOS2 производилась путем амплификации в ПЦР участков с последующей их обработкой эндонуклеазами рестрикции и электрофорезом в полиакриламидном геле.

Выбор полиморфизмов гена NOS2 для анализа их роли в формировании инфаркта мозга определялся, прежде всего, частотой распределения минорных аллелей в популяции. На основании опубликованных данных по частоте распределения минорных аллелей полиморфных вариантов гена NOS2 в близкородственных европейских популяциях были выбраны для изучения вышеуказанные участки гена. Распределение аллельных вариантов изучаемых полиморфизмов соответствовало закону Харди-Вайнберга. Анализ полиморфизма гена NOS2 в группе сравнения показал, что выбранные участки гена отличаются достаточно высокими частотами распределения минорных аллелей.

Статистическая обработка проводилась с помощью пакета статистических программ Statistica 7.0 с использованием стандартных методов вариационной статистики. Учитывая, что большинство совокупностей данных имели распределение, отличное от нормального, для характеристики центральной тенденции значений была использована медиана, а достоверность различий устанавливали с помощью непараметрического U-критерия Манна-Уитни. Анализ связи двух признаков проводился с использованием метода корреляции гамма. Качественные признаки оценивались с помощью критерия χ2 с поправкой Йетса и двустороннего критерия Фишера. В качестве порогового уровня статистической значимости было принято значение 0,05.

При проведении статистического анализа было установлено, что в группе больных, характеризующихся отрицательной динамикой в неврологическом статусе по шкале Оргогозо в период с 1-х по 7-е сутки, достоверно повышена частота генотипа 150С/С полиморфного локуса S608L (150С/Т) по сравнению с группой пациентов, характеризующихся положительной динамикой, в которой наблюдается преобладание носителей 150С/Т+Т/Т генотипов (критерий χ2 с поправкой Йетса - 5,75, p = 0,02; двусторонний критерий Фишера р = 0,006).

Анализ зависимости динамики тяжести состояния от генотипов по полиморфным локусам -2447C/G, -1659С/Т и -0,7 (TAAA)n I/D гена NOS2 не выявил достоверных различий в распределении частот генотипов ни по одному из этих локусов, ни в целом по группе, ни отдельно в подгруппах исходно малого, среднего или большого очага инфаркта мозга на разных сроках обследования.

Таким образом, в приведенных примерах был проведен комплексный клинический, молекулярно-генетический и МР-морфометрический анализ, который выявил взаимосвязь между наличием у пациента полиморфного варианта Ser608Leu(C/T) гена NOS2 и динамикой формирования очага инфаркта мозга в период с 1-х по 3-и и с 1-х по 7-е сутки от развития заболевания (r=-0,376 и r=-0,295, p < 0,05), а также связь Ser608Leu(C/T) и - 1659С/Т гена NOS2 с динамикой формирования очага инфаркта мозга в период с 7-х по 21-е сутки от развития заболевания (r=-0,422 и r=0,75 соответственно р < 0,05) независимо от исходного объема.

Приведенные примеры демонстрируют статистически значимое различие по выраженности динамики объема очага церебральной ишемии в группах носителей гомозиготного генотипа С/С и носителей аллеля Т полиморфного варианта Ser608Leu(C/T). Для носителей аллеля Т характерно менее выраженное увеличение объема очага с 1-х по 3-и сутки по сравнению с носителями гомозиготного генотипа С/С независимо от исходного объема очага (p = 0,03). В группе пациентов с малым объемом очага церебральной ишемии носительство гомозиготного генотипа С/С по полиморфизму Ser608Leu(C/T) высоко достоверно связано с более выраженным увеличением объема малого очага в период с 1-х по 3-и сутки по сравнению с носительством аллеля Т (p = 0,005).

Примеры также демонстрируют достоверное различие по выраженности динамики объема очага церебральной ишемии в группах носителей гомозиготного генотипа С/С и носителей аллеля Т полиморфных вариантов Ser608Leu(C/T) и -1659С/Т. Для носителей протективной аллели Т характерно более выраженное уменьшение объема очага с 7-х по 21-е сутки по сравнению с носителями гомозиготного генотипа С/С (p = 0,03 и p = 0,02 соответственно).

Частота С/С генотипа достоверно преобладает у больных с отрицательной динамикой в неврологическом статусе (по балльной шкале Оргогозо) в периоды с 1-х по 3-и и с 7-х по 21-е сутки, а также среди пациентов с замедленным восстановлением нарушенных неврологических функций к концу острого периода ишемического инсульта (тяжелая или умеренная инвалидизация) по сравнению с носительством аллеля Т, независимо от исходного объема инфаркта мозга (p = 0,006 и p = 0,01 соответственно). А вот исследование полиморфных вариантов -2447C/G и -0,7 (TAAA)n I/D не выявило их корреляции с динамикой объема очага инфаркта мозга, динамикой тяжести состояния и степенью функционального восстановления (p > 0,05).

Таким образом, представленные примеры достоверно демонстрируют возможность использования молекулярно-генетической диагностики по полиморфному варианту Ser608Leu(C/T) гена NOS2 в качестве молекулярно-генетического маркера индивидуальной чувствительности ткани мозга к ишемии с целью выявления группы риска по неблагоприятной динамике объема очага инфаркта мозга в случае острого сосудистого мозгового эпизода и соответственно возможности использовать указанный ген в способе прогнозирования течения ишемического инсульта.

Таблица 1.
Последовательность праймеров, температура отжига и размер анализируемых фрагментов для изученных полиморфизмов гена NOS2.
Полиморфизм Прямой праймер (5'→3')
Обратный праймер (5'→3')
Температура отжига, °С Размер ампликона, пн Эндонуклеаза рестрикции Аллели гена1, пн
-1659С/Т TGCTGCAGGTATAGCCAGAAT ATGGAGGGATGGTATGGTGCATAT 60 160 FspBI 160
29, 31
-2447C/G TGAGACAGGCTAGGGTGCAGT GGGCAACATAGTGAGATCCAA 69 181 BstMWI 84, 66, 31
84, 53, 31, 13
S608L TGTAAACCAACTTCCGTGGTG GTCTCTGCGGGTCTGAGAAAG 57 288 Sse91 175, 113
142, 113, 33
Инсерция/делеция повтора -0.7(ТТТА)n TGGTGCATGCCTGTAGTCC GAGGCCTCTGAGATGTTGGTC 69 313 в отсутствии, 313+n(ТТТА)в присутствии вставки - 313+n(TTTA)
313
Примечание. Размер фрагмента (фрагментов) в верхней строчке соответствует первому полиморфному аллелю гена, размер фрагмента (фрагментов) нижней строчки соответствует второму полиморфному аллелю гена.

1. Аллель S608L(150C/T) гена NOS2, представляющий собой молекулярно-генетический маркер индивидуальной чувствительности ткани мозга к ишемии.

2. Применение аллеля S608L(150C/T) гена NOS2 для прогнозирования динамики формирования острого ишемического атеротромботического инсульта, течения и исхода указанного заболевания.

3. Применение аллеля S608L(150C/T) гена NOS2 в качестве молекулярно-генетического маркера индивидуальной чувствительности ткани мозга к ишемии.

4. Способ прогнозирования динамики течения острого ишемического атеротромботического инсульта, включающий анализ полиморфизма гена NOS2 на наличие гомозиготности по аллелю S608L(150C/T), в случае выявления гомозиготности по указанному аллелю в варианте 150С прогнозируется распространение очага инфаркта, а также отрицательная динамика в неврологическом статусе по шкале Оргогозо, а при выявлении варианта 150Т - уменьшение объема очага инфаркта и положительная динамика в неврологическом статусе по шкале Оргогозо.



 

Похожие патенты:

Изобретение относится к области биотехнологии, в частности к способу гибридизации нуклеиновых кислот, и может быть применено в биомедицинской диагностике. .

Изобретение относится к области биотехнологии и иммунологии. .

Изобретение относится к области биотехнологии и иммунологии. .

Изобретение относится к области биотехнологии и генетической инженерии, а именно к генно-инженерной конструкции pGoatcasGCSF для экспрессии гранулоцит-колониестимулирующего фактора человека (Г-КСФ).

Изобретение относится к ДНК, кодирующей модифицированное антитело, способное распознавать и поперечно сшивать рецептор ТРО и содержащее две или более V-области Н-цепи и две или более V-области L-цепи исходного антитела, соединенные напрямую или через линкер ковалентной или нековалентной связью, с меньшим размером по сравнению с исходным антителом.

Изобретение относится к области биотехнологии, а именно к способу получения мутантной молочной бактерии вида Streptococcus thermophilus, молочной закваске, способу получения ферментированного молочного продукта и к ферментированному молочному продукту.

Изобретение относится к биотехнологии и генной инженерии и касается способа получения янтарной кислоты с использованием штамма дрожжей, Yarrowia lipolytica ВКПМ Y-3314. .

Изобретение относится к генной инженерии, биохимии, биотехнологии и иммунологии. .

Изобретение относится к области биотехнологии, конкретно к клеточным технологиям, и может быть использовано для селекции генетически модифицированных клеток
Наверх