Генетические конструкции для антивич-терапии

Изобретение относится к медицинской и молекулярной генетике. Описана группа генетических конструкций, экспрессирующих РНК-последовательности и гены, кодирующие белки, обладающие антивирусной активностью в отношении вируса иммунодефицита человека. Конструкции, включающие один или более генетических антивирусных агентов, обладают сильными противовирусными свойствами. Изобретение может быть использовано в медицине. 6 н. и 19 з.п. ф-лы, 12 ил., 6 табл.

 

Изобретение относится к медицинской и молекулярной генетике, а именно к генетическим конструкциям, экспрессирующим РНК-последовательности и/или гены, кодирующие белки, обладающие антивирусной активностью в отношении вируса иммунодефицита человека, и может быть использовано в научных исследованиях.

Уровень техники

ВИЧ-инфекция остается огромной проблемой для здравоохранения и общества в целом. Число ВИЧ-инфицированных продолжает неуклонно расти. Современная высокоактивная антиретровирусная терапия (ВААРТ) позволяет эффективно сдерживать прогрессирование заболевания и значительно повышает уровень жизни ВИЧ-инфицированного пациента. Однако ВААРТ является дорогостоящим пожизненным лечением и приводит к накоплению побочных эффектов, связанных с токсичностью используемых химических препаратов. Кроме того, проблемой ВААРТ является возникновение лекарственно устойчивых мутантных штаммов, что приводит к необходимости в постоянной разработке и использовании все большего количества новых химических препаратов.

Генная терапия ВИЧ подразумевает введение в клетки генов, подавляющих развитие инфекции. На данный момент на клеточных культурах опробовано множество генетических конструкций, в той или иной мере усиливающих устойчивость клеток к ВИЧ. Усовершенствование клинических методов изоляции и трансплантации клеток позволяет рассматривать генотерапию как перспективное направление антиВИЧ-терапии.

Заявка WO/2007/104633 A1 20.09.2007 раскрывает самоинактивирующиеся рекомбинантные лентивирусные векторы для ингибирования репликации ВИЧ, включающие 5'LTR и 3'LTR, отличающиеся тем, что включают ген бета-интерферона.

Заявка WO 0137881 (А2) 31.05.2001 относится к лечению ВИЧ-инфекции с помощью генной терапии путем экспрессии в клетке заякоренных на мембране пептидов gp41. Для этого впервые доступны векторы, кодирующие слитый белок, который содержит производимый от gp41 ВИЧ-пептид и карбоксиконцевой, сцепленный через гибкий линкер трансмембранный якорь.

Патент RU 2324738C2 10.01.2008 описывает три генетические конструкции на основе векторной плазмиды pEGFP-N1, продуцирующие siPHK-ингибиторы репродукции вируса иммунодефицита человека 1 типа. Изобретение может использоваться в разработке более эффективных антиВИЧ-препаратов на основе интерферирующих РНК (siPHK), продуцируемых в клетках с помощью введенных векторных экспрессирующих конструкций.

Задачей изобретения является расширение арсенала средств нового поколения, предназначенных для лечения ВИЧ-инфекции. Технический результат - создание предложенных конструкций и реализация ими указанного назначения. Предложенное изобретение направлено на создание более эффективных антиВИЧ-препаратов на основе РНК и белков, продуцируемых в клетках, с помощью введенных генетических конструкций, предложенных по изобретению. В настоящем изобретении также продемонстрировано, что комбинирование двух и более антивирусных агентов, перечисленных ниже, в одной генетической конструкции обеспечивает синергетический эффект.

Раскрытие изобретения

В настоящем изобретении "молекула нуклеиновой кислоты" и "полинуклеотид" означают полимерную форму нуклеотидов любой длины, либо дезоксирибонуклеотиды, либо рибонуклеотиды, либо их аналоги. Полинуклеотиды могут иметь трехмерную структуру и могут осуществлять любую функцию. Неограничивающими примерами полинуклеотидов являются ген, генный фрагмент, экзоны, интроны, открытая рамка считывания, матричная РНК (мРНК), транспортная РНК, рибосомная РНК, рибозимы, кДНК, рекомбинантные полинуклеотиды, разветвленные полинуклеотиды, плазмиды, космиды, векторы, выделенная ДНК с любой последовательностью, выделенная РНК с любой последовательностью, нуклеиновокислотные зонды и праймеры.

Полинуклеотид обычно состоит из специфической последовательности из четырех нуклеотидных оснований: аденина (А), цитозина (С), гуанина (G) и тимина (Т) (а в случае если указанным полинуклеотидом является РНК, то вместо тимина (Т) присутствует урацил (U)). Таким образом, термин "полинуклеотидная последовательность" означает буквенное представление полинуклеотидной молекулы. Это буквенное представление может быть введено в базу данных компьютера, имеющего центральный процессор, и используется в биоинформатике, например в функциональной геномике и в поиске гомологии.

Термин "конструкция" означает любую молекулу, способную переносить последовательности нуклеиновой кислоты (например, невирусные векторы, частицы-носители, липосомы и вирусные векторы) в клетки-мишени. Термин "плазмидная конструкция" означает внехромосомный генетический элемент, способный к саморепликации в клетке-хозяине. Обычно термины "вектор", "конструкция", "экспрессирующий вектор" и "вектор для переноса генов" означают любую конструкцию нуклеиновой кислоты, способную регулировать экспрессию нужного гена и переносить генные последовательности в клетки-мишени. Таким образом, этот термин включает в себя клонирующие и экспрессирующие носители, а также вирусные векторы.

Вектор может содержать либо ДНК, либо РНК. Например, для получения вектора может быть использован либо ДНК-, либо РНК-вирус. На основе геномной РНК вируса может быть получена копия кДНК. И наоборот, фрагмент кДНК (или вирусной геномной ДНК) может быть транскрибирован in vitro с образованием РНК. Эти методики хорошо известны специалистам.

Термин "кодирующая последовательность" или последовательность, которая "кодирует" выбранный полипептид, означает молекулу нуклеиновой кислоты, которая транскрибируется (в случае ДНК) и транслируется (в случае мРНК) в полипептид in vivo при ее нахождении под контролем соответствующих регуляторных последовательностей (или "регуляторных элементов"). Границы кодирующей последовательности определены старт-кодоном у 5' (амино)-конца и кодоном терминации трансляции у 3' (карбокси)-конца. Кодирующей последовательностью может быть, не ограничиваясь ими, кДНК, происходящая от вирусной, прокариотической или эукариотической мРНК, геномные ДНК-последовательности, происходящие от вирусной или прокариотической ДНК, и даже синтезированные ДНК-последовательности. Последовательность терминации транскрипции может быть локализована со стороны 3'-конца по отношению к кодирующей последовательности. Транскрипция и трансляция кодирующих последовательностей обычно регулируются "регуляторными элементами", включая, но не ограничиваясь ими, промоторы транскрипции, энхансерные элементы транскрипции, последовательности Шайна-Дальгарно, сигналы терминации транскрипции, последовательности полиаденилирования (локализованные со стороны 3'-конца по отношению к кодону терминации трансляции), последовательности для оптимизации инициации трансляции (локализованные со стороны 5'-конца по отношению к кодирующей последовательности) и последовательности терминации трансляции. Термин "элемент регуляции экспрессии генов" означает нуклеотидную последовательность, содержащую, как минимум, промотор. Такой элемент может, кроме того, содержать другие последовательности, необходимые для экспрессии кодирующих последовательностей, функционально присоединенных к промотору, или влияющие на такую экспрессию. Компоненты этих элементов необязательно должны быть смежными, то есть они могут быть разделены промежуточными последовательностями. Компоненты этих элементов могут влиять на экспрессию кодирующих последовательностей на уровне транскрипции, стабильности РНК, процессинга и/или трансляции РНК. Обычно такой элемент не содержит кодирующих последовательностей, с которыми они функционально связаны. В некоторых случаях элемент регуляции экспрессии гена может содержать природный ген либо, в основном, состоять из такого гена, кроме кодирующей последовательности данного гена.

Векторы для генной терапии ВИЧ

Главным требованием генной терапии является устойчивая экспрессия терапевтических генов, не вызывающая негативных клинических эффектов. Крайне желательно иметь вектор (последовательность, обеспечивающую встраивание ДНК последовательностей в геном клетки человека) с высоким титром, который способен стабильно интегрировать в клетки-мишени (включая делящиеся и неделящиеся клетки) и который не является патогенным и не вызывает иммунной реакции.

Ретровирусные векторные системы

Одной из первых систем для генотерапии был ретровирусный вектор, сконструированный на основе вируса мышиного лейкоза Moloney (MoMLV). Этот вектор обладает способностью инфицировать делящиеся клетки. ДНК-провирус MoMLV способен интегрироваться в геном делящихся клеток и передаваться по наследству вместе с клеточным геномом. В целом, клинические испытания с помощью векторных систем на основе вируса MoMLV составляют более 23% от клинических испытаний всех систем генотерапии различных заболеваний человека.

Векторы на основе спумовируса (foamy virus)

В настоящее время для генной терапии разработаны векторы на основе спумавируса. Спумавирусы - не патогенные, интегрирующие ретровирусы, обладающие свойствами, отличающими их от лентивирусов и гамма-ретровирусов. Такие векторы позволяют упаковывать и переносить большие фрагменты ДНК и эффективно трансдуцируют гемапоэтические клетки. Кроме того, преимуществом данного вектора для генной терапии ВИЧ-инфекции является низкая гомология нуклеотидной последовательности с вирусом иммунодефицита человека, благодаря которой резко понижается риск мобилизации вектора, обеспечивая безопасность терапии. Способность эффективно переносить антиВИЧ-трансгены, которые не могут быть перенесены с помощью векторов на основе ВИЧ-1, является ключевым преимуществом этого вектора. Показано, что на титр вектора на основе спумавируса не влияют кассеты трансгенов, которые значительно уменьшают титр лентивирусного вектора. Сайты интеграции данного вектора значительно отличаются от сайтов интеграции лентивирусов и гамма-ретровирусов, что может уменьшить риск возникновения лейкемии при использовании в генной терапии.

Невирусные системы доставки генов - вектор на основе транспозонов

Невирусные системы доставки генов (с помощью ДНК плазмид) являются наиболее простыми и безопасными, однако эффективность таких способов долгое время оставалась очень низкой. На данный момент существуют несколько экспрессионных векторов на основе транспозонов, некоторые из которых обладают эффективностью переноса ДНК, сравнимой с ретровирусными системами. Примером такого вектора может служить транспозонная система Спящей красавицы (Sleeping Beauty). Эта система состоит из искусственного транспозона и соответствующей транспозазы, фермента, который обладает функцией разрезания и встраивания фрагментов ДНК. Процесс переноса гена состоит из двух ступеней: на первой транспозаза распознает короткие инвертированные или прямые повторы в составе транспозона, а на второй вырезает и встраивает транспозон в геномную ДНК, в области ТА-повторов. В системе транспозонов Спящей красавицы могут быть использованы две независимые плазмиды, кодирующие транспозон и транспозазу, или оба компонента могут быть объединены на одной плазмиде. Усовершенствование фермента транспозазы привело к увеличению эффективности доставки генов с помощью этой системы. Показана возможность переноса генов в различные клетки млекопитающих, включая эмбриональные клетки мышей. Использование векторов транспозон/транспозаза представляет собой альтернативный способ доставки трансгена для генной терапии ВИЧ.

Лентивирусные векторы

На сегодняшний день лентивирусные векторы на основе ВИЧ-1 наиболее часто используются в генной терапии и молекулярно-биологических исследованиях, так как строение генома этого вируса детально изучено, что значительно облегчает проведение генно-инженерных манипуляций. Однако также сконструированы векторы на основе других лентивирусов: ВИЧ-2, ВИО (вирус иммунодефицита обезьян, SIV), вирус иммунодефицита крупного рогатого скота (BIV), лентивирус артрита-энцефалита коз (CAEV), вирус инфекционной анемии лошадей (EIAV), вирус иммунодефицита кошек (FIV), вирус болезни Джембрана (JDV). Такие векторы потенциально могут обладать определенными преимуществами, такими как повышенная безопасность, так как они не могут инфицировать человека, а значит, понижается вероятность возникновения репликационно-компетентных вирусных частиц. Кроме того, многие антиВИЧ-агенты действующие против вируса на этапе упаковки, значительно снижают титр вирусных частиц при использовании векторов на основе ВИЧ-1, но не влияют на титр вирусных частиц на основе других лентивирусов.

Вирусы подсемейства лентивирусов обладают уникальной способностью стабильно переносить генетический материал в неделящиеся клетки. В отличие от MuLV и других γ-ретровирусов лентивирусные векторы обычно встраиваются после точки начала транскрипции и, таким образом, не могут активировать онкогены. Широкомасштабный скрининг сайтов интеграции лентивирусов показал отсутствие злокачественных перерождений клеток. Разработка новых векторов на основе лентивирусов (в частности, ВИЧ) открывает широкие возможности в генной терапии ВИЧ. К РНК-вирусам подсемейства Lentivirus относят вирусы иммунодефицита человека типов 1 и 2 (т.е. ВИЧ-1 или ВИЧ-2, при этом ВИЧ-1 раньше называли с лимфаденопатией вирусом 3 (HTLV-III) и вирусы, ассоциированные с синдромом приобретенного иммунодефицита (СПИД) (ARV)), или другие вирусы, близкие ВИЧ-1 или ВИЧ-2, которые были идентифицированы и ассоциированы со СПИДом или СПИД-подобным заболеванием. Кроме того, к РНК-вирусам подсемейства Lentivirus относят вирус Висны/Маэди (например, инфицирующий овец), вирус иммунодефицита кошек (FIV), бычий лентивирус, вирус иммунодефицита обезьян (SIV), вирус инфекционной анемии лошадей (EIAV) и вирус артрита-энцефалита коз (CAEV).

Требования к вирусному вектору включают наличие промоторных элементов, размер генома, позволяющий упаковывать инородный генетический материал, и отсутствие вирулентных детерминант. Для уменьшения патогенности при производстве рекомбинантных вирусных векторов поступление структурных генов (кодирующих белки, образующие оболочку вируса, нуклеокапсид и т.д.) обеспечивается in trans путем интеграции в геном упаковочных клеток либо на плазмиде, вводимой в клетки совместно с вектором.

Репликация, интеграция и упаковка вирусных частиц требует наличия РНК (ДНК) областей, которые не кодируют белков. Большинство из таких цис-элементов необходимо включать в лентивирусный вектор (табл.1).

Таблица 1
Цис-элементы вектора
Название элемента Функция в векторе
LTR (long terminal repeat) Содержит последовательности, необходимые для обратной транскрипции и интеграции
PBS (primer binding site) Необходим для инициации синтеза минус цепи ДНК
ψ Необходим для упаковки векторной РНК
RRE (rev responsive element) Взаимодействует с Rev белком, необходим для процессинга и транспорта РНК-вектора
PPT (polypurine tract) Необходим для затравки синтеза плюс цепи
cPPT (central polypurine tract - flap) Обеспечивает эффективную обратную транскрипцию и ядерный транспорт векторной ДНК

Структурные гены, которые поставляются in trans, включают три группы белков gag, pol и env (табл.2). Эти гены входят в состав нескольких отдельных упаковочных плазмид. Удаление таких генов из состава вектора не дает ему возможность самостоятельно реплицироваться и производить вирусные частицы, тем самым увеличивая безопасность применения таких векторов.

Таблица 2
Транс-элементы вектора
Название элемента Функция
Gag/pol Кодирует структурные белки капсида и нуклеокапсида и ферменты, необходимые для обратной транскрипции и интеграции
env Определяет связывание и вход в клетку вирусной частицы
rev Необходим для экспрессии несплайсированных и частично сплайсированных мРНК ВИЧ в клетке. Увеличивает титр вирусных частиц, содержащих вектор при упаковке в клеточной линии in vitro Дает преимущество при наличие RRE элемента в векторе

Векторы по настоящему изобретению также могут представлять собой самоинактивирующиеся лентивирусные векторы, которые придают конструкциям свойство самоинактивироваться и обеспечивают дополнительную безопасность при проведении терапии. При конструировании самоинактивирующихся векторов в 3'-LTR векторной ДНК (провирус) вносят делецию, затрагивающую энхансерно-промоторную область (она находится в US-районе LTR), т.е. конструируют 3'LTR с делецией в области U3. После заражения клетки мишени из-за особенностей обратной транскрипции образуется провирус, у которого оба LTR лишены промоторно-энхансерной области. Таким образом, после интеграции в геном клетки-мишени самоинактивирующийся вектор не способен к репликации, поэтому вероятность возникновения репликационно-компетентного вируса (RCV) в культуре трансдуцированных клеток ничтожно мала. Кроме того, исключается возможность инсерционного мутагенеза, так как отсутствие сильных энхансерно-промоторных участков на 3' конце вектора (которые находятся в делегированном участке LTR) предотвращает активацию собственных генов клетки, в том числе онкогенов.

Для получения векторных транскриптов в упаковочных клетках вместо вирусного промотора-энхансера в U5-районе LTR используется RSV/5'-LTR гибридный промотор. Это позволяет не вводить дополнительно плазмиду, кодирующую вирусный белок tat, и делает систему еще более безопасной.

Согласно настоящему изобретению в предложенных генетических конструкциях могут быть использованы любые известные векторы с последовательностью, обеспечивающей встраивание ДНК последовательностей в геном клетки человека, с высоким титром, которые способны стабильно интегрировать в клетки-мишени (включая делящиеся и неделящиеся клетки) и которые не является патогенным и не вызывают иммунной реакции. Однако использование лентивирусных векторов обеспечивает некоторые неожиданные преимущества.

Промоторы

Последовательности, кодирующие генетические антивирусные агенты, могут быть включены в векторную частицу под контролем соответствующих промоторов, известных для специалиста в данной области.

Термин "промотор" означает нуклеотидную последовательность, которая контролирует инициацию и скорость транскрипции полинуклеотида. Промотор содержит элементы, с которыми могут связываться регуляторные белки и молекулы, такие как РНК-полимераза и другие факторы транскрипции, для инициации специфической транскрипции последовательности нуклеиновой кислоты. Выражения «функционально расположенный», «функционально связанный», «под контролем» и «под транскрипционным контролем» означают, что промотор находится в корректном функциональном расположении и/или ориентации по отношению к последовательности нуклеиновой кислоты для контроля инициации транскрипции и/или экспрессии такой последовательности.

Промотор РНК полимеразы II человека

Транскрипция всех кодирующих последовательностей эукариот находится под контролем промотора РНК полимеразы II и приводит к образованию полностью зрелой мРНК, имеющей кэп на 5' конце и полиА на 3' конце последовательности мРНК. Промотор, в общем, содержит последовательность, которая определяет положение начала синтеза РНК. Лучшим известным примером такой последовательности является ТАТА-бокс, но в некоторых промоторах, лишенных ТАТА-бокса, таких как, например, промотор гена терминальной дезоксинуклеотидилтрансферазы млекопитающего и промотор поздних генов SV40, другой элемент, прилегающий к участку старта, способствует точному определению места инициации. Дополнительные промоторные элементы регулируют частоту инициации транскрипции. Обычно они локализованы в области на 30-110 н.п. выше участка старта, хотя некоторые промоторы, как было показано, содержат также функциональные элементы ниже участка старта. Для помещения кодирующей последовательности «под контроль промотора» располагают 5'-конец участка инициации транскрипции в транскрипционной рамке считывания «ниже» (т.е. в 3'-направлении) выбранного промотора.

Действие промотора может быть усилено «энхансером». Под энхансером подразумевают специфическую цис-действующую последовательность нуклеотидов, многократно усиливающую транскрипцию генов РНК-полимеразой II; например энхансер вируса SV40 (размер - 72 пары нуклеотидов) может усиливать транскрипцию бета-глобинового гена в 200 раз, даже находясь на значительном удалении от него и в любой ориентации по отношению к промотору. Способность ряда энхансеров взаимодействовать со специфическими белками в дифференцированных клетках обеспечивает тканеспецифичный характер экспрессии соответствующих генов.

Естественно, важно использовать промотор и/или энхансер, который эффективно направляет экспрессию сегмента ДНК в органелле, клеточном типе, ткани, органе или организме, выбранном для экспрессии. Специалистам в области молекулярной биологии, в основном, известно применение промоторов, энхансеров и комбинаций клеточных типов для экспрессии белка (см., например, Sambrook et al., 1989, включенный сюда в качестве ссылки). Используемые промоторы могут быть конститутивными, тканеспецифичными, индуцируемыми и/или могут использоваться в условиях, подходящих для направления высокоуровневой экспрессии введенного сегмента ДНК. Промотор может быть гетерологичным или эндогенным.

Конститутивные промоторы

К конститутивным промоторам, т.е. промоторам, работающим во всех типах клеток не зависимо от условий, относятся промоторы генов «домашнего хозяйства» (housekeeping genes). К генам «домашнего хозяйства» относятся гены, обеспечивающие жизнедеятельность эукариотической клетки и функционирующие повсеместно, на всех стадиях жизненного цикла организма. Они обеспечивают процесс гликолиза, биосинтез аминокислот и нуклеотидов, катаболизм белков и т.п. Неограничивающими примерами таких промоторов являются промотор гена фактора элонгации EFα, гена фосфоглицераткиназы (PGK), гена β-актина, убиквитиновый промотор UbC, гистоновый промотор Н2В (ТН2В) и др.

Многие вирусные промоторы выполняют конститутивную функцию в эукариотических клетках. Эти промоторы включают: ранние и поздние промоторы SV40 (см. Bernoist and Chambon, Nature, 290:304 (1981)); длинные концевые повторы (LTR) вируса лейкоза Молонея и других ретровирусов (см. Weisset al., RNA Tumor Viruses, Cold Spring HarborLaboratory, Cold Spring Harbor, NY (1985)); промотор тимидинкиназы вируса простого герпеса (HSV) (см. Wagner et al., Proc. Nat. Acad. Sci. USA, 78: 1441 (1981)); самый ранний промотор цитомегаловируса (IE1) (см. Karasuyama et al., J. Exp. Med., 169: 13 (1989); промотор вируса саркомы Payca (RSV) (Yamamoto et al., Cell, 22:787 (1980)); главный поздний промотор аденовируса (Yamada et al., Proc. Nat. Acad. Sci. USA, 82:3567 (1985)) и многие другие. Поэтому любые вышеуказанные конститутивные промоторы можно использовать для контроля транскрипции генной вставки.

Тканеспецифичные промоторы

Тканеспецифичными называются промоторы, которые инициируют транскрипцию гена только в клетках определенной ткани. Тканеспецифический характер экспрессии генов обеспечивается различными механизмами взаимодействия белковых факторов транскрипции с регуляторными последовательностями нуклеиновых кислот. Отличительные черты тканеспецифических промоторов или элементов, а также анализы для характеристики их активности хорошо известны специалистам в данной области. Неограничивающие примеры генов под контролем таких промоторов охватывают человеческий ген LIMK2 (Nomoto et al., 1999), ген соматостатинового рецептора 2 (Kraus et al., 1998), ген связывающего ретиноевую кислоту белка придатков яичка мыши (Lareyre et al., 1999), человеческий CD4 (Zhao-Emonet et al., 1998), мышиный альфа-2-(XI)-коллаген (Tsumaki, et al., 1998), ген дофаминового рецептора D1A (Lee, et al., 1997), инсулиноподобный фактор роста II (Wu et al., 1997) и молекулу-1 адгезии тромбоцитов-эндотелиальных клеток человека (Almendro et al., 1996).

Ниже перечислены неограничивающие примеры тканеспецифичных элементов/промоторов РНК-полимеразы II, которые могут использоваться в контексте настоящего изобретения для регуляции экспрессии РНК: промотор гена тяжелой цепи иммуноглобулина человека, гена Т-клеточного рецептора, гена β-интерферона, гена IL2, гена рецептора IL2, генов МНС класса II, гена α-фетопротеина, гена γ-глобина, гена β-глобина, генов, кодирующих α- и β-субъединицы гемоглобина человека, гена альбумина, гена коллагеназы, гена металлотионеина (MTII), гена эластазы I, гена c-HA-ras, гена инсулина и др.

Регулируемые промоторы

Регулируемые или индуцибельные промоторы позволяют включать и/или выключать транскрипцию гена. Активность таких промоторов зависит от введения дополнительных факторов, в норме отсутствующих в экспрессирующих клетках. Существует несколько систем обратимого регулирования экпрессии, которые позволяют включать и выключать работу гена. Наиболее используемой и изученной является тетрациклин зависимая система переключения, которая состоит из трех основных частей: молекулы тетрациклина Tet или его аналога, молекулы белка тетрациклинового репрессора TetR или активатора tTA и участка промотора (т.н. тетрациклинового оператора tetO), связывающего репрессор или активатор. Существуют два варианта: а) в системе Tet-On используется репрессор TetR, связывающийся с оператором и блокирующий транскрипцию; добавление терациклина приводит к удалению репрессора и включению экспрессии гена б) в системе Tet-OFF, используется активатор tTA, способствующий экспрессии в отсутствие тетрациклина и выключающий работу гена при добавлении тетрациклина. Аналог тетрациклина доксициклин лучше проникает через клеточную мембрану и обладает большим сродством с репрессором и активатором, поэтому чаще используется в качестве переключателя. Другими примерами регулируемых промоторов могут служить LacZ регулируемая система или экдизон регулируемая система. Единственным примером необратимой индукции (или репрессии) является система, базирующаяся на Cre-Lox рекомбинации бактериофага Р1. Использование Cre-Lox рекомбинации позволяет необратимо включить или выключить экспрессию интересующей последовательности в генной конструкции после введения ее в клетку.

Промоторы полимеразы III человека

Для экспрессии коротких РНК-последовательностей (в нашем случае рибозим, TAR, shRNA) удобно использовать промоторы для РНК полимеразы III. Промоторы для РНК-полимеразы III делятся на три типа, основываясь на композиции промоторных элементов и их положении относительно старта транскрипции (PAULE MR, WHITE RJ. Survey and summary: transcription by RNA polymerases I and III. Nucleic Acids Res 2000; 28(6): 1283-98). Промоторы 3-го типа для РНК-полимеразы III наиболее подходят для транскрипции коротких РНК-последовательностей, поскольку в природе они используются клеткой для наработки малых ядерных РНК-молекул. В отличие от промоторов 1-го и 2-го типа промоторы третьего типа полностью расположены выше транскрипционного старта и содержат 3 специфических промоторных элемента, необходимые для их функционирования: 1. ТАТА-последовательность в позиции -20 п.о., 2. PSE-последовательность проксимального элемента в позиции -50 п.н., 3. DSE-последовательность дистального элемента в позиции -240 п.н. (где +1 - первый транскрибируемый нуклеотид). Оба элемента DSE и PSE содержат энхансер и последовательность, связывающую транскрипционный фактор, которые абсолютно необходимы и делеция которых полностью элиминирует транскрипцию. Расстояние между этими элементами строго определено и критично для достижения максимальной скорости транскрипции. Характерной особенностью данных промоторов является четко определенный сайт инициации транскрипции и простой сигнал терминации, состоящий из 4-х или 5-ти последовательных тимидинов (SCHRAMM L et al. Recruitment of RNA polymerase III to its target promoters. Genes Dev 2002; 16(20): 2593-620). Относительная простота и высокий уровень транскрипции (4*105 транскриптов на клетку) делает их максимально удобными для использования в генетических конструкциях.

К промоторам 3-го типа для РНК-полимеразы III относятся промоторы генов H1, U6 и 7SK, которые обычно используются в экспериментах для экспрессии shRNA. Ген H1 кодирует РНК, которая является компонентом ядерной РНКазы Р и вовлечена в созревание тРНК. HI промотор человека является необыкновенно компактным - все элементы, необходимые для транскрипции, находятся в пределах 100 п.о. выше старта. РНК, кодируемая геном U6, играет центральную роль в процессинге РНК и является неотъемлимой частью сплайсосомы (BERGET SM, ROBBERSON BL. U1, U2, and U4/U6 small nuclear ribonucleoproteins are required for in vitro splicing but not polyadenylation. Cell 1986; 46(5): 691-6). Эксперименты in vivo и in vitro показывают, что U6 промотор намного активнее, чем H1. Однако по-аналогии с U1 РНК для U6 РНК предполагают наличие регуляторного механизма, который предотвращает избыточное накопление U6 РНК в клетке Noonberg SB, Scott GK, Benz CC. Evidence of posttranscriptional regulation ofU6 small nuclear RNA. J Biol Chem 1996; 271(18): 10477-81). Поэтому сверхэкспрессия shRNA, контролируемая U6 промотором, может приводить к уменьшению количества эндогенной U6 РНК и изменению фенотипа клетки. Все более популярен становится промотор 7SK как более сильный по сравнению с U6, но не обладающий механизмом саморегуляции. 7SK РНК эволюционно консервативна и присутствует в клетке в большом количестве. Существуют искусственно созданные регулируемые промоторы РНК-полимеразы III, основанные на описанных выше тетрациклиновой и Cre-Lox системе.

В общем, промоторы и энхансеры, которые контролируют транскрипцию в эукариотических клетках, составлены из множественных генетических элементов. Клеточный аппарат способен объединить и интегрировать регуляторную информацию, которую несет каждый элемент, что позволяет образовывать комплексные профили транскрипционной регуляции. Активация или репрессия промоторных и энхансерных элементов может осуществляться путем контакта данных элементов с подходящими белковыми активаторами или репрессорами транскрипции.

В контексте данного изобретения может использоваться любая комбинация элементов промотор/энхансер (согласно базе данных эукариотических промоторов EPDB), приводящая к эффективной инициации и поддержанию транскрипции последовательности в гемапоэтических клетках. Для экспрессии трансгенов могут быть использованы регулируемые промоторы, позволяющие включать/выключать транскрипцию в процессе производства вирусных частиц и/или в процессе терапии ВИЧ-инфекции. Специалист на основании данного описания и уровня техники способен подобрать соответствующий промотор для каждого из перечисленных ниже антивирусных агентов или их комбинации.

Генетические антивирусные агенты

Генетические антивирусные конструкции, которые используются в генной терапии, можно разделить на 2 типа: агенты, взаимодействующие с вирусными элементами после проникновения в клетку и начала репликации, и агенты, предотвращающие проникновение вируса в клетку и/или интеграцию в геном, и таким образом придающие клетке-хозяину резистентность (устойчивость) к инфицированию.

Согласно настоящему изобретению предлагаются генетические конструкции, включающие по меньшей мере один из перечисленных ниже антивирусных агентов.

Короткие интерферирующие РНК, направленные против гена рецептора человека CCR5 (CCR5 si)

В качестве одного из агентов, придающих клетке устойчивость к ВИЧ, авторами были выбраны короткие интерферирующие РНК, направленные против гена хемокинового рецептора CCR5, задействованного в процессе проникновения ВИЧ в клетку.

РНК-интерференция - регуляторный механизм, присутствующий в большинстве эукариотических клеток, который использует двухцепочечные РНК-молекулы как сигнал для регуляции активности генов, гомологичных этим РНК. В клетках млекопитающих эндогенный механизм РНК-интерференции запускается так называемыми молекулами микроРНК. Последовательности генов микроРНК образуют шпилечную структуру (первичная микроРНК), которая распознается и процессируется клеточным ферментом Drosha в ядре, после чего образовавшиеся короткие РНК-шпильки (предшественники микроРНК) экспортируются в цитоплазму. В цитоплазме специальный белковый комплекс (RISC) удаляет петлю шпильки, образуя короткие РНК-дуплексы. Эти дуплексы, известные как короткие интерферирующие РНК - киРНК (short interfering RNAs, siRNAs), представляют собой двухцепочечные РНК размером 21-22 пар нуклеотидов; на 3' концах обеих цепей которых присутствуют два неспаренных нуклеотида. киРНК широко используются для ингибирования экспрессии генов при работе с клеточными культурами in vitro. Дальнейшее процессирование РНК-дуплекса приводит к выбору эффекторной короткой (~21 п.н.) цепи РНК, которая направляется к гомологичной мРНК и гибридизуется с комплементарным участком мРНК-мишени. В случае 100% гомологии связывание приводит к расщеплению мРНК и последующей полной деградации мРНК.

Запустить внутриклеточный механизм РНК-интерференции, направленный на подавление вирусных или клеточных генов, можно введя в клетку трансгены, экспрессирующие короткие шпилечные РНК (short hairpin RNA, shRNA), которые образуют во вторичной структуре плотные шпильки и являются аналогами предшественников микроРНК. Так же как и микроРНК-предшественники, они экспортируются в цитоплазму и далее процессируются, используя механизм РНК интерференции. Если такая шпилечная РНК содержит последовательность, комплементарную последовательности гена CCR5, это приведет к деградации мРНК и отсутствию экспрессии рецептора. Короткие РНК, образующие шпильки, вводят в клетки при помощи вектора, использующего промотор РНК-полимеразы III для обеспечения конститутивной или индуцибельной экспрессии.

Последовательность, комплементарную последовательности гена CCR5, также можно встроить в тело эндогенной микроРНК; такая искусственно модифицированная первичная микроРНК будет процессирована и приведет к расщеплению мРНК соответствующего гена. Экспрессия микроРНК регулируется промотором РНК-полимеразы II

Интегрированный вектор, содержащий shRNA или микроРНК, передается дочерним клеткам и обеспечивает наследуемое выключение гена (PADDISON P et al, (2002). "Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells". Genes Dev. 16 (8): 948-58. DOI: 10.1101/gad.981002. PMID 11959843).

РНК-интерференция является очень эффективным механизмом подавления экспрессии генов, с ее помощью можно достигнуть 99% ингибирования, то есть практически выключить работу гена.

Основная проблема, возникающая при использовании РНК-интерферирующих молекул, направленных против генов ВИЧ, кроется в самой природе вируса, приводящей к возникновению устойчивых мутантных штаммов. Для успешного применения РНК-интерференции необходима строгая комплементарность siRNA и мРНК-мишени. Возникновение единственной замены нуклеотида в РНК ВИЧ, соответствующего 9-11 нуклеотиду siRNA, приводит к полной несостоятельности механизма РНК-интерференции и отсутствию подавления репликации. В клеточной культуре возникновение устойчивых вирусных мутантов, несущих замену единственного нуклеотида, как правило, возникает на 25 день. siRNA, направленные против высоко консервативных участков, лишь отчасти улучшают ситуацию, требуя более длительного времени для появления мутантов. Наиболее перспективный подход состоит в использовании siRNA, направленных против клеточных генов, белковые продукты которых взаимодействуют с ВИЧ, и которые отличаются высокой консервативностью.

В заявках WO2004065549 А2 (UNIV FLORIDA) 05.08.2004 и WO03022052 А1 (CALIFORNIA INST OF TECHN) 20.03.2003 раскрываются лентивирусные системы доставки siRNA в клетки для лечения рака.

В соответствии с настоящим изобретением предложены конструкции, содержащие последовательность, кодирующую siRNA, направленную против клеточного гена - гена хемокинового рецептора CCR5. CCR5 - корецептор, необходимый для проникновения в клетку R5 тропных вирусов. Естественные мутации корецепторов широко встречаются в популяции как ВИЧ-инфицированных, так и неинфицированных людей. У некоторых людей такие мутации приводят к полному отсутствию рецепторной молекулы, что делает таких людей устойчивыми к инфицированию ВИЧ. Примечательно, что отсутствие CCR5 рецептора у таких людей не приводит к нарушениям фенотипа.

Таким образом, еще одной задачей настоящего изобретения является создание конструкций, кодирующих CCR5 siRNA, которые используются для придания клетке-мишени устойчивости к инфицированию ВИЧ.

Последовательность, кодирующая данную siRNA, может быть клонирована в лентивирусный вектор в двух вариантах:

1) в виде короткой РНК-шпильки (shCCR5), транскрипция которой инициируется Pol III промотором;

2) в виде искусственной микроРНК (miCCR5), на основе микроРНК человека, траскрипция которой инициируется Pol II промотором.

Преимуществами данных siRNA являются высокая эффективность подавления экспрессии гена CCR5 и в то же время отсутствие клеточной токсичности. Поскольку присутствие даже нескольких молекул на поверхности клетки делает ее чувствительной к заражению вирусом, то только полное подавление синтеза рецептора за счет высокой эффективности siRNA защищает клетку от проникновения вируса. Предложенные в соответствии с настоящим изобретением конструкции, включающие, в частности, miCCR5, обеспечивают превосходную антивирусную активность в сочетании с полным отсутствием токсичности.

РНК-шпилька, аналогичная TAR-последовательности

Еще одной группой антивирусных агентов являются РНК-аптамеры. Аптамеры - молекулы полинуклеотидов, связывающие с высокой эффективностью белковые лиганды вируса. Аптамеры, синтезированные in vitro, демонстрируют высокую ингибирующую активность, однако при экспрессии в клетке эффективность заметно снижается. Проблемой является формирование правильной пространственной структуры в клеточном контексте. Исключение составляет использование двух последовательностей, присутствующих в РНК ВИЧ - области TAR (trans-activating response region) и RRE (Rev response element), так называемые TAR и RRE-ловушки, которые являются естественными аптамерами для tat и rev вирусных белков.

Tat - один из ранних вирусных белков, продуцируемый во время ВИЧ-инфекции, играет ключевую роль в регуляции ВИЧ-репликации. Связываясь с последовательностью TAR, Tat активизирует экспрессию вирусных генов более чем в 100 раз. TAR-элемент локализован на 5 конце всех ВИЧ-транскриптов, его структура представляет собой шпильку длиной 59 нуклеотидов. Исследования показали, что за связывание tat белка отвечает выступ из трех нуклеотидов, а петля на конце шпильки необходима для кооперативного взаимодействия с клеточным белком циклин Т1 (cyclinT1). Длинный двухцепочечный участок - ствол шпильки - играет лишь структурную роль.

Среди нескольких стратегий генной терапии, направленных на блокирование активности гена tat, одна из самых успешных - использование коротких РНК-молекул, работающих как ловушки. Такие РНК имитируют tat связывающую РНК-последовательность вируса, приводя к уменьшению свободного tat белка (BOHJANEN PR et al, A small circular TAR RNA decoy specifically inhibits Tat-activated HIV-1 transcription. Nucleic Acids Research, 1996, Vol.24, No. 19 3733-3738).

Однако на данный момент до сих пор существует потребность в более эффективных средствах доставки tat-связывающих РНК для осуществления направленной антиВИЧ-терапии.

Таким образом, еще одной задачей настоящего изобретения является создание генетических конструкций, содержащих последовательность, кодирующую РНК-шпильку, аналогичную TAR-последовательности.

Рибозим, направленный против консервативных участков вируса иммунодефицита человека

Рибозимы - ферментативные молекулы РНК, которые способны катализировать специфическое расщепление РНК, в том числе ВИЧ. Многочисленные исследования подтвердили, что рибозимы могут быть, по меньшей мере частично, эффективными при ингибировании размножения ВИЧ в клетках тканевой культуры (MAKI SHIOTA et al, Ribozymes: Applications to Functional Analysis and Gene Discovery, J. Biochem. 136, 133-147 (2004), DOI: 10.1093/jb/mvh119).

Известны конструкции, содержащие рибозимы, например, в заявке WO9946372 (А2) 16.09.1999 раскрывается применение рибозимов для лечения HIV-1 посредством подавления CCR5 рецепторов. В заявке US2003036056 A1 (ROSSI JOHN J) 20.02.2003 раскрываются химерные tRNALys-рибозимы, ингибирующие обратную транскрипцию ВИЧ посредством доставки ингибиторов ВИЧ к вирионам.

Для эффективной работы рибозимов необходима комплементарность плечей рибозима и последовательности мишени, в данном случае ВИЧ. Так же как и в случае siRNA, введение противовирусного рибозима приводит к возникновению устойчивых мутантных вирусов. Использование одного рибозима, направленного одновременно против двух консервативных участков в области R/U5 LTR и в области гена pol вируса, заметно уменьшает вероятность образования устойчивых мутантов. Кроме того, до сих пор существует потребность в более эффективных средствах доставки рибозима для осуществления направленной антиВИЧ-терапии.

Таким образом, еще одной задачей настоящего изобретения является создание генетических конструкций, содержащих последовательность, кодирующую рибозим, направленный против двух консервативных участков вируса иммунодефицита человека.

Рибозим, РНК-шпилька, аналогичная TAR-последовательности, и короткая интерферирующая РНК, направленная против гена рецептора человека CCR5 (CCR5 si), являются короткими РНК-молекулами, для экспрессии которых удобно использовать промоторы РНК-полимеразы III. Примерами таких промоторов, используемых в изобретении, являются U6 и H1 промоторы малых ядерных РНК человека. Однако изобретение не ограничивается использованием этих промоторов. Кроме того, экспрессия коротких РНК-последовательностей может быть получена и без использования индивидуального промотора, а при слиянии с длинным кодирующим транскриптом, под контролем промотора РНК-полимеразы II.

Антисмысловая последовательность к участку гена env ВИЧ

Антисмысловые (антисенс) РНК - короткие или длинные РНК-последовательности, комплиментарные последовательности РНК ВИЧ, образуют нефункциональные дуплексы с вирусной РНК и способны блокировать репликацию вируса в клетках. Хотя точный механизм ингибирования не ясен, он может включать запуск деаминации цитозина ВИЧ:антисенс дуплексной РНК, приводя к задержке транскриптов в ядре и последующей их деградации или к образованию многочисленных нежизнеспособных вирусных мутантов. Другими возможными механизмами (которые зависят от структуры антисмысловой РНК) являются ингибирование экспрессии на уровне сплайсинга, ингибирование трансляции, упаковка химерного дуплекса с образованием дефектных вирусных частиц.

Множество антисенс-конструкций, исследованных in vitro, обладали способностью подавлять размножение вируса, в том числе антисмысловые РНК, блокирующие регуляторные цис-элементы, такие как сигнал упаковки (ψ), последовательность связывания tat-белка (TAR) и сайт связывания праймера (PBS) (Cohli Н, В. Fan, R. L. Joshi, A. Ramezani, X. Li & S. Joshi: Inhibition of HIV-1 multiplication in a human CD4+ lymphoid cell line expressing antisense and sense RNA molecules containing HIV-1 packaging signal and RREs. Antisense Res Dev 4, 19-26 (1994), Ding S. F, J. Noronha & S. Joshi: Co-packaging of sense and antisense RNAs: a novel strategy for blocking HIV-1 replication. Nucl Acids Res 26, 3270-3278 (1998), Chadwick, D.R., and A.M.Lever. 2000. Antisense RNA sequences targeting the 5 leader packaging signal region of human immunodeficiency virus type-1 inhibits viral replication at post-transcriptional stages of the life cycle. Gene Ther. 7:1362-1368) или антисенс РНК, соответствующие кодирующим областям вирусных генов, таким как rev, env, vif и т.д. Известно, что антивирусный эффект в большой степени зависит от промотора и вектора использованного для доставки.

В статье LEVINE BL et al. Gene transfer in humans using a conditionally replicating lentiviral vector, PNAS November 14, 2006 vol. 103 no. 46 17372-17377 раскрываются конструкции на основе лентивирусных векторов, экспрессирующие антисмысловые гены против оболочки ВИЧ.

В предложенных в соответствии с настоящим изобретением конструкциях в качестве антисмысловой последовательности к участку гена env ВИЧ используют последовательность, полученную из кДНК-изолята вируса иммунодефицита человека субтипа А. Данный изолят был получен из клинического материала от Российского ВИЧ-инфицированного пациента. Поскольку в России в подавляющем большинстве ВИЧ-позитивные пациенты инфицированы ВИЧ субтипа А (более 90%), можно говорить о том, что противовирусный агент, полученный на основе данного изолята, будет более предпочтителен при лечении российских пациентов.

Таким образом, еще одной задачей настоящего изобретения является создание конструкций, содержащих указанную антисмысловую последовательность к участку гена env ВИЧ, используемых для противовирусной терапии.

Модифицированная последовательность гена TRIM5α человека

TRIM5α (tripartite motif 5 α) - белковый фактор, обуславливающий устойчивость резус-макак к ВИЧ, содержащий 3 различных домена (RING, B-box и RBCC домены). Кроме этих доменов в состав TRIM5α входит C-концевой SPRY домен, связывающийся с капсидом ВИЧ и отвечающий за устойчивость клетки к заражению ВИЧ. Различие в аминокислотном составе этого домена между приматами определяет различие в наборе ретровирусов, к которым устойчив данный вид. Белковые тримеры образуют множественные контакты с поверхностью вирусного капсида и распознают, по-видимому, пространственную структуру. Таким образом, TRIM5α можно назвать распознающим структуру рецептором (PRR) врожденной иммунной системы, направленным на распознавание мультимерной белковой поверхности капсида вируса. Механизмы действия белка пока мало изучены, известно, что он предотвращает интерграцию вирусной ДНК в хромосому, т.е. блокирует ВИЧ на ранней стадии. Предполагается, что блокирование вируса происходит на 2х ступенях вирусного цикла: блокирование образования кДНК (до или после обратной транскрипции) и блокирование входа в ядро прединтеграционного комплекса.

Человеческий гомолог белка TRIM5α неэффективен по отношению к ВИЧ, вероятно, из-за изменений вирусного капсида в процессе эволюции (Luban J., Cyclophilin A, TRIM5, and resistance to human immunodeficiency virus type 1 infection, J Virol. 2007 Feb; 81(3):1054-61). Изменения всего одной аминокислоты в последовательности человеческого гомолога TRIM5α делает клетки устойчивыми к ВИЧ-инфекции. Таким образом, модифицированный TRIM5α является перспективным для использования в генной терапии - необходимое минорное изменение делает его не иммуногенным, и в то же время введение такой модификации в клетки-мишени придает им устойчивость к инфицированию ВИЧ. На основе TRIM5α изоформы человека создан химерный белок, в котором 11 а.о. заменены на 13 а.о. из TRIM5α резуса-макаки (SAWYER Sara L. et al, Positive selection of primate TRIM5α identifies a critical species-specific retroviral restriction domain. Proceedings of the National Academy of Sciences of the United States of America, 2005, vol. 102, no8, pp.2832-2837).

В заявке WO2005081911 A2 (SODROSKI JOSEPH) 09.09.2005 раскрываются TRIM5α и генетические конструкции их содержащие. Однако отсутствуют сведения о возможности использования модифицированного лентивирусного вектора, обеспечивающего доставку.

Таким образом, еще одной задачей настоящего изобретения является создание генетических конструкций, содержащих последовательность, кодирующую модифицированный белок TRIM5α человека, где модификация включает изменение аминокислотной последовательности TRIM 5α в области SPRY домена, которое обеспечивает распознавание белком TRIM 5α вирусного капсида ВИЧ.

Модифицированный ген TRIM5α человека может находиться под контролем промотора РНК-полимеразы II, который обеспечивает транскрипцию данного трансгена в клетке человека. В предпочтительном осуществлении промотор активен в кроветворных клетках-предшественниках человека и/или конкретных клеточных типах или нисходящих ростках клеток-предшественников. Действие промотора может активироваться или подавляться факторами контроля транскрипции, активаторами или репрессорами.

В качестве промотора может быть использован промотор цитомегаловируса, который также входит в состав вектора pLVX. Однако настоящее изобретение не ограничивается этим промотором, и специалисту в данной области известны другие промоторы, которые могут быть использованы без ограничения, например PGK, EF1-α, CD4, CD2, IL-2, промотор бета-глобина, промоторы МНС. Могут быть использованы гибридные промоторы, в составе которых дополнительно к природной последовательности введены последовательности энхансера или сайленсера, а также последовательности, позволяющие регулировать активность промотора в зависимости от связывания с цитокинами/хемокинами или другими регулирующими молекулами.

Главной задачей настоящего изобретения является создание генетических конструкций, продуцирующих один из перечисленных выше генетических антивирусных агентов или их комбинацию.

Комбинирование двух и более антивирусных генов в одной генетической конструкции представляет преимущество перед использованием одного агента, в частности проявляется синергетический эффект. Разные противовирусные агенты предотвращают инфицирование клетки на разных этапах, блокируя проникновение вируса (CCR5 siRNA), предотвращая интеграцию вируса в геном (TRIM5a), замедляя репликацию вируса (TAR, рибозим) и приводя к образованию неинфекционного вирусного потомства (env антисенс). Каждый агент в отдельности в различной степени подавляет репродукцию ВИЧ (от 50 до 90%). Одновременное использование нескольких противовирусных агентов замедляет образование мутантных штаммов, а комбинация противовирусных агентов с агентами, придающими резистентность клеткам к ВИЧ, позволяет получить 100% антивирусную активность препарата и предотвратить появление устойчивых мутантов.

Специалист в данной области на основании информации, раскрытой в настоящем описании, легко может получить генетические конструкции, включающие любые комбинации перечисленных выше генетических антивирусных агентов.

Комбинация последовательностей, кодирующих антивирусные агенты, подразумевает комбинацию любых двух, трех, четырех антивирусных агентов, а также включение в генетическую конструкцию всех пяти перечисленных выше агентов, при этом они могут быть включены в прямом или обратном направлении по отношению к вектору. Например, возможные следующие неограничивающие комбинации:

Для характеристики возможных комбинации по изобретению и далее в описании используются следующие сокращения:

CCR5 si - последовательность, экспрессия которой, приводит к образованию короткой интерферирующей РНК, направленной против гена рецептора человека CCR5 (CCR5 si);

TAR - последовательность, кодирующая РНК-шпильку, аналогичную TAR-последовательности;

Ribozim - последовательность, кодирующая рибозим, направленный против консервативных участков области R/U5 LTR и в области гена pol вируса иммунодефицита человека;

a/s env - антисмысловая последовательность к участку гена env ВИЧ;

TRIM5a - последовательность, кодирующая модифицированный белок TRIM 5α человека.

Например, двойные комбинации включают: CCR5 si и TAR, CCR5 si и Ribozim, CCR5 si и a/s env, CCR5 si и TRIM5a, TAR и Ribozim, TAR и a/s env, TAR и TRIM5a, Ribozim и a/s env, Ribozim и TRIM5a, a/s env и TRIM5a и т.д.

Например, тройные комбинации без ограничения могут включать: CCR5 si, TAR и Ribozim; TAR, Ribozim и a/s env; Ribozim, a/s env и TRIM5a; CCR5 si, Ribozim и TRIM5a и т.д.

Получение вирусных частиц

Для получения упакованного вектора векторную плазмиду трансфецируют в упаковывающую клеточную линию, вместе с плазмидами, экспрессирующими упаковочные белки. Векторная плазмида включает в себя терапевтический ген и цис-действующие элементы. Упаковочные плазмиды направляют экспрессию структурных белков. Белки, экспрессируемые упаковочными плазмидами, образуют капсид и полимеразный компонент и узнают специфические цис-элементы на РНК, синтезируемой с векторной плазмиды, что приводит к упаковке этой РНК в вирусные частицы. Плазмида с гетерологичным геном оболочки экспрессирует белок оболочки, который присоединяется к вирусному капсиду. Полученные вирусные частицы используются для инфицирования целевых клеток, При трансдукции клеток-мишеней вирусными частицами структурные белки осуществляют обратную транскрипцию и интеграцию последовательности вектора в геном. Целевые клетки экспрессируют интегрированные гены с соответствующих внутренних промоторов, при этом продукциия новых векторных частиц невозможна, так как в этих клетках отсутствуют последовательности, кодирующие упаковочные белки и белок оболочки.

Трансфекция клеток

Настоящее изобретение частично основано на разработке способа генотерапии ех vivo, при осуществлении которого используется клетка, которая (1) может быть легко удалена из организма пациента; (2) может быть модифицирована in vitro путем введения генетического материала; (3) может быть имплантирована реципиенту; (4) не является тромбогенной и (5) может быть имплантирована реципиенту в большом количестве. Генетически модифицированные клетки должны сохранять жизнеспособность и продолжать продуцировать экспрессированный материал in situ в течение периода времени, необходимого для того, чтобы экспрессированный материал мог оказать благоприятное (то есть лечебное) действие, не препятствуя при этом нормальному функционированию ткани, в которой находятся эти клетки.

В используемом здесь значении термин "трансфекция клеток" означает приобретение клеткой нового генетического материала путем введения добавленной ДНК. Таким образом, трансфекция относится к введению нуклеиновой кислоты (например, ДНК) в клетку с использованием физических или химических методов. Специалистам в этой области известны методы трансфекции.

Трансфекция клеток человека включает контактирование популяции клеток человека с вирусными частицами (трансдукция), содержащими одну из конструкций по изобретению в условиях, подходящих для проведения трансдукции в указанной популяции данным вектором. Клетки могут быть трансдуцированы in vivo или in vitro с последующим введением трансдуцированной клетки субъекту. Клетка может быть выделена из организма, например, человека способами, известными в данной области, и может быть трансдуцирована, как указано выше. Трансдуцированные клетки затем вводят обратно тому же или другому реципиенту.

CD4+ Т лимфоциты - это главная клеточная популяция, поражаемая вирусом, уменьшение которой вследствие инфекции приводит к прогрессированию заболевания и проявлению симптомов СПИД. Поэтому именно эти клетки являются основной мишенью для введения терапевтических генов. Также привлекательной мишенью для введения трансгена являются гемопоэтические стволовые клетки, т.к. они являются предшественниками всех клеток, вовлеченных в инфекцию вирусом. Генетическая модификация ГСК может защитить весь спектр восприимчивых клеток. ГСК можно изолировать из костного мозга, периферической крови (после выброса из костного мозга под воздействием гранулоцитарного колониестимулирующего фактора) или пуповинной крови. CD34+ клетки культивируют в течение 2-4 дней в смеси с рекомбинантными цитокинами для стимуляции роста во время введения трансгена. ГСК подвергаются многократным делениям и дифференцировке, прежде чем образовать функциональные лимфоциты (или другие иммунные клетки), поэтому стабильная экспрессия трансгена должна аккуратно передаваться всем потомкам этих клеток. Лентивирусные векторы могут трансдуцировать больший процент ГСК с более коротким периодом культивирования ex vivo, чем гамма-ретровирусные векторы, которые были использованы в первых клинических испытаниях.

Когда клетки, например CD34+-клетки, дендритные клетки, клетки периферической крови, клетки лимфоцитов CD4+ или другие клетки, трансдуцируют ех vivo, частицы вектора инкубируют с клетками, используя дозы, в общем, порядка от 1 до 50 множественности заражения (MOI), что также соответствует 1·105-50·105 единицам трансдукции вирусного вектора на 105 клеток. Обычно количество вектора может быть выражено в терминах единиц трансдукции (TU) HeLa.

Другие пути введения вектора включают в себя внутривенный, внутриартериальный, эндоскопический, в область повреждения, чрескожный, подкожный, внутримышечный, интратекальный, интраорбитальный, внутрикожный, внутрибрюшинный, транстрахеальный, субкутикулярный, путем внутристеблевой инъекции, путем ингаляции или интраназального распыления, эндотрахеальный путь и т.п.

Вирусные частицы в соответствии с настоящим изобретением могут использоваться не только для терапии вирусной инфекции, но и для защиты потенциальной клетки-хозяина от вирусной инфекции, т.е. как способ профилактики вирусной инфекции или "вакцинации" против заданного вируса, такого как РНК-вирус, в частности ретровирус, например ВИЧ.

Таким образом, для решения обозначенных выше задач предложены генетические конструкции для антиВИЧ-терапии, которые включают: векторную последовательность, обеспечивающую встраивание ДНК-последовательностей в геном клетки человека, и по меньшей мере одну из следующих последовательностей, которые могут быть как в прямом, так и в обратном направлении по отношению к векторной последовательности:

последовательность, экспрессия которой приводит к образованию короткой интерферирующей РНК, направленной против гена рецептора человека CCR5 (CCR5 si), выбранную из короткой РНК-шпильки (sh CCR5) или искусственной микроРНК (miRNA CCR5),

последовательность, кодирующую РНК-шпильку, аналогичную TAR-последовательности (TAR),

последовательность, кодирующую рибозим, направленный против консервативных участков в области R/U5 LTR и в области гена pol вируса иммунодефицита человека (Ribozim),

антисмысловую последовательность к участку гена env ВИЧ (a/s env),

последовательность, кодирующую модифицированный белок TRIM 5α человека, где модификация включает изменение аминокислотной последовательности TRIM 5α в области SPRY домена, которое обеспечивает распознавание белком TRIM 5α вирусного капсида ВИЧ (TRIM5a)

и любые их комбинации.

В качестве векторной последовательности может быть использован лентивирусный вектор или вектор, созданный на основе спумавируса или невирусный вектор, в том числе невирусный вектор, созданный на основе векторной системы транспозон/транспозаза.

Частные варианты выполнения изобретения включают генетические конструкции для антиВИЧ-терапии на основе лентивирусного вектора, в том числе и самоинактивирующегося лентивирусного вектора, где лентивирусный вектор создан на основе одного или нескольких из лентивирусов: ВИЧ-1, ВИЧ-2, ВИО, вирус иммунодефицита крупного рогатого скота, лентивирус артрита-энцефалита коз, вирус инфекционной анемии лошадей, вирус иммунодефицита кошек и/или вирус болезни Джембрана,

где конструкции включают любую из следующих последовательностей:

антисмысловую последовательность к участку гена env ВИЧ (a/s env), полученную из кДНК изолята вируса иммунодефицита человека субтипа А,

последовательность, кодирующую рибозим, направленный против консервативных участков в области R/U5 LTR и в области гена pol вируса иммунодефицита человека (Ribozim),

последовательность, кодирующую искусственную микроРНК, которая ингибирует экспрессию гена рецептора человека CCR5 (miRNA CCR5).

Еще одним частным вариантом выполнения изобретения является генетическая конструкция для антиВИЧ-терапии на основе лентивирусного вектора, в которой в качестве вектора используется лентивирусный вектор на основе ВИЧ-1, необязательно модифицированный последовательностью SEQ ID N1 перед областью сРРТ, включающая по меньшей мере одну из следующих последовательностей:

последовательность, экспрессия которой, приводит к образованию короткой интерферирующей РНК, направленной против гена рецептора человека CCR5 (CCR5 si), выбранной из короткой РНК-шпильки (sh CCR5) или искусственной микроРНК (miRNA CCR5),

последовательность, кодирующую РНК-шпильку, аналогичную TAR-последовательности (TAR),

последовательность, кодирующую рибозим, направленный против консервативных участков в области R/U5 LTR и в области гена ро1 вируса иммунодефицита человека (Ribozim),

антисмысловую последовательность к участку гена env ВИЧ (a/s env),

последовательность, кодирующую модифицированный белок TRIM 5a человека, где модификация включает изменение аминокислотной последовательности TRIM 5α в области SPRY домена, которое обеспечивает распознавание белком TRIM 5α вирусного капсида ВИЧ (TRIM5a) и любые их комбинации.

Другим частным вариантом выполнения изобретения является генетическая конструкция для антиВИЧ-терапии, в которой в качестве вектора используется лентивирусный вектор, в том числе самоинактивирующийся лентивирусный вектор, на основе ВИЧ-1, необязательно модифицированный последовательностью SEQ ID N1 перед областью сРРТ, и которая включает

по меньшей мере одну из следующих последовательностей:

последовательность, выбранную из SEQ ID N 2, 8, 9, 10, экспрессия которой приводит к образованию короткой интерферирующей РНК, направленной против гена рецептора человека CCR5 (CCR5 si),

последовательность SEQ ID N4, кодирующую РНК-шпильку, аналогичную TAR-последовательности (TAR),

последовательность SEQ ID N5, кодирующую рибозим, направленный против консервативных участков вируса иммунодефицита человека (Ribozim),

антисмысловую последовательность к участку гена env ВИЧ SEQ ID N3 (a/s env),

последовательность, кодирующую модифицированный белок TRIM 5α человека SEQ ID N 11 (TRIM5a),

и любые их комбинации.

Векторные конструкции в соответствии с настоящим изобретением могут быть созданы, например, на основе вектора pLVX-Puro (Clontech), содержащего лентивирусные LTR и упаковочный сигнал (ψ). Также вектор содержит последовательность сРРТ размером 124 п.о., который повышает эффективность транспорта вирусного генома в ядро. Это приводит к более эффективной интеграции генома, а следовательно, к более эффективной трансдукции. Наличие RRE (Rev-responsive element) в векторе способствует увеличению титра за счет повышения экспорта из ядра несплайсированной вирусной РНК в присутствии белка rev. Наличие в векторе WPRE (посттранскрипционного регуляторного элемента вируса гепатита североамериканского лесного сурка) позволяет повысить эффективность событий, связанных с процессингом РНК и экспорта из ядра. WPRE обеспечивает двойной эффект. Во-первых, находясь в составе вирусного транскрипта, данный элемент повышает эффективность упаковки вектора, что способствует повышению титра вируса, продуцируемого упаковочными клетками 293Т. Во вторых, он усиливает экспрессию гена (gene of interest) за счет облегчения образования зрелой матричной мРНК из транскрипта, инициированного с внутреннего промотора (CMV).

В соответствии с другим вариантом выполнения изобретения генетические конструкции могут быть выполнены на основе самоинактивирющегося лентивирусного вектора, например, на основе вектора pLV-neo. Указанный вектор содержит те же основные элементы, что и вектор pLVX-Puro, за исключением последовательностей LTR. Вместо 5' LTR последовательности используется RSV/5'-LTR гибридный промотор, что позволяет не вводить дополнительно плазмиду, кодирующую вирусный белок tat. 3'LTR содержит делецию в области U3, затрагивающую энхансерно-промоторную область. Так как из-за особенностей обратной транскрипции интегрирующий в геном провирус имеет U3 области LTR, идентичные длинному концевому повтору, расположенному на 3' конце, в данном случае он будет лишен промоторно-энхансерной области.

Неожиданно было дополнительно обнаружено, что модификация лентивирусного вектора, заключающаяся в клонировании последовательности SEQ ID N1 непосредственно перед областью сРРТ, позволяет еще более стабилизировать генную экспрессию, способствует повышению инфекционности вирусных частиц, улучшает эффективность введения генетического материала в клетки-мишени.

В некоторых вариантах выполнения изобретения для удобства дальнейшего клонирования коротких последовательностей, кодирующих РНК, вместо CMV промотора по сайтам ClaI и EcoRI вводили линкер (кроме конструкций с TRIM5α).

При необходимости в вектор вместо гена для селекции пуромицина в качестве молекулярного маркера может быть введена другая последовательность для селекции и/или мониторинга модифицированных клеток. Маркерный ген представляет собой последовательность, которая присоединена к элементам гетерологичного промотора или энхансера, кодирующую продукт, который может быть легко и количественно проанализирован в том случае, когда эта конструкция введена в ткани или в клетки. Специалистам в данной области известны различные последовательности для мониторинга и/или селекции, например ген зеленого флюоресцентного белка (EGFP). Маркерный ген/последовательность может быть удален при использовании вектора в терапии ВИЧ.

Краткое описание чертежей

На фиг.1 представлена карта плазмиды pLVX-puro, характеризующейся:

5'LTR: 1-635

PBS: 636-653

ψ: 685-822

RRE:1303-1536

cPPT: 2028-2151

PCMV IE: 2185-2788

MCS: 2816-2880

PPGK: 2882-3390

Puror: 3411-4010

WPRE: 4024-4615

3'LTR: 4819-5455

pUC: 5925-6595

Ampr: 6740-7736

На фиг.2 представлена карта плазмиды pLV-neo, характеризующейся:

RSV/5'-LTR гибридный промотор: 1-416

PBS: 418-435

ψ: 467-604

RRE:1081-1314

cPPT: 1810-1928

PCMV IE: 1940-2525

Гистоновый промотор: 2576-2933

Ген устойчивости к неомицину: 2942-3736

WPRE: 3750-4291

3'LTR, с делецией в области U3: 4428-4662

SV40 polyA: 4734-4864

Ampr: 5828-6688

На фиг.3-8 представлены карты полученных в примерах плазмид. Плазмида puro U6 CCR5 (фиг.3) характеризуется:

5'LTR: 1-635

PBS: 636-653

ψ: 685-822

RRE: 1303-1536

SEQ#1 2028-2246

cPPT: 2247-2363

U6 promoter 2393-2719

antiCCR5 shRNA 2726-2788

PPGK:2802-3310

Puror: 3331-3930

WPRE: 3944-4535

3'LTR: 4739-5375

pUC: 5845-6515 reverse

Ampr: 6660-7656 reverse

Плазмида puro env (фиг.4), характеризуется:

5'LTR: 1-635

PBS: 636-653

ψ: 685-822

RRE: 1303-1536

SEQ#1 2028-2246

сРРТ: 2247-2363

ENV antisense (SEQ ID N3) 2421-3351

PPGK: 3374-3882

Puror: 3903-4502

WPRE: 4516-5107

3'LTR: 5311-5947

pUC: 6417-7087 reverse

Ampr: 7232-8228 reverse

Плазмида puro SupH1 TAR (фиг.5), характеризуется:

5'LTR: 1-635

PBS: 636-653

ψ: 685-822

RRE: 1303-1536

SEQ#1 2028-2246

сРРТ: 2247-2363

H1 promoter 2394-2609

TAR seq (SEQ IDN4) 2616-2752

PPGK: 2753-3261

Puror: 3282-3881

WPRE: 3895-4486

3'LTR: 4690-5326

pUC: 5796-6466 reverse

Ampr: 6611-7607 reverse

Плазмида puro U6 Rz (фиг.6), характеризуется:

5'LTR: 1-635

PBS: 636-653

ψ: 685-822

RRE: 1303-1536

SEQ#1 2028-2246

сРРТ: 2247-2363

U6 promoter 2394-2720

Ribozym 2734-2862

PPGK: 2883-3391

Puror: 3412-4011

WPRE: 4025-4616

3'LTR: 4820-5456

pUC: 5926-6596 reverse

Ampr: 6741-7737 reverse

Плазмида puro CMV Trim-mk (фиг.7), характеризуется:

5'LTR: 1-635

PBS: 636-653

ψ: 685-822

RRE: 1303-1536

SEQ#1 2028-2246

cPPT: 2247-2363

CMV promoter 2371-2974

TRIM hybrid (SEQ ID N6) 3031-4537

PPGK: 4600-5108

Puror: 5129-5728

WPRE: 5742-6333

3'LTR: 6537-7173

pUC: 7643-8313 reverse

Ampr: 8458-9454 reverse

Плазмида puro CMV Trim-mk (фиг.8), характеризуется:

RSV/5'-LTR гибридный промотор: 1-416

PBS: 418-435

ψ: 467-604

RRE: 1081-1314

SEQ#1 1802-2028

cPPT: 2029-2145

PCMV IE: 2152-2755

TRIM hybrid (SEQ ID N6) 2821-4308

PPGK: 4381-4889

Puror: 4910-5509

WPRE: 5529-6114

3'LTR, с делецией в области U3: 6318-6552

SV40 polyA: 6624-6754

Ampr: 7718-8578

На фиг.9 приведена схема упаковки при использовании набора Lenti-X. Включает следующие стадии: совместная трансфекция векторных плазмид с упаковочными плазмидами, транскрипция и трансляция, узнавание вирусными белками ψ, упаковка и сборка вирусных капсидов, отпочковывание инфекционных, репликационно-некомпетентных вирусов, сбор лентивирусов и заражение клеток-мишеней.

На фиг.10 показана антиВИЧ-активность конструкций, включающих антивирусные агенты - env, TAR, TRIM, Ribozym.

На фиг.11 показана антиВИЧ-активность конструкций, включающих антивирусные агенты - CCR5 si в двух модификациях: shCCR5 и miCCR5.

На фиг.12 показана антиВИЧ-активность конструкций, включающих три, четыре и пять видов антивирусных агентов.

Осуществление изобретения

Примеры осуществления изобретения и реализации назначения

Пример 1. Получение векторов для генетических конструкций

1а. Лентивирусный вектор

Вектор pLVX-puro (доступен от Clontech Cat#632164, Protocol No PT4002-5, Version NO PR782350, дата публикации 28.09.2007) длиной 8102 пар нуклеотидов содержит следующие последовательности:

5'LTR: 1-635

PBS: 636-653

ψ: 685-822

RRE: 1303-1536

cPPT: 2028-2151

PCMV IE: 2185-2788

MCS: 2816-2880

PPGK: 2882-3390

Puror: 3411-4010

WPRE: 4024-4615

3'LTR: 4819-5455

pUC: 5925-6595

Ampr: 6740-7736

С помощью праймеров сРРТ lg Hpa for (TTTGGTTAACCCAGTAAAAACAGTACATACAG) и сРРТ lg Cla Bam rev (TTTTGGATCCATCGATAAATTTTGAATTTTTGTAATTTG), используя в качестве матрицы плазмиду pLP1 (Invitrogen), наработали ПЦР-продукт длиной 370 п.о., который клонировали в вектор pGEM-T vector (Promega). После трансформации и последующей селекции данный фрагмент переклонировали в плазмиду pLV-neo, предварительно гидролизованную по сайтам HpaI и BamHI. Полученную плазмиду нарабатывали в препаративных количествах и резали с использованием эндонуклеаз MfeI и ClaI, a полученный фрагмент длиной 1532 п.о. лигировали в вектор pLVX-Puro, предварительно гидролизованный по этим же сайтам. Полученный после лигирования вектор pLVX-Puro сРРТ lg нарабатывали в препаративных количествах и выделяли из E.coli с помощью набора Axygen. Для последующего удобства клонирования в вектор pLVX-Puro сРРТ lg вместо CMV промотора по сайтам ClaI и EcoRI был введен линкер.

Link For (TTGATATCGATCTGAGTGAGACTCTGACGAATTCTTCT)

Link Rev (AGAAGAATTCGTCAGAGTCTCACTCAGATCGATATCAA).

Полученный вектор pLVX Puro сРРТ lg ΔCMV использовали для последующих процедур клонирования перечисленных последовательностей.

16. Самоинактивирующийся лентивирусный вектор

Плазмида-Вектор pLV-neo длиной 7907 пар нуклеотидов содержит следующие последовательности:

RSV/5'-LTR гибридный промотор: 1-416

PBS: 418-435

ψ: 467-604

RRE:1081-1314

сРРТ: 1810-1928

PCMV IE: 1940-2525

Гистоновый промотор: 2576-2933

Ген устойчивости к неомицину: 2942-3736

WPRE: 3750-4291

3'LTR, с делецией в области U3: 4428-4662

SV40 polyA: 4734-4864

Ampr: 5828-6688

Модификацию pLV-neo последовательностью SEQ ID N1 проводили аналогично предыдущему. С помощью праймеров сРРТ lg Hpa for (TTTGGTTAACCCAGTAAAAACAGTACATACAG) и сРРТ lg Cla Barn rev (TTTTGGATCCATCGATAAATTTTGAATTTTTGTAATTTG), используя в качестве матрицы плазмиду pLP1 (Invitrogen), наработали ПЦР-продукт длиной 370 п.о., который клонировали в вектор pGEM-T vector (Promega). После трансформации и последующей селекции данный фрагмент переклонировали в плазмиду pLV-neo, предварительно гидролизованную по сайтам HpaI и BamHI. Полученная плазмида pLV-neo сРРТ lg содержит последовательность SEQ ID N1 перед областью сРРТ. В плазмиду pLV-neo сРРТ lg вместо CMV промотора ввели линкер, также как в примере 1а, и получили pLV-neo сРРТ lg ΔCMV.

Пример 2. Модификация лентивирусного вектора - получение конструкции без гена PURO с геном-маркером EGFP

ПЦР фрагмент, содержащий ген EGFP и внутренний сайт связывания рибосомы IRES, получен при амплификации плазмиды pIRES-EGFP (Clontech #6064-1) с праймерами RI-ires for GACGGAATTCAGTGGATCCACTAGTAACGGC Sal-egfp rev TTTGTCGACCTTTACTTGTACAGCTCGTCCATGCC. Данный фрагмент встроен в pLVneo вектор по сайтам EcoRI-SalI. Кассета, содержащая сайт IRES и ген EGFP, переклонирована в вектор pLVX-Puro сРРТ lg вместо гена устойчивости к пуромицину по сайтам рестрикции EcoRI-KpnI. Данный вектор вместо селективного гена устойчивости к пуромицину содержит ген зеленого флуоресцентного белка в качестве маркера, позволяющего сортировать клетки по наличию флуоресценции.

Пример 3. Клонирование последовательности, кодирующей короткую шпилечную РНК, направленную против CCR5 гена в вектор

Наложением пары праймеров CCR5-2 for (TTTCAGATCTGTGTCAAGTCCAATCTATGACATCAATTATATGTGAATTGATGTCAT) и CCR5-2 rev (CAACAAGCTTCTAGAAAAAAAGTGTCAAGTCCAATCTATGACATCAATTCACATATA) наработали продукт длиной 93 п.о., который клонировали в pGEM-T Easy вектор (Promega). Далее последовательность CCR5 si клонировали под промотор U6 в плазмиду pRNA-U6.1/Neo/ (Genscript), предварительно гидролизованную по сайтам BamHI и HindIII. Затем фрагмент pU6-CCR5 shRNA длиной 490 п.о. переклонировали в модифицированную плазмиду pLVX Puro cPPTIg ΔCMV с использованием эндонуклеаз рестрикции EcoRI и XbaI. Полученную конструкцию Puro U6-CCR5 проверили рестриктным анализом и секвенированием, далее наработали в препаративных количествах в E.coli и выделили с использованием QIAGEN plasmid maxi kit.

Пример 4. Клонирование последовательности, кодирующей короткую шпилечную РНК, направленную против CCR5 гена в самоинактивирующийся вектор

Плазмиду Puro U6-CCR5 рестрицировали по сайтам рестрикции Kpn и Mfe, и фрагмент содержащий ген устойчивости к пуромицину, и CCR5 si конструкцию вырезали из геля. Вектор pLV-neo cPPT lg ΔCMV рестрицировали по тем же сайтам и лигировали с фрагментом Puro U6-CCR5. Полученную конструкцию SIV U6-CCR5 проверили рестриктным анализом и секвенированием, далее наработали в препаративных количествах в E.coli и выделили с использованием QIAGEN plasmid maxi kit.

Пример 5. Клонирование последовательности, кодирующей микроРНК, направленную против CCR5 гена в вектор

Нуклеотидную последовательность микроРНК человека miR155 SEQ ID 7 использовали для создания искусственных микроРНК: SEQ ID 8, SEQ ID 9 или SEQ ID 10, направленных против гена рецептора CCR5 (miCCR5).

Праймеры O1-1 TGCTGTAAGAGGTAGTTTCTGAACGTTTTG и O3-1 GTGGCCAAAACGTTCAGAAACTACCTCTTAC отжигали друг на друга с получением короткого двухцепочечного олига olig1-3 с липкими концами. Аналогично отжигали праймеры O2-1 GCCACTGACTGACGTTCAGAATACCTCTTA и O4-1 CCTGTAAGAGGTATTCTGAACGTCAGTCA с получением двухцепочечного олига olig2-4. Смесь, состоящую из плазмиды pcDNA6.2-GW/miR (набор Block-iT PolII miR RNA expression Vector Kit, Invitrogen) и двух олигов oligl-3 и olig2-4, лигировали в течение 1 часа при комнатной температуре в соответствии с инструкцией из набора.

Лигазную смесь трансформировали в клетки E.Coli, выросшие клоны отбирали по сиквенсу. Трансформанты, содержащие искомую плазмиду, наращивали и выделяли ДНК плазмиды miR-CCR5-1. Фрагмент, содержащий микроРНК (SEQ ID 7), вырезали из плазмиды по сайтам рестрикции SalI-BglII. Вектор pLVX Puro cPPTIg рестрицировали ферментами XhoI-BamHI и лигировали с фрагментом, содержащим микроРНК. Полученную конструкцию Puro/ miR-CCR5-1 проверяли рестрикционным анализом и секвенировали. Для трансфекции нарабатывали в препаративных количествах в E.coli и выделяли с использованием QIAGEN plasmid maxi kit.

Аналогично получали конструкции, содержащие miRNA SEQ ID 8 или SEQ ID 9.

Пример 6. Клонирование Env антисенс последовательности в вектор

Используя в качестве матрицы кДНК изолята вируса иммунодефицита человека типа А с парой праймеров envA for (TTTCTAGACCAGTAGCAATATAACAACTG) и envA rev (TTTCCCGGGTTGCTGCTATTATTTCCACT), наработали ПЦР продукт длиной 967 п.о., который клонировали в pGEM-T Easy вектор (Promega), без предварительной ферментативной обработки ДНК. После бело-голубой селекции и скрининга ПЦР-продукт был клонирован по сайтам XmaI и Xba I в вектор без CMV промотора pLVX-Puro cPPTIg ΔCMV. Полученную конструкцию Puro Env А нарабатывали в препаративных количествах в E.coli и выделяли с помощью набора QIAGEN plasmid maxi.

Пример 7. Клонирование последовательности TAR в вектор

Наложением пары праймеров U16-1 for (CAATGATGTCGTAATTTGCGTCTTACTCTGTTCTCAGCGACACC) и TAR2 rev (CGAGAGCTCCCAGGCTCAGATCGTGGTGTCGCTGAGAACAGAG) был наработан фрагмент длиной 68 п.о., который затем амплифицировали с праймерами U16 Bgl for (TCACCAGATCTCTTGCAATGATGTCGTAATTTGCG) и TAR short rev (CACCACGAGAGCTCCCAGGCTCAGATCGTGGTG).

Наложением пары праймеров TAR2 for (GCCTGGGAGCTCTCGTGGTGTCAGTAAGCTGGTACAGAAGGTTG) и U16 rev (TTCTTGCTCAGTAAGAATTTTCGTCAACCTTCTGTACCAGCTTAC) наработали продукт длиной 71 п.о. Смесь двух фрагментов 68 и 71 п.о. амплифицировали с получением продукта 132 п.о. Используя его в качестве матрицы, наработали фрагмент длиной 157 п.о с праймерами TAR short for (TGAGCCTGGGAGCTCTCGTGGTGTC) и U16 Xba Hind rev (CACCAAGCTTCTAGAAAAAATTTCTTGCTCAGTAAGAATTTTCG).

Продукт длиной 157 п.о. клонировали в pGEM-T Easy вектор (Promega). Далее этот фрагмент переклонировали под промотор U6.1 в плазмиду pRNA-U6.1/Neo (Genscript) с использованием рестриктаз Bam H1 и HindIII. Полученную плазмиду pRNA U6-TAR гидролизовали по сайтам EcoRI и XbaI и фрагмент длиной 490 п.о. лигировали в модифицированный вектор pLVX Puro cPPT lg ΔCMV. Готовую плазмиду Puro U6-TAR нарабатывали в препаративных количествах в E.coli и выделяли с помощью набора QIAGEN plasmid maxi kit.

Пример 8 Клонирование последовательности TAR в самоинактивирующийся вектор

Клонирование проводили аналогично клонированию SIV U6-CCR5 (пример 4).

Пример 9. Клонирование рибозима в вектор

С помощью пары праймеров U16-Rz-1 for (CTTGCAATGATGTCGTAATTTGCGTCTTACTCTGTTCTCAGCGACAGTTGAAA) и U16 Rz-2 rev (TTTCGAGCTTTCGAAAACTCATCAGAATGTGCTTTCAACTGTCGCTGAGAAC), и пары праймеров U16 Rz-3 for (CTGATGAGTTTTCGAAAGCTCGAAAAAACCTGCTGTCAGTAAGCTGGTACAGAAG) и U16 Rz-4 rev (TTTCTTGCTCAGTAAGAATTTTCGTCAACCTTCTGTACCAGCTTACTGAC) амплифицировали два фрагмента длиной 81 и 86 п.о. соответственно. Смесь этих фрагментов амплифицировали с получением продукта длиной 143 п.о. С помощью праймеров U16 Bgl for (TCACCAGATCTCTTGCAATGATGTCGTAATTTGCG) и U16 Xba Hind rev (CACCAAGCTTCTAGAAAAAATTTCTTGCTCAGTAAGAATTTTCG) на матрице предыдущего фрагмента получили продукт длиной 174 п.о., который лигировали в pGEM-T Easy вектор (Promega). Затем фрагмент был переклонирован по сайтам BglII и Hind в вектор pRNA-U6.1/Neo (Genscript), предварительно гидролизованный по этим же сайтам. Рестрикцией получившейся плазмиды по сайтам EcoRI и XbaI получали фрагмент 488 п.о. Очищенный продукт рестрикции клонировали в модифицированный вектор pLVX Puro cPPT lg ΔCMV.

Полученная плазмида - pLVX Puro cPPT lg ΔCMV-U61-Rz

Пример 10. Клонирование модифицированного гена человека TRIM5α в вектор

кДНК, наработанную из клеточной линии HL-60, амплифицировали с помощью двух пар праймеров TRIM1 hum for (CATCAGGGAAACATTACTGGG) и TRIM1 hum rev (GGGGCTGAGTGTGTAAGAAGG), TRIM2 hum for (AACAAGAGGAACCTCAGCAGC) и TRIM2 hum rev (CATACCCCCAGGATCCAAGC) фрагменты гена TRIM длиной 441 п.о. и 1179 п.о. соответственно. ПЦР-продукты были клонированы в pGEM-T Easy вектор, и после селекции и скрининга несколько клонов для каждого фрагмента были отсеквенированы. Проведены три раунда амплификации короткого фрагмента 441 п.о. со следующими праймерами:

1-й раунд

TRIM2-1 monk for (CCCAGCCTGACCAATTTCAATTATTGTACTGGCATCC)

TRIM rev (TCAAGAGCTTGGTGAGCACAGA)

2-й раунд TRIM2-2 mk for (CTGTTCACCTTCCCCAGCCTGACCAATTTCAA) TRIM rev (TCAAGAGCTTGGTGAGCACAGA)

3-й раунд TRIM2-3 mk for (GCCCCCGGGACCCTGTTCACCTTCCCCAGCC)

TRIM Xba rev (TTTTTCTAGATCAAGAGCTTGGTGAGCACAGA)

Полученный ампликон 508 п.о. клонировали в pGEM-T Easy вектор (Promega), так чтобы Xba сайт оказался со стороны Т7 промотора (плазмида pT-TR monk2).

Длинный фрагмент гена TRIM 1179 п.о. амплифицировали с праймерами

TRIM koz for (GCCGCCACCATGGCTTCTGGAATCCTGG)

TRIM1-1 monk rev (TCCCGGGGGCCTGATATATTATCTGTGGTTTCGGAG), клонировали в pGEM-T Easy вектор и отобрали ориентацию, при которой Xma сайт находился со стороны Т7 промотора (плазмида pT-TR monk1).

Фрагмент плазмиды pT-TR monk1, полученный рестрикцией по сайтам Nsi и Xma, лигировали с фрагментом плазмиды pT-TR monk2, гидролизованной по тем же сайтам - получили плазмиду pT-TR monk. Рестрикцией этой плазмиды по сайтам ApaI и SalI получили фрагмент 1576 п.о., который клонировали в вектор pLVX-Puro cPPT long по сайтам ApaI и XhoI. Полученная плазмида - pLVX-Puro cPPT Ig-TKmonk

Пример 11. Клонирование модифицированного гена человека TRIM5α в самоинактивирующийся вектор

Плазмиды - pLVX-Puro cPPT Ig-TKmonk и pLV-neo cPPT lg ΔCMV рестрицировали по Kpn и Bam. Фрагменты лигировали и трансформировали клетки E.coli. Отбирали трансформанты со вставкой. Был получен самоинактивирующийся вектор SIV TRIM monk, содержащий последовательность, кодирующую модифицированный белок TRIM5α человека.

Пример 12. Получение конструкции, содержащей одновременно модифицированный ТММ 5α и микроРНК против CCR5

Плазмиду pT-TR monk из предыдущего примера модифицировали добавлением линкера между сайтами рестрикции SacII и AatII. Для получения линкера праймеры Linker 2 for ggctcgagcacagttaacggtaccgaattcgctagctctagacgt и Linker 2 rev ctagagctagcgaattcggtaccgttaactgtgctcgagccgc отжигали друг на друга. Плазмиду pT-TR monk рестрицировали по SacII и AatII и лигировали с линкером. Лигазную смесь трансформировали в Е.Coli, транформанты анализировали секвенированием. Плазмиду pT-TR monk-link рестрицировали по XhoI-Hpa сайтам. Плазмиду miR-CCR5-l резали по BglII и достраивали липкий конец при помощи фрагмента Кленова. Затем miR-CCR5-1/ BglII рестрицировали SalI ферментом, вырезали фрагмент 154 п.о. из геля и лигировали с pT-TR monk-link/ XhoI-Hpa. Полученную плазмиду pT-TR monk-miRCCR рестрицировали по сайтам ApaI и SalI, вырезали фрагмент 1731 п.о., который клонировали в вектор pLVX-Puro cPPT lg по сайтам ApaI и XhoI. Полученая плазмида Puro Trim-miR ccR содержит TRIM5α и микроРНК против CCR5 гена.

Пример 13. Получение конструкции, содержащей одновременно модифицированный TRIM 5α, микроРНК против CCR5, последовательность TAR и рибозим.

Плазмиду pRNA U6-TAR гидролизовали по сайтам EcoRI и XbaI и фрагмент длиной 490 п.о. лигировали в вектор pT-TR monk-miRCCR по тем же сайтам рестрикции. Полученную конструкцию pT-TR mk-miRCCR-TAR гидролизовали по AatII и затупляли концы ферментом Кленова, затем резали по XbaI.

Рестрикцией плазмиды pRNA H1-Rz по сайтам SmaI и XbaI получали фрагмент 386 п.о. Очищенный продукт рестрикции клонировали в приготовленный вектор pT-TR mk-miRCCR-TAR/ AatII- XbaI. Полученную плазмиду pT-TR mk-miRCCR-TAR-Rz рестрицировали по сайтам ApaI и SalI, вырезали фрагмент 2667 п.о., который клонировали в вектор pLVX-Puro cPPT long по сайтам ApaI и XhoI. Полученная плазмида Puro Trim-miR ccR-TAR-Rz содержит TRIM5α, микроРНК против CCR5 гена, последовательность TAR и рибозим.

Пример 14. Получение конструкции, содержащей одновременно 5 противовирусных агентов: модифицированный TRIM5α, микроРНК против CCR5, последовательность TAR, рибозим и ENV антисмысловую последовательность.

Используя в качестве матрицы pLVX-Puro cPPTlg dCMV Env А с парой праймеров envACla for (TTATCGATACCAGTAGCAATATAACAACTG) и envACla rev (TTTATCGATTGCTGCTATTATTTCCACT) наработали ПЦР продукт длиной 969 п.о., который клонировали по ClaI сайту рестрикции в вектор Puro Trim-miR ccR-TAR-Rz, гидролизованный по ClaI. Для отбора трансформатов, содержащих вставку в нужном направлении, использовали ПЦР анализ. Полученную конструкцию (Puro penta vector) нарабатывали в препаративных количествах в E.coli и выделяли с помощью набора QIAGEN plasmid maxi.

Из каждой полученной плазмиды получали вирусные частицы, согласно методике, описанной в нижеследующих примерах.

Пример 15. Трансфекция упаковочных клеток и получение лентивирусных частиц

Для получения лентивирусов использовали клеточную линию НЕК 293Т и набор упаковочных плазмид Lenti-X HT Packaging Mix (Clontech). Среда для роста HEK 293Т представляет собой: Dulbecco's Modified Eagle's Medium (DMEM), содержащая 4 милимоль L-глутамина, 4,5 г/л глюкозы, 1 милимоль натрия пирувата, 1,5 г/л натрия бикарбоната и 10% эмбриональной бычьей сыворотки. Такой уровень натрия бикарбоната (NaHCO3; 1,5 г/л) используется в инкубаторах, содержащих 5% СО2.

За день до трансфекции 4-5*106 клеток вносили на чашку 100 мм в 10 мл полной среды, содержащей сыворотку свободную от тетрациклина (Tet System Approved FBS Clontech Cat# 631106). В день трансфекции в 15 мл пробирке смешивали 15 мкл смеси Lenti-X HT Packaging Mix и векторную ДНК 3 мкг. Затем в пробирку добавляли 1 мл среды OptiMEM (Invitrogen) и 20 мкл реагента для трансфекции Turbofect (Fermentas). Смесь инкубировали 20 минут при комнатной температуре. Во время инкубации клеточную среду заменяли на 10 мл среды OptiMEM, содержащей 10% сыворотки, свободной от тетрациклина. После окончания инкубации смесь плазмид, OptiMEM и Turbofect по каплям добавляли в клеточную среду. Клетки инкубировали в течение ночи при 37°C в CO2-инкубаторе. На следующий день удаляли среду, содержащую комплекс ДНК-Turbofect, и заменяли на 10 мл культуральной среды, содержащей сыворотку, свободную от тетрациклина. Клетки инкубировали при 37°C в CO2-инкубаторе 48-72 часа. Отбирали супернатант, содержащий лентивирусные частицы. Супернатант центрифугировали при 3000 об/мин в течение 15 минут при +4°C. Фильтровали супернатант через 0,45 мкм. Готовый препарат хранили при -80°C.

Для получения самоинактивирующихся лентивирусных частиц использовали конструкции на основе самоинактивирующегося вектора и набор упаковочных плазмид ViraPower Packaging Mix (Invitrogen). Трансфекция клеток проводилась аналогично, сыворотку свободную от тетрациклина, заменяли на сыворотку Invitrogen.

Пример 16. Определение титра вируса

За день до трансдукции (1 день) фибробласты (приблизительно 2×105 клеток на лунку) помещали в плашку и инкубировали в течение ночи при 37°C в CO2-инкубаторе. На следующий день (2 день) размораживали лентивирусный сток и выполняли последовательные 10-кратные разведения от 10-2 до 10-6. Для каждого разведения доводили объем до 1 мл культуральной средой. Удаляли из клеток среду и добавляли каждое разведение вируса в свою лунку (в объеме 1 мл). Инкубировали в течение ночи при 37°C в CO2-инкубаторе.

На следующий день (3 день) удаляли среду, содержащую вирус, и заменяли на 2 мл культуральной среды. Инкубировали в течение ночи при 37°C в CO2-инкубаторе.

4 день: обрабатывали клетки антибиотиком пуромицином. Удаляли среду, заменяли на среду, содержащую 2 мкг/мл пуромицина. Заменяли среду, содержащую антибиотик, каждые 3-4 дня.

Через 7-10 дней селекции удаляли среду и отмывали клетки PBS 2 раза. Добавляли раствор crystal violet и инкубировали 10 минут при комнатной температуре. Отмывали клетки PBS 2 раза. Подсчитывали синие колонии и определяли титр вирусного стока.

Пример 17. Трансдукция МТ-4 клеток

Наращивали клетки в культуральной среде RPMI+10% FBS до концентрации 0,5×106 клеток на мл. В первый день размораживали лентивирусный сток и развовдили в свежей культуральной среде до необходимого MOI. К 3 мл суспензии клеток с концентрацией 0,5×106 кл/мл добавляли 1,5×106 вирусных частиц в 2 мл культуральной среды +5 мкл полибрен 4 мг/мл.

Инкубировали в течение ночи при 37°C в CO2-инкубаторе.

На следующий день (день 2) центрифугировали клетки, удаляли среду, содержащую вирус, и заменяли ее на свежую культуральную среду. Инкубировали в течение ночи при 37°C в CO2-инкубаторе.

На 3 день в среду добавляли антибиотик для селекции трансдуцированных клеток. Меняли среду на свежую с антибиотиком каждые 3-4 дня.

Клетки, устойчивые к пуромицину, наращивали до титра 0,9×106. Далее клетки были использованы для тестирования на устойчивость к заражению вирусом ВИЧ.

Пример 18. Оценка эффективности

Методика:

Суспензию модифицированных клеток МТ-4 делили на два культуральных сосуда и разводили до концентрации 5*105 клеток на мл. Одну часть клеток инфицировали вирусом иммунодефицита человека (из коллекции штаммов вирусов иммунодефицита человека ГУ НИИВС им. И.И.Мечникова, РАМН) для определения противовирусной активности, другая служила контролем цитотоксичности препарата. Клетки культивировали параллельно.

Клетки инфицировали вирусом со множественностью заражения 0,01 инфекционных единиц на клетку. Инкубировали культуры клеток при 37C° в течение 1 часа и дважды отмывали. После этого к культуре клеток добавляли питательную среду RPMI-1640 (конечная концентрация клеток 400000 клеток/мл). Далее смена среды производилась на 2, 4, 8, 12, 15 и 19 день культивирования. При смене среды старая среда полностью удалялась, клетки отмывались свежей средой RPMI-1640 без сыворотки, после чего добавлялась свежая питательная среда (конечная концентрация клеток 400000 клеток/мл). Учет результатов противовирусной активности производили по жизнеспособности клеток, путем окрашивания клеток красителем трипановым синим. Методом иммуноферментного анализа с использованием коммерческого иммуноферментного набора фирмы Биорад, Органон Техника (Нидерланды) проводили определение количества р24 антигена (ng/ml) в культуральной жидкости, согласно инструкции изготовителя. Результаты учитывали с помощью фотометра "Multiscan" при длине волны 630 нм.

Дополнительными контролями эксперимента служили не модифицированные клетки МТ-4, инфицированные и не инфицированные вирусом.

Результаты исследования

В опыте параллельно исследовали устойчивость клеток, модифицированных следующими векторами: Puro Env A, Puro U6-TAR, Puro U6-Rz и Puro CMV TRIM. В качестве контроля использовали клетки, модифицированные вектором без вставки, и немодифицированные клетки. Результаты представлены в таблице 2 и на фиг.8.

На 8-й и 12-й дни количество р24 антигена в культурах клеток, модифицированных генетическими конструкциями, меньше, чем в контрольных клетках, что говорит о подавлении репродукции ВИЧ (в разной степени разными конструкциями). При дальнейшем культивировании клеток титр антигена в контрольных клетках снижался, что объясняется гибелью клеток и, как следствие, истощением вирусной популяции. Клетки, несущие конструкцию, сохраняли жизнеспособность до конца эксперимента (23-й день). Таким образом, показано, что все исследуемые конструкции эффективны (наиболее эффективными оказались конструкции Puro EnvA и Puro CMV TRIM).

Таблица 3
Накопление р24 антигена в клетках МТ-4 ng/ml
День после инфицирования МТ-4 Пустой вектор ENV TAR Ribozym Trim
4 561,7 63,3 34,4 108,8 185,4 54,4
8 408,5 398,5 64,4 137,6 216,5 64,4
12 297,5 991,2 30,0 129,9 308,6 95,5
15 118,8 418,5 27,8 159,8 381,8 103,2
19 13,3 234,2 17,8 183,2 331,9 79,9
23 17,8 53,3 20,0 190,9 417,4 83,3

Таким образом, показано, что все исследуемые конструкции эффективны (наиболее эффективными оказались конструкции Puro Env А и Puro CMV TRIM).

Исследование эффективности конструкций, содержащих комбинацию антивирусных агентов на клетках МТ-4

Эффективность двойных конструкций оценивали по проценту подавления репликации ВИЧ на 8-й день инфицирования. Для этого вычисляли процентное отношение количества р24 антигена в культуре опытных клеток к количеству р24 в культуре контрольных клеток МТ4. Ингибирование вычисляли по формуле:

(1-р24опыт/р24контроль)*100%.

Составлена матрица эффективности двойных конструкций:

Таблица 4
Процент ингибирования ВИЧ на 8 день в клетках МТ-4 для генетических конструкций на основе pLVX, содержащих двойные комбинации:
miRNACCR5 sh CCR5 TAR Ribozim a/s env TRIM5α
miRNACCR5 **83,6% * 89,2% 85,4% 94,1% 93,8%
sh CCR5 * **62,3% * 68,8% 95,1% 90,9%
TAR **б6,3% 72,4% 88,4% 87,4%
Ribozim **47,0% 86,5% 85,9%
a/s env **84,2% 92,4%
TRIM5a **84,2%
Значения ** - для конструкций, включающих один антивирусный агент.
* - не оценивали

Таким образом, показан синергетический эффект конструкций, включающих комбинации антивирусных агентов.

Таблица 5
Процент ингибирования ВИЧ на 8 день в клетках МТ-4 для генетических конструкций на основе самоинактивирующегося лентивирусного вектора, содержащих двойные комбинации:
miRNACCR5 sh CCR5 TAR Ribozim a/s env TRIM5α
miRNACCR5 **74,1% * 87,3% 82,9% 81,6% 95,3%
sh CCR5 * **59,8% 78,1% 83,7% 88,5% 94,8%
TAR **66,7% 68,8% 82,8% 91.0%
Ribozim **45,7% 88,4% 88,9%
a/s env **69,2% 94,2%
TRIM5a **84,1%
Значения ** - для конструкций, включающих один антивирусный агент.
* - не оценивали

Таким образом, показан синергетический эффект конструкций, включающих комбинации антивирусных агентов.

В следующем опыте параллельно исследовались конструкции, содержащие: одновременно: 1) модифицированный TRIM5α и микроРНК против CCR5 (плазмида Puro Trim-miR ccR), 2) модифицированный TRIM5α, микроРНК против CCR5, последовательность TAR и рибозим (Puro Trim-miR ccR-TAR-Rz) и 3) 5 противовирусных агентов: модифицированный TRIM5α, микроРНК против CCR5, последовательность TAR, рибозим и ENV антисмысловую последовательность (Puro penta vector). В качестве контроля был использован вектор без вставки. Полученные данные приведены в таблице 4 и на фиг.10. Из результатов видно, что конструкция, содержащая 5 элементов, наиболее эффективна и ее антивирусная активность ≥99%.

Таблица 6
Накопление р24 антигена в клетках МТ-4 ng/ml
День после инфицирования Вектор без вставки Puro Trim-miR ccR Puro Trim-miR ccR-TAR-Rz Puro penta vector
4 52,4 8,37 2,82 0,37
8 211 13,0 4,28 0,19
12 257 15,8 1,91 0,65
15 69,9 11,1 2,73 0,47
19 62,5 16,7 0,82 0,37
23 44,1 9,30 0,36 0,47

Таким образом, настоящими экспериментальными данными продемонстрировано, что конструкции, включающие один генетический антивирусный агент, обладали противовирусной активностью, конструкции, содержащие комбинацию из двух и более агентов, проявляли более сильные противовирусные свойства, демонстрируя синергетический эффект, при этом показано, что комбинации из пяти антивирусных агентов наиболее эффективны.

1. Генетическая конструкция для антиВИЧ-терапии, в которой в качестве вектора используется лентивирусный вектор на основе ВИЧ-1, модифицированный последовательностью SEQ ID N1 перед областью сРРТ, и которая включает по меньшей мере одну из следующих последовательностей:
последовательность, выбранную из SEQ ID N 2, 8, 9, 10, экспрессия которой приводит к образованию короткой интерферирующей РНК, направленной против гена рецептора человека CCR5 (CCR5 si),
последовательность SEQ ID N4, кодирующую РНК шпильку, аналогичную TAR-последовательности (TAR),
последовательность SEQ ID N5, кодирующую рибозим, направленный против консервативных участков вируса иммунодефицита человека (Ribozim),
антисмысловую последовательность к участку гена env ВИЧ SEQ ID N3 (a/s env),
последовательность, кодирующую модифицированный белок TRIM5α человека SEQ ID N 11 (TRIM5a).

2. Конструкция по п.1, где по меньшей мере одна из последовательностей:
TAR, CCR5 si, Ribozim, находится под контролем промотора РНК полимеразы III;
и/или по меньшей мере одна из последовательностей: TRIM5α, a/s env, CCR5 si, выбранная из SEQ ID N 8, 9, 10, находится под контролем промотора РНК полимеразы II;
и/или последовательность TRIM5α находится под контролем конститутивного, тканеспецифичного или индуцибельного промотора, неограничивающими примерами которого являются CMV, PGK, EFα, UbC, промотор генов МНС класса II, промотор гена Т-клеточного рецептора, промотор гена β-интерферона, промотор гена IL2, промотор гена рецептора IL2 или тетрациклинзависимый промотор.;
и/или перед последовательностью a/s env и/или CCR5 si промотор может отсутствовать.

3. Конструкция по п.1, где последовательности CCR5 si, TAR, Ribozim, a/s env, TRIM5α могут быть в прямом или обратном направлении по отношению к вектору.

4. Конструкция по п.1, дополнительно включающая молекулярный маркер, представляющий собой ген устойчивости к пуромицину, ген зеленого флюоресцентного белка или другую последовательность для селекции и/или мониторинга модифицированных клеток.

5. Конструкция по п.1, или п.2, или п.3, или п.4, где лентивирусный вектор на основе ВИЧ-1 включает по меньшей мере следующие области:
5'-LTR и 3'LTR,
участок связывания специфической тРНК (PBS),
упаковочный сигнал (ψ),
rev-отвечающий элемент (RRE),
посттранскрипционный регуляторный элемент вируса гепатита
североамериканского лесного сурка (WPRE),
последовательность SEQ ID N1,
область сРРТ.

6. Генетическая конструкция для антиВИЧ-терапии, в которой в качестве вектора используется самоинактивирующийся лентивирусный вектор на основе ВИЧ-1, модифицированный последовательностью SEQ ID N1 перед областью сРРТ, и которая включает по меньшей мере одну из следующих последовательностей:
последовательность, выбранную из SEQ ID N 2, 8, 9, 10, экспрессия которой приводит к образованию короткой интерферирующей РНК, направленной против гена рецептора человека CCR5 (CCR5 si),
последовательность SEQ ID N4, кодирующую РНК шпильку, аналогичную TAR-последовательности (TAR),
последовательность SEQ ID N5, кодирующую рибозим, направленный против консервативных участков вируса иммунодефицита человека (Ribozim),
антисмысловую последовательность к участку гена env ВИЧ SEQ ID N3 (a/s env),
последовательность, кодирующую модифицированный белок TRIM 5α человека SEQ ID N 11 (TRIM5α).

7. Конструкция по п.6, где по меньшей мере одна из последовательностей: TAR, CCR5 si, Ribozim находится под контролем промотора РНК полимеразы III;
и/или по меньшей мере одна из последовательностей: TRIM5α, a/s env, CCR5 si, выбранная из SEQ ID N 8, 9, 10, находится под контролем промотора РНК полимеразы II;
и/или последовательность TRIM5α находится под контролем конститутивного, тканеспецифичного или индуцибельного промотора, неограничивающими примерами которого являются CMV, PGK, EFα, UbC, промотор генов МНС класса II, промотор гена Т-клеточного рецептора, промотор гена β-интерферона, промотор гена IL2, промотор гена рецептора IL2 или тетрациклинзависимый промотор;
и/или перед последовательностью a/s env и/или CCR5 si промотор может отсутствовать.

8. Конструкция по п.6, где последовательности CCR5 si, TAR, Ribozim, a/s env, TRIM5α могут быть в прямом или обратном направлении по отношению к вектору.

9. Конструкция по п.6, дополнительно включающая молекулярный маркер, представляющий собой ген устойчивости к пуромицину, ген зеленого флюоресцентного белка или другую последовательность для селекции и/или мониторинга модифицированных клеток.

10. Конструкция по п.6, или 7, или 8, или 9, где самоинактивирующийся лентивирусный вектор на основе ВИЧ-1 включает, по меньшей мере, следующие области:
RSV/5'-LTR гибридный промотор,
3'LTR, с делецией в области U3,
участок связывания специфической тРНК (PBS),
упаковочный сигнал (ψ),
rev-отвечающий элемент (RRE),
посттранскрипционный регуляторный элемент вируса гепатита североамериканского лесного сурка (WPRE),
последовательность SEQ ID N1,
область сРРТ.

11. Генетическая конструкция для анти-ВИЧ терапии на основе лентивирусного вектора, включающая по меньшей мере одну из следующих последовательностей:
последовательность, выбранную из SEQ ID N 8, 9, 10, кодирующую искусственную микро РНК, которая ингибирует экспрессию гена рецептора человека CCR5 (miRNA CCR5), последовательность SEQ ID N5, кодирующую рибозим, направленный против консервативных участков в области R/U5 LTR и в области гена роl вируса иммунодефицита человека (Ribozim),
антисмысловую последовательность к участку гена env ВИЧ SEQ ID N3 (a/s env).

12. Конструкция по п.11, дополнительно включающая последовательность SEQ ID N4, кодирующую РНК шпильку, аналогичную TAR-последовательности (TAR) и/или последовательность, кодирующую модифицированный белок TRIM5α человека SEQ ID N 11 (TRIM5α).

13. Конструкция по п.11, где лентивирусный вектор создан на основе одного или нескольких лентивирусов: ВИЧ-1, ВИЧ-2, ВИО, вируса иммунодефицита крупного рогатого скота, лентивируса артрита-энцефалита коз, вируса инфекционной анемии лошадей, вируса иммунодефицита кошек и/или вируса болезни Джембрана.

14. Генетическая конструкция для анти-ВИЧ терапии, в которой в качестве вектора используется лентивирусный вектор на основе ВИЧ-1, модифицированный последовательностью SEQ ID N1 перед областью сРРТ, включающая по меньшей мере одну из следующих последовательностей:
последовательность, экспрессия которой приводит к образованию короткой интерферирующей РНК, направленной против гена рецептора человека CCR5 (CCR5 si), выбранную из короткой РНК шпильки (sh CCR5) или искусственной микро РНК (miRNA CCR5), последовательность, кодирующую РНК шпильку, аналогичную TAR-последовательности (TAR),
последовательность, кодирующую рибозим, направленный против консервативных участков в области R/U5 LTR и в области гена роl вируса иммунодефицита человека (Ribozim),
антисмысловую последовательность к участку гена env ВИЧ (a/s env), полученную из кДНК изолята вируса иммунодефицита человека субтипа А,
последовательность, кодирующую модифицированный белок TRIM5α человека, где модификация включает изменение аминокислотной последовательности TRIM5α в области SPRY домена, которое обеспечивает распознавание белком TRIM5α вирусного капсида ВИЧ.

15. Конструкция по п.14, где по меньшей мере одна из последовательностей: TAR, sh CCR5, Ribozim, находится под контролем промотора РНК полимеразы III;
и/или по меньшей мере одна из последовательностей: TRIM5α, a/s env, miRNA CCR5, находится под контролем промотора РНК полимеразы II;
и/или последовательность TRIM5α находится под контролем конститутивного, тканеспецифичного или индуцибельного промотора, неограничивающими примерами которого являются CMV, PGK, EFα, UbC, промотор генов МНС класса II, промотор гена Т-клеточного рецептора, промотор гена β-интерферона, промотор гена IL2, промотор гена рецептора IL2 или тетрациклин зависимый промотор и/или перед последовательностью a/s env и/или CCR5 si промотор может отсутствовать.

16. Конструкция по п.14 или п.15, где лентивирусный вектор представляет собой самоинактивирующийся лентивирусный вектор.

17. Генетическая конструкция для анти-ВИЧ терапии, которая включает векторную последовательность, обеспечивающую встраивание ДНК последовательностей в геном клетки человека, и любую комбинацию из двух, трех, четырех или все из следующих последовательностей:
последовательность, экспрессия которой приводит к образованию короткой интерферирующей РНК, направленной против гена рецептора человека CCR5 (CCR5 si), выбранную из короткой РНК шпильки (sh CCR5) или искусственной микро РНК (miRNA CCR5),
последовательность, кодирующую РНК шпильку, аналогичную TAR-последовательности (TAR),
последовательность, кодирующую рибозим, направленный против консервативных участков в области R/U5 LTR и в области гена роl вируса иммунодефицита человека (Ribozim),
антисмысловую последовательность к участку гена env ВИЧ (a/s env), последовательность, кодирующую модифицированный белок TRIM5α человека, где модификация включает изменение аминокислотной последовательности TRIM5α в области SPRY домена, которое обеспечивает распознавание белком TRIM5α вирусного капсида ВИЧ (TRIM5α),
исключая случай, когда комбинация представляет собой комбинацию из sh CCR5, TAR, TRIM5α.

18. Конструкция по п.17, где по меньшей мере одна из последовательностей: TAR, sh CCR5, Ribozim, находится под контролем промотора РНК полимеразы III;
и/или по меньшей мере одна из последовательностей: TRIM5α, a/s env, miRNA CCR5, находится под контролем промотора РНК полимеразы II;
и/или последовательность TRIM5α находится под контролем конститутивного, тканеспецифичного или индуцибельного промотора, неограничивающими примерами которого являются CMV, PGK, EFα, UbC, промотор генов МНС класса II, промотор гена Т-клеточного рецептора, промотор гена β-интерферона, промотор гена IL2, промотор гена рецептора IL2 или тетрациклин зависимый промотор и/или перед последовательностью a/s env и/или CCR5 si промотор может отсутствовать.

19. Конструкция по п.17 или п.18, где в качестве векторной последовательности используется лентивирусный вектор, созданный на основе одного или нескольких из лентивирусов: ВИЧ-1, ВИЧ-2, ВИО, вирус иммунодефицита крупного рогатого скота, лентивирус артрита-энцефалита коз, вирус инфекционной анемии лошадей, вирус иммунодефицита кошек, и/или вирус болезни Джембрана.

20. Конструкция по п.17, где в качестве вектора используется вектор, созданный на основе спумавируса, или невирусный вектор.

21. Конструкция по п.17 или 20, где в качестве вектора используется невирусный вектор, созданный на основе векторной системы транспозон/транспозаза.

22. Генетическая конструкция для анти-ВИЧ терапии, которая включает векторную последовательность, обеспечивающую встраивание ДНК последовательностей в геном клетки человека, и по меньшей мере одну из следующих последовательностей:
антисмысловую последовательность к участку гена env ВИЧ (a/s env), полученную из кДНК изолята вируса иммунодефицита человека субтипа А,
последовательность, кодирующую рибозим, направленный против консервативных участков в области R/U5 LTR и в области гена роl вируса иммунодефицита человека (Ribozim),
последовательность, кодирующую искусственную микро РНК, которая ингибирует экспрессию гена рецептора человека CCR5 (miRNA CCR5).

23. Конструкция по п.22, дополнительно включающая последовательность, кодирующую РНК шпильку, аналогичную TAR-последовательности (TAR), и/или последовательность, кодирующую модифицированный белок TRIM5α человека (TRIM5α).

24. Конструкция по п.22, где используется лентивирусный вектор на основе одного или нескольких из лентивирусов: ВИЧ-1, ВИЧ-2, ВИО, вирус иммунодефицита крупного рогатого скота, лентивирус артрита-энцефалита коз, вирус инфекционной анемии лошадей, вирус иммунодефицита кошек, и/или вирус болезни Джембрана, или в качестве вектора используется вектор, созданный на основе спумавируса или невирусный вектор.

25. Конструкция по п.22 или 24, где в качестве вектора используется невирусный вектор, созданный на основе векторной системы транспозон/транспозаза.



 

Похожие патенты:

Изобретение относится к области биотехнологии и генной инженерии. .

Изобретение относится к области биотехнологии и здравоохранения. .

Изобретение относится к области биотехнологии, генной инженерии, вирусологии и медицины. .

Изобретение относится к области генной инженерии и вирусологии. .

Изобретение относится к таким иммуногенным и вакцинным композициям, которые пригодны для использования у различных животных (мишеневых или хозяев) видов, восприимчивых к заболеванию, вызванному BTV, включая, но не ограничиваясь, млекопитающих, рептилий, птиц, в особенности людей, парных млекопитающих или животных, таких как, но не ограничиваясь, собак, кошек, лошадей, млекопитающих из зоопарков или животных, таких как морские млекопитающие, напр., тюлени, кошки, лошади, зоопарковые рептилии, такие как змеи, крокодилы, аллигаторы, и птичьи виды

Изобретение относится к области биотехнологии

Изобретение относится к области биотехнологии и вирусологии

Изобретение относится к области молекулярной биологии и генной инженерии

Изобретение относится к области биотехнологии и генной инженерии. Предложен способ получения вектора экспрессии, кодирующего адаптированную рекомбиназу. Указанная адаптированная рекомбиназа рекомбинирует асимметричные участки-мишени в LTR провирусной ДНК ретровируса, встроенного в геном клетки-хозяина, и пригодна в качестве средства для вырезания провируса из генома клетки-хозяина. Настоящее изобретение дополнительно относится к способу оптимизации лечения ретровирусной инфекции у индивида in vitro и к использованию адаптированных рекомбиназ для получения фармацевтических композиций для снижения вирусной нагрузки у индивида, инфицированного ретровирусом. 11 н. и 10 з.п. ф-лы, 11 ил., 1 табл., 4 пр.

Изобретение относится к области биотехнологии. Предложен аденовирусный вектор-помощник для получения рекомбинантного аденовируса с высокой емкостью. Указанные вектора позволяют разрабатывать системы для создания в клетках рекомбинантных аденовирусов с высокой емкостью, и которые оптимально уменьшают загрязнение указанных аденовирусов с высокой емкостью аденовирусами-помощниками. Изобретение может быть использовано в клеточной технологии. 8 н. и 20 з.п.ф-лы, 14 ил., 5 пр.

Изобретение относится к медицинской и молекулярной генетике

Наверх