Моноклональные антитела против интерферона-альфа и способы применения



Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения
Моноклональные антитела против интерферона-альфа и способы применения

 


Владельцы патента RU 2431638:

БЭЙЛОР РИСЕРЧ ИНСТИТЬЮТ (US)

Изобретение относится к биотехнологии и представляет собой антитела, которые избирательно нейтрализуют биоактивность по крайней мере двух подтипов белка интерферона-альфа ("IFNα") в отношении подтипов белка А, 2, В2, С, F, G, H2, I, J1, К, 4а, 4b и WA, и не нейтрализуют по крайней мере одну биоактивность белка IFNα подтипа D. Также представлено применение антитела для производства лекарственного средства. Кроме того представлены продуцирующее антитело клетка-хозяин и гибридома. Антитела по изобретению эффективны для выявления подтипов IFNα в образце или ткани и/или для терапевтического применения, включающего в себя лечение и/или улучшение состояния при связанном с IFNα заболевании, таком как SLE, волчанка, диабет типа I, псориаз, СПИД и реакция "трансплантат против хозяина". 4 н. и 33 з.п. ф-лы, 17 ил., 10 табл.

 

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ ИЗОБРЕТЕНИЕ

Настоящее изобретение относится к способам и композициям, пригодным для диагностики и лечения состояний, которые связаны с патологическим уровнем экспрессии интерферона-α (IFNα) у индивидуума.

УРОВЕНЬ ТЕХНИКИ

Интерфероны (IFN) человека представляют собой функционально связанные цитокины, регулирующие врожденные и адаптивные иммунные реакции. Их подразделяют, преимущественно на основе гомологии последовательностей, на две группы, такие как тип I и тип II. IFN типа I включают шесть типов (IFN-α, IFN-β, IFN-ω, IFN-κ, IFN-ε и IFN-λ). IFN-α, -β, -ω и -κ действуют через один и тот же рецептор IFN, IFNAR. IFN-λ связан с отдельным рецептором, IFNLR. Рецептор для IFN-ε в настоящее время неизвестен. IFN типа II включает единственный тип (IFN-γ) и связан с рецептором IFNGR. Тогда как IFN типа I в значительной степени индуцируются при вирусных инфекциях, IFN типа II в основном индуцируется в ответ на иммунные и воспалительные стимулы, и поэтому IFN-γ часто называют "иммунным IFN". Наиболее изученные из множества IFN типа I включают в себя IFN-α, IFN-β и IFN-ω. Из них IFN-α является наиболее сложным, включая по крайней мере пятнадцать различных подтипов белков, обладающих последовательностями с гомологией более чем 75%. Diaz (1995) Semin. Virol. 6:143-149; Weissmann et al. (1986) Prog Nucl Acid Res Mol Biol 33:251; J Interferon Res (1993) 13:443-444; Roberts et al. (1998) J Interferon Cytokine Res 18:805-816. Кроме обладания структурным сходством, гены IFN-α и их продукты проявляют функциональное сходство. Например, они индуцируются посредством дцРНК или вирусом и могут взаимодействовать с одним и тем же рецептором, рецептором IFNAR для IFN-α/β. Mogensen, et al. (1999) J. Interferons and other Regulatory Cytokines, John Wiley & Sons. Также IFN-α ингибирует апоптоз, способствует выживанию и дифференцировке активированных антигеном T-клеток-хелперов и способствует созреванию функционально эффективных дендритных клеток, происходящих из моноцитов.

Клетки множества типов продуцируют IFN-α, когда подвергаются воздействию вирусов и дцРНК. Специализированные лейкоциты (называемые клетками, продуцирующими интерферон-α ("IPC")) продуцируют IFN-α в ответ на широкое разнообразие стимулов, например, вирусы, бактерии и простейшие. В нескольких исследованиях in vitro показано, что различные подтипы IFN-α продуцируются в различной степени различными секретирующими IFN-α линиями клеток или специфичным к типу вируса образом после инфицирования мононуклеарных клеток периферической крови человека (PBMC), и что эти профили часто связаны с зависящими от подтипа различиями в антипролиферативной, противовирусной и противоопухолевой активностях. Однако физиологическая значимость отдельных подтипов и их синергической или антогонистической активности в отношении друг друга in vivo остается неясной.

IFN-α действовал в качестве медиатора при патологии, наблюдаемой при некоторых аутоиммунных заболеваниях. Кроме того, он способен вызывать развитие аутоиммунного заболевания у пациентов, которых при раке и вирусных инфекциях лечат посредством IFN-α. Повышенная экспрессия IFN-α была выявлена в пораженных заболеванием тканях пациентов с инсулинозависимым сахарным диабетом (IDDM или диабет типа I), псориазом, болезнью Крона и целиакией. Сверхэкспрессия IFN-α была выявлена у пациентов с системной красной волчанкой (SLE), IDDM и СПИДом. В случае SLE, характеризующейся избытком аутореактивных B- и T-клеток, экспрессию IFN-α наблюдают не только в участках повреждения ткани, но и в циркулирующей крови пораженных индивидуумов. Кроме того, для уровней IFN-α сыворотки наблюдают тенденцию к взаимосвязи с клиническим показателем активности заболевания. Предполагают, что это обусловлено циклической индукцией моноцитов, в норме находящихся в состоянии покоя, в активные антигенпрезентирующие дендритные клетки (DC), что вызвано повышением продукции IFN-α плазмоцитоидными DC (pDC). Действительно, посредством анализа с использованием олигонуклеотидного микрочипа авторами настоящего изобретения ранее было показано, что SLE можно различать по "характерным признакам" нерегулируемых генов, которые вовлечены в гранулоцитопоэз и индукцию IFN; эти характерные признаки возвращаются к норме после инфузии высокой дозы глюкокортикоидов (патентная заявка США 11/228586, содержание которой приведено здесь в качестве ссылки).

Системная красная волчанка (SLE) представляет собой системное аутоиммунное ревматическое заболевание, которое особенно активно у детей и характеризуется вспышками высокой заболеваемости. Такие аутоиммунные заболевания, как SLE, часто протекают в виде непрекращающихся циклов обострения и ремиссии. Эти циклы часто характеризуют по этапам лечения с использованием общих терапевтических схем, применяемых для подавления цикла заболевания SLE. Утвержденные FDA средства для лечения SLE включают кортикостероиды, нестероидные иммунодепрессанты, противомалярийные средства и нестероидные противовоспалительные лекарственные средства. Эти лекарственные средства нарушают единство всех иммунных эффекторных реакций, а не действуют на реакции, специфичные для патогенеза SLE. SLE представляет неудовлетворенную потребность в лечебных средствах, поскольку указанные варианты лечения лишь частично эффективны в неполной мере, сопровождаясь побочными эффектами, в том числе истончением костей, потерей массы, угрями, анемией, бесплодием, внезапно возникающей диареей, потерей волос и тошнотой. Кроме того, за 40 лет не было утверждено никаких новых лечебных средств для SLE.

В последнее время SLE тесно связывали с непрерывной продукцией IFNα. Shi et al. (1987) Br. J. Dermatol. 117(2):155-159. IFNα присутствует в повышенном количестве в сыворотке при SLE (Crow et al. (2004) Curr. Opin. Rheumatol. 16(5):541-547) и плазмацитоидных DC (pDC), основном источнике IFNα, накапливаясь в кожных покровах при SLE. Farkas et al. (2001) Am. J. Pathol. 159(l):237-243. Кроме того, было выявлено, что у некоторых пациентов, которых лечат посредством IFNα, развивалась волчанка (Okanoue et al. (1996) J. Hepatol. 25(3):283-291; Tothova et al. (2002) Neoplasma 49(2):91-94; и Raanani et al. (2002) Acta Haematol. 107(3):133-144) и что у пациентов с волчанкой, у которых присутствовали антитела против IFNα, наблюдали проявление более легкой формы заболевания. Von Wussow et al. (1988) Rheumatol. Int. 8(5):225-230. IFNα может действовать через дифференцировку моноцитов в функциональные дендритные клетки (DC), которые в свою очередь опосредуют этиопатогенез SLE. Pascual V. et al. (2003) Curr. Opin. Rheumatol. 15(5):548-556. Предлагаемый способ лечения SLE состоит в нейтрализации IFNα (см. Banchereau et al., PCT/US02/00343, содержание которого приведено здесь в качестве ссылки).

Хотя были получены моноклональные антитела (MAb), способные блокировать биоактивность IFNα человека, к настоящему времени ни для одного из них не показана способность нейтрализовать все пятнадцать известных подтипов, и лишь несколько способны нейтрализовать природный IFN из лейкоцитов, содержащих IFN-α. В PBL Biomedical Laboratories предлагают десять мышиных моноклональных антител, связывающихся с множеством подтипов гена IFNα человека (см. interferonsource.com/relativespecificity.html во всемирной сети). Однако каждое из антител PBL связывает подтип белка IFNα, кодируемый геном IFNα человека подтипа 1 (белок IFNα подтипа D), и от одного до двенадцати других подтипов IFNα. В опубликованном патенте США № 2003/0166228A1 описано моноклональное антитело (обозначенное 9F3), полученное в результате иммунизации мышей лейкоцитарным IFNα (который включает все подтипы белка IFNα). MAb 9F3 связывает и нейтрализует противовирусную активность белков, кодируемых семью подтипами гена IFNα человека 1, 2, 4, 5, 8, 10 и 21 (которые кодируют подтипы белка IFNα D, A, 4, G, B2, C и F, соответственно), при отсутствии нейтрализации противовирусной активности IFNβ человека. В этой публикации не указано, связывает ли и инактивирует ли антитело 9F3 другие восемь подтипов гена IFNα, а также связывает ли оно белок IFNα одного или обоих подтипов 4a и 4b. В публикации PCT предложено использование моноклональных антител для лечения заболеваний, связанных с повышенной экспрессией IFNα, особенно аутоиммунных нарушений, таких как инсулинозависимый сахарный диабет и SLE. Однако неизвестно, способно ли антитело 9F3 в достаточной степени нейтрализовывать биологическую активность подтипов белка IFNα, которые находятся в сыворотке при SLE.

Поскольку IFNα представляет собой многофункциональный медиатор иммунной реакции и обладает благоприятной противовирусной активностью, полное ингибирование или значительное подавление всех подтипов IFNα не является оптимальным терапевтическим подходом. Таким образом, существует необходимость в средствах, избирательно нейтрализующих подтипы IFNα, связанные с патологическими состояниями. Это изобретение удовлетворяет этой потребности, а также обеспечивает соответствующие преимущества.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Это изобретение относится к моноклональным антителам и их производным, нейтрализующим конкретные подтипы IFNα. Антитела по изобретению эффективны в улучшении и лечении состояний, связанных с повышенной экспрессией IFNα, например, SLE, псориаза, диабета типа I, СПИДа, реакции "трансплантат против хозяина" и других аутоиммунных заболеваний. В одном из аспектов изобретение относится к антителу, избирательно нейтрализующему биоактивность по крайней мере двух подтипов белка интерферона-альфа ("IFNα"), таких как подтипы A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b и WA, но не нейтрализующему в значительной степени по крайней мере одну биоактивность белка IFNα подтипа D; где биоактивность представляет собой активацию промотора MxA или противовирусную активность. Предпочтительно, антитело представляет собой моноклональное антитело. В одном из вариантов осуществления антитело не нейтрализует в значительной степени белок IFNα ни подтипа D, ни 1. В одном из вариантов осуществления моноклональное антитело представляет собой ACO-1 (моноклональное антитело, продуцируемое клеточной линией гибридомы с регистрационным номером ATCC PTA-6557) или ACO-2 (моноклональное антитело, продуцируемое клеточной линией гибридомы с регистрационным номером ATCC PTA-6558). Предпочтительно, антитела по изобретению инактивируют способность сыворотки, выделенной у пациентов с системной красной волчанкой (SLE), стимулировать дифференцировку моноцитов в дендритные клетки.

В другом аспекте изобретение относится к антителу или его антигенсвязывающему фрагменту, содержащим вариабельный домен тяжелой цепи и вариабельный домен легкой цепи, где вариабельный домен легкой цепи содержит следующие CDR, их производные или участки:

VL1 с аминокислотной последовательностью SEQ ID NO:12;

VL2 с аминокислотной последовательностью SEQ ID NO:14; и

VL3 с аминокислотной последовательностью SEQ ID NO:16;

где антитело или антигенсвязывающий фрагмент нейтрализует биоактивность белка IFNα подтипов A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b и WA, но не биоактивность белка IFNα подтипа D, где биоактивность представляет собой активацию промотора MxA.

В другом аспекте изобретение относится к антителу или его антигенсвязывающему фрагменту, содержащим вариабельный домен легкой цепи и вариабельный домен тяжелой цепи, где вариабельный домен тяжелой цепи содержит следующие CDR, их производные или участки:

VH1 с аминокислотной последовательностью SEQ ID NO:4;

VH2 с аминокислотной последовательностью SEQ ID NO:6; и

VH3 с аминокислотной последовательностью SEQ ID NO:8;

где антитело или антигенсвязывающий фрагмент специфично нейтрализует биоактивность белка IFNα подтипов A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b и WA, но не нейтрализует в значительной степени биоактивность белка IFNα подтипа D, где биоактивность представляет собой активацию промотора MxA.

В другом варианте осуществления изобретение относится к антителу или его антигенсвязывающему фрагменту, содержащим по крайней мере одну легкую цепь или ее антигенсвязывающий фрагмент, которые включают следующие CDR, их производные или участки:

VL1 с аминокислотной последовательностью SEQ ID NO:12;

VL2 с аминокислотной последовательностью SEQ ID NO:14; и

VL3 с аминокислотной последовательностью SEQ ID NO:16; и

по крайней мере одну тяжелую цепь или ее антигенсвязывающий фрагмент, содержащие следующие CDR, их производные или участки:

VH1 с аминокислотной последовательностью SEQ ID NO:4;

VH2 с аминокислотной последовательностью SEQ ID NO:6; и

VH3 с аминокислотной последовательностью SEQ ID NO:8.

В другом варианте осуществления изобретение относится к антителу, избирательно нейтрализующему биоактивность белка IFNα подтипа 4a, но не нейтрализующему в значительной степени биоактивность белка IFNα подтипа 4b, где биоактивность представляет собой активацию промотора MxA и/или противовирусную активность. Предпочтительно, антитело избирательно нейтрализует биоактивность белка IFNα подтипов A, 2, B2, C, I, K и 4a, но не нейтрализует в значительной степени биоактивность белка IFNα подтипов D, F, G, 4b и 1. В одном из вариантов осуществления антитело представляет собой моноклональное антитело ACO-3.

Также изобретение относится к антителу, избирательно нейтрализующему биоактивность белка IFNα подтипов A, 2, B2 и C, но не нейтрализующему в значительной степени биоактивность белка IFNα подтипов D, 4b и 1, где биоактивность представляет собой активацию промотора MxA и/или противовирусную активность. В одном из вариантов осуществления антитело представляет собой моноклональное антитело ACO-4.

В другом аспекте изобретение относится к антителу, избирательно нейтрализующему биоактивность белка IFNα подтипов A, 2, G, H2, K, WA и 1, но не нейтрализующему биоактивность белка IFNα подтипов B2 и D, где биоактивность представляет собой активацию промотора MxA и/или противовирусную активность. В одном из вариантов осуществления антитело представляет собой моноклональное антитело ACO-5.

В еще одном аспекте изобретение относится к моноклональному антителу, избирательно нейтрализующему биоактивность белка IFNα подтипов 2 и C, но не нейтрализующему биоактивность белка IFNα подтипов A, B2, C, D, F и 1, где биоактивность представляет собой активацию промотора MxA. В одном из вариантов осуществления антитело представляет собой моноклональное антитело ACO-6.

В другом аспекте изобретение относится к антителу, избирательно нейтрализующему биоактивность белка IFNα подтипов A, 2, B2, F, I, 4a, 4b и 1, но не нейтрализующему биоактивность белка IFNα подтипов C, H2, K и WA, где биоактивность представляет собой активацию промотора MxA. В одном из вариантов осуществления антитело представляет собой моноклональное антитело ACO-8.

В еще одном аспекте изобретение относится к антителу, избирательно нейтрализующему биоактивность белка IFNα подтипов A, 2, B2, D, F, I, J1, 4a, 4b и 1, но не нейтрализующему биоактивность белка IFNα подтипов C, G, H2, K и WA, где биоактивность представляет собой активацию промотора MxA.

Антитела, их производные или фрагменты по изобретению могут принадлежать мыши, крысе, человеку или другим млекопитающим, или являться фрагментами или гуманизированными или химерными формами таких антител. Антитела по изобретению включают моноклональные антитела мыши, например, ACO-1, ACO-2, ACO-3, ACO-4, ACO-5, ACO-6 и ACO-8, а также их гуманизированные формы, химерные формы или фрагменты. Кроме того, изобретение относится к антителам, связывающимся по существу с тем же эпитопом IFNα, что и мышиные моноклональные антитела ACO-1, ACO-2, ACO-3, ACO-4, ACO-5, ACO-6 и ACO-8. Кроме того, изобретение относится к клеткам-хозяевам, гибридомам, композициям, фармацевтическим композициям и наборам, содержащим антитела по изобретению.

Антитела, их производные или фрагменты по изобретению используют в лечении заболеваний или состояний, связанных со сверхэкспрессией IFNα, включая в себя, но ими не ограничиваясь, SLE, псориаз, СПИД, диабет типа I и аутоиммунный тиреоидит, а также используют для получения лекарственных средств для лечения таких заболеваний и состояний. Также антитела по изобретению можно использовать для различения или очистки различных подтипов IFNα.

В другом аспекте изобретение относится к изолированной нуклеиновой кислоте, содержащей полинуклеотид, который кодирует полипептид, выбранный из группы, состоящей из SEQ ID NO:2; SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14 и SEQ ID NO:16, или полипептиды, обладающие такой последовательностью по крайней мере на 80%. Предпочтительно, полинуклеотид выбирают из группы, состоящей из SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13 и SEQ ID NO:15.

Кроме того, изобретение относится к белку или пептиду, содержащему полипептид, выбранный из группы, состоящей из SEQ ID NO:2; SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ BD NO:14 и SEQ ID NO:16, или белок или пептид с последовательностью, по крайней мере на 80% идентичной такой последовательности. В другом аспекте изобретение относится к способу получения клеточной линии гибридом, включающему иммунизацию млекопитающего композицией, которая содержит рекомбинантный IFNα подтипов A, B2 и F; слияние спленоцитов от иммунизированного млекопитающего c линией миеломных клеток для получения гибридом; и выявление клеточной линии гибридом, продуцирующей моноклональное антитело, которое избирательно нейтрализует один или несколько подтипов белка IFNα, выбранных из группы, состоящей из 2, C, G, I, J1, K, 4a, 4b и WA, а также 1, но которое не нейтрализует избирательно белок IFNα подтипа D.

Также изобретение относится к клеткам-хозяевам и клеточным линиям гибридом, продуцирующим антитела с указанными выше специфичностями, например, специфичным связыванием с одним или несколькими подтипами белка интерферона-альфа ("IFNα") (A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b и WA), но не нейтрализующими биоактивность, например, белка IFNα подтипа D. Для использования в способах диагностики и лечения антитела и/или клеточные линии гибридом можно сочетать с носителем, таким как фармацевтически приемлемый носитель. Антитела пригодны для выявления конкретных подтипов IFNα и для диагностики, прогноза, лечения и/или ослабления симптомов заболеваний, связанных с IFNα. Примеры таких состояний включают в себя, но ими не ограничиваются, SLE, псориаз, диабет типа I, реакцию "трансплантат против хозяина" (GVH), СПИД, аутоиммунный тиреоидит и другие аутоиммунные заболевания. Также антитела по изобретению пригодны для нейтрализации и/или выделения таких подтипов IFNα in vitro или in vivo.

КРАТКОЕ ОПИСАНИЕ ФИГУР

Для более полного понимания признаков и преимуществ настоящего изобретения далее следует ссылка на подробное описание изобретения вместе с сопровождающими фигурами, в которых:

на фиг.1 представлена принципиальная схема анализа с использованием гена-репортера (RG) и анализа на предмет ингибирования цитопатического эффекта (CPE). Закрашенные круги на диаграмме для анализа CPE отражают живые неповрежденные клетки. Незакрашенные круги отражают мертвые клетки, уничтоженные вирусной инфекцией. Закрашенные круги и клетки, а также "+" на диаграмме для анализа RG отражают экспрессию люциферазы, тогда как незакрашенные круги и клетки отражают отсутствие экспрессии люциферазы.

На фиг.2 представлена блок-схема для способа получения MAb против IFNα.

На фиг.3 представлена нейтрализация источников комплексного IFN посредством ACO-1, 2, 3, 4 и 5. (a) Нейтрализацию 600 пг лейкоцитарного IFN (Sigma) посредством указанных количеств каждого из MAb оценивали с использованием биоанализа RG. Проценты блокирования вычисляли на основе величин LCPS, получаемых в присутствии/отсутствие лейкоцитарного IFN и в отсутствие какого-либо MAb. Величины представляют собой среднее значение для трех серий. (b) Нейтрализация PBMC-flu (640-кратное разведение) посредством каждого MAb. Проценты блокирования вычисляли, как описано ранее. Величины представляют собой среднее значение для трех серий.

На фиг.4 представлена нейтрализация пятнадцати подтипов рекомбинантного IFNα посредством ACO-1. (a) Нейтрализацию указанных подтипов IFNα посредством возрастающих концентраций ACO-1 оценивали с использованием биоанализа RG. Численное значение, соответствующее каждой кривой, отражает среднюю точку (EC50), рассчитываемую из величины LCPS (импульсы люминесценции в секунду), которую получают в отсутствие ACO-1 (указано незаштрихованными кругами на оси Y) и при наивысшей концентрации тестируемого MAb (2000 нг/мл). N.D. обозначает, что величину EC50 было невозможно определить. Экспериментальные точки были получены из трех серий. (b) Отсутствие нейтрализации IFN-β посредством возрастающих концентраций ACO-1, 2, 3, 4, 5 и 8. Экспериментальные точки были получены из трех серий.

На фиг.5 представлены результаты множественного анализа моноклональных антител ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 и ACO-6.

На фиг.6 представлены результаты твердофазного анализа связывания подтипов IFNα моноклональными антителами ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 и ACO-6.

На фиг.7 представлена нейтрализация биоактивности образцов сыворотки от пациентов с SLE SLE-43 (a), SLE-133 (b), SLE-140 (c) и SLE-BD (d), оцениваемая анализом CPE. Указаны количества тестируемых MAb. Контроли включают отдельно сыворотку, только среды (-), а также пан-нейтрализующее поликлональное антитело (pAb, против IFNα кролика и человека, PBL). Величины представляют собой среднее значение для трех серий.

На фиг. 8A-C представлена перекрестная реактивность ACO-1 (A), ACO-2 (B) и ACO-3 (C) с IFN макака 156 пг/лунка.

На фиг.9 представлены последовательности кДНК и аминокислот тяжелой цепи из ACO-1. Последовательности ДНК, кодирующие CDR VH1, VH2 и VH3, выделены курсивом, а соответствующие аминокислотные последовательности подчеркнуты.

На фиг.10 представлена последовательность кДНК и аминокислот легкой цепи из ACO-1. Последовательности ДНК, кодирующие CDR VL1, VL2 и VL3, выделены курсивом, а соответствующие аминокислотные последовательности подчеркнуты.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Хотя осуществление и использование различных вариантов осуществления настоящего изобретения подробно описаны ниже, следует понимать, что настоящее изобретение относится к множеству применимых идей изобретения, которые можно осуществлять во множестве различных конкретных вариантов. Описанные в настоящей заявке конкретные варианты осуществления предназначены только для иллюстрации конкретных способов осуществления и использования изобретения и не предназначены для ограничения объема изобретения.

Для облегчения понимания этого изобретения ниже определен ряд терминов. Определенные в настоящей заявке термины обладают значениями, в которых обычно понимает специалист в связанных с настоящим изобретением областях. Такие термины, как "некоторый" и "этот" предназначены не только для обозначения единственного числа, но и включают в себя общий класс, из которого для иллюстрации можно использовать конкретный пример. В настоящей заявке терминология использована для описания конкретных вариантов осуществления изобретения, однако их применение не ограничивает изобретение, за исключением того, как указано в формуле изобретения. Например, термин "клетка" включает множество клеток, в том числе их смеси. Все численные обозначения, например, pH, температура, время, концентрация и молекулярная масса, включая диапазоны, представляют собой приблизительные величины, различающиеся (+) или (-) с шагом 0,1. Следует понимать, что хотя это не всегда четко указано, всем численным обозначениям предшествует термин "приблизительно". Также следует понимать, что хотя это не всегда четко указано, описанные в настоящей заявке реагенты представлены только в качестве примера и что в данной области известны эквиваленты таких реагентов.

В настоящей заявке термин "антитело" относится ко всем классам и подклассам целых иммуноглобулинов. Также термин "антитело" включает моноклональные антитела, фрагменты антител и клоны фрагментов антител. "Фрагменты антител" включают участок целого антитела, содержащий антигенсвязывающую или вариабельную область целого антитела. Примеры фрагментов антител включают фрагменты Fab, Fab', F(ab')2 и Fv; молекулы одноцепочечных антител, полиспецифичные антитела, формируемые из фрагментов антител; фрагмент Fd, включающий домены VH и CH; фрагмент Fv, включающий домены VL и VH из одного плеча антитела, фрагмент dAb (Ward et al. (1989) Nature 341:544-546), включающий домен VH; а также отдельную гипервариабельную область (CDR). "Одноцепочечные Fv" или "scFv" фрагменты антител включают домены VH и VL антитела, где эти домены присутствуют в одной полипептидной цепи. Как правило, полипептид scFv дополнительно содержит полипептидный линкер между доменами VH и VL, позволяющий scFv формировать желаемую структуру для связывания антигена. Для обзора scFv см. Pluckthun (1994) в The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315, Dall'Acqua and Carter (1998) Curr. Opin. Struct. Biol. 8: 443-450, Hudson (1999) Curr. Opin. Immunol. 11: 548-557, Bird et al. (1988) Science 242:423-426 и Huston et al. (1988) Proc. Natl. Acad Sci. USA 85:5879-5883. Любой из указанных выше фрагментов антител можно получать с использованием общепринятых способов, известных специалистам в данной области, а на предмет специфичности связывания и нейтрализующей активности фрагменты отбирают тем же способом, что и целые антитела. Антитела можно выделять из любого приемлемого биологического источника, например мыши, кролика, крысы, человека, овцы, собаки и т.д. "Природные" или "нативные" антитела представляют собой гетеротетрамерные гликопротеины, как правило, с молекулярной массой приблизительно 150-200 кДа. Гетеротетрамер содержит две одинаковые легкие (L) цепи и две одинаковые тяжелые (H) цепи. Каждая легкая цепь ковалентно связана дисульфидной связью с тяжелой цепью.

В рамках настоящей заявки термин "производное антитела" относится к обозначению молекул, которые связываются с эпитопом и которые являются модификациями или производными природного моноклонального антитела по этому изобретению. Например, производные включают в себя, но ими не ограничиваются, биспецифичные, полиспецифичные, гетероспецифичные, триспецифичные, тетраспецифичные, мультиспецифичные антитела, химерные, рекомбинантные и гуманизированные.

В рамках настоящей заявки термин "вариант антитела" относится к антителам, продуцируемым у вида, отличного от мыши, или к изотипу антитела, выбранного из антител, которые обозначены от ACO-1 до ACO-6 и ACO-8. Также термин "вариант антитела" включает антитела, содержащие посттрансляционные модификации линейной полипептидной последовательности антитела или фрагмента. Кроме того, термин включает в себя антитела, полностью относящиеся к человеку.

В рамках настоящей заявки термин "моноклональное антитело" относится к антителу (в том числе фрагментам антител), получаемому из популяции практически гомогенных антител, т.е. отдельные антитела в популяции являются одинаковыми, за исключением возможных природных мутаций, которые могут присутствовать в незначительных количествах, где эти антитела также являются частью настоящего изобретения при условии, что они обладают желаемой биологической активностью. Моноклональные антитела являются высокоспецифичными и направленными против одного эпитопа. Моноклональные антитела можно синтезировать посредством культивирования гибридом, в биореакторе, в виде асцита или можно получать рекомбинантными способами, такими как трансляция in vitro, в клетках бактерий, дрожжей, растений, насекомых и/или животных. Соответственно, определение "моноклональный" указывает на природу антитела как получаемого из практически гомогенной популяции антител и оно не подразумевает необходимости получения антитела каким-либо конкретным способом. Например, моноклональные антитела, подлежащие использованию по настоящему изобретению, можно получать способом гибридомы, впервые описанным Kohler et al. (1975) Nature, 256:495, или можно получать способами рекомбинантной ДНК (см., например, патент США № 4816567). "Моноклональные антитела" включают в себя, но ими не ограничиваются, гуманизированные моноклональные антитела, рекомбинантные антитела человека, клоны фрагментов антител, которые содержат участки распознавания и связывания антигенов (клоны Fv), выделяемые из фаговых библиотек антител и их производных. (См. Clackson, et al. (1991) Nature, 352:624-628; и Marks, et al. (1991) J Mol Biol 222:581-597). Также моноклональные антитела включают "химерные" антитела (иммуноглобулины), в которых, например, участок тяжелой и/или легкой цепи является идентичным или гомологичным соответствующим последовательностям в антителах, получаемых из конкретного вида или принадлежащих к конкретному классу или подклассу антител, тогда как остальная часть цепи(ей) или их участков является идентичной или гомологичной соответствующим последовательностям в антителах, получаемых из другого вида или принадлежащих другому классу или подклассу антител, а также фрагменты таких антител при условии, что они проявляют желаемую биологическую активность (патент США № 4816567; Morrison et al. (1984) Proc Natl Acad Sci USA, 81:6851-6855).

В рамках настоящей заявки термин "моноклональное антитело человека" относится к антителам, которые проявляют единственную специфичность связывания, обладая вариабельными и константными областями, происходящими из последовательностей иммуноглобулинов зародышевой линии человека.

В рамках настоящей заявки термин "антитело человека" относится к антителам с вариабельными и константными областями, происходящими из последовательностей иммуноглобулинов зародышевой линии человека. Антитела человека по изобретению могут содержать аминокислотные остатки, не кодируемые последовательностями иммуноглобулинов зародышевой линии человека (например, мутации, вводимые случайным или сайт-специфическим мутагенезом in vitro или в результате соматической мутации in vivo). Однако в рамках настоящей заявки термин "антитело человека" не подразумевает включения в себя антител, в которых последовательности CDR, происходящие из зародышевой линии другого вида млекопитающих, такого как мышь, были присоединены к принадлежащим человеку каркасным последовательностям. Таким образом, в рамках настоящей заявки термин "антитело человека" относится к антителу, в котором практически каждая часть белка (например, CDR, каркасная область, домены CL, CH (например, CH1, CH2, CH3), шарнирный участок (VL, VH)) в основном является неиммуногенной у человека при только незначительных изменениях или отличиях последовательностей. Сходным образом, антитела, указанные в отношении примата (обезьяна, павиан, шимпанзе и т.д.), грызуна (мышь, крыса, кролик, морская свинка, хомяк и т.п.) и других млекопитающих, указывают на такой вид, подрод, род, подсемейство, семейство специфичных антител. Как описано выше, химерные антитела могут также содержать любое сочетание из указанного выше. Необязательно и предпочтительно, в сравнении с немодифицированными антителами такие изменения или отличия сохраняют или снижают иммуногенность у человека или другого вида. Таким образом, антитело человека отлично от химерного или гуманизированного антитела. Антитело человека можно получать из не относящегося к человеку животного или из прокариотической или эукариотической клетки, способной к экспрессии функционально преобразованных генов иммуноглобулина человека (например, тяжелой цепи и/или легкой цепи). Кроме того, если антитело человека представляет собой одноцепочечное антитело, то оно может также содержать линкерный пептид, который не встречается в природных антителах человека. Например, фрагмент Fv также может содержать линкерный пептид, например, от двух до приблизительно восьми глицинов или других аминокислотных остатков, соединенных с вариабельной областью тяжелой цепи и вариабельной областью легкой цепи. Подразумевают, что такие линкерные пептиды происходят от человека.

Антитело человека "получено из" конкретной зародышевой последовательности, если антитело получают из системы с использованием последовательностей иммуноглобулинов человека, например, посредством иммунизации трансгенной мыши, несущей гены иммуноглобулинов человека, или посредством скрининга библиотеки генов иммуноглобулинов человека. Антитело человека, "полученное из" последовательности иммуноглобулинов зародышевой линии человека, можно выявлять как таковое посредством сравнения аминокислотной последовательности антитела человека с аминокислотной последовательностью иммуноглобулинов зародышевой линии человека. Как правило, аминокислотная последовательность выбранного антитела человека по крайней мере на 90% совпадает с аминокислотной последовательностью, кодируемой геном иммуноглобулина зародышевой линии человека, и содержит аминокислотные остатки, которые определяют антитело человека как относящееся к человеку при сравнении с аминокислотными последовательностями иммуноглобулинов зародышевой линии другого вида (например, последовательности зародышевой линии мыши или крысы). В определенных случаях аминокислотная последовательность антитела человека может по крайней мере на 95% или даже по крайней мере на 96%, 97%, 98% или 99% совпадать с аминокислотной последовательностью, кодируемой геном иммуноглобулина зародышевой линии. Как правило, у антитела человека, получаемого из конкретной последовательности зародышевой линии человека, наблюдают не более чем 10 отличий в аминокислотах при сравнении с аминокислотной последовательностью, кодируемой геном иммуноглобулина зародышевой линии человека. В определенных случаях у антитела человека можно наблюдать не более чем 5 или даже не более чем 4, 3, 2 или 1 отличие в аминокислотах при сравнении с последовательностью аминокислот, кодируемой геном иммуноглобулина зародышевой линии.

В рамках настоящей заявки термин "гуманизированный" относится к использованию участков не принадлежащих человеку антител (например, мыши или крысы), которые применяют для каркаса иммуноглобулина человека для получения химерных иммуноглобулинов, к цепям иммуноглобулинов или их фрагментам (таким как Fv, Fab, Fab', F(ab')2 или другим антигенсвязывающим последовательностям антител), которые содержат последовательности, получаемые из не принадлежащего человеку иммуноглобулина. Как правило, гуманизированные антитела представляют собой иммуноглобулины человека (реципиентное антитело), в которых остатки из части или всей из одной или нескольких гипервариабельных областей (CDR) реципиентного антитела заменяют остатками из одной или нескольких CDR видов, не относящихся к человеку (донорское антитело), таких как мышь, крыса или кролик, которые обладают желаемой специфичностью, аффинностью и активностью. Например, остатки каркасной области (FR) Fv иммуноглобулина человека заменяют соответствующими остатками, не принадлежащими человеку, или наоборот, т.е. участки иммуноглобулина человека можно присоединять к участкам не принадлежащего человеку иммуноглобулина, определяющим специфичность к антигену. Кроме того, гуманизированные антитела могут содержать остатки, которые не встречаются ни в реципиентном антителе, ни во вводимых последовательностях CDR или каркасной области. Модификации, не являющиеся частью донорского или реципиентного антитела, часто и легко осуществляют для дополнительной очистки и оптимизации характеристик антитела. В целом, гуманизированное антитело практически полностью содержит по крайней мере один, а обычно оба вариабельных домена (легкий и тяжелый), в которых все или практически все области CDR соответствуют областям в иммуноглобулине, не принадлежащем человеку, а все или практически все области FR представляют собой области из последовательности иммуноглобулина человека. Также гуманизированное антитело может содержать по крайней мере участок константной области (Fc) иммуноглобулина, как правило, иммуноглобулина человека.

В рамках настоящей заявки термин "рекомбинантное антитело человека" включает все антитела человека, получаемые, экспрессируемые, создаваемые или выделяемые рекомбинантным способом, такие как антитела, выделяемые у животного (например, мыши), которые являются трансгенными или трансхромосомными в отношении генов иммуноглобулинов человека, или получаемая из них гибридома, антитела, выделяемые из клетки-хозяина, которую трансформируют для экспрессии антитела, например, из клетки, трансфицированной для экспрессии антитела (обычно из плазмацитомы), антитела, выделяемые из рекомбинантных комбинаторных библиотек антител человека, а также антитела, получаемые, экспрессируемые, создаваемые или выделяемые любым другим способом, который может включать соединение последовательностей генов иммуноглобулинов человека с другими последовательностями ДНК. Такие рекомбинантные антитела человека содержат вариабельные и константные области, получаемые из последовательностей иммуноглобулинов зародышевой линии человека. Однако в определенных вариантах осуществления такие рекомбинантные антитела человека можно подвергать мутагенезу in vitro (или соматическому мутагенезу in vivo при использовании животного, трансгенного последовательностям Ig человека), и поэтому аминокислотные последовательности областей VH и VL рекомбинантных антител являются такими последовательностями, которые хотя и происходят из и относятся к последовательностям VH и VL зародышевой линии человека, могут в естественных условиях не существовать в составе антител зародышевой линии человека in vivo.

В рамках настоящей заявки термины "антигенсвязывающий участок" или "связывающий участок" относятся к части молекулы иммуноглобулина, участвующей в связывании антигена. Антигенсвязывающий участок формируется аминокислотными остатками из N-концевых трех вариабельных ("V") областей тяжелой ("H") цепи и трех вариабельных областей легких ("L") цепей. Три высоко отличающихся участка в областях V тяжелых и легких цепей называют "гипервариабельными участками" или "CDR", из которых три расположены между четырьмя консервативными фланкирующими участками, известными как "каркасные области" (FR). Каркасные области относятся к аминокислотным последовательностям, которые в природе находятся между, а также примыкают к гипервариабельным участкам в иммуноглобулинах. В молекулах антител три гипервариабельных участка легкой цепи (VL1, VL2 и VL3) и три гипервариабельных участка тяжелой цепи (VH1, VH2 и VH3) располагаются друг относительно друга в трехмерном пространстве, формируя антигенсвязывающую поверхность. Антигенсвязывающая поверхность комплементарна трехмерной поверхности связываемого антигена, а три гипервариабельных участка каждой из тяжелых и легких цепей называют "определяющими комплементарность участками" или "CDR".

В рамках настоящей заявки термин "биоактивность" относится к способности одного или нескольких подтипов IFNα (или IFNβ) активировать промотор MxA (и индуцируемый интерфероном промотор) или оказывать противовирусный эффект. EC50 и процент нейтрализации антителом биоактивности IFNα могут различаться в зависимости от условий анализа и вида измеряемой биоактивности IFNα. Для согласованности используют конкретные виды биоактивности (т.е. активацию промотора MxA и противовирусную активность) и условия анализа (т.е. "анализ RG" и "анализ CPE"). Анализ RG можно проводить с использованием описанных в настоящей заявке условий. Процент нейтрализации активации промотора MxA определяют, как описано в примерах (см. пример 3), с использованием RGмакс количеств IFN и 2 микрограмма антитела в мл. Антивирусный (CPE) анализ можно выполнять в соответствии со способами, описанными в примерах.

В рамках настоящей заявки термин "биспецифичная молекула" относится к любому веществу, например белку, пептиду или белковому или пептидному комплексу, обладающему двумя различными специфичностями связывания. Подразумевают, что термин "полиспецифичная молекула" или "гетероспецифичная молекула" включает любое вещество, например белок, пептид или белковый или пептидный комплекс, обладающий более чем двумя специфичностями связывания.

В рамках настоящей заявки термин "композиция" относится к сочетанию активного средства и другого носителя, например соединения или композиции, инертных (например, поддающегося выявлению вещества или метки) или активных, таких как адъювант, разбавитель, связывающее вещество, стабилизатор, буферные вещества, соли, липофильные растворители, консерванты, адъювант или т.п. Также носители включают фармацевтические эксципиенты и добавки в виде белков, пептидов, аминокислот, липидов и углеводов (например, сахаров, в том числе моносахаридов, ди-, три-, тетра- и олигосахаридов; дериватизированных сахаров, таких как альдиты, альдоновые кислоты, этерифицированные сахара и т.п.; а также полисахаридов или полимеров сахаров), которые могут присутствовать по отдельности или в сочетании, в том числе отдельно или в сочетании в количестве 1-99,99% масс. или об. Примеры эксципиентов в виде белка включают альбумин сыворотки, такой как альбумин сыворотки человека (HSA), рекомбинантный альбумин человека (rHA), желатин, казеин и т.п. Типичные компоненты аминокислот/антител, также способные функционировать в качестве буферных веществ, включают, например аланин, глицин, аргинин, бетаин, гистидин, глутаминовую кислоту, аспарагиновую кислоту, цистеин, лизин, лейцин, изолейцин, валин, метионин, фенилаланин, аспартам и т.п. Также в объем изобретения входят углеводные эксципиенты, примеры которых включают в себя, но ими не ограничиваются, моносахариды, такие как фруктоза, мальтоза, галактоза, глюкоза, D-манноза, сорбоза и т.п.; дисахариды, такие как лактоза, сахароза, трегалоза, целлобиоза и т.п.; полисахариды, такие как рафиноза, мелезитоза, мальтодекстрины, декстраны, крахмалы и т.п.; а также альдиты, такие как маннит, ксилит, мальтит, лактит, ксилитосорбит (глюцит) и миоинозит. Кроме того, термин "носитель" включает буферное вещество или доводящее pH средство; как правило, буферное вещество представляет собой соль, получаемую из органической кислоты или основания. Типичные буферные вещества включают соли органических кислот, такие как соли лимонной кислоты, аскорбиновой кислоты, глюконовой кислоты, углекислоты, винной кислоты, янтарной кислоты, уксусной кислоты или фталевой кислоты; трис, гидрохлорид трометамина или фосфатные буферы. Дополнительные носители включают полимерные эксципиенты/добавки, такие как поливинилпирролидоны, фиколлы (полимерный сахар), декстраны (например, циклодекстрины, такие как 2-гидроксипропилциклодекстрин), полиэтиленгликоли, ароматизаторы, противомикробные средства, подсластители, антиоксиданты, антистатики, поверхностно-активные вещества (например, полисорбаты, такие как "TWEEN 20" и "TWEEN 80"), липиды (например, фосфолипиды, жирные кислоты), стероиды (например, холестерин) и хелатообразующие вещества (например, EDTA).

В рамках настоящей заявки термин "контроль" относится к альтернативному индивидууму или образцу, используемому в исследовании с целью сравнения. Контроль может быть "положительным" или "отрицательным".

В рамках настоящей заявки термин "эффективное количество" относится к количеству, достаточному для достижения благоприятных или желаемых результатов. Эффективное количество можно вводить посредством одного или нескольких введений, применений или доз.

В рамках настоящей заявки термины "эпитоп" или "антигенная детерминанта" относятся к участку на антигене или фрагменте антигена, распознаваемому антителом или рецептором для антигена. Эпитоп T-клеток представляет собой короткий пептид, происходящий из белкового антигена, представляемого соответствующим белком главного комплекса гистосовместимости (MHC). Как правило, эпитопы B-клеток представляют собой антигенные детерминанты, распознаваемые B-клетками, и являются обычными участками трехмерной поверхности, распознаваемыми антителом, которые могут включать последовательные или конформационные детерминанты, как известно специалисту в данной области.

Антитела IgG можно расщеплять на три фрагмента посредством расщепления папаином. Как правило, два из этих фрагментов являются одинаковыми антигенсвязывающими фрагментами, которые называют фрагментами "Fab", где каждый содержит один антигенсвязывающий участок, и остаточный фрагмент "Fc". Фрагмент Fab содержит легкую цепь и аминоконцевую половину тяжелой цепи, связанные вместе межцепочечной дисульфидной связью. Фрагмент Fc состоит из карбоксиконцевых половин двух тяжелых цепей, связываемых друг с другом дисульфидной связью посредством остаточного шарнирного участка. Расщепление антитела IgG пепсином приводит к расщеплению в том же общем участке антитела, что и папаином, но с карбоксиконцевой стороны дисульфидной связи, приводя к образованию фрагмента F(ab')2, который содержит два антигенсвязывающих участка и по-прежнему способен к перекрестному связыванию антигена. Фрагменты Fab' отличаются от фрагментов Fab вследствие добавления нескольких остатков на карбоксиконцевом участке домена тяжелой цепи CH1, в том числе одного или нескольких цистеинов из шарнирного участка антитела. Fab'-SH обозначает Fab', в котором остаток(и) цистеина константных доменов содержит свободную тиольную группу.

В рамках настоящей заявки термин "Fv" относится к минимальному фрагменту антитела, который содержит полный участок, распознающий и связывающий антиген. В двухцепочечном типе Fv эта область содержит димер нековалентно связанных одного вариабельного домена тяжелой цепи и одного вариабельного домена легкой цепи. В одноцепочечном типе Fv один вариабельный домен тяжелой цепи и один вариабельный домен легкой цепи могут быть ковалентно связаны гибким пептидным линкером таким образом, что легкая и тяжелая цепи могут соединяться в "димерную" структуру, аналогичную структуре в двухцепочечном типе Fv.

В рамках настоящей заявки термин "гетероантитела" относится к двум или более антителам, антителосвязывающим фрагментам (например, Fab), их производным или соединенным вместе антигенсвязывающим участкам, которые обладают по крайней мере двумя различными специфичностями к антигенам.

В рамках настоящей заявки термин "интерферон-альфа" ("IFNα") относится к семейству белков, включающему некоторые из основных эффекторов врожденного иммунитета. Существуют по крайней мере 15 известных изотипов IFNα человека. Названия подтипов белка IFNα и соответствующих кодирующих генов приведены ниже.

Подтип белка IFNα Соответствующий ген IFNα
A 2a
2 2b
B2 8
C 10
D (Val114) 1
F 21
G 5
H2 14
I 17
J1 7
K 6
4a 4a
4b 4b
WA 16
1 (Ala114) 1

См. Pestka et al. (1997) "Interferon Standardization and Designations" J Interferon Cytokine Res 17: Supplement 1, S9-S14. Иногда IFNα B2 также называют IFNα B, и его не следует путать с IFNβ. Природный IFNα из лейкоцитов (лейкоцитарный IFN), а также эти подтипы рекомбинантного белка IFNα человека доступны в PBL Biomedical Labs, Piscataway, NJ (interferonsource.com). Природный IFNα представляет собой сложную смесь подтипов IFNα. IFNβ в используемых в настоящей заявке природных препаратах IFNα выявлено не было. Способы выявления и разбиения этих интерферонов на группы, например, ELISA и RIA, известны в данной области. См. Staehelin et al. (1981) Methods in Enzymology 79 (S. Pestka, ed.) Academic Press, NY 589-595; Kelder et al. (1986) Methods in Enzymology 119 (S. Pestka, ed.) Academic Press, NY 582-587; Stewart (2003) выше; Bennett, et al. (2003) J. Exp. Med. 197(6):711-723; Baechler, et al. (2003) Proc. Natl. Acad. Sci. USA 100(5):2610-2615.

В рамках настоящей заявки термин "продуцирующая IFNα клетка" относится к специализированному лейкоциту, который ответственен за продукцию IFNα, неспецифически индуцируемую двухцепочечной РНК, (дц)РНК, вирусами, бактериями, простейшими, определенными линиями клеток и неметилированной CpG-ДНК. Ronnblom and Aim (2004) J. Exp. Med. 194(12):F59-F63.

В рамках настоящей заявки выражение "состояние или заболевание, связанное с IFNα", относится к патологическим и оказывающим вредное воздействие заболеваниям или доклиническим стадиям заболеваний, которые связаны с повышенными уровнями IFNα в сыворотке пациента. Примеры таких заболеваний включают в себя, но ими не ограничиваются, SLE, реакцию "трансплантат против хозяина" (GVHD), диабет типа 1, СПИД (обусловленный вирусом иммунодефицита человека (ВИЧ)), аутоиммунный тиреоидит, псориаз и волчанку. Способы определения уровня IFNα известны в данной области и описаны в настоящей заявке.

В рамках настоящей заявки термин "иммунная реакция" относится к антигенспецифичным реакциям лимфоцитов на чужеродные вещества. Любое вещество, способное вызывать иммунную реакцию, считают "иммуногенным" и называют "иммуногеном". Все иммуногены являются антигенами, однако не все антигены иммуногенны. Иммунная реакция может быть гуморальной (посредством активности антител) или опосредованной клетками (через активацию T-клеток).

В рамках настоящей заявки термины "иммунологическое связывание" и "способность к иммунологическому связыванию" относятся к типу нековалентных взаимодействий, происходящих между молекулой иммуноглобулина и антигеном, к которому специфичен иммуноглобулин. Прочность, или аффинность, взаимодействий при иммунологическом связывании можно выражать в терминах константы диссоциации (Kd) взаимодействия, где наименьшая Kd отражает наибольшую аффинность. Способность к иммунологическому связыванию для выбранных полипептидов можно количественно определять с использованием известных в данной области способов. Один такой способ включает измерение скоростей образования и диссоциации комплекса антигенсвязывающий участок/антиген, где эти скорости зависят от концентраций членов комплекса, аффинности взаимодействия и геометрических параметров, которые в равной степени в обоих направлениях влияют на скорость. Таким образом, "константу скорости в прямом направлении" (Kпр) и "константу скорости в обратном направлении" (Kобр) можно определять вычислением концентраций и действительных скоростей ассоциации и диссоциации, как хорошо известно в данной области. Соотношение Kобр/Kпр позволяет устранять все параметры, не связанные с аффинностью, и, таким образом, является равным константе диссоциации Kd. См., например, Coligan, et al., CURRENT PROTOCOLS IN IMMUNOLOGY, Wiley, NY (1999).

В рамках настоящей заявки термин "выделенный" относится к антителу, выявленному и выделенному и/или восстановленному из компонента из его природного окружения. Загрязняющие компоненты из его природного окружения представляют собой вещества, которые могут препятствовать диагностическому или терапевтическому применению антитела и которые могут включать в себя ферменты, гормоны и другие белковые или небелковые растворы. В предпочтительных вариантах осуществления антитела очищают (1) до более чем 95% масс. антитела, как определяют способом Lowry, а наиболее предпочтительно - более чем 99% масс., (2) до степени, достаточной для получения по крайней мере 15 остатков N-концевой или внутренней аминокислотной последовательности с использованием секвенатора с вращающимся стаканом, или (3) до гомогенности при SDS-PAGE в восстанавливающих или невосстанавливающих условиях с использованием окрашивания Кумасси синим или, предпочтительно, серебром. Выделенное антитело включает в себя антитело in situ в рекомбинантных клетках, поскольку отсутствует по крайней мере один компонент природного окружения антитела. Однако, как правило, выделенное антитело можно получать посредством по крайней мере одной стадии очистки. Моноклональные антитела и их варианты и производные считают выделенными антителами.

В рамках настоящей заявки термин "изотип" относится к классу антител на основе аминокислотной последовательности константного домена их тяжелых цепей. Существуют пять основных изотипов иммуноглобулинов: IgA, IgD, IgE, IgG и IgM, а некоторые из них можно дополнительно подразделить на подклассы, например, IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2.

"Волчанка" относится к некоторым заболеваниям или нарушениям. "Системная красная волчанка" (SLE) представляет собой форму заболевания, способную поражать множество частей организма. Симптомы SLE могут быть умеренными или тяжелыми, и они рассмотрены в настоящей заявке. "Дискоидная красная волчанка" представляет собой хроническое заболевание кожи, при котором на лице, коже черепа или где-либо еще возникает красная выпуклая сыпь. Выпуклые области могут становиться утолщенными и чешуйчатыми и могут вызывать образование рубца. Сыпь может длиться в течение суток или лет и может возникать заново. SLE есть или развивается впоследствии у малого процента людей с дискоидной волчанкой. "Подострая кожная красная волчанка" относится к повреждениям кожи, возникающим в областях организма, подвергающихся воздействию солнечных лучей. "Лекарственная волчанка" представляет собой форму волчанки, обусловленную определенными лекарственными средствами. Симптомы сходны с симптомами при SLE (артрит, сыпь, лихорадка и боль в груди) и, как правило, они полностью исчезают при прекращении приема лекарственного средства. Почки и головной мозг вовлекаются редко. "Волчанка у новорожденных" представляет собой редкое заболевание, которое может возникать у новорожденных детей женщин с SLE, синдромом Шегрена или вообще не имеющих заболевания, и может быть обусловлено аутоантителами в крови матери, называемыми антителами против Ro (SSA) и антителами против La (SSB). Как правило, при рождении у младенца наблюдают кожную сыпь, проблемы с печенью и низкое количество форменных элементов крови.

В рамках настоящей заявки подразумевают, что термин "фармацевтически приемлемый носитель" включает любые общепринятые фармацевтические носители, например, забуференный фосфатом физиологический раствор, воду и эмульсии, такие как эмульсия масло/вода или вода/масло, а также различные виды увлажнителей. Также композиции могут содержать стабилизаторы и консерванты, а также любые из указанных выше носителей с дополнительным условием, что они приемлемы для использования in vivo. Для примеров носителей, стабилизаторов и адъювантов см. Martin REMINGTON'S PHARM. SCI, 18th Ed., Mack Publ. Co., Easton, PA (1995), и в "PHYSICIAN'S DESK REFERENCE", 58th ed., Medical Economics, Montvale, N.J. (2004).

В рамках настоящей заявки термины "избирательно нейтрализует" и "избирательно нейтрализующий" относятся к выделенному и очищенному антителу (такому как, но им не ограничиваясь, моноклональное антитело), которое избирательно нейтрализует биоактивность одного или нескольких подтипов белка "IFNα" по крайней мере на 40%, но в значительной степени не нейтрализует по крайней мере одну биоактивность другого подтипа белка IFNα, где биоактивность представляет собой активацию промотора MxA или противовирусную активность. Поскольку различные подтипы IFNα различаются функциями, предпочтительно избирательно нейтрализовывать конкретные формы IFNα для контроля над конкретными функциями. Одно или несколько антител по настоящему изобретению специфичны к IFNα, но при этом также являются "избирательными" в отношении одного или нескольких подтипов, но не в отношении других. Для избирательной нейтрализации одного или нескольких подтипов белка IFNα, например, A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b, были выявлены, выделены, охарактеризованы и очищены, как описано в настоящей заявке, один или несколько антигенных эпитопов IFNα, которые в значительной степени не реагируют перекрестно с антигенными эпитопами, например, подтипа D.

В рамках настоящей заявки выражение "в значительной степени не нейтрализует" относится к антителу, нейтрализующему биоактивность конкретного подтипа IFNα (или IFNβ) менее чем на 40%, где биоактивность измеряют анализом с использованием гена-репортера MxA (анализ RG) или анализом цитопатического эффекта (анализ CPE) в соответствии с описанными в настоящей заявке условиями. В некоторых вариантах осуществления антитело по изобретению нейтрализует биоактивность конкретного подтипа IFNα в значительной степени не более чем на 35%, 30%, 25%, 20%, 15%, 10%, 5%, 2% или даже не более чем на 1%.

В рамках настоящей заявки термин "индивидуум" относится к позвоночному, предпочтительно - млекопитающему, более предпочтительно - человеку. Млекопитающие включают в себя, но ими не ограничиваются, грызунов, человекообразных обезьян, человека, сельскохозяйственных животных, лошадей, собак и кошек.

Существующие в настоящее время варианты лечения SLE являются симптоматическими и вызывают общее подавление иммунитета; эти варианты включают глюкокортикоиды, циклофосфамид, азатиоприн и мофетил микофенолата. Их эффективность является лишь частичной и часто наблюдаются нежелательные побочные эффекты, такие как повышенная восприимчивость к инфекциям. Таким образом, специфическая нейтрализация IFN-α у пациентов с SLE является привлекательным способом контролирования патологии при заболевании. Поскольку в значительной степени нерегулируемая продукция IFN-α посредством pDC играет важную роль в постоянном существовании цикла заболевания, нейтрализация биоактивности IFN-α с использованием блокады специфичными MAb обеспечивает нацеленное терапевтическое средство, которое не нарушает способность пациентов к возникновению эффективных иммунных реакций на патогены. Для желаемого MAb-кандидата против IFN-α необходимы специфические характеристики, включающие: (i) способность реагировать на большинство или все подтипы IFN-α человека, вовлеченные в этиологию SLE; (ii) способность блокировать биологическую активность таких подтипов IFN-α, (iii) неспособность блокировать IFN-β или IFNAR; и/или (iv) высокую аффинность. Нейтрализация IFN-α, а не IFNAR, может также обеспечивать более безопасное и более специфичное лекарственное средство, поскольку этот способ не влияет на противовирусные эффекты пути передачи сигналов для IFN-β, в котором используется тот же рецептор, что и для IFN-α. С этой целью изобретение также относится к сериям моноклональных антител (MAb), способных нейтрализовывать IFN-α человека. Например, два из таких MAb против IFN-α способны блокировать биоактивность тринадцати подтипов рекомбинантных IFN-α, а также двух сложных смесей IFN, получаемых при вирусной инфекции. В одном из аспектов изобретение относится к семи MAb, различно нейтрализующих IFN-α человека, три из которых в значительной степени нейтрализуют вплоть до тринадцати подтипов рекомбинантных IFN-α и сложные смеси IFN-α (коммерчески доступный лейкоцитарный IFN и супернатанты, получаемые при инфицировании PBMC вирусом гриппа). Два из MAb, ACO-1 и ACO-2, также согласованно блокируют биоактивность сыворотки от пациентов с SLE, у которых наблюдают "характерные признаки" IFN-α при анализе посредством микрочипа. Поскольку ACO-1 и ACO-2 в значительной степени не нейтрализуют биоактивность белка IFN-α подтипов D и 1, но нейтрализуют биоактивность IFN-α сыворотки при SLE, то, вероятно, эти подтипы существенно не вовлечены в этиологию SLE. Соответственно, желательно лечить SLE с использованием антител, таких как гуманизированные или неантигенные (например, деиммунизированные) варианты ACO-1 и ACO-2, которые блокируют биоактивность подтипов IFN-α, связанных с SLE, но не блокируют биоактивность белка IFN-α подтипов (D и 1), в значительной степени не связанных с SLE.

Также изобретение относится к антителу, избирательно нейтрализующему биоактивность по крайней мере двух подтипов белка интерферона-альфа ("IFNα"), выбранных из группы, которая состоит из подтипов белка A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b и WA, но в значительной степени не нейтрализующему по крайней мере одну биоактивность белка IFNα подтипа D; где биоактивность представляет собой, например, активацию промотора MxA и/или противовирусную активность. В другом аспекте изобретение относится к способу лечения у индивидуума заболевания или состояния, связанного с патологической экспрессией по крайней мере одного подтипа белка интерферона-альфа ("IFNα"), выбранного из подтипов белка A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b и WA, в отсутствие нейтрализации противовирусной активности белка IFNα подтипа D, где способ включает введение индивидууму эффективного количества одного или нескольких описанных в настоящей заявке антител. Примеры таких антител включают в себя, но ими не ограничиваются, антитела, обозначенные ACO-1, ACO-2, ACO-3, ACO-4, ACO-5, ACO-6, и антитела, преимущественно распознающие тот же эпитоп IFNα, что и любые указанные выше антитела. Предпочтительно, антитела представляют собой моноклональные антитела. Регистрационные номера депозитов ATCC для клеточных линий гибридом, продуцирующих такие моноклональные антитела, указаны ниже. Соответственно, изобретение дополнительно относится к клеточным линиям гибридом, экспрессирующих антитела ACO-1, ACO-2, ACO-3, ACO-4, ACO-5, ACO-6 и ACO-8.

В одном из аспектов изобретение относится к антителу, преимущественно связывающему тот же эпитоп IFNα, что и антитело, выбранное из группы, которая состоит из ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 и ACO-6. Кроме того, изобретение относится к линиям клеток, например, к гибридоме, экспрессирующим такие антитела.

В другом варианте осуществления изобретение относится к антителу, нейтрализующему биоактивность по крайней мере 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 или 14 подтипов белка IFNα, выбранных из подтипов белка A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b и WA, но не нейтрализующему по крайней мере одну биоактивность белка IFNα подтипа D; где биоактивность представляет собой активацию промотора MxA или противовирусную активность. Кроме того, изобретение относится к клеточным линиям гибридом, экспрессирующим такие антитела.

Предоставлены моноклональные антитела, не нейтрализующие по крайней мере одну биоактивность белка IFNα подтипа 1, где биоактивность представляет собой активацию промотора MxA и/или противовирусную активность.

В другом аспекте изобретение относится к моноклональному антителу, избирательно нейтрализующему биоактивность белка IFNα подтипов A, 2, B2, C, F, G, H2, I, K, 4a, 4b и WA, но в значительной степени не нейтрализующему биоактивность белка IFNα подтипов D и 1, где биоактивность представляет собой активацию промотора MxA и/или противовирусную активность. Другие варианты осуществления включают ACO-1 и ACO-2.

В еще одном аспекте изобретение относится к моноклональному антителу, избирательно нейтрализующему биоактивность белка IFNα подтипов A, 2, B2, C, I, K и 4a, но в значительной степени не нейтрализующему биоактивность белка IFNα подтипов D, F, G, 4b и 1; где биоактивность представляет собой активацию промотора MxA и/или противовирусную активность. Один из таких вариантов осуществления представляет собой антитело ACO-3, получаемое посредством клетки ACO-3 и ее производных.

В другом аспекте изобретение относится к антителу, избирательно нейтрализующему биоактивность белка IFNα подтипов A, 2, B2 и C, но в значительной степени не нейтрализующему биоактивность белка IFNα подтипов D, 4b и 1, где биоактивность представляет собой активацию промотора MxA и/или противовирусную активность. Один из таких вариантов осуществления представляет собой антитело ACO-4 и его производные, получаемые посредством клетки ACO-4 и ее производных.

В другом аспекте антитело по этому изобретению избирательно нейтрализует биоактивность IFNα 4a, но избирательно не нейтрализует IFNα 4b, где биоактивность представляет собой активацию промотора MxA. Примеры таких антител представляют собой антитела, обозначенные ACO-3 и ACO-4, а также их производные, получаемые, например, посредством клеток ACO-3 и ACO-4 и их производных, соответственно.

В еще одном аспекте изобретение относится к моноклональному антителу, избирательно нейтрализующему биоактивность белка IFNα подтипов A, 2, G, I, K, WA и 1, но в значительной степени не нейтрализующему биоактивность белка IFNα подтипов B2 и D, где биоактивность представляет собой активацию промотора MxA и/или противовирусную активность. Один из таких вариантов осуществления представляет собой антитело ACO-5 и его производные, получаемые, например, посредством клетки ACO-5 и ее производных.

В дополнительном варианте осуществления изобретение относится к моноклональному антителу, избирательно нейтрализующему биоактивность белка IFNα подтипов 2 и C, но не нейтрализующему биоактивность белка IFNα подтипов A, B2, C, D, F и 1, где биоактивность представляет собой активацию промотора MxA. Примером является антитело ACO-6 и его производные, получаемые посредством клетки ACO-6 и ее производных.

В еще одном аспекте изобретение относится к моноклональному антителу, избирательно нейтрализующему биоактивность белка IFNα подтипов A, 2, B2, D, F, I, 4a, 4b и 1, но в значительной степени не нейтрализующему биоактивность белка IFNα подтипов C, H2, K и WA, где биоактивность представляет собой активацию промотора MxA. Примером является антитело ACO-8 и его производные, получаемые посредством клетки ACO-8 и ее производных.

Также моноклональные антитела по изобретению включают гуманизированное антитело, антитело человека, химерное антитело, фрагмент антитела, такой как фрагмент Fab, фрагмент F(ab')2, фрагмент Fab' или любой другой фрагмент(ы), известный специалисту в данной области. В одном из примеров антитело представляет собой гуманизированное химерное антитело.

В еще одном варианте осуществления изобретение относится к способу получения клеточной линии гибридом, например, посредством иммунизации млекопитающего композицией, которая содержит рекомбинантный IFNα подтипов A, B2 и F; слияния спленоцитов от млекопитающего в линию миеломных клеток для получения гибридом; и выявления клеточной линии гибридом, продуцирующей моноклональное антитело, которое избирательно нейтрализует один или несколько подтипов белка IFNα, выбранных из группы, состоящей из 2, C, G, I, J1, K, 4a, 4b и WA, а также 1, но которое избирательно не нейтрализует белок IFNα подтипа D.

В рамках настоящей заявки термин "нейтрализует" относится к способности антитела ингибировать одну или несколько биологических активностей подтипа белка IFNα по крайней мере на 40%, как определяют посредством описанных в настоящей заявке анализов RG, CPE или дифференцировки моноцитов. Например, антитело нейтрализует биологическую активность подтипа белка IFNα по крайней мере на 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% или 100%. Биологическая активность IFNα включает в себя транскрипционную активацию промотора MxA (см., например, анализ "RG", ниже), противовирусную активность (например, анализ цитопатического эффекта ("CPE")) и способность сыворотки при SLE вызывать дифференцировку моноцитов в дендритные клетки. Способы определения % нейтрализации с использованием анализа RG и анализа CPE описаны в настоящей заявке.

В рамках настоящей заявки выражения "не нейтрализует" или "в значительной степени не нейтрализует" относятся к антителам, нейтрализующим биологическую активность подтипа белка IFNα менее чем на 40%, где нейтрализующий эффект добавляемого антитела измеряют посредством RG, CPE или анализа дифференцировки моноцитов. Например, антитело нейтрализует биоактивность менее чем на 35% или менее чем на 35%, или менее чем на 30%, или менее чем на 25%, или менее чем на 20%, или менее чем на 15%, или менее чем на 10%, или менее чем на 8%, или менее чем на 5%, или менее чем на 3%, или даже менее чем на 1%.

Антитело по изобретению может представлять собой варианты, производные или фрагменты антитела. В одном из аспектов антитела являются выделенными. В другом аспекте антитела сочетают с приемлемым носителем. Антитела можно выделять из любого вида, мыши, крысы, человекообразной обезьяны, или получать рекомбинантным способом. Примеры моноклональных антител мыши представляют собой антитела, обозначенные ACO-1, ACO-2, ACO-3, ACO-4, ACO-5, ACO-6 и ACO-8. Также это изобретение относится к клеточным линиям гибридом, продуцирующим такие моноклональные антитела, по отдельности, в сочетании с носителем или в культуре.

Также это изобретение относится к полипептидам, которые включают антитело, его вариант, производное или фрагмент, включая в себя, но ими не ограничиваясь, цепи иммуноглобулинов и CDR. Предпочтительно, полипептиды связывают, ингибируют и/или нейтрализуют IFNα, как описано выше, с той же или сходной аффинностью и/или способностью.

Кроме того, настоящее изобретение относится к антиидиотипическому антителу, реагирующему с любым из антител от ACO-1 до ACO-6 или ACO-8. Антиидиотипическое антитело представляет собой антитело, получаемое против уникальных детерминант отдельного антитела. Антиидиотипические антитела эффективны для выявления связавшихся антител в иммуноанализах и для других вариантов применения. Антиидиотипическое антитело по изобретению может включать в себя или может быть получено от любого млекопитающего, такого как, но ими не ограничиваясь, человек, мышь, кролик, крыса, грызун, примат и т.п.

Кроме того, одно или несколько из указанных выше антител можно сочетать с носителем, фармацевтически приемлемым носителем или медицинским устройством, приемлемым для использования антитела или соответствующей композиции в способах диагностики или лечения. Носитель может представлять собой носитель в виде жидкой фазы или носитель в виде твердой фазы, например гранулу, гель или такую молекулу носителя, как липосома. Кроме того, необязательно, композиция может содержать по крайней мере одно дополнительное соединение, белок или композицию. Дополнительный пример "носителей" включает терапевтически активные средства, такие как другой пептид или белок (например, фрагмент Fab', J-цепь, другое антитело, токсин и т.п.). Например, антитело против IFNα по этому изобретению, его вариант, производное или фрагмент могут быть функционально связаны (например, посредством химического связывания, генетического слияния, нековалентного связывания или иным способом) с одной или несколькими другими молекулами, такими как другое антитело (например, для получения биспецифичного или полиспецифичного антитела), цитотоксин, клеточный лиганд или антиген. Соответственно, это изобретение включает большое разнообразие конъюгатов антител, би- и полиспецифичных молекул и слитых белков, вне зависимости от того, нацелены они или нет на тот же эпитоп, что и антитела по этому изобретению.

Дополнительными примерами носителей являются органические молекулы (также называемые модифицирующими веществами) или активирующие вещества, которые можно ковалентно присоединять, прямо или косвенно, к антителу по этому изобретению. Присоединение молекулы может улучшать фармакокинетические характеристики (например, повышенное время полужизни в сыворотке in vivo). Примеры органических молекул включают в себя, но ими не ограничиваются, гидрофильную полимерную группу, группу жирной кислоты или группу сложного эфира жирной кислоты. В рамках настоящей заявки термин "жирная кислота", например, относится к монокарбоновым кислотам и дикарбоновым кислотам. В рамках настоящей заявки термин "гидрофильная полимерная группа" относится к органическому полимеру, например, более растворимому в воде, чем в октане.

Гидрофильные полимеры, приемлемые для модифицирования антител по изобретению, могут быть линейными или разветвленными и включают в себя, например, полиалкангликоли (например, полиэтиленгликоль (PEG), монометоксиполиэтиленгликоль (mPEG), полипропиленгликоль (PPG) и т.п.), углеводы (например, декстран, целлюлозу, олигосахариды, полисахариды и т.п.), полимеры гидрофильных аминокислот (например, полилизин, полиаргинин, полиаспартат и т.п.), полиалканоксиды (например, полиэтиленоксид, полипропиленоксид и т.п.) и поливинилпирролидон. Приемлемый гидрофильный полимер для использования вместе с антителом по изобретению может иметь молекулярную массу, например, приблизительно от 800 до приблизительно 150000 Дальтон в виде отдельной молекулы. Гидрофильную полимерную группу можно замещать с использованием от одной до приблизительно шести алкильных групп, групп жирной кислоты или групп сложного эфира жирной кислоты. Гидрофильные полимеры, замещенные группой жирной кислоты или группой сложного эфира жирной кислоты, можно получать с использованием соответствующих способов. Например, содержащий аминогруппу полимер можно связывать с карбоксилатной группой жирной кислоты или сложного эфира жирной кислоты, а активированную карбоксилатную группу (например, активированную посредством N,N-карбонилдиимидазола) в жирной кислоте или сложном эфире жирной кислоты можно связывать с гидроксильной группой полимера.

Жирные кислоты и сложные эфиры жирных кислот, приемлемые для модификации антител по изобретению, могут быть насыщенными или могут содержать одно или несколько ненасыщенных звеньев. Примеры таких веществ включают в себя, но ими не ограничиваются, н-додеканоат, н-тетрадеканоат, н-октадеканоат, н-эйкозаноат, н-докозаноат, н-триаконтаноат, н-тетраконтаноат, цис-δ-9-октадеканоат, полностью цис-δ-5,8,11,14-эйкозатетраеноат, октандиовую кислоту, тетрадекандиовую кислоту, октадекандиовую кислоту, докозандиовую кислоту и т.п. Приемлемые сложные эфиры жирных кислот включают сложные моноэфиры дикарбоновых кислот, содержащих линейную или разветвленную группу низшего алкила. Группа низшего алкила может содержать от одного до приблизительно двенадцати, предпочтительно, от одного до приблизительно шести атомов углерода.

В еще одном аспекте настоящее изобретение относится к трансгенному, не относящемуся к человеку животному, такому как трансгенная мышь (также называемая в настоящей заявке "мышью для MAb человека"), у которой экспрессируется полностью принадлежащее человеку моноклональное антитело, которое нейтрализует по крайней мере один подтип белка IFNα сходно с антителом по этому изобретению, как описано выше. В конкретном варианте осуществления трансгенное, не относящееся к человеку животное представляет собой трансгенную мышь с геномом, включающим трансген тяжелой цепи человека и трансген легкой цепи человека, которые кодируют все или часть антитела против альфа-V по изобретению. Для получения антител человека трансгенное, не относящееся к человеку животное можно иммунизировать очищенным или обогащенным препаратом белка IFNα подтипов A, B и F. Пример трансгенного, не относящегося к человеку животного может представлять собой, например, трансгенную мышь, способную продуцировать множество изотипов моноклональных антител человека против IFNα (например, IgG, IgA и/или IgM) вследствие прохождения рекомбинации V-D-J и переключения изотипов. Например, переключение изотипов может происходить вследствие классического или неклассического переключения изотипов.

Соответственно, в другом варианте осуществления изобретение относится к выделенным клеткам, происходящим или выделенным из трансгенного, не относящегося к человеку животного, как описано выше, например, из трансгенной мыши, экспрессирующей антитела человека. Затем выделенные B-клетки можно иммортализовывать посредством слияния с иммортализованной клеткой для получения источника (например, гибридомы) антител человека. Эти гибридомы также включены в объем изобретения.

Кроме того, настоящее изобретение относится к способу или композиции по крайней мере одного антитела для диагностики по крайней мере одного связанного с IFNα состояния в клетке, ткани, органе, животном или пациенте и/или до, после или в течение соответствующего состояния, как известно в данной области и/или описано в настоящей заявке. Также их используют для прогноза или наблюдения за развитием заболевания.

Также предоставлена композиция, содержащая по крайней мере одно антитело против IFNα по этому изобретению, его вариант, производное или фрагмент, приемлемые для введения в эффективном количестве для изменения или ослабления связанных с IFNα симптомов или для лечения по крайней мере одного связанного с IFNα состояния в клетке, ткани, органе, животном или пациенте и/или до, после или в течение соответствующего состояния, как известно в данной области и/или описано в настоящей заявке. Например, композиции включают фармацевтические и диагностические композиции/наборы, в том числе фармацевтически приемлемый носитель и по крайней мере одно антитело против IFNα по этому изобретению, его вариант, производное или фрагмент. Кроме того, как указано выше, композиция может содержать дополнительные антитела или терапевтические средства, которые в сочетании обеспечивают множественное лечение, предназначенное для обеспечения максимальной терапевтической пользы.

Альтернативно, композицию по этому изобретению можно вводить совместно с другими терапевтическими и цитотоксическими средствами, вне зависимости от того, связаны ли они с ними или вводятся ли в одной и той же дозе. Их можно совместно вводить одновременно с такими средствами (например, в единой композиции или по отдельности) или можно вводить до или после введения таких средств. Такие средства могут включать кортикостероиды, нестероидные иммунодепрессанты, противомалярийные средства и нестероидные противовоспалительные лекарственные средства. Композиции можно сочетать с альтернативными вариантами лечения, такими как введение кортикостероидов, нестероидных иммунодепрессантов, противомалярийных средств и нестероидных противовоспалительных лекарственных средств.

В другом аспекте изобретение относится к способам избирательной нейтрализации биоактивности по крайней мере двух подтипов белка интерферона-альфа ("IFNα"), выбранных из группы, которая состоит из подтипов белка A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b и WA, в отсутствие избирательной нейтрализации по крайней мере одной биоактивности белка IFNα подтипа D; где биоактивность представляет собой активацию промотора MxA или противовирусную активность. Для способа необходимо контактирование образца, в котором предполагают наличие подтипа, с моноклональным антителом, избирательно нейтрализующим подтип. Примеры таких антител включают в себя, но ими не ограничиваются, антитела, обозначенные ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 и ACO-6.

Это изобретение относится к различным способам лечения. Например, в этом описании указаны способы ослабления симптомов, связанных с патологической экспрессией по крайней мере одного подтипа белка интерферона-альфа ("IFNα"), выбранного из группы, которая состоит из подтипов белка A, 2, B2, C, F, G, H2, I, K, 4a, 4b и WA, при отсутствии связывания у индивидуума белка IFNα подтипов D и 1, где способ включает введение индивидууму эффективного количества антитела, избирательно нейтрализующего подтип. Примеры этого указаны выше.

Изобретение относится к способам лечения заболевания или состояния, приводящего к патологической экспрессии по крайней мере одного подтипа белка интерферона-альфа ("IFNα"), выбранного из группы, которая состоит из подтипов белка A, 2, B2, C, F, G, H2, I, K, 4a, 4b и WA, при отсутствии связывания у индивидуума белка IFNα подтипов D и 1, где способ включает введение индивидууму эффективного количества антитела, избирательно нейтрализующего подтип. Примеры этого указаны выше. Кроме того, предоставлены способы иммунизации посредством введения млекопитающему композиции, содержащей рекомбинантный IFNα подтипов A, B2 и F. В другом варианте осуществления способ иммунизации включает введение млекопитающему композиции, преимущественно содержащей IFNα подтипов A, B2 и F, фармацевтически приемлемый носитель и, необязательно, один или несколько адъювантов. В альтернативном аспекте иммунизация приводит к образованию антител, нейтрализующих белок IFNα подтипов A, B2 и F, но не белок IFNα подтипов D и 1. В другом аспекте способ и композиция нейтрализуют IFNα 4a, но не IFNα 4b (например, ACO-3).

Для использования in vivo антитела и композиции по этому изобретению вводят или доставляют пациентам (например, человеку) в терапевтически эффективных дозах для нейтрализации выбранных подтипов IFNα. Кроме того, введение или доставку эффективных количеств антител или композиций по этому изобретению можно использовать для лечения или ослабления у индивидуума симптомов связанного с IFNα состояния, такого как SLE, диабет, псориаз или СПИД, используя любой приемлемый способ введения клинических продуктов на основе антител. В данной области известны множество способов, например, инъекция или инфузия.

Лекарственные формы. Стандартная лекарственная форма для использования антител по настоящему изобретению может представлять собой одно соединение или его смеси с другими соединениями. Соединения можно смешивать вместе, образуя ионные или даже ковалентные связи. Одно или несколько антител по настоящему изобретению можно вводить в форме для перорального, внутривенного (болюсно или инфузией), внутрибрюшинного, подкожного или внутримышечного введения, где все используемые лекарственные формы хорошо известны специалистам в фармацевтической области. В зависимости от конкретного расположения или способа доставки можно использовать различные лекарственные формы, например таблетки, капсулы, пилюли, порошки, гранулы, эликсиры, настойки, суспензии, сиропы и эмульсии, для доставки антитела(ел) по настоящему изобретению пациенту при необходимости лечения, включающего нейтрализацию определенных подтипов IFNα, как описано в настоящей заявке. Как правило, антитела являются гидрофобными, но их можно вводить в виде любой известной соли.

Как правило, антитела вводят в смеси с приемлемыми фармацевтическими солями, буферами, разбавителями, наполнителями, эксципиентами и/или носителями (в совокупности называемых в настоящей заявке фармацевтически приемлемым носителем или веществами-носителями), которые выбирают на основе предполагаемого способа введения и согласно общепринятой фармацевтической практике. В зависимости от наилучшего участка для введения антитела можно составлять для обеспечения, например, максимальной и/или соответствующей дозы для конкретной формы для перорального, ректального, местного введения, внутривенной инъекции или парентерального введения. Кроме того, антитела, например, гуманизированные формы ACO-1, ACO-2, ACO-3, ACO-4, ACO-5, ACO-6 и ACO-8, можно вводить по отдельности или в сочетании, в фармацевтически приемлемом носителе. Носитель может быть твердым или жидким в зависимости от выбранного вида и/или участка для введения.

Способы и композиции для получения эффективных лекарственных форм с использованием настоящего изобретения описаны в одной или нескольких следующих ссылках: Ansel, Introduction to Pharmaceutical Dosage Forms 2nd Edition (1976); Remington's Pharmaceutical Sciences, 17th ed. (Mack Publishing Company, Easton, Pa., 1985); Advances in Pharmaceutical Sciences (David Ganderton, Trevor Jones, Eds., 1992); Advances in Pharmaceutical Sciences Vol 7. (David Ganderton, Trevor Jones, James McGinity, Eds., 1995); Aqueous Polymeric Coatings for Pharmaceutical Dosage Forms (Drugs and the Pharmaceutical Sciences, Series 36 (James McGinity, Ed., 1989); Pharmaceutical Particulate Carriers: Therapeutic Applications: Drugs and the Pharmaceutical Sciences, Vol 61 (Alain Rolland, Ed., 1993); Drug Delivery to the Gastrointestinal Tract (Ellis Horwood Books in the Biological Sciences. Series in Pharmaceutical Technology; J. G. Hardy, S.S. Davis, Clive G. Wilson, Eds.); Modern Pharmaceutics Drugs and the Pharmaceutical Sciences, Vol 40 (Gilbert S. Banker, Christopher T. Rhodes, Eds.) и т.п., соответствующие части которых приведены здесь в качестве ссылки.

Антитела по настоящему изобретению можно вводить в виде липосомных систем доставки, например, небольших однослойных везикул, больших однослойных везикул и многослойных везикул, несущих или не несущих заряд. Липосомы могут включать одно или несколько из фосфолипидов (например, холестерина), стеариламина и/или фосфатидилхолинов, их смесей и т.п.

Также антитела можно связывать с одним или несколькими растворимыми, биоразлагаемыми, биоприемлемыми полимерами в виде носителей лекарственного средства или в виде пролекарства. Такие полимеры могут включать поливинилпирролидон, сополимер пирана, полигидроксилпропилметакриламидфенол, полигидроксиэтиласпартамидфенол или замещенный остатками пальмитоила полиэтиленоксидполилизин, их смеси и т.п. Кроме того, антитела можно связывать с одним или несколькими биоразлагаемыми полимерами для достижения контролируемого высвобождения антител, где биоразлагаемые полимеры для использования по настоящему изобретению включают полимер молочной кислоты, полимер гликолевой кислоты, сополимеры молочной и гликолевой кислот, полиэпсилонкапролактон, полимер гидроксимасляной кислоты, сложные полиортоэфиры, полиацетали, полидигидропираны, полицианоацилаты и сшитые или амфипатические блок-сополимеры гидрогелей, их смеси и т.п.

Для направленной доставки в носовые проходы, пазухи, полость рта, горло, пищевод, трахею, легкие и альвеолы антитела можно также доставлять в виде формы для интраназального введения с использованием приемлемого интраназального носителя. Для дермальной или трансдермальной доставки антитела можно доставлять с использованием лосьонов, кремов, масел, эликсиров, сывороток, трансдермальных кожных пластырей и т.п., как хорошо известно специалистам в данной области. Формы для парентерального и внутривенного введения могут также содержать фармацевтически приемлемые соли и/или минеральные вещества, а также другие вещества для достижения их совместимости с типом выбранной инъекции или системы доставки, например, забуференный изотонический раствор. Примеры эффективных фармацевтических лекарственных форм для введения антител могут включать следующие формы.

Раствор для инъекции. Композицию для парентерального применения, приемлемую для введения инъекцией, получают перемешиванием 1,5% масс. активного ингредиента в деионизированной воде и смешиванием, например, вместе с вплоть до 10% об. пропиленгликоля и воды. Раствор делают изотоническим с использованием хлорида натрия и стерилизуют, например, посредством ультрафильтрации. Стерильные растворы для инъекции получают включением активных соединений в необходимых количествах в соответствующий растворитель вместе с различными другими ингредиентами, которые перечислены выше, как необходимо, с последующей стерилизацией фильтрацией. Как правило, дисперсии получают включением различных стерилизованных активных ингредиентов в стерильный носитель с основной дисперсионной средой. В случае стерильных порошков для получения стерильных растворов для инъекции эффективные способы для получения сухого порошка включают в себя вакуумную сушку, замораживание орошением, вакуумную сушку при наличии нагревания и способы лиофилизации, посредством которых получают порошок активного ингредиента вместе с любым дополнительным желаемым ингредиентом из его предшествующего, стерилизованного фильтрацией раствора. Антитела по настоящему изобретению можно доставлять в виде микро- или наночастиц в форме для инъекции или посредством легочной или другой доставки.

Суспензии. В одном из вариантов осуществления водную суспензию можно получать для введения таким образом, что каждые 5 мл содержат, например, 0,001-1000 мг тонкоизмельченного активного ингредиента, 200 мг карбоксиметилцеллюлозы натрия, 5 мг бензоата натрия, 1,0 г раствора сорбита и физиологический раствор до 0,01, 0,1, 1, 5 или 10 мл.

Эффективная доза антитела может содержать количества, достигающие после восстановления, в случае влажной/сухой системы, концентраций приблизительно от 1,0 мкг/мл до приблизительно 1000 мг/мл, хотя низшая и высшая концентрации являются функциональными и зависят от предполагаемого носителя для доставки, например, препараты раствора отличаются от трансдермального пластыря, способов легочного введения, введения через слизистую или осмотических способов, или способов с использованием микропомп.

В настоящей заявке предоставлены препараты, содержащие антитело по этому изобретению. Препараты по настоящему изобретению можно получать способом, включающим смешивание по крайней мере одного антитела по этому изобретению и консерванта, выбранного из группы, которая состоит из фенола, м-крезола, п-крезола, о-крезола, хлоркрезола, бензилового спирта, алкилпарабена (метил, этил, пропил, бутил и т.п.), хлорида бензалкония, хлорида бензетония, дегидроацетата натрия и тимерозала или их смесей в водном разбавителе. Смешивание антитела и консерванта в водном разбавителе осуществляют с использованием общепринятого растворения и процедур смешивания. Например, измеренное количество по крайней мере одного антитела в забуференном растворе сочетают с желаемым консервантом в забуференном растворе в количествах, достаточных для обеспечения антитела и консерванта в желаемых концентрациях. Специалист в данной области понимает различия в этом способе, например, порядок добавления компонентов, использование дополнительных добавок, температуру и pH, при которых получают препарат, где все являются факторами, которые можно оптимизировать для используемой концентрации и способа введения.

Препарат может содержать один или несколько консервантов или стабилизаторов, таких как фенол, м-крезол, п-крезол, о-крезол, хлоркрезол, бензиловый спирт, нитрит фенилртути, феноксиэтанол, формальдегид, хлорбутанол, хлорид магния (например, гексагидрат), алкилпарабен (метил, этил, пропил, бутил и т.п.), хлорид бензалкония, хлорид бензетония, дегидроацетат натрия и тимерозал или их смеси в водном разбавителе. Можно использовать любую приемлемую концентрацию или смесь, как известно в данной области, например, 0,001-5% или любой диапазон или входящую в него величину, например, но ими не ограничиваясь, 0,001, 0,003, 0,005, 0,009, 0,01, 0,02, 0,03, 0,05, 0,09, 0,1, 0,2, 0,3, 0,4, 0,5, 0,6, 0,7, 0,8, 0,9, 1,0, 1,1, 1,2, 1,3, 1,4, 1,5, 1,6, 1,7, 1,8, 1,9, 2,0, 2,1, 2,2, 2,3, 2,4, 2,5, 2,6, 2,7, 2,8, 2,9, 3,0, 3,1, 3,2, 3,3, 3,4, 3,5, 3,6, 3,7, 3,8, 3,9, 4,0, 4,3, 4,5, 4,6, 4,7, 4,8, 4,9 или любой диапазон или входящую в него величину. Неограничивающие примеры включают отсутствие консервантов или такие консерванты, как, например, 0,1-2% м-крезола (например, 0,2, 0,3, 0,4, 0,5, 0,9, 1,0%), 0,1-3% бензилового спирта (например, 0,5, 0,9, 1,1, 1,5, 1,9, 2,0, 2,5%), 0,001-0,5% тимерозала (например, 0,005, 0,01), 0,001-2,0% фенола (например, 0,05, 0,25, 0,28, 0,5, 0,9, 1,0%), 0,0005-1,0% алкилпарабена(ов) (например, 0,00075, 0,0009, 0,001, 0,002, 0,005, 0,0075, 0,009, 0,01, 0,02, 0,05, 0,075, 0,09, 0,1, 0,2, 0,3, 0,5, 0,75, 0,9 и 1,0%).

Композиции и препараты можно доставлять пациентам в виде чистых растворов или в виде сдвоенных флаконов, включающих флакон с лиофилизированным антителом, которое восстанавливают с использованием второго флакона, содержащего водный разбавитель. Флакон с единым раствором или сдвоенный флакон, для которого необходимо восстановление, можно повторно использовать много раз и он может быть достаточным для разового или многократных циклов лечения пациента, и, таким образом, обеспечивает более удобную схему лечения, чем доступные в настоящее время. Общепринятые устройства, включая такие системы из одного флакона, включают в себя такие устройства для доставки в виде устройства для инъекции карандашного типа, как, например, BD Pens, BD Autojectore, HumajectTM NovoPenTM, B-DTMPen, AutoPenTM, а также OptiPenTM, GenotropinPenTM, Genotronorm PenTM, Humatro PenTM, Reco-PenTM, Roferon PenTM, BiojectorTM, IjectTM, безыгольный InjectorTM с J-наконечником, IntrajectTM, Medi-Ject, например, получаемые или разрабатываемые Becton Dickensen (Franklin Lakes, NJ., доступно в bectondickenson.com), Disetronic (Burgdorf, Switzerland, доступно в disetronic.com; Bioject, Portland, Oregon доступно в bioject.com); National Medical Products, Weston Medical (Peterborough, UK, доступно в weston-medical.com), Medi-Ject Corp (Minneapolis, Minn., доступно в mediject.com).

Изобретение относится к набору, содержащему упаковочное вещество и по крайней мере один флакон, который включает раствор по крайней мере антитела, например, по настоящему изобретению, вместе с назначенными буферными веществами и/или консервантами, необязательно, в водном разбавителе, где упаковочное вещество содержит ярлык, на котором указано, что такой раствор можно хранить в течение периода 1, 2, 3, 4, 5, 6, 9, 12, 18, 20, 24, 30, 36, 40, 48, 54, 60, 66, 72 часов или более. Кроме того, изобретение относится к набору, включающему упаковочное вещество, первый флакон, который содержит по крайней мере одно лиофилизированное антитело по этому изобретению, и второй флакон, который содержит водный разбавитель из назначенного буфера или консерванта, где упаковочное вещество включает ярлык, на котором пациенту приведены указания для восстановления антитела в водном разбавителе для получения раствора, способного храниться в течение периода двадцати четырех часов или более.

Наборы. Также настоящее изобретение относится к фармацевтическим наборам, например, эффективным для лечения состояний заболевания, где набор может включать один или несколько контейнеров, содержащих фармацевтическую композицию, которую можно предоставлять как есть, разведенную или ресуспендированную до терапевтически эффективного количества антител. По желанию, такие наборы могут дополнительно содержать один или несколько различных общепринятых фармацевтических компонентов для набора, таких как, например, контейнеры с одним или несколькими фармацевтически приемлемыми носителями, жидкостями, дополнительными контейнерами и т.д., как легко понимают специалисты в данной области. Также в набор можно включать напечатанные инструкции, в виде вкладышей или в виде ярлыков, на которых указаны количества подлежащих введению компонентов, указания для введения и/или указания для смешивания компонентов. Следует понимать, что хотя указанные вещества и условия важны для осуществления изобретения на практике, неуказанные вещества и условия не исключены при условии, что они не препятствуют осуществлению благоприятных эффектов изобретения.

Антитела. Антитела по этому изобретению включают моноклональные антитела. Также они могут представлять собой нейтрализующие IFNα функциональные фрагменты, производные антител или варианты антител. Они могут быть химерными, гуманизированными или полностью принадлежать человеку. Функциональный фрагмент антитела включает в себя, но ими не ограничивается, Fab, Fab', Fab2, Fab'2 и одноцепочечные вариабельные области. Антитела можно получать в культуре клеток, например, в бактериях, дрожжах, растениях или клетках растений, насекомых или клетках насекомых, эукариотической клетке или в различных животных, включая в себя, но ими не ограничиваясь, коров, кроликов, коз, мышей, крыс, хомяков, морских свинок, овец, собак, кошек, обезьян, шимпанзе, человекообразных обезьян и т.д. Фрагмент или производное можно использовать при условии, что они сохраняют специфичность связывания или нейтрализующую способность, как антитела по этому изобретению. Антитела можно тестировать на специфичность связывания посредством сравнения связывания с соответствующим антигеном со связыванием с посторонним антигеном или смесью антигенов при заданном наборе условий. Если антитело связывается с соответствующим антигеном по крайней мере в 2, 5, 7 и даже 10 раз выше, чем с посторонним антигеном или смесью антигенов, то его считают специфичным. Конкретные анализы для определения специфичности, например, ELISA, описаны ниже.

Также антитела характеризуют по их способности нейтрализовать одну или несколько биологических активностей подтипа белка IFNα, например, но ими не ограничиваясь, транскрипционную активацию промотора MxA или другого промотора, индуцируемого IFNα, противовирусную активность, способность сыворотки при SLE вызывать дифференцировку моноцитов в дендритные клетки.

Моноклональные антитела по изобретению можно получать с использованием общепринятых способов гибридом, известных в данной области и хорошо описанных в литературе. Например, гибридому получают слиянием приемлемой иммортализованной линии клеток (например, линии миеломных клеток, такой как, но ими не ограничиваясь, Sp2/0, Sp2/0-AG14, NSO, NS1, NS2, AE-1, L.5, >243, P3X63Ag8.653, Sp2 SA3, Sp2 MAI, Sp2 SS1, Sp2 SA5, U397, MLA 144, ACT IV, MOLT4, DA-1, JURKAT, WEHI, K-562, COS, RAJI, NIH 3T3, HL-60, MLA 144, NAMAIWA, NEURO 2A, CHO, PerC.6, YB2/O) или т.п., или гетеромиелом, их продуктов слияния, или любой происходящей из них клетки или слитой клетки, или любой другой приемлемой клеточной линии, такой как известные в данной области (см., например, www.atcc.org, www.lifetech.com и т.п.), с продуцирующими антитела клетками, такими как, но ими не ограничиваясь, выделенные или клонированные клетки селезенки, периферической крови, лимфы, миндалин или другие иммунные клетки или клетки, содержащие B-клетки, или любые другие клетки, экспрессирующие последовательности константной или вариабельной, или каркасной, или CDR областей тяжелой или легкой цепи, а также эндогенную или гетерологичную нуклеиновую кислоту, например, рекомбинантную или эндогенную, вирусную, бактериальную, водорослевую, прокариотическую, принадлежащую земноводным, насекомым, пресмыкающимся, рыбам, млекопитающим, грызунам, лошадям, овцам, козам, баранам, приматам, эукариотическую, геномную ДНК, кДНК, рДНК, митохондриальную ДНК или РНК, ДНК или РНК хлоропласта, гяРНК, мРНК, тРНК, одно-, двух- или трехцепочечную, гибридизованную и т.п. или любое их сочетание. Также продуцирующие антитела клетки можно получать из периферической крови или, предпочтительно, селезенки или лимфатических узлов человека или других приемлемых животных, которые были иммунизированы интересующим антигеном. Также для экспрессии гетерологичной или эндогенной нуклеиновой кислоты, кодирующей антитело, его конкретный фрагмент или вариант по настоящему изобретению, можно использовать любую другую приемлемую клетку-хозяина. Слитые клетки (гибридомы) или рекомбинантные клетки можно выделять с использованием условий селективного культивирования или другими приемлемыми известными способами и клонировать серийными разведениями или сортировкой клеток, или другими известными способами.

Можно использовать другие приемлемые способы получения или выделения антител требуемой специфичности, в том числе, но ими не ограничиваясь, способы, которыми отбирают рекомбинантное антитело из библиотеки пептидов или белков (например, но ими не ограничиваясь, библиотек бактериофагового, рибосомного, олигонуклеотидного, РНК, кДНК или т.п. дисплея; как, например, доступные у различных коммерческих производителей, таких как Cambridge Antibody Technologies (Cambridgeshire, UK), MorphoSys (Martinsreid/Planegg, Del.), Biovation (Aberdeen, Scotland, UK), BioInvent (Lund, Sweden) и Antitope (Cambridge, UK)), с использованием известных в данной области способов. См. патенты США №№ 4704692; 5723323; 5763192; 5814476; 5817483; 5824514; 5976862. Альтернативные способы основаны на иммунизации трансгенных животных (например, мышей SCID, Nguyen et al. (1977) Microbiol. Immunol. 41:901-907 (1997); Sandhu et al. (1996) Crit. Rev. Biotechnol. 16:95-118; Eren et al. (1998) Immunol. 93:154-161), способных продуцировать набор антител человека, как известно в данной области и/или описано в настоящей заявке. Такие способы включают в себя, но ими не ограничиваются, рибосомный дисплей (Hanes et al. (1997) Proc. Natl. Acad. Sci. USA, 94:4937-4942; Hanes et al., (1998) Proc. Natl. Acad. Sci. USA, 95:14130-14135); способы продукции антител в одной клетке (например, способ выбранного антитела из лимфоцита ("SLAM") (патент США № 5627052, Wen et al. (1987) J. Immunol. 17:887-892; Babcook et al., Proc. Natl. Acad. Sci. USA (1996) 93:7843-7848); способ с использованием микрокапель геля, а также проточная цитометрия (Powell et al. (1990) Biotechnol. 8:333-337; One Cell Systems, (Cambridge, Mass); Gray et al. (1995) J. Imm. Meth. 182:155-163; Kenny et al. (1995) Bio/Technol. 13:787-790); селекция B-клеток (Steenbakkers et al. (1994) Molec. Biol. Reports 19:125-134 (1994)).

Также варианты антител по настоящему изобретению можно получать с использованием доставки полинуклеотида, кодирующего антитело по этому изобретению, в приемлемый организм-хозяин таким образом, чтобы обеспечить трансгенных животных или млекопитающих, таких как козы, коровы, лошади, овцы и т.п., продуцирующих такие антитела в своем молоке. Эти способы известны в данной области и описаны, например, в патентах США №№ 5827690; 5849992; 4873316; 5849992; 5994616; 5565362 и 5304489.

В рамках настоящей заявки термин "вариант антитела" относится к посттрансляционной модификации линейной полипептидной последовательности антитела или фрагмента. Например, в патенте США № 6602684 B1 описан способ получения модифицированных гликольных форм антител, в том числе целых молекул антител, фрагментов антител или слитых белков, содержащих область, которая эквивалентна области Fc иммуноглобулина с усиленной клеточной токсичностью, опосредуемой Fc, где таким образом получают гликопротеины.

Также варианты антител можно получать доставкой полинуклеотида по этому изобретению для обеспечения трансгенных растений и культивируемых клеток растений (например, но ими не ограничиваясь, табак, кукуруза и ряска), продуцирующих в частях растений или в культивируемых из них клетках такие антитела, конкретные участки или варианты. Например, в Cramer et al. (1999) Curr. Top. Microbiol. Immunol. 240:95-118 и цитируемых в настоящей заявке ссылках описано получение трансгенных листьев табака, экспрессирующих большие количества рекомбинантных белков, например, с использованием индуцируемого промотора. Трансгенную кукурузу использовали для экспрессии белков млекопитающих на коммерческих уровнях продукции, где белки обладают биологической активностью, эквивалентной активности белков, продуцируемых в других рекомбинантных системах или очищенных из природных источников. См., например, Hood et al., Adv. Exp. Med. Biol. (1999) 464:127-147 и цитируемые в настоящей заявке ссылки. Также варианты антител, в том числе фрагменты антител, такие как одноцепочечные антитела (scFv), в больших количествах получали из трансгенных семян растений, включая семена табака и клубни картофеля. См., например, Conrad et al. (1998) Plant Mol. Biol. 38:101-109 и цитируемую в настоящей заявке ссылку. Таким образом, антитела по настоящему изобретению можно также получать с использованием трансгенных растений в соответствии с известными способами.

Производные антител можно получать, например, добавлением экзогенных последовательностей для модифицирования иммуногенности или снижения, усиления или модифицирования связывания, аффинности, скорости в прямом направлении, скорости в обратном направлении, авидности, специфичности, времени полужизни или любой другой приемлемой характеристики. Как правило, сохраняют часть или все последовательности CDR, не относящиеся к человеку или принадлежащие человеку, при этом не относящиеся к человеку последовательности вариабельных или константных областей заменяют аминокислотами человека или другими аминокислотами. В целом, остатки CDR непосредственно и в наибольшей степени вовлечены в воздействие на связывание антигена.

Моноклональные антитела, получаемые у мышей (или других не относящихся к человеку животных), обладают при лечении тем риском, что у человека могут образовываться антитела против MAb животного. Таким образом, антитела человека могут снижать эффективность MAb животного и также могут приводить к аллергической реакции. Эту проблему можно избежать конструированием антител, которые не распознаются как чужеродные. Способы конструирования таких антител известны в данной области и часто основаны на присоединении участка CDR из MAb животного к каркасу иммуноглобулина намеченного организма-хозяина. Наиболее распространенным способом является гуманизация, которую можно осуществлять присоединением CDR антитела животного к каркасной области иммуноглобулина человека. В некоторых случаях для сохранения целостности антигенсвязывающего участка оставляют несколько аминокислотных остатков из каркасной области антитела животного.

Гуманизацию или конструирование антител по настоящему изобретению можно осуществлять с использованием любого известного способа, такого как, но ими не ограничиваясь, способы, описанные в патентах США №№ 5723323, 5976862, 5824514, 5817483, 5814476, 5763192, 5723323, 5766886, 5714352, 6204023, 6180370, 5693762, 5530101, 5585089, 5225539 и 4816567. Способы гуманизации антител, основанные на компьютерном моделировании и вариабельных областях, известны специалистам в данной области. См., например, Tsurushita et al. (2005) Humanized Antibodies and their Applications 36(1):69-83; содержания которых приведены здесь в качестве ссылки.

В одном из способов гуманизации вместо того, чтобы присоединять к принадлежащей человеку каркасной области целые CDR животного, к принадлежащей человеку каркасной области присоединяют только определяющие специфичность остатки (SDR) (наиболее важные для связывания антитело-лиганд остатки CDR) (Kashmiri et al. (2005) Humanized Antibodies and their Applications 36(1):25-34; содержания которых приведены здесь в качестве ссылки). В альтернативном способе гуманизации принадлежащие человеку последовательности каркасной области из набора генов зародышевой линии человека выбирают на основе структурного сходства CDR человека с теми CDR животного, которые подлежат гуманизации (Hwang et al. (2005) Humanized Antibodies and their Applications 36(1):35-42; содержания которых приведены здесь в качестве ссылки).

Перестановка каркасной области представляет собой другой способ гуманизации, позволяющий выявлять сочетания каркасных областей человека, которые поддерживают функциональные особенности CDR мыши или другого животного в отсутствие необходимости в конструктивной разработке или структурных данных. В этом способе комбинаторные библиотеки Fab получают посредством слияния с сохранением рамки считывания CDR из MAb животного с совокупностями соответствующих каркасных областей человека, включающих все известные гены тяжелых и легких цепей зародышевой линии человека. Затем библиотеки Fab можно скринировать на предмет связывания антигена. Легкие и тяжелые цепи родительского Mab можно эффективного гуманизировать в дальнейшем процессе селекции. См. Dall'Acqua et al. (2005) Humanized Antibodies and their Applications 36(1):43-60; содержания которых приведены здесь в качестве ссылки.

В альтернативном способе, который эффективно использовали для получения по крайней мере одного антитела, утвержденного FDA для применения у человека, можно использовать направленную селекцию для осуществления последовательного переноса вариантов антител грызунов от грызуна к человеку посредством применения набора антител человека со сходными характеристиками для исходного антитела грызуна, а также фагового или рибосомного дисплея. См. Osbourn et al. (2005) Humanized Antibodies and their Applications 36(1):61-68; содержания которых приведены здесь в качестве ссылки. В этом способе набор антител или V-областей человека скринируют на предмет связывания интересующего антигена. Получаемое антитело полностью относится к человеку.

В данной области известны способы получения антител, от частично до полностью принадлежащих человеку, и можно использовать любые такие способы. В соответствии с одним из вариантов осуществления последовательности полностью принадлежащих человеку антител получают в трансгенной мыши, сконструированной для экспрессии генов тяжелой и легкой цепей антитела человека. Было получено множество линий таких трансгенных мышей, которые способны продуцировать различные классы антител. Для получения клеточных линий гибридом для непрерывной продукции желаемого антитела можно осуществлять слияние B-клеток из трансгенных мышей, продуцирующих желаемое антитело. (См., например, Russel et al. (2000) Infection and Immunity April 2000:1820-1826; Gallo et al. (2000) European J. of Immun. 30:534-540; Green (1999) J. of Immun. Methods 231:11-23; Yang et al. (1999) J. of Leukocyte Biology 66:401-410; Yang (1999) Cancer Research 59(6):1236-1243; Jakobovits (1998) Advanced Drug Delivery Reviews 31:33-42; Green, L. and Jakobovits (1998) J. Exp. Med. 188(3):483-495; Jakobovits (1998) Exp. Opin. Invest. Drugs 7(4):607-614; Tsuda et al. (1997) Genomics 42:413-421; Sherman-Gold (1997) Genetic Engineering News 17(14); Mendez et al. (1997) Nature Genetics 15:146-156; Jakobovits (1996) WEIR'S HANDBOOK OF EXPERIMENTAL IMMUNOLOGY, THE INTEGRATED IMMUNE SYSTEM Vol. IV, 194.1-194.7; Jakobovits (1995) Current Opinion in Biotechnology 6:561-566; Mendez et al. (1995) Genomics 26:294-307; Jakobovits (1994) Current Biology 4(8):761-763; Arbones et al. (1994) Immunity 1(4):247-260; Jakobovits (1993) Nature 362(6417):255-258; Jakobovits et al. (1993) Proc. Natl. Acad. Sci. USA 90(6):2551-2555; патент США № 6075181).

Также моноклональные антитела человека можно получать посредством гибридомы, содержащей слитую с иммортализованной клеткой B-клетку, которую получают от трансгенного животного, не относящегося к человеку, например, трансгенной мыши с геномом, который содержит трансген тяжелой цепи и трансген легкой цепи человека. Также антитела по этому изобретению можно модифицировать для получения химерных антител. Химерные антитела представляют собой антитела, в которых различные домены тяжелых и легких цепей антител кодируются посредством ДНК из более чем одного вида. См., например, патент США № 4816567.

Любое рекомбинантное антитело или фрагмент этого антитела по настоящему изобретению можно использовать до тех пор, пока оно способно специфически реагировать по крайней мере с двумя подтипами белка интерферона-альфа ("IFNα"), выбранными из группы, которая состоит из подтипов белка A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b и WA, но не нейтрализует по крайней мере одну биоактивность белка IFNα подтипа D. Также антитело может нейтрализовывать IFNα, как измеряют известными биоанализами, где, например, биоактивность представляет собой активацию промотора MxA или противовирусную активность. Одно из таких антител представляет собой антитело, специфически реагирующее с одним или несколькими подтипами IFNα A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b и WA, но не с подтипом D, и содержащее свои CDR, производные или участки, выбранные из

VH1 с аминокислотной последовательностью SEQ ID NO:4;

VH2 с аминокислотной последовательностью SEQ ID NO:6;

VH3 с аминокислотной последовательностью SEQ ID NO:8.

VL1 с аминокислотной последовательностью SEQ ID NO:12;

VL2 с аминокислотной последовательностью SEQ ID NO:14;

VL3 с аминокислотной последовательностью SEQ ID NO:16; их производных и сочетаний.

Кроме того, в объем настоящего изобретения также входят антитела, которые могут включать в себя антитела и/или фрагменты антител, в которых одна или несколько аминокислот удалены, добавлены, заменены и/или вставлены в такие аминокислотные последовательности, и которые специфически реагируют с подтипами IFNα A, 2, B2, C, F, G, H2, I, J1, K, 4a, 4b и WA.

По настоящему изобретению одна или несколько делеций, замен, вставок или добавлений аминокислот в аминокислотную последовательность относятся к модификациям и/или мутациям одной или нескольких аминокислот, которые удаляют, заменяют, вставляют и/или добавляют в одно или несколько положений в каркасе иммуноглобулина. В одной и той же аминокислотной последовательности можно одновременно осуществлять одну или несколько делеций, замен, вставок и/или добавлений. Кроме того, заменяемые, вставляемые или добавляемые аминокислотные остатки могут быть природными или искусственными. Примеры природного аминокислотного остатка включают L-аланин, L-аспарагин, L-аспарагиновую кислоту, L-глутамин, L-глутаминовую кислоту, глицин, L-гистидин, L-изолейцин, L-лейцин, L-лизин, L-метионин, L-фенилаланин, L-пролин, L-серин, L-треонин, L-триптофан, L-тирозин, L-валин, L-цистеин и т.п.

Примеры аминокислотных остатков, которые можно заменять, можно найти в одной или нескольких следующих группах, например:

группа A: лейцин, изолейцин, норлейцин, валин, норвалин, аланин, 2-аминомасляная кислота, метионин, O-метилсерин, t-бутилглицин, трет-бутилаланин, циклогексилаланин;

группа B: аспарагиновая кислота, глутаминовая кислота, изоаспарагиновая кислота, изоглутаминовая кислота, 2-аминоадипиновая кислота, 2-аминосубериновая кислота;

группа C: аспарагин, глутамин;

группа D: лизин, аргинин, орнитин, 2,4-диаминомасляная кислота, 2,3-диаминопропионовая кислота;

группа E: пролин, 3-гидроксипролин, 4-гидроксипролин;

группа F: серин, треонин, гомосерин; и

группа G: фенилаланин, тирозин.

Термин "производное антитела" дополнительно включает "линейные антитела". Способ получения линейных антител известен в данной области и описан в Zapata, et al. (1995) Protein Eng. 8(10):1057-1062. Вкратце, линейные антитела содержат пару тандемных участков Fd (VH-CH1-VH-CH1), формирующих пару антигенсвязывающих участков. Линейные антитела могут быть биспецифичными или моноспецифичными.

Антитела по этому изобретению можно восстанавливать и очищать из культур рекомбинантных клеток известными способами, которые включают в себя, но ими не ограничиваются, очистку белком A, осаждение сульфатом аммония или этанолом, экстракцией кислотой, анионо- или катионообменной хроматографией, хроматографией с использованием фосфоцеллюлозы, хроматографией посредством гидрофобного взаимодействия, аффинной хроматографией, хроматографией с использованием гидроксиапатита и хроматографией с использованием лектина. Также для очистки можно использовать высокоэффективную жидкостную хроматографию.

Антитела по настоящему изобретению включают очищенные природные продукты, продукты химических процедур синтеза и продукты, получаемые рекомбинантными способами из эукариотического организма-хозяина, в том числе, например, клеток дрожжей, высших растений, насекомых и млекопитающих, или, альтернативно, из прокариотических клеток, как описано выше.

В некоторых аспектах этого изобретения является эффективным регистрируемо или терапевтически метить антитело. Способы конъюгации антител с такими веществами известны в данной области. Только в целях иллюстрации антитела можно метить таким поддающимся выявлению веществом, как радиоактивный атом, хромофор, флуорофор или т.п. Такие меченые антитела можно использовать для способов диагностики, in vivo или в отдельном тестируемом образце. Также антитела можно конъюгировать, например, с фармацевтическим средством, таким как химиотерапевтическое лекарственное средство или токсин. Их можно присоединять к цитокину, лиганду, другому антителу. Приемлемые вещества для связывания с антителами для достижения противоопухолевого эффекта включают в себя цитокины, такие как интерлейкин-2 (IL-2) и фактор некроза опухолей (TNF); фотосенсибилизаторы для использования в фотодинамической терапии, в том числе фталоцианинтетрасульфонат алюминия (III), гематопорфирин и фталоцианин; радионуклиды, такие как иод-131 (131I), иттрий-90 (90Y), висмут-212 (212Bi), висмут-213 (213Bi), технеций-99m (99mTc), рений-186 (186Re) и рений-188 (188Re); антибиотики, такие как доксорубицин, адриамицин, даунорубицин, метотрексат, дауномицин, неокарциностатин и карбоплатин; бактериальные, растительные и другие токсины, такие как дифтерийный токсин, экзотоксин A синегнойной палочки, стафилококковый энтеротоксин A, токсин абрин-A, рицин A (дегликозилированный рицин A и природный рицин A), токсин TGF-альфа, цитотоксин из китайской кобры (naja naja atra) и гелонин (растительный токсин); инактивирующие рибосомы белки из растений, бактерий и грибов, такие как рестриктоцин (инактивирующий рибосомы белок, продуцируемый Aspergillus restrictus), сапорин (инактивирующий рибосомы белок из Saponaria officinalis) и РНКаза; ингибиторы тирозинкиназы; ly207702 (двуфтористый пуриновый нуклеозид); липосомы, содержащие противокистозные средства (например, антисмысловые олигонуклеотиды, плазмиды, кодирующие токсины, метотрексат и т.д.); а также другие антитела или фрагменты антител, такие как F(ab).

Что касается препаратов, содержащих антитела, которые ковалентно связаны с органическими молекулами, то их можно получать с использованием общепринятых способов, таких как реакция с одним или несколькими модифицирующими средствами. Их примеры включают модифицирующие и активирующие группы. В рамках настоящей заявки термин "модифицирующее средство" относится к приемлемой органической группе (например, гидрофильному полимеру, жирной кислоте, сложному эфиру жирной кислоты), содержащей активирующую группу. Конкретные примеры таких средств описаны выше. "Активирующая группа" представляет собой химическую молекулу или функциональную группу, способную в соответствующих условиях реагировать со второй химической группой, тем самым формируя ковалентную связь между модифицирующим веществом и второй химической группой. Примерами таких групп являются электрофильные группы, такие как тозилат, мезилат, галогеногруппа (хлор-, бром-, фтор-, иод-), сложные эфиры N-гидроксисукцинимидила (NHS) и т.п. Активирующие группы, которые способны реагировать с тиолами, включают, например, имид малеиновой кислоты, иодацетил, акрилоил, дисульфиды пиридила, тиол 5-тиол-2-нитробензойной кислоты (TNB-тиол) и т.п. Альдегидную функциональную группу можно связывать с молекулами, содержащими амин или гидразид, а азидная группа может реагировать с группой трехвалентного фосфора, формируя фосфорамидатные или фосфоримидные связи. Приемлемые способы введения активирующих групп в молекулы известны в данной области (см., например, Hermanson (1996) BIOCONJUGATE TECHNIQUES, Academic Press: San Diego, Calif.). Активирующую группу можно связывать непосредственно с органической группой (например, гидрофильным полимером, жирной кислотой, сложным эфиром жирной кислоты) или через линкерную группу, например, двухвалентную группу C1-C12, где один или несколько атомов углерода можно заменять на гетероатом, такой как атом кислорода, азота или серы. Например, приемлемые линкерные группы включают тетраэтиленгликоль. Модифицирующие средства, содержащие линкерную группу, можно получать, например, реакцией моно-Boc-алкилдиамина (например, моно-Boc-этилендиамина, моно-Boc-диаминогексана) с жирной кислотой в присутствии 1-этил-3-(3-диметиламинопропил)карбодиимида (EDC) для образования амидной связи между свободным амином и карбоксилатом жирной кислоты. Защитную группу Boc можно удалять из продукта посредством обработки трифторуксусной кислотой (TFA) для воздействия на первичный амин, который можно соединять с другим карбоксилатом, как описано, или который может реагировать с малеиновым ангидридом, а получаемый продукт можно циклизовать для получения активированного малеимидного производного жирной кислоты.

Модифицированные антитела по изобретению можно получать взаимодействием антитела или антигенсвязывающего фрагмента, принадлежащего человеку, с модифицирующим веществом. Например, органические молекулы можно присоединять к антителу неспецифичным к участку способом посредством использования аминореактивного модифицирующего вещества, например, сложного NHS эфира PEG. Также модифицированные антитела или антигенсвязывающие фрагменты, принадлежащие человеку, можно получать восстановлением дисульфидных связей (например, внутрицепочечных дисульфидных связей) в антителе или антигенсвязывающем фрагменте. Затем можно проводить реакцию восстановленного антитела или антигенсвязывающего фрагмента с тиолреактивным модифицирующим веществом для получения модифицированного антитела по изобретению. Модифицированные антитела и антигенсвязывающие фрагменты, принадлежащие человеку, в том числе органическую молекулу, связанную со специфическими участками антитела по настоящему изобретению, можно получать с использованием приемлемых способов, таких как обратимый протеолиз. В целом, см. Hermanson (1996) BIOCONJUGATE TECHNIQUES, Academic Press: San Diego, Calif. (1996).

Получение и выделение белков и полипептидов. Полипептиды и белки являются необходимыми компонентами различных способов по этому изобретению. Например, рекомбинантные антитела, их варианты, производные и фрагменты можно получать химическим синтезом с использованием коммерчески доступного автоматического синтезатора пептидов, такого как синтезаторы, производимые Perkin Elmer/Applied Biosystems, Inc., Model 430A или 431A, Foster City, CA, USA. Синтезированный белок или полипептид можно осаждать и дополнительно очищать, например, высокоэффективной жидкостной хроматографией (HPLC). Альтернативно, белки и полипептиды можно получать известными рекомбинантными способами, как описано в настоящей заявке, с использованием описанных выше клетки-хозяина и систем векторов. Также их можно получать ферментативным перевариванием или расщеплением природных белков.

Белки и пептиды можно выделять или очищать общепринятыми способами, в том числе хроматографией (например, ионообменной, аффинной и эксклюзионной хроматографией на колонках), центрифугированием, способом на основе дифференциальной растворимости или любым другим общепринятым способом очистки белков. Альтернативно, к пептидам по изобретению можно присоединять аффинные метки, такие как гекса-His (Invitrogen), связывающий мальтозу домен (New England Biolabs), последовательность оболочки вируса гриппа (Kolodziej, et al., (1991) Methods Enzymol. 194:508-509) и глутатион-S-трансфераза, для предоставления возможности легкой очистки посредством прохождения через соответствующую аффинную колонку. Также выделенные пептиды можно характеризовать физически с использованием таких способов, как протеолиз, ядерный магнитный резонанс и рентгенокристаллография.

Хорошо известно, что модификации можно осуществлять для любого пептида для получения такого пептида с измененными свойствами. Пептиды для использования по этому изобретению можно модифицировать для включения аминокислот, не являющихся природными. Таким образом, пептиды могут содержать D-аминокислоты, сочетание D- и L-аминокислот, а также различные "сконструированные" аминокислоты (например, β-метиламинокислоты, C-β-метиламинокислоты и N-α-метиламинокислоты и т.д.) для придания пептидам особых свойств.

В другом варианте осуществления выбирают субъединицы пептидов, придающие эффективные химические и структурные особенности. Например, пептиды, содержащие D-аминокислоты, могут быть устойчивы in vivo к протеазам, специфичным для L-аминокислот. Модифицированные соединения с D-аминокислотами можно синтезировать с расположением аминокислот в обратном порядке, получая пептиды по изобретению в виде обратно-инверсных пептидов. Кроме того, настоящее изобретение относится к получению пептидов, обладающих более четко определенными структурными особенностями, и к использованию пептидомиметиков и пептидомиметических связей, таких как сложноэфирные связи, для получения пептидов с новыми свойствами. В другом варианте осуществления можно получать пептид, содержащий восстановленную пептидную связь, т.е. R1-CH2NH-R2, где R1 и R2 представляют собой аминокислотные остатки или последовательности. Восстановленную пептидную связь можно вводить в виде дипептидной субъединицы. Такая молекула устойчива к гидролизу пептидной связи, например, к активности протеаз. Такие молекулы обеспечивают пептиды с уникальной функцией и активностью, например, продолжительным временем полужизни in vivo вследствие устойчивости к метаболическому распаду или протеазной активности. Кроме того, хорошо известно, что в определенных системах закрепленные белки обладают повышенной функциональной активностью (Hruby (1982) Life Sciences 31:189-199 и Hruby et al. (1990) Biochem J. 268:249-262); настоящее изобретение относится к способу получения закрепленного пептида, содержащего во всех остальных положениях случайные последовательности.

Анализы на предмет биологической активности IFNα. Дифференцировка моноцитов. Получение активированных T- и B-лимфоцитов требует рекрутинга и созревания антигенпрезентирующих клеток ("APC"). Эти APC включают B-клетки, моноциты/макрофаги и дендритные клетки. Сыворотка пациентов с SLE содержит IFNα, способный активировать DC, а активированную активность можно блокировать препаратами поликлональных или моноклональных антител. Способы регистрации и количественного определения этой активности описаны в научной и патентной литературе (например, см. разделы от 0136 до 0150 патентной публикации США № 2004/0067232 A1), где соответствующие разделы приведены здесь в качестве ссылки.

Активация промотора MxA. Способность IFNα активировать промотор MxA и способность моноклональных антител против IFNα по изобретению блокировать эту активацию можно измерять, используя анализы с применением гена-репортера, где промотор MxA слит с геном-репортером, таким как хлорамфеникол-ацетилтрансфераза (CAT) или люцифераза (luc), предпочтительно, люцифераза. Анализы для CAT и люциферазы известны специалистам в данной области. Предпочтительно, активность промотора MxA измеряют в клетках A549, стабильно трансформируемых слитым конструктом промотор MxA/ген-репортер. Клетки A549 представляют собой линию клеток карциномы легких, доступную в ATCC (номер продукта CC1-185). Промотор MxA (также известный как Mx1) может принадлежать человеку, мыши или крысе. Последовательность и структура промотора MxA человека описана под уникальным идентификатором банка генов № X55639, Chang et al. (1991) Arch Virol. 117:1-15; и Ronni et al. (1998) J Interferon Cytokine Res. 18:773-781. Слитые конструкты промотор MxA человека/люцифераза и люциферазные анализы описаны в патентной заявке США № 20040209800 и Rosmorduc et al. (1999) J of Gen Virol 80:1253-1262. Слитые конструкты промотор MxA человека/CAT и анализы CAT описаны в Fernandez et al. (2003) J Gen Virol 84:2073-2082 и Fray et al. (2001) J Immunol Methods 249:235-244. Промотор MxA (Mx1) мыши описан под уникальным идентификатором банка генов № M21104; Hug et al. (1988) Mol Cell Biol 8:3065-3079; и Lleonart et al. (1990) Biotechnology 8:1263-1267. Слитый конструкт промотор MxA мыши/люцифераза и люциферазный анализ описаны в Canosi et al. (1996) J Immunol Methods 199:69-67.

ПРИМЕРЫ

Вещества и способы

Источники IFN-α человека. Подтип рекомбинантных белков IFN-α получали из PBL Biomedical Laboratories (PBL). Подтипы и специфическую активность определяли посредством включаемых производителем: IFN-α A (3,8×108 ед./мг); IFN-α 2 (2,77×108 ед./мг); IFN-α B2 (4,63×108 ед./мг); IFN-α C (2,31×108 ед./мг); IFN-α D (7,5×107 ед./мг); IFN-α F (3,6×108 ед./мг); IFN-α G (2,33×108 ед./мг); IFN-α H2 (1,05×108 ед./мг); IFN-α I (1,4×108 ед./мг); IFN-α J1 (2,6×108 ед./мг); IFN-α K (1,480×108 ед./мг); IFN-α 1 (1,4×108 ед./мг); IFN-α 4a (2,12×108 ед./мг); IFN-α 4b (1,8×108 ед./мг); IFN-α WA (2,4×108 ед./мг); и IFN-β (8,23×107 ед./мг). Лейкоцитарный IFN покупали в Sigma (I-2396, серия № 111K1603).

Супернатант PBMC-flu (PBMC-flu), содержащий сложную смесь подтипов IFNα человека, получали в лабораторных условиях посредством инфицирования PBMC человека из лейкоцитарных пленок вирусом гриппа A/PR/8/34 (H1N1) (Charles River Laboratories, серия № 4XPR011022) при титре вирусов 1 гемагглютинирующая единица/pDC. Конкретно, PBMC (моноциты периферической крови) получали из лейкоцитарной пленки человека посредством центрифугирования в фиколле и отбора поверхности, содержащей PBMC. Проводили окрашивание/анализ FACS для подтверждения наличия плазмацитоидных DC и определения их процентной доли в PBMC, а также выполняли окрашивание с использованием конъюгированных с флуоресцентной меткой антител, которые специфичны к Lin, CD3, CD14, CD16, CD19, CD56, CD123, HLA-DR и CD11c (BD Pharmingen). pDC были охарактеризованы как CD14-отрицательные, CD11c-отрицательные и CD123-положительные. Исходный источник вируса гриппа (относящийся к птицам источник, не содержащий специфических патогенов; вирус гриппа A/PR/8/34 (H1N1) (номер в каталоге 490710; серия № 4XPR011022), конечный титр HA в 0,05 мл: 1:16777216; Charles River Laboratories, Connecticut, USA) разводили до 1000 гемагглютинирующих единиц/мкл (гемагглютинирующих единиц в микролитре) в среде RPMI (RPMI + 10% FCS + L-глутамин). Необходимый объем разведенного вируса был основан на доле pDC в очищенных PBMC таким образом, что присутствует по крайней мере 1 гемагглютинирующая единица/pDC (т.е. каждая лунка должна содержать 1×106 PBMC, и, если есть 0,3% pDC, то каждая лунка содержит 3000 pDC. В этом случае в каждую лунку добавляют 4-5 мкл вируса при 1000 гемагглютинирующих единиц/мкл).

Полученные из лейкоцитарной пленки PBMC центрифугировали в течение 10 минут при 900 об/мин и ресуспендировали в RPMI + 10% FCS + L-глутамин при 5000 клеток/мкл (это обеспечивает 1×106 клеток в лунке в объеме 200 мкл). Клетки вместе с вирусом гриппа высевали на 96-луночные планшеты с U-образным дном и инкубировали в течение 24 часов при 37ºC + 5% CO2. После инкубации в течение 24 часов клетки образовывали осадок на дне лунок и формировали скопления. Супернатант из лунок отбирали тщательным пипетированием, не затрагивая клеточных осадков на дне лунок. Объединенные супернатанты центрифугировали в конических пробирках объемом 50 мл при 900 об/мин в течение 10 минут для осаждения любых остаточных клеток и других продуктов разрушения культур. Супернатанты PBMC-flu, содержащие сложную смесь IFNα, объединяли в совокупности, смешивали и хранили при -80ºC в аликвотах по 0,5 мл до момента использования.

Анализ ингибирования цитопатического эффекта (CPE). Вещества для CPE: "полная" модифицированная по способу Дульбекко среда Игла (DMEM): DMEM вместе с феноловым красным + 10% FCS + 2 мМ L-глутамин + пенициллин + стрептомицин + β-2-меркаптоэтанол (β-me), 96-луночные плоскодонные планшеты для культивирования тканей, клетки A549 (ATCC CCL-185); эти клетки культивируют в среде Хэма F12K + 10% FCS + 2 мМ L-глутамин + пенициллин + стрептомицин + 500-800 мкг G418, 1x PBS, 1x трипсин, контроли "Intron A" (IFNα-2b, Schering-Plough), тестируемые образцы (сыворотка при SLE, подтипы рекомбинантных IFNα) при наличии/отсутствии гибридомного супернатанта или покупаемые препараты поликлональных/моноклональных антител, исходные источники вирусов EMC (получаемые из вируса мышиного энцефаломиокардита (EMCV), приспособленного к культуре ткани на клеточном монослое Vero; номер продукта в ATCC для этого исходного источника вирусов представляет собой VR-129B, а номер продукта для клеток Vero представляет собой CCL-81).

Исходный раствор кристаллического фиолетового: 1,25 мг NaCl + 3,75 мг кристаллического фиолетового + 775 мл раствора формальдегид/этанол (который получают с использованием 75 мл формальдегида, 750 мл 95% этанола и 1500 мл дистиллированной воды) перемешивали в течение 20 минут, затем фильтровали через фильтр с размером ячеек 0,45 микрон и хранили не более чем 3 месяца. Рабочий раствор кристаллического фиолетового получали разбавлением исходного раствора 1:10 с использованием раствора формальдегид/этанол. Растворы кристаллического фиолетового хранили при комнатной температуре.

Способы CPE. Принципиальная схема анализа ингибирования цитопатического эффекта (CPE) представлена на фиг.1. Анализы CPE проводили в трех сериях лунок в 96-луночных плоскодонных планшетах. Для каждого вида анализа было эффективным включать лунки для положительного контроля, содержащие образцы интрона A (Schering-Plough) в различных концентрациях, и лунки для отрицательного контроля, содержащие только клетки + среду. Прикрепленные клетки A549 снимали с флаконов посредством удаления культуральных сред, одного промывания посредством PBS и обработки трипсином. Обработку трипсином прекращали добавлением во флакон "полной" DMEM. Обработанные трипсином клетки отбирали из флакона, центрифугировали, ресуспендировали и подсчитывали. Доводили их концентрацию до 600000 клеток/мл в полной DMEM. Объем лунок для анализа составлял 150 мкл (перед добавлением вируса) и 200 мкл (после добавления вируса). 50 мкл объема составляли клетки, где в лунку добавляли 15000 таких клеток (50 мкл суспензии клеток 300000/мл).

Анализ ингибирования вирусов посредством рекомбинантного IFNα. В три серии лунок добавляли 100 мкл раствора IFNα (в полной DMEM) в различных концентрациях. Добавляли 50 мкл клеток и инкубировали в течение 5 часов при 37°C + 5% CO2. После этого периода времени добавляли 50 мкл вируса EMC, разведенного из исходного источника в 50 раз, и продолжали инкубацию в течение 48 часов при 37°C + 5% CO2.

Анализ ингибирования вирусов посредством сыворотки при SLE. В три серии лунок помещали 50 мкл (например, без разведения) или 25 мкл (например, 2x разведение) сыворотки при SLE. Объем доводили до 100 мкл добавлением DMEM без FCS (примечание: во всех случаях добавления образцов сыворотки любого типа к лункам, используемым в этом анализе, применяли DMEM без FCS), а затем добавляли 50 мкл клеток и инкубировали в течение 4 часов при 37°C + 5% CO2. После этого периода времени добавляли 50 мкл вируса EMC, разведенного из исходного источника в 50 раз (в случае рассматриваемого препарата эту концентрацию определяли как минимальное количество исходного источника, способное убить все клетки в течение 48 часов), и продолжали инкубацию в течение 48 часов при 37°C + 5% CO2.

Анализ ингибирования вирусов посредством супернатантов PBMC-flu. К трем сериям лунок добавляли 50 мкл (например, без разведения) или последовательные разведения супернатанта PBMC-flu. Объем каждой лунки доводили до 100 мкл добавлением DMEM с FCS, а затем добавляли 50 мкл клеток и инкубировали в течение 4 часов при 37°C + 5% CO2. После этого периода времени добавляли 50 мкл вируса EMC, разведенного из исходного источника в 50 раз, и продолжали инкубацию в течение 48 часов при 37°C + 5% CO2.

Для анализа опосредуемой антителами блокады ингибирования вирусов рекомбинантным IFNα, сывороткой при SLE или супернатантами PBMC-flu с использованием коммерчески доступных антител, мышиной сыворотки или слитых супернатантов добавляли, доводя общий объем каждой лунки на этой стадии до 100 мкл, по 50 мкл из: (i) DMEM без FCS, содержащей коммерческие препараты поликлональных или моноклональных антител; (ii) 50 мкл мышиной сыворотки; или (iii) 50 мкл гибридомного супернатанта. Планшеты инкубировали от 1,5 до 2 часов при 37°C + 5% CO2. К каждой лунке добавляли 50 мкл клеток и инкубировали в течение 5 часов при 37°C + 5% CO2. После этого периода времени добавляли 50 мкл вируса EMC, разведенного из исходного источника в 50 раз, и продолжали инкубацию в течение 48 часов при 37°C + 5% CO2.

После периода инкубации в течение 48 часов в ходе указанных выше анализов CPE из лунок тщательно удаляли все среды с использованием многоканальной пипетки. Добавляли 50 мкл кристаллического фиолетового и позволяли окрашиваться в течение 4-6 минут. Кристаллический фиолетовый тщательно удаляли, а также добавляли и сразу удаляли 200 мкл дистиллированной воды. Планшетам позволяли сушиться в течение по крайней мере 30 минут, а затем считывали на планшет-ридере для ELISA при OD 570 нм.

Для получения процентного значения блокады (на основе способности включаемого контрольного антитела или антитела, содержащегося в гибридомных супернатантах, ингибировать опосредуемую IFNα защиту от клеточной гибели) данные нормализовали относительно "отрицательного контроля" (рекомбинантный IFNα, сыворотка при SLE или супернатант PBMC-flu + клетки + вирус), представляющего 100% жизнеспособность (0% клеточная гибель), и "положительного контроля" (только клетки + вирус), представляющего 0% жизнеспособность (100% клеточная гибель), с использованием программного обеспечения Prism 4.0 для Macintosh, версия 4.0A (GraphPad Software, Inc., San Diego, CA) и алгоритма нормализации для приведения всех величин согласно с процентами, соответствующими контролям.

Анализ с использованием гена-репортера (RG). Вещества для RG. Модифицированная по способу Дульбекко среда Игла (DMEM) без фенолового красного или добавок; "полная" модифицированная по способу Дульбекко среда Игла (DMEM): DMEM с феноловым красным + 10% FCS + 2 мМ L-глутамин + пенициллин + стрептомицин + 2-me (β-me); модифицированная по способу Дульбекко среда Игла (DMEM), которую получают так, что она содержит все указанное выше, кроме FCS; ViewPlate-96, белый, обработанный тканевой культурой (Perkin Elmer Life Sciences); клетки 93D7 (A549, трансфицированные для экспрессии люциферазы под управлением промотора MxA типа I, индуцируемого IFN); эти клетки культивируют в среде Хэма F12K + 10% FCS + 2 мМ L-глутамин + пенициллин + стрептомицин + 500-800 мкг G418; 1x PBS; 1x трипсин; контроли "интрон A" (IFNα 2b, Schering-Plough); тестируемые образцы (сыворотка при SLE, подтипы рекомбинантного IFNα) при наличии/отсутствии гибридомного супернатанта или покупаемых препаратов поликлональных/моноклональных антител; набор для люминесцентного анализа с использованием гена-репортера BriteliteТМ (Perkin Elmer Life Sciences).

Способы для RG. Анализ с использованием гена-репортера на основе люциферазы применяли для оценки способности MAb против IFNα нейтрализовать биоактивность подтипов рекомбинантного IFNα, лейкоцитарного IFN и PBMC-flu. Принципиальная схема анализа RG представлена на фиг.1. Линия клеток 93D7, полученная стабильной трансфекцией клеточной линии A549 (CLL-185, ATCC) с использованием конструкта, индуцируемого IFN (слитый конструкт промотор MxA/люцифераза), была любезно предоставлена Dr. Guenther Adolf (Boehringer-Ingelheim GmbH, Austria). Слитый вектор промотор MxA/luc содержит фрагмент BamHI величиной 1,6 т.п.н., включающий мышиный промотор MxA и элементы для реакции IFN, вырезанные из pSP64-Mxp(PstI-PvuII)-rβglo (Lleonart et al. (1990) Biotechnology 8:1263-1267) и вставленные выше последовательности, кодирующей люциферазу.

Анализы RG выполняли в трех сериях лунок в непрозрачном 96-луночном плоскодонном планшете (ViewPlatesTM, белые стенки, прозрачное дно; Perkin Elmer). Для каждого вида анализа предпочтительно включать лунки для положительного контроля, содержащие образцы интрона A (Schering-Plough) в различных концентрациях, и лунки для отрицательного контроля, содержащие только клетки + среду.

Конкретно, прикрепленные клетки 93D7 снимали с флаконов удалением культуральных сред, одной промывкой посредством PBS и обработкой трипсином. Обработку трипсином прекращали добавлением во флакон "полной" DMEM. Клетки отбирали из флакона, центрифугировали, ресуспендировали и подсчитывали. Доводили их концентрацию до 600000/мл в полной DMEM.

Сыворотку от иммунизированных мышей, гибридомные супернатанты или очищенные MAb против IFNα предварительно инкубировали с подтипами рекомбинантного IFN, лейкоцитарным IFN или PBMC-flu в объемах 100 мкл/лунка в течение 1,5 часов при 37°C + 5% CO2, после чего в каждую лунку добавляли клетки 93D7 (50 мкл клеточной суспензии 600000/мл = 30000 клеток) и продолжали инкубацию в течение дополнительных 5 часов. Конечный объем лунок для анализа составлял 150 мкл. Затем проводили анализы с использованием люминесцентной системы гена-репортера BriteliteTM (Perkin Elmer) и считывали в сцинтилляционном и люминесцентном счетчике Wallac Microbeta TriluxTM в течение 15 минут добавления субстрата.

Анализ индукции MxA рекомбинантным IFNα. Концентрацию раствора IFNα (в полной DMEM) доводили до содержания количества, которое подлежит помещению в каждую лунку, величиной 100 мкл. 100 мкл IFNα помещали в три серии лунок, а затем добавляли 50 мкл клеток и инкубировали в течение 5 часов при 37°C + 5% CO2.

Анализ индукции MxA сывороткой при SLE. В три серии лунок помещали 50 мкл (например, без разведения) или 25 мкл (например, 2x разведение) сыворотки при SLE. Затем объем/лунка доводили до 100 мкл добавлением DMEM без FCS (примечание: во всех случаях добавления образцов сыворотки любого типа к лункам, используемым в этом анализе, применяли DMEM без FCS), а затем добавляли 50 мкл клеток и инкубировали в течение 5 часов при 37°C + 5% CO2.

Анализ блокады индукции MxA супернатантами PBMC-flu. В три серии лунок помещали 50 мкл (например, без разведения) или последовательные разведения супернатанта PBMC-flu. Затем объем каждой лунки доводили до 100 мкл добавлением DMEM вместе с FCS с последующим добавлением 50 мкл клеток и инкубацией в течение 5 часов при 37°C + 5% CO2.

Анализ блокады индукции MxA рекомбинантным IFNα, сывороткой при SLE или супернатантами PBMC-flu с использованием коммерчески доступных антител, мышиной сыворотки или слитых супернатантов. В каждую лунку добавляли 50 мкл или желаемое разведение рекомбинантного IFNα, сыворотки при SLE или PBMC-flu. Затем для доведения общего объема каждой лунки до 100 мкл в каждую лунку добавляли по 50 мкл из: (i) DMEM без FCS, содержащей коммерческие препараты поликлональных или моноклональных антител; (ii) 50 мкл мышиной сыворотки; или (iii) 50 мкл гибридомного супернатанта. Планшеты инкубировали в течение 1,5 часов при 37°C + 5% CO2. После этого времени добавляли 50 мкл клеток и продолжали инкубацию в течение 5 часов при 37°C + 5% CO2.

Перед проведением анализа набор реагентов/проявляющих реагентов BriteliteTM (флаконы с субстратом, буфер для субстрата, бесцветная DMEM) выдерживали в течение 40 минут при комнатной температуре. За 30 минут до проведения анализа планшеты для анализа помещали в условия с комнатной температурой. За 10 минут до проведения анализа лиофилизированный субстрат восстанавливали буфером (10 мл на флакон).

После периода инкубации в течение 5 часов все среды тщательно удаляли из лунок с использованием многоканальной пипетки. Затем на дне ViewPlateTM фиксировали белое адгезивное блокирующее вещество. В каждую лунку добавляли 90 мкл DMEM (без фенолового красного). В каждую лунку добавляли 90 мкл восстановленного реагента BriteliteTM, обеспечивая пипетирование вверх и вниз два раза (но без разбрызгивания содержимого лунок на стенки лунок или создания пузырей воздуха) для тщательного перемешивания реагента и сред. Пипетирование выполняют как можно быстрее, но при этом точно. Планшет герметично запечатывают прозрачной клейкой герметизирующей лентой. В течение периода, превышающего 1 минуту, но составляющего не более чем 15 минут, считывали интенсивность люминесценции планшета(ов) с использованием Wallac Microbeta TriluxTM.

Для получения процентного значения блокады (на основе способности включаемого контрольного антитела или антитела, содержащегося в гибридомных супернатантах, нейтрализовать индукцию MxA-люциферазы) данные нормализовали относительно "положительного контроля" (рекомбинантный IFNα, сыворотка при SLE или супернатант PBMC-flu + клетки), представляющего 100% активность IFNα, и "отрицательного контроля" (только клетки в средах), представляющего 0% активность IFNα, с использованием программного обеспечения Prism (GraphPad Software, Inc., San Diego, CA) и алгоритма нормализации для приведения всех величин согласно с процентами, соответствующими контролям.

Пример 1

Иммунизация и селекция клеточных линий моноклональных антител

Блок-схема для способа получения MAb против IFNα представлена на фиг.2. Каждую из групп из пяти самок мышей Balb/c (Harlan) в возрасте 6-8 недель иммунизировали посредством 5-10 мкг природного лейкоцитарного IFNα (I-2396, серия № 111K1603, Sigma) и/или коктейлем рекомбинантных белков (5-10 мкг каждого из трех подтипов рекомбинантного IFNα A, B2 и F (получаемых из PBL Biomedical Laboratories "PBL")) в MPL® + эмульсии TDM (Sigma № M6536) с интервалами от двух до трех недель в соответствии со схемами, указанными ниже в таблице 1. MPL® + эмульсия TDM представляет собой систему адъюванта Ribi, состоящую из монофосфориллипида A (MPL: детоксифицированный эндотоксин из S. Minnesota) и дикориномиколата трегалозы (TDM) в 2% эмульсии масло (сквален)-Tween 80-вода. Антиген вводили внутрибрюшинным (i.p.) или подкожным (s.c.) способом. Предшествующий слиянию скрининг собранной у мышей сыворотки проводили при трех титрах (1:200, 1:2000 и 1:20000), используя анализ с применением гена-репортера (RG), основанный на слитом белке MxA-люцифераза при посредстве активации рецептора IFN типа I для регистрации блокады биоактивности IFNα. Сыворотку у мышей собирали посредством ретроорбитального забора крови после третьей бустер-инъекции и отбора на предмет нейтрализации биоактивности PBMC-flu с использованием описанного выше анализа на основе гена-репортера (RG). Мышам, у которых наблюдали титры, составляющие по крайней мере 1:2000 для ≥50% нейтрализации, предоставляли покой в течение четырех недель, а затем проводили заключительную бустер-инъекцию (i.v. или i.p.) 2,5 мкг лейкоцитарного IFN перед слиянием спленоцитов с миеломой мыши Sp2/0-Ag14 (CRL-8287, ATCC) через трое суток. Слияния проводили в 50% PEG 1500 (Roche), а для селекции гибридом использовали 1x добавку HAT (Sigma) в DMEM + 15% FCS. Через 10-14 суток супернатанты культур отбирали на предмет нейтрализации PBMC-flu. Основываясь на описанном выше биоанализе с использованием гена-репортера MxA/luc (RG), 17 из иммунизированных мышей были способны к нейтрализации супернатанта PBMC-flu по крайней мере на 50% при титрах 1:200, среди них 14 были способны к нейтрализации на уровне ≥50% при разведениях 1:2000, а у 3 сохранялась нейтрализация при титрах вплоть до 1:20000.

Таблица 1
Иммунизация и селекция клеточных линий моноклональных антител
Схема 1
мыши Balb/c
Схема 2
мыши Balb/c
Схема 3
мыши Balb/c
Схема 4
мыши B6
Схема 5
мыши B6
Исходно На сутки 0
10 мкг природного IFNα
5 мышей i.p.
5 мышей s.c.
На сутки 0
10 мкг IFNα А, В2 и F
5 мышей i.p.
5 мышей s.c.
На сутки 0
5 мкг природного IFNα, разделяя на i.p. и s.c. 3 группы 4 мыши (получали адено-mIFNα на сутки -2, +2 или 1ая бустерная инъекция)
На сутки 0
2,5 мкг IFNα F
5 мышей i.p.
2,5 мкг IFNα F и В2
5 мышей i.p.
На сутки 0
4 мкг IFNα В2
5 мышей i.p.
1ая бустерная инъекция Через 2 недели
5 мкг природного IFNα
5 мышей i.p.
5 мышей s.c.
Через 2 недели
5 мкг IFNα A, B2 и F
5 мышей i.p.
5 мышей s.c.
Через 2 недели
2,5 мкг природного IFNα,
разделяя на i.p.
и s.c.
Через 2 недели
2 мкг IFNα F
5 мышей i.p.
2 мкг IFNα F и B2
5 мышей i.p.
Через 1,5 недели
2 мкг IFNα А
5 мышей i.p.
2ая бустерная инъекция Через 5 недель
5 мкг природного IFNα
5 мышей i.p.
5 мышей s.c.
Через 5 недель
5 мкг IFNα A, B2 и F
5 мышей i.p.
5 мышей s.c.
Через 5 недель
1,5 мкг природного IFNα,
разделяя на i.p. и s.c.
Через 5 недель
4 мкг IFNα F
5 мышей i.p.
4 мкг IFNα F и B2
5 мышей i.p.
Через 4 недели
2 мкг IFNα F
5 мышей i.p.
3ая бустерная инъекция Через 10,5 недель
2,5 мкг природного IFNα
Все мыши i.p.
Через 9 недель
2 мкг IFNα A, B2 и F
Все мыши i.p.
Через 8,5 недель
2 мкг природного IFNα,
i.p.
Через 7 недель
2 мкг IFNα F
5 мышей i.p.
2 мкг IFNα F и B2
5 мышей i.p.
N/A
4ая бустерная инъекция Через 16,5 недель
2,5 мкг природного IFNα
Все мыши i.p.
Через 13,5 недель
2,5 мкг природного IFNα
Все мыши i.p.
N/A Через 9 недель
2,5 мкг IFNα А
Все мыши i.p.
N/A

Примечание: мышей из схем 1, 2 и 3 использовали для осуществления слияний с 1 по 6. Слияния осуществляли, объединяя в совокупности клетки от 2-3 мышей в пределах схемы. Двух мышей (исходно иммунизированных посредством IFNα F по схеме 6) объединяли в совокупность для проведения слияния 8. При схеме 5 двух мышей объединяли в совокупность для проведения слияния 7, а трех объединяли в совокупность для проведения слияния 9.

Получение и очистка моноклональных антител. Как описано выше, мышей выявляли как кандидатов для слияния, основываясь на способности их сыворотки нейтрализовать сложную смесь подтипов IFNα, присутствующих в PBMC-flu. Серии из 8 слияний проводили с использованием спленоцитов, получаемых от мышей с приемлемыми титрами сыворотки. Осуществляли слияние спленоцитов с линией миеломных клеток мыши Sp2/0-Agl4 (номер ATCC CRL-1581, которую выбирали потому, что она неспособна экспрессировать имеющие эндогенное происхождение цепи Ig), высевали на 96-луночные плоскодонные планшеты для культивирования тканей и инкубировали в течение 12-15 суток до скрининга супернатантов для регистрации реакции поликлональных антител с использованием описанной выше схемы анализа RG. Конкретно, образцы сыворотки от иммунизированных мышей предварительно инкубировали с супернатантом из инфицированных вирусом гриппа PBMC в течение 1 часа при 37°C, после чего добавляли клетки 93D7 на дополнительные 5 часов. Через 5 часов проводили анализы и считывали на люминесцентном счетчике. Обобщенные данные для первых 8 слияний представлены ниже в таблице 2. Супернатанты в результате 8 слияний отбирали из 3911 исходных лунок, и были выявлены восемь кандидатов (от ACO-1 до 8), где каждый выделен из слияния 4, на основе их способности последовательно проявлять какое-либо видимое снижение опосредуемой PBMC-flu (разведенными в 640 раз) активации продукции MxA/luc при биоанализе RG, который описан в настоящей заявке. Клеточные линии гибридом субклонировали серийным разведением. Гибридомы, продуцирующие MAb против IFN-α, приспосабливали к росту в Gibco PFHM-II (Invitrogen) и культивировали во флаконах Integra CELLine (Becton Dickinson). Супернатанты собирали из клеточных компартментов каждые 5-7 суток и замораживали при -80°C. Затем MAb очищали из порций супернатанта объемом 50 мл посредством FPLC через колонку с белком A с последующим диализом в PBS. Очищенные MAb разделяли на аликвоты и хранили при -80°C. У ACO-1, -2, -3, -4, -5 и -8 посредством ELISA определили изотип как IgG2a (ACO-1), IgG2b (ACO-2) и IgG1 (ACO-3, -4, -5, -6 и -8). Все эти кандидаты получали в результате слияний спленоцитов мышей, исходно иммунизированных лейкоцитарным IFN или смесью рекомбинантных белков IFNα A, B2 и F с последующей, предшествующей слиянию повторной иммунизацией лейкоцитарным IFN; слияния проводили для мышей, которым вводили только подтипы рекомбинантного IFNα, не способные привести к получению каких-либо кандидатов, способных нейтрализовать PBMC-flu.

Таблица 2
Обобщенные данные для слияний
Слияние 1 2 3 4 5 6 7 8 Всего
Проскринировано 435 1644 560 396 136 217 191 332 3911
Выбрано 12 66 2 25 0 29 5 15 154
Субклонировано 3 13 0 8 0 2 0 0 26
Кандидаты 0 0 0 6 0 2 0 0 8

Пример 2

Нейтрализация биоактивности коммерчески доступного лейкоцитарного IFNα или супернатанта PBMC-flu посредством ACO-1, ACO-2, ACO-3, ACO-4 и ACO-5

MAb против IFNα, для которых наблюдали значительное связывание и нейтрализацию по крайней мере одного подтипа IFNα, отбирали для исследования их способности нейтрализовывать препараты природного IFN, для которых известно, что они содержат большое разнообразие подтипов IFNα. Для этих исследований ACO от 1 до 5 титровали в биоанализе RG против коммерчески доступного лейкоцитарного IFN и супернатанта PBMC-flu, получаемого, как описано выше. ACO-1, -2 и -3 блокировали биоактивность лейкоцитарного IFN по крайней мере на 50% при всех трех тестируемых количествах MAb (200, 20 и 2 нг) (фиг.3a); для ACO-4 наблюдали нейтрализацию, незначительно превосходящую 50%, только при тестировании 200 нг. В сравнении с этим ACO-5 плохо действовало против лейкоцитарного IFN, блокируя максимально менее чем 10% сигнала при анализе.

Сравнительное ингибирование различных разведений супернатанта PBMC-flu моноклональными антителами в определенных концентрациях проводили с использованием описанного выше анализа RG. Абсолютная концентрация IFNα в супернатанте Flu/PBMC неизвестна, поэтому в этом исследовании оценивают только относительную нейтрализующую способность. При этом при титровании пяти MAb (2000, 200, 20 и 2 нг) против PBMC-flu ACO-5 было способно нейтрализовать биоактивность по крайней мере на 50% при всех тестируемых количествах антител, за исключением наиболее низкого (фиг.3b). Наибольшую эффективность при тестировании с PBMC-flu наблюдали у ACO-1, достигающего блокады по крайней мере на 50% при всех четырех титруемых количествах MAb. Вероятно, различия в нейтрализации лейкоцитарного IFN и PBMC-flu посредством ACO-5 обусловлены различными подтипами IFNα и/или их относительными концентрациями, присутствующими в двух отдельных источниках IFN, которые используют в рассматриваемых анализах.

Пример 3

Ингибирование биоактивности рекомбинантного подтипа IFNα посредством ACO-1, ACO-2, ACO-3, ACO-4, ACO-5, ACO-6 и ACO-8

Нейтрализующие IFNα кандидаты от ACO-1 до 6 и ACO-8 скринировали посредством анализа RG, а также общепринятого анализа ингибирования цитопатического эффекта (CPE) на предмет нейтрализации 15 подтипов рекомбинантного IFNα, а также на предмет нейтрализации IFNβ. Рекомбинантные белки подтипа IFN-α получали из PBL Biomedical Laboratories (Piscataway, NJ); info@interferonsource.com, здесь и далее "PBL"). Специфическая активность, как определено производителем, представлена в таблице 3.

Таблица 3

Подтипы рекомбинантного IFN-α человека, используемые при характеризации антител

Предоставляемые производителем единицы нейтрализации (ед.) были определены посредством анализа, в котором измеряют способность заданных подтипов к 50% нейтрализации (измеряемой как 1 ед./мл) цитопатического эффекта, оказываемого вирусом везикулярного стоматита на клетки MDBK быка. Учитывая, что на эффективность IFNα в биоанализах влияет множество переменных факторов (в том числе вид анализа, отдельно получаемые порции и незначительные различия в способах от одной лаборатории к другой), а также тот факт, что признанные на международном уровне стандарты для каждого подтипа недоступны, в этих исследованиях последовательно использовали отдельные номера серий. Определяли обозначенные производителем ед. для каждого рекомбинантного вещества, приводящего к максимальной реакции в биоанализе RG (RGмакс). Затем титровали очищенные ACO-1, -2, -3, -4, -5, -6 и -8 в присутствии таких количеств подтипа IFNα в биоанализе RG. IFNβ (специфическая активность = 8,23×107 ед./мг) получали из PBL.

Характерные данные биоанализа RG для титрования ACO-1 против величин RGмакс для пятнадцати подтипов IFNα представлены на фиг.4a. Как указано в подписи, численные величины для каждого титрования ACO-1 против обозначенных подтипов были присвоены на основе определяемых для каждого величин EC50. ACO-1 было неспособно нейтрализовать IFNα D или IFNα 1, тогда как другие тринадцать подтипов можно было нейтрализовать при различных концентрациях антитела. Результаты EC50 в нг/мл для всех нейтрализующих IFNα MAb ACO-1, -2, -3, -4, -5 и -8 представлены в таблице 4. Процент нейтрализации представлен в таблице 5. Соответственно, для ACO-1 и -2 наблюдают сходство их способности нейтрализовать двенадцать подтипов (IFNα A, 2, B2, C, F, G, H2, I, J1, 4a, 4b и WA) при концентрациях менее чем 300 нг/мл антитела; ACO-1 также нейтрализовало на таком уровне IFNα K, а ACO-2 нет. ACO-3 и -4 нейтрализовали девять (IFN-α A, 2, B2, C, I, J1, K, 4a и WA) и шесть (IFNα A, 2, B2, C, I, J1 и 4a) подтипов при менее чем 300 нг/мл, соответственно. ACO-8 нейтрализовало четыре подтипа (IFNα 2, 1, 4a и 4b) при фиксированной концентрации антитела, тогда как ACO-5 нейтрализовало в значительной степени только три (IFNα A, 2 и WA). Ни одно из MAb не было способно нейтрализовать IFNβ (фиг.4b).

Таблица 4

Нейтрализация подтипов рекомбинантного IFNα посредством ACO-1, -2, -3, -4, -5 и -8 (EC50 нг/мл)

Таблица 5

Процент нейтрализации количеств IFN RGмакс посредством

2 микрограмм/мл антитела

Анализ CPE проводили сходно с анализом RG, используя нетрансфицированные клетки A549 (номер ATCC CCL-185, линия клеток карциномы легких человека): анализы выполняют в общепринятых 96-луночных плоскодонных планшетах для культивирования ткани. После предварительной инкубации (1 час при 37°C) антител с подтипами IFNα и добавления через 5 часов клеток добавляли вирус энцефаломиокардита мыши (EMCV) и инкубировали клетки в течение 48 часов перед окрашиванием кристаллическим фиолетовым для оценки оставшихся живых клеток. Для анализов RG и CPE количества каждого используемого подтипа IFNα определяли посредством предварительных титрований рекомбинантных белков IFNα до достижения в анализе максимальной индукции MxA-люцифераза (RG) или защиты от гибели клеток (CPE). Представленные в таблице 6 данные отражают процент блокады биоактивности, наблюдаемый для каждого моноклонального антитела ACO в отношении соответствующих подтипов IFNα (соответствующие гены, которые кодируют подтипы, указаны в скобках) при анализе CPE. Для обоих анализов CPE количества каждого используемого подтипа IFNα определяли предварительными титрованиями рекомбинантных белков IFNα до достижения максимальной защиты от гибели клеток (CPE). N/D = не определено. Как показано, ACO-1 и ACO-2 в условиях анализа способны блокировать наибольшее количество подтипов IFNα на уровне 90%, тогда как ACO-6 является наиболее ограниченным. В большинстве случаев результаты анализов RG и CPE соответствуют друг другу.

Таблица 6

Процент нейтрализации активности подтипа IFNα посредством Mab в анализе CPE

Пример 4

Множественный анализ ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 и ACO-6.

Множественный анализ проводили для оценки, вовлечены ли различные в пространственном отношении домены связывания. Антитела ACO комбинаторно анализировали на предмет их способности к одновременному связыванию IFNα А посредством множественного анализа в системе LuminexTM 100. Гранулы, связанные с немечеными антителами ACO ("вещество для захвата"), инкубировали с рекомбинантным IFNα А при указанной концентрации, а затем подвергали воздействию PE-меченых антител ACO ("репортер"). В этом исследовании было выявлено, что ACO-5 способно к множественному воздействию вместе с любым из ACO-1, -2, -3 и -4 (см. область ненасыщенного цвета на фиг.5). Множественное воздействие дополнительно происходит при использовании ACO-4 в качестве захватываемого антитела и ACO-3 в качестве антитела-репортера. Соответственно, ACO-5 связывает домен IFN-α, отличный в пространственном отношении от домена, связываемого посредством ACO-1, -2, -3 и -4. Сходным образом, ACO-3 и ACO-4 связывают различные в пространственном отношении домены IFNα. Результаты для ACO-6 во всех случаях были отрицательными.

Пример 5

Анализы аффинности для ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 и ACO-6

Кинетический анализ антител ACO против IFNα проводили с использованием оптических биосенсоров Biacore 2000 и 3000, оборудованных сенсорными микросхемами CM5 и уравновешенных посредством 10 мМ HEPES, 150 мМ NaCl, 0,005% P20, 0,1 мг/мл BSA, pH 7,4 при 25°C. В случае каждого из ACO от 1 до 6 для антител сначала меняли буфер с трис-глицинового буфера на буфер из 10 мМ ацетата натрия, pH 5,0 с использованием фиксированной колонки для обессоливания, а затем антитела закрепляли на поверхностях трех проточных кювет с использованием общепринятых химических способов связывания аминов, тогда как четвертую оставляли немодифицированной, служащей в качестве контроля. Конечные значения плотности фиксации MAb находились в диапазоне 500-1100 RU (реагирующие единицы). Реакции связывания наблюдали по мере того, как IFNα А в титруемых количествах (0, 0,31, 0,93, 2,78, 8,33, 25,0 и 75,0 нМ) протекал над проточными кюветами с антителами и контрольной проточной кюветой при скорости 50 мкл/минута. Ассоциацию комплекса антитело/антиген наблюдали в течение четырех минут, а диссоциацию наблюдали в течение двенадцати минут. Поверхности восстанавливали с использованием 1/1000 H3PO4 (за исключением ACO-5, для которого необходимо 1/200 H3PO4) в конце каждого цикла связывания. Анализы выполняли в трех сериях. Результаты представлены в таблице 7. Величины KD для пяти MAb против IFNα составляли диапазон, обратно пропорциональный объему подтипов IFNα, нейтрализуемых каждым MAb, а также их способности блокировать биоактивность лейкоцитарного IFN и PBMC-flu. ACO-1 обладал наиболее низкой аффинностью (5,61×10-9 M), тогда как ACO-5 обладал в 14 раз большей аффинностью (4,00×10-10 M). ACO-6 не связывается с IFNα, и поэтому данные о скоростях недоступны.

Таблица 7

Кинетический анализ Biacore для ACO от ACO-1 до ACO-6 вместе с IFNα А

Пример 6

Твердофазное связывание подтипов IFNα посредством ACO-1, ACO-2, ACO-3, ACO-4, ACO-5 и ACO-6

Твердофазное связывание всех 15 подтипов IFNα оценивали посредством анализа ELISA для скрининга специфичности MAb. Вкратце, 50 мкл/лунка 1 мкг/мл рекомбинантного подтипа белка IFNα наносили на планшеты для ELISA (NUNC MaxiSorpTM) в течение ночи при 4°C. Покрытые планшеты блокировали с использованием PBS + 1% BSA и инкубировали с 50 мкл 25 нг MAb-кандидата ACO в PBS в течение 1 часа при 37°C. Анализы проводили посредством инкубации с 50 мкл/лунка конъюгированного с HRP козьего антитела против IgG мыши (Jackson ImmunoResearch) в течение 30 минут при комнатной температуре с последующей инкубацией вместе с 100 мкл/лунка раствора субстрата TMB (Zymed) в течение 15 минут. Реакцию останавливали с использованием 100 мкл/лунка 1н. HCl и считывали на планшет-ридере для ELISA при OD450. Проценты связывания вычисляли посредством нормализации величин фонового сигнала в соответствии с максимальными величинами сигнала на протяжении анализа (наблюдаемыми для IFNα-4a). Результаты представлены в таблице 8 и на фиг.6. Оба ACO-1 и 2 связывали те же двенадцать подтипов IFNα, которые они эффективно нейтрализовали в биоанализе RG, при величинах сигнала, по крайней мере в 2 раза превышающих величины для контролей, соответствующих по изотипу; для связывания подтипов IFNα B2, K, 4a и 4b наблюдали сигналы, более чем в 20 раз превышающие контрольные. Однако среди ACO-3, -4, -5 и -8 были выявлены отличия между связывающей и нейтрализующей способностями. В случае ACO-3 сигналы при ELISA для подтипов B2, K и 4a были наивысшими, несмотря на то, что величина EC50 для нейтрализации IFNα K более чем в 200 раз превышала значение EC50 для IFNα B2 и в 4 раза превышала значение для IFNα 4a; значительного связывания подтипа J1, который был нейтрализован в биоанализе, не наблюдали. Профили связывания и нейтрализации для ACO-4 и -5 отражают обратную зависимость друг от друга. Хотя ACO-4 и -5 в значительной степени связывали по одному подтипу каждое (IFNα 4a и 2, соответственно), ACO-4 было способно связывать большее число подтипов, чем оно нейтрализовало, а ACO-5 было способно нейтрализовать (хотя и при высоких значениях EC50) большее число подтипов, чем оно связывало. Возможное объяснение может состоять в различиях в доступности специфических эпитопов, распознаваемых этими двумя MAb, в анализе с водной фазой (RG) в сравнении с твердофазным анализом (ELISA). ACO-8 было неспособно связывать в значительной степени какой-либо из тестируемых подтипов IFNα; для него наблюдали менее чем в 20 раз превышающее связывание с IFNα D, 1 и 4a. ACO-6 было неспособно связываться с каким-либо из подтипов.

Таблица 8

Связывание рекомбинантных подтипов IFNα посредством ACO-1, -2, -3, -4, -5 и -8

Подчеркивание указывает на сигналы, более чем в 2 раза превышающие соответствующие контроли. Жирным шрифтом указаны сигналы, более чем в 20 раз превышающие соответствующие контроли. Сигналы, менее чем в 2 раза превышающие соответствующие контроли, указывают на незначительное связывание.

Пример 7

Блокада биоактивности сыворотки пациентов с SLE моноклональными антителами ACO-1, -2 и -3

Анализ на предмет противовирусного эффекта использовали для оценки способности MAb против IFNα нейтрализовать защитную активность сыворотки от пациентов с активным заболеванием SLE против гибели клеток A540 (CCL-185, ATCC) при инфицировании вирусом энцефаломиокардита (RMCV). Тестировали антитела, обладающие наиболее широкими профилями подтипов IFNα, лейкоцитарного IFN и нейтрализации PBMC-flu (ACO-1, -2 и -3). Сыворотку при SLE получали от четырех пациентов с активной SLE (обозначенных как SLE-43, 133, 140 и BC), которых выбирали на основе характерных признаков экспрессии генов IFN и гранулопоэза, где эти характеристики получали для мононуклеаров крови пациентов. Перед тестированием нейтрализации MAb сыворотки при SLE скринировали в биоанализе CPE на предмет защиты от вирусной инфекции. Анализ RG в этих анализах не использовали вследствие ингибирования сывороточными факторами связывания клеток с ViewPlatesTM в ходе относительно короткого периода инкубации (5 часов) при биоанализе RG в сравнении с анализом CPE (48 часов). Клетки Vero (CCL-81, ATCC) инфицировали посредством (VR-129B, ATCC) для получения рабочих исходных источников вирусов из супернатантов. Анализы выполняли в трех сериях в обрабатываемых тканевой культурой плоскодонных 96-луночных планшетах, которые инкубировали в течение ночи при 37°C + CO2 вместе с клетками A549 (15000 клеток/лунка в 50 мкл каждая). Затем к планшетам добавляли MAb против IFNα и сыворотку от пациентов с SLE (100 мкл/лунка) и предварительно инкубировали в течение 4 часов перед добавлением EMCV, разведенного в 50 мкл до минимальной концентрации, способной убивать 100% незащищенных клеток в течение 48 часов. Инкубацию продолжали в течение 48 часов с последующим окрашиванием кристаллическим фиолетовым и считыванием при OD570 на планшет-ридере для ELISA. Контроли представляли собой только отдельно сыворотку, только среды (-), а также пан-нейтрализующее поликлональное антитело (pAb, кроличье антитело против IFNα человека, PBL). Представленные на фиг.7a-d результаты представляют собой средние значения для трех серий. Несмотря на их более низкие аффинности, ACO-1 и -2 были способны в определенной степени нейтрализовать все четыре сыворотки. ACO-3 было неспособно блокировать SLE-43, 140 или BC. Способность контрольных антител с соответствующим изотипом блокировать сыворотку в некоторых случаях (IgG2b для SLE-43, все три изотипа для SLE-BC), вероятно, обусловлена природными различиями от одного пациента к другому в других компонентах сыворотки, являвшихся цитотоксическими для используемых в анализе клеток.

Пример 8

Перекрестная реактивность ACO-1 и ACO-2 с IFNα примата

Для проведения доклинических исследований безопасности/токсичности как предшествующих клиническим испытаниям у человека является эффективным определить животную модель, в которой эндогенный IFNα реагирует с гуманизированным моноклональным антителом против IFNα. Тестировали способность двух кандидатов, мышиных антител ACO-1 и ACO-2 против IFNα человека, нейтрализовать IFNα примата. Конкретно, определяли способность антител блокировать индукцию гена-репортера MxA-люцифераза в клетках A549 при стимуляции очищенным IFNα 4b макака (156 пг/лунка). Как представлено на фиг.8, антитела ACO-1 и ACO-2 способны блокировать индукцию гена-репортера (A и B, соответственно), тогда как ACO-3 неспособно блокировать даже при высоких концентрациях (C). Гомология между IFNα человека и макака является высоко консервативной. Кроме того, для коммерчески доступных антител против IFNα человека наблюдали перекрестное реагирование с гомологами от макака-резус и яванского макака. Эти данные позволяют предположить, что приматы обеспечивают приемлемую безопасную модель для скрининга.

Пример 9

Последовательность тяжелой и легкой цепей ACO-1

Для амплификации мРНК из экспрессирующей ACO-1 гибридомы проводили RT/PCR с использованием вырожденных совокупностей праймеров. мРНК вариабельной области тяжелой цепи амплифицировали с использованием набора из шести вырожденных совокупностей праймеров (от HA до HG), а мРНК вариабельной области легкой цепи амплифицировали с использованием набора из восьми вырожденных совокупностей праймеров (от LA до LI). Продукты амплификации получали при использовании совокупностей праймеров: HA, HB, HE, HF, LB, LC и LG. Ни одного продукта PCR не амплифицировали при использовании совокупности LI, поэтому легкую цепь получают из группы каппа. Каждый продукт клонировали и для каждого секвенировали по несколько клонов.

Были выявлены две различных последовательности тяжелой цепи. Совокупности HA и HF приводили к амплификации одной последовательности, кодирующей усеченную тяжелую цепь со стоп-кодоном в конце каркасной области 3. Поэтому маловероятно, что эта тяжелая цепь может формировать антитело, способное связывать антиген.

Совокупности HB и HE приводили к амплификации одной последовательности, отличавшейся от последовательности при HA и HF и кодирующей полноразмерную область Vh мыши, как представлено на фиг.9. Полноразмерная последовательность ДНК тяжелой цепи представляет собой SEQ ID NO:1, а полноразмерная последовательность аминокислот представляет собой SEQ ID NO:2. Последовательности ДНК, кодирующие CDR VH1 (TACACCTTCACCAACTACTGGATGCAC; SEQ ID NO:3), VH2 (GAGATTAATCCTAGCCACGGTCGTACTATCTACAATGAAAACTTCAAGAGC; SEQ ID NO:5) и VH3 (GGGGGACTGGGACCCGCCTGGTTTGCTTAC; SEQ ID NO:7) выделены курсивом, тогда как аминокислотные последовательности VH1 (YTFTNYWMH; SEQ ID NO:4), VH2 (EINPSHGRTIYNENFKS; SEQ ID NO:6) и VH3 (GGLGPAWFAY; SEQ ID NO:8) подчеркнуты.

Были выявлены две последовательности легких цепей. Совокупности LB и LC приводили к амплификации одной последовательности, которая совпадала с подтвержденной документальными доказательствами нарушенной, усеченной легкой цепью каппа, наблюдаемой в некоторых гибридомах. Совокупность LG приводила к амплификации одной последовательности, которая являлась полноразмерной и отличалась от амплифицированных с совокупностями LB и LC. Последовательность легкой цепи представлена на фиг.10. Полноразмерная последовательность ДНК легкой цепи представляет собой SEQ ID NO:9, а полноразмерная последовательность аминокислот представляет собой SEQ ID NO:10. Последовательности ДНК, кодирующие CDR VL1 (AGTGCCGGCTCAAGTGTAGATTCCAGCTATTTGTAC; SEQ ID NO:11), VL2 (AGC ACATCCAACCTGGCTTCT; SEQ ID NO:13) и VL3 (CATCAGTGGAGTAGTTACCCATTCACG; SEQ ID NO:15) выделены курсивом, тогда как аминокислотные последовательности VL1 (SAGSSVDSSYLY; SEQ ID NO:12), VL2 (STSNLAS; SEQ ID NO:14) и VL3 (HQWSSYPFT; SEQ ID NO:16) подчеркнуты.

Анализ последовательностей, полученных из гибридомы ACO-1, обобщен в таблице 9. Вариабельные области обладают гомологией с ближайшими для них последовательностями из зародышевой линии человека (от 67% до 65%), а каркасные последовательности имеют близких гомологов в базе данных зародышевой линии человека.

Таблица 9

Клон ACO-1

a Обозначения CDR и нумерация последовательностей в соответствии с Kabat;

b Указаны ID зародышевой линии, за которыми следует % гомологии.

Пример 10

Гуманизация моноклонального антитела и его характеризация

Гуманизированное антитело получают присоединением мышиных гипервариабельных участков к каркасной области антитела человека (пересадка CDR) с использованием известных в данной области способов (см. Jones, et al., (1986) Nature, 321:522-525; Reichmann et al., (1988) Nature, 332:323-329; Presta (1992) Curr. Op. Struct. Biol., 2:593-596; и Clark (2000) Immunol. Today 21: 397-402). Гуманизированное антитело может обладать такими же характеристиками связывания и функциональными характеристиками, что и описанные выше моноклональные антитела мыши.

Пример 11

Лечение SLE с использованием гуманизированного моноклонального антитела

Для наблюдения характерных признаков IFNα используют анализ с применением микрочипов в соответствии со способами, известными в данной области и описанными в Bennett, et al. (2003), выше, и Baechler, et al. (2003), выше. Этот новый способ служит для разделения на группы (т.е. положительный критерий включения для характерных признаков IFNα), а также для наблюдения пациентов. Также использование этого анализа эффективно для определения пациентов, подходящих для лечения композициями и способами по этому изобретению. В одном из аспектов введение антитела по этому изобретению устраняет эти характерные признаки. В одном из аспектов специалист в данной области способен определить, когда достигается цель способа по этому изобретению и когда было доставлено эффективное количество антитела, которое обозначают как количество, необходимое для подавления характерных признаков IFNα на 50% за эффективный период времени, например, приблизительно 4 недели.

Например, вводимое инфузией эффективное количество составляет приблизительно от 1 мг/кг антитела, второе количество - 2,5 мг/кг, третье - 5 мг/кг и четвертое, при необходимости, составляет 10 мг/кг. "Рассчитываемую оптимальную дозу" для каждого пациента определяют как количество, которое можно безопасно вводить и которое приводит к подавлению характерных признаков IFNα по крайней мере на 50% в течение приблизительно четырех недель.

Пациентов еженедельно наблюдают на предмет характерных признаков IFNα. Время повторного возникновения характерных признаков IFNα определяет интервал между введением доз. Например, если доза 1 мг/кг приводит к снижению характерных признаков на 50% только на 2 недели, то пациенту вводят 2-ую дозу, составляющую 2,5 мг/кг. Если при еженедельном наблюдении было выявлено подавление характерных признаков на 50% только на 3 недели, то пациенту вводят его 3-ю дозу, составляющую 5 мг/кг. Максимальную дозу 10 мг/кг тестируют с целью выявить дозу, приводящую к подавлению IFNα на 50% по крайней мере на 4 недели.

Эффективность можно измерять любым приемлемым способом. Приемлемые способы включают в себя, но ими не ограничиваются, анализ PBMC с использованием микрочипов (эффективность выявляют по подавлению характерных признаков интерферона), проточную цитометрию для PBMC (эффективность выявляют на основании повышенного содержания T/B-лимфоцитов), сниженный плазмацитоз и сниженное присутствие незрелых нейтрофилов или множественный анализ цитокинов в сыворотке с использованием анализа Luminex.

Биологические депозиты. Клеточные линии гибридом от ACO-1 до ACO-6 депонировали в Американскую коллекцию типовых культур, 10801 University Blvd., Manassas, VA 20110-2209, USA (ATCC), и им были присвоены регистрационные номера депозитов, указанные ниже в таблице 10.

Таблица 10

Эти депозиты были получены в соответствии с условиями Будапештского договора о международном признании депонирования микроорганизмов для целей патентной процедуры и установления правил на основании этого договора (Будапештского договора). Это обеспечивает поддержание жизнеспособной культуры депозита в течение 30 лет от даты депонирования. Депозиты доступны в ATCC в соответствии с условиями Будапештского договора и подлежат действию договора между Baylor Research Institute и ATCC, который обеспечивает постоянную и неограниченную доступность потомства культуры депозита для пользователей после опубликования соответствующего патента США или после предоставления в открытый доступ какой-либо патентной заявки США или иностранной патентной заявки, вне зависимости от того, какая будет первой, а также который обеспечивает доступность потомства для индивидуума, определенного комиссаром по патентам, которому предоставлено на это право в соответствии с 35 U.S.C. § 122 и относящимися к этому правилу для комиссара (в том числе 37 C.F.R. § 1.14 с особой ссылкой на 866 OG 638).

Обладатель настоящей заявки согласился с тем, что в случае гибели или утраты или разрушения культуры веществ на депозите при культивировании в приемлемых условиях вещества незамедлительно, с уведомлением, заменят другими такими же веществами. Доступность депонированного вещества не следует понимать как разрешение осуществлять изобретение на практике в нарушение прав, гарантированных какими-либо органами власти в соответствии со своим патентным законодательством.

Следует понимать, что описанные в настоящей заявке конкретные варианты осуществления предназначены для иллюстрации, а не для ограничения изобретения. Основные особенности этого изобретения можно использовать в различных вариантах осуществления, не выходя за рамки объема изобретения. Специалисты в данной области понимают или определяют множество эквивалентов конкретных описанных в настоящей заявке способов, используя только лишь общепринятые эксперименты. Подразумевают, что такие эквиваленты входят в объем этого изобретения и предусмотрены формулой изобретения.

Все указанные в описании публикации и патентные заявки показательны для уровня навыков специалистов в области, к которой относится это изобретение. Все публикации и патентные заявки, а особенно их соответствующие разделы приведены в настоящей заявке в качестве ссылки в таком же объеме, как если бы каждая отдельная публикация или патентная заявка была индивидуально и конкретно указана для включения в качестве ссылки.

В формуле изобретения все переходные выражения, такие как "содержащий", "включающий", "несущий", "обладающий", "вмещающий", "предусматривающий" и т.п. следует понимать как открытые, т.е. они обозначают, что включают в себя, но этим не ограничиваются. Только переходные выражения "состоящий из" и "состоящий преимущественно из", соответственно, должны являться закрытыми или полузакрытыми переходными выражениями.

Все композиции и/или способы, описанные и заявленные в настоящей заявке, можно получать и осуществлять без чрезмерных экспериментов с учетом настоящего описания. Хотя композиции и способы по этому изобретению были описаны относительно предпочтительных вариантов осуществления, специалистам в данной области очевидно, что можно осуществлять изменения в описанных в настоящей заявке композициях и/или способах, а также в стадиях или в последовательности стадий способа без утраты принципов, сущности и объема изобретения. Более конкретно, очевидно, что описанные в настоящей заявке вещества можно заменять определенными химически и физиологически родственными веществами при условии достижения таких же или сходных результатов. Подразумевают, что все такие сходные замены и модификации, очевидные специалистам в данной области, входят в сущность, объем и принципы изобретения, как указано в прилагаемой формуле изобретения.

1. Антитело или его антигенсвязывающий фрагмент, избирательно нейтрализующее биоактивность по крайней мере двух подтипов белка интерферона-альфа (IFNα), выбранных из группы, которая состоит из подтипов белка А, 2, В2, С, F, G, H2, I, J1, K, 4а, 4b и WA, но не нейтрализующее в значительной степени по крайней мере одну биоактивность белка IFNα подтипа D, где биоактивность представляет собой активацию промотора МхА или противовирусную активность, где антитело или его антигенсвязывающий фрагмент содержит вариабельный домен тяжелой цепи и вариабельный домен легкой цепи и где вариабельный домен легкой цепи содержит следующие CDR:
VL1, имеющий аминокислотную последовательность SEQ ID NO:12;
VL2, имеющий аминокислотную последовательность SEQ ID NO:14;
и VL3, имеющий аминокислотную последовательность SEQ ID NO:16;
и вариабельный домен тяжелой цепи содержит следующие CDR:
VH1, имеющий аминокислотную последовательность SEQ ID NO:4;
VH2, имеющий аминокислотную последовательность SEQ ID NO:6;
и VH3, имеющий аминокислотную последовательность SEQ ID NO:8.

2. Антитело или его антигенсвязывающий фрагмент по п.1, где биоактивность представляет собой активацию промотора МхА.

3. Антитело или его антигенсвязывающий фрагмент по п.1, где биоактивность представляет собой противовирусную активность.

4. Антитело или его антигенсвязывающий фрагмент по п.1, где антитело или его антигенсвязывающий фрагмент не нейтрализует по крайней мере одну биоактивность белка IFNα подтипа 1, где биоактивность представляет собой активацию промотора МхА или противовирусную активность.

5. Антитело или его антигенсвязывающий фрагмент по п.1, где антитело или его антигенсвязывающий фрагмент избирательно нейтрализует по крайней мере три подтипа белка IFNα.

6. Антитело или его антигенсвязывающий фрагмент по п.1, где антитело или его антигенсвязывающий фрагмент избирательно нейтрализует по крайней мере четыре подтипа белка IFNα.

7. Антитело или его антигенсвязывающий фрагмент по п.1, где антитело или его антигенсвязывающий фрагмент избирательно нейтрализует по крайней мере пять подтипов белка IFNα.

8. Антитело или его антигенсвязывающий фрагмент по п.1, где антитело или его антигенсвязывающий фрагмент избирательно нейтрализует по крайней мере шесть подтипов белка IFNα.

9. Антитело или его антигенсвязывающий фрагмент по п.1, где антитело или его антигенсвязывающий фрагмент избирательно нейтрализует по крайней мере семь подтипов белка IFNα.

10. Антитело или его антигенсвязывающий фрагмент по п.1, где антитело или его антигенсвязывающий фрагмент избирательно нейтрализует по крайней мере восемь подтипов белка IFNα.

11. Антитело или его антигенсвязывающий фрагмент по п.1, избирательно нейтрализующее биоактивность белка IFNα подтипов А, 2, В2, С, F, G, H2, I, J1, K, 4а, 4b и WA, но не нейтрализующее в значительной степени биоактивность белка IFNα подтипов D и 1.

12. Антитело по п.1, где антитело представляет собой моноклональное антитело АСО-1, которое продуцируется клеточной линией гибридомы с регистрационным номером АТСС РТА-6557.

13. Антитело или его антигенсвязывающий фрагмент по п.1 или 11, где антитело или его антигенсвязывающий фрагмент нейтрализует биоактивность указанных подтипов IFNα по крайней мере на 50%, где биоактивность представляет собой активацию промотора МхА.

14. Антитело или его антигенсвязывающий фрагмент по п.13, где антитело или его антигенсвязывающий фрагмент нейтрализует указанную биоактивность по крайней мере на 60%.

15. Антитело или его антигенсвязывающий фрагмент по п.13, где антитело или его антигенсвязывающий фрагмент нейтрализует указанную биоактивность по крайней мере на 70%.

16. Антитело или его антигенсвязывающий фрагмент по п.13, где антитело или его антигенсвязывающий фрагмент нейтрализует указанную биоактивность по крайней мере на 80%.

17. Антитело или его антигенсвязывающий фрагмент по п.13, где антитело или его антигенсвязывающий фрагмент нейтрализует указанную биоактивность по крайней мере на 90%.

18. Антитело по п.1, где антитело представляет собой гуманизированную или химерную форму моноклонального антитела АСО-1.

19. Антитело по п.1, где антитело представляет собой гуманизированное моноклональное антитело против IFNα человека, включающее вариабельный домен тяжелой цепи SEQ ID NO:2 и вариабельный домен легкой цепи SEQ ID NO:10.

20. Антитело или его антигенсвязывающий фрагмент по п.1, где антитело или его антигенсвязывающий фрагмент связывает, по существу, тот же эпитоп IFNα, что и антитело против IFNα, продуцируемое гибридомой с регистрационным номером АТСС № РТА-6557, или его гуманизированная или химерная форма.

21. Антитело или его антигенсвязывающий фрагмент по п.1, где антитело представляет собой гомотетрамерную структуру, состоящую из двух связанных дисульфидной связью пар тяжелая цепь - легкая цепь антитела.

22. Антитело по п.1, где антитело представляет собой линейное антитело.

23. Антитело по п.1, где антитело не нейтрализует IFNβ.

24. Антитело по пп.1, 11 или 20, где антитело представляет собой антитело мыши, антитело человека, гуманизированное антитело или химерное антитело.

25. Антитело по пп.1, 11 или 20, где антитело представляет собой моноклональное антитело.

26. Клетка-хозяин, содержащая нуклеиновую кислоту, которая кодирует антитело или его антигенсвязывающий фрагмент по пп.1, 11 или 20, где клетка-хозяин пригодна для получения антитела или его антигенсвязывающего фрагмента, которое избирательно нейтрализует биоактивность по крайней мере двух подтипов белка интерферона-альфа (IFNα), выбранных из группы, которая состоит из подтипов белка А, 2, В2, С, F, G, H2, I, J1, K, 4а, 4b и WA, но не нейтрализует в значительной степени, по крайней мере, одну биоактивность белка IFNα подтипа D.

27. Клетка-хозяин по п.26, где клетка-хозяин представляет собой гибридому.

28. Гибридома, продуцирующая антитело или его антигенсвязывающий фрагмент по пп.1, 11 или 20.

29. Гибридома по п.28, которая продуцирует моноклональное антитело АСО-1.

30. Гибридома по п.29, которая представляет собой гибридому с регистрационным номером АТТС РТА-6557.

31. Применение антитела или его антигенсвязывающего фрагмента по пп.1, 11 или 20 для производства лекарственного средства для лечения заболевания или состояния, связанного с патологической экспрессией по крайней мере одного подтипа белка интерферона-альфа (IFNα), выбранного из группы, которая состоит из подтипов белка А, 2, В2, С, F, G, H2, I, J1, K, 4a, 4b и WA.

32. Применение по п.31, где антитело или его антигенсвязывающий фрагмент связывает, по существу, тот же эпитоп IFNα, что и антитело АСО-1.

33. Применение по п.31, где заболевание или состояние выбрано из группы, состоящей из системной красной волчанки (SLE), реакции "трансплантат против хозяина" (GVHD), диабета типов 1 и 2, СПИДа, волчанки, псориаза и аутоиммунного тиреоидита.

34. Применение по п.33, где заболевание представляет собой SLE.

35. Применение по п.33, где заболевание представляет собой псориаз.

36. Антитело по п.1, полученное из гибридомы с регистрационным номером АТСС РТА-6557, где гибридома пригодна для получения антитела, которое избирательно нейтрализует биоактивность по крайней мере двух подтипов белка интерферона-альфа (IFNα), выбранных из группы, которая состоит из подтипов белка А, 2, В2, С, F, G, H2, I, J1, K, 4а, 4b и WA, но не нейтрализует в значительной степени по крайней мере одну биоактивность белка IFNα подтипа D.

37. Антитело по п.36, где антитело является гуманизированным.



 

Похожие патенты:

Изобретение относится к биотехнологии и представляет собой антитела, которые специфически связывают сайт II онкостатина М человека (hOSM) и ингибируют взаимодействие между hOSM и gp130.

Изобретение относится к области медицины и касается гуманизированного антитела против остеопонтина человека. .

Изобретение относится к иммунологии и биотехнологии. .

Изобретение относится к биотехнологии и представляет собой фармацевтическую композицию для лечения эпителиальной опухоли у человека, где указанная фармацевтическая композиция содержит биспецифическое одноцепочечное антитело, обладающее первым связывающим доменом, специфически связывающимся с CD3 человека, и вторым связывающим доменом, специфически связывающимся с СЕА человека.

Изобретение относится к биотехнологии и представляет собой IL-17-связывающее антитело или его активный фрагмент. .

Изобретение относится к биотехнологии и представляет собой стабильное и растворимое scFv-антитело и Fab-фрагмент, специфические в отношении TNF , которые содержат специфические последовательности легкой цепи и тяжелой цепи, которые оптимизированы в отношении стабильности, растворимости, in vitro и in vivo связывания TNF и низкой иммуногенности.

Изобретение относится к биотехнологии и представляет собой антитела, которые специфически связываются с IL-13

Изобретение относится к фармацевтической композиции для локального введения на поверхность барьера эпителиальной ткани, содержащей scFv-антитела, которые специфически связывают выбранные антигены и могут быть получены способом, предусматривающим (i) отбор из пула растворимых и стабильных каркасов антител растворимого и стабильного каркаса, соответствующего наилучшим образом каркасу антитела не человека против антигена с определенной связывающей специфичностью, (ii) либо обеспечение указанного растворимого и стабильного каркаса CDR, которые связываются специфически с указанным антигеном, либо мутирование этого каркаса указанного антитела не человека в направлении последовательности указанного растворимого и стабильного каркаса, для генерирования scFv-антител, (iii) тестирование генерированного антитела на растворимость и стабильность, и тестирование генерированного антитела на связывание антигена, и (iv) отбор scFv-антитела, которое является стабильным, растворимым и специфически связывается с этим антигеном

Изобретение относится к биотехнологии

Изобретение относится к биохимии и представляет собой изолированное человеческое или гуманизированное антитело или его функциональный фрагмент, которое является специфическим в отношении человеческого GM-CSF

Изобретение относится к биохимии и представляет собой человеческое моноклональное антитело или его фрагмент, которые специфически связываются с GM-CSF приматов и нейтрализуют его

Изобретение относится к биохимии и представляет собой варианты антител, связывающих IL-22 человека
Наверх