Способ получения лекарственного препарата генетически модифицированных клеток

Авторы патента:

 

C12N15 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2431669:

Ризванов Альберт Анатольевич (RU)
Государственное образовательное учреждение высшего профессионального образования "Казанский государственный университет им. В.И. Ульянова-Ленина" (RU)
Киясов Андрей Павлович (RU)
Государственное образовательное учреждение высшего профессионального образования "Казанский государственный медицинский университет Федерального агентства по здравоохранению и социальному развитию" (RU)
Исламов Рустем Робертович (RU)

Изобретение относится к биотехнологии. Получают двухкассетную генетическую плазмидную конструкцию pBud-VEGF-GDNF, содержащую фрагменты ДНК, кодирующие VEGF и GDNF. Из крови человека выделяют мононуклеарные клетки. Выделенные клетки генетически модифицируют pBud-VEGF-GDNF. Генетически модифицированные клетки культивируют, концентрируют, очищают от культуральной среды, ресуспензируют. Генетически модифицированные клетки анализируют на количество, концентрацию, жизнеспособность и по результатам анализа определяют оптимальную терапевтическую дозу генетически модифицированных клеток, которая является лекарственным препаратом генетически модифицированных клеток. Изобретение позволяет получать препарат с существенно повышенными лечебными свойствами. 1 з.п. ф-лы.

 

Изобретение относится к способам получения лекарственных препаратов, содержащих генетический материал. Может быть использовано в медицине.

Известен способ [1] стимуляции ангиогенеза. Недостатком способа [1] является неудовлетворительная эффективность действия препаратов, получаемых применением известного способа, из-за того, что используют ограниченное разнообразие генов - только один (из многих возможных) терапевтический ген сосудистого эндотелиального фактора роста - VEGF. Это ограничивает лечебные свойства трансплантируемых клеток. Кроме того, для получения модифицированных клеток (трансфекции рекомбинантной ДНК в клетки-мишени) по способу [1] используют «японский гемагглютинирующий вирус», в результате чего увеличивается аллергентность и иммуногенность лечебного препарата, с угрозой здоровью и жизни.

Известен способ [2] для лечения бокового амиотрофического склероза. Недостатком способа является неудовлетворительная эффективность препаратов, получаемых применением известного способа, из-за того, что для повышения лечебных свойств трансплантируемых клеток используют только один (из многих возможных) терапевтический ген глиального фактора роста - GDNF. Кроме того, используемый для получения модифицированных клеток (трансфекции рекомбинантной ДНК в клетки-мишени) ретровирусный вектор (генетическую конструкцию) приводит к интеграции рекомбинантной ДНК в хромосому клетки-мишени. Это сопровождается риском возникновения мутаций с последующим раковым перерождением клеток.

Известен способ [3] для лечения бокового амиотрофического склероза. Недостатком способа [3] является неудовлетворительная эффективность препаратов, получаемых применением известного способа, из-за того, что используют ограниченное разнообразие генов - только один (из многих возможных) терапевтический ген сосудистого эндотелиального фактора роста - VEGF. Кроме того, используемый для получения модифицированных клеток (трансфекции рекомбинантной ДНК в клетки тканей) аденовирусный вектор (являющийся вирусной генетической конструкцией), который вызывает сильную иммунологическую реакцию у пациентов при наличии у пациента аденовирусной инфекции и/или при повторном применении. Иммунологическая реакция несет угрозу жизни и здоровью.

Способ [3] основан на прямом введении генетического материала в ткани пациента и не позволяет проводить адресную доставку терапевтических генов в очаги поражения на клеточном уровне. Это приводит к эффекту неспецифической экспрессии терапевтических генов, например, вызывающей формирование и рост новых кровеносных сосудов в ненужных местах.

Наиболее близким по существу предлагаемого изобретения (прототипом) является известный способ получения генетически модифицированных клеток [4].

Недостатком прототипа является низкая эффективность действия препарата, изготовленного по способу [4], из-за низкого выхода продукта в виде генетически модифицированных клеток. Низкий выход продукта обусловлен следующим. Для приготовления эффективной лекарственной формы препарата по способу [4] необходимо одновременное введение двух независимых генетических конструкций. Использование двух отдельных генетических конструкций сопровождается получением недостаточной доли (из общей численности используемых клеток) клеток, генетически модифицированных одновременно двумя терапевтическими генами. Этим недостатком объясняется первая причина низкой эффективности препарата. Другим недостатком является низкая терапевтическая эффективность препарата, получаемого путем использования способа, из-за того, что второй ген представляет собой молекулу адгезии клеток. Этот второй ген выполняет лишь роль механической связи и не действует в качестве лекарственного компонента. Поэтому прототип обладает недостаточной эффективностью действия при применении.

Целью предлагаемого изобретения является получение лекарственного препарата генетически модифицированных клеток повышенной эффективности действия препарата.

Цели достигают тем, что получают двухкассетную генетическую плазмидную конструкцию pBud-VEGF-GDNF, содержащую фрагменты ДНК, кодирующие VEGF и GDNF. Из пуповинной крови человека выделяют мононуклеарные клетки. Выделенные клетки генетически модифицируют генетической конструкцией pBud-VEGF-GDNF. Генетически модифицированные клетки культивируют, концентрируют, очищают от культуральной среды, ресуспензируют. Генетически модифицированные клетки анализируют на количество, концентрацию, жизнеспособность и по результатам анализа определяют оптимальную терапевтическую дозу генетически модифицированных клеток, которая является лекарственным препаратом генетически модифицированных клеток.

Лекарственный препарат применяют для лечения нейродегенеративных заболеваний.

Лекарственный препарат замораживают для хранения и последующего применения.

Сущность предлагаемого изобретения иллюстрируется примером осуществления предлагаемого способа для изготовления лечебного препарата. Изготовление препарата производят, например, в три этапа.

Первый этап

Генетическую конструкцию pBud-VEGF-GDNF создают на основе плазмиды pBud СЕ4.1 с использованием стандартного метода генетической инженерии [5] следующим путем.

Субклонирование фрагментов ДНК (несущих последовательности, кодирующие синтез изоформы 165 человеческого VEGF) в двухкассетный экспрессионный плазмидный вектор pBudCE 4.1 проводят с использованием рестрикционных сайтов, например рестрикционных ферментов Kpnl и Xhol. Ферменты (Kpnl и Xhol) являются несовместимыми по составу реакционных буферов. По данной причине рестрикционное расщепление плазмиды pcDNA-VEGF165 указанными выше ферментами проводят раздельно, с промежуточной очисткой фрагментов. Результат рестрикционного расщепления анализируют, например, с помощью электрофореза в агарозном геле с окраской ДНК бромистым этидием. Субклонируемые ДНК-фрагменты вырезают из геля и очищают, например, с использованием набора EZ-10 Spin Column DNA Gel Extraction Kit (фирма-производитель BioBasic Inc., Китай). Векторный фрагмент плазмиды pBudCE4.1 очищают от других компонентов реакционной смеси, например, с использованием набора EZ-10 Spin Column PCR Purification Kit (фирма-производитель BioBasic Inc., Китай). Векторный фрагмент обрабатывают щелочной фосфатазой - для уменьшения количества клонов, не несущих вставку. Векторный и вставочные фрагменты ковалентно сшивают, например, с использованием ДНК-лигазы бактериофага Т4. Продукты реакции лигирования трансформируют в компетентные клетки Е. coli, например в штамм XLIblue с использованием CaCl2-метода [5]. Проводят скрининг колоний на наличие потребной (создаваемой для достижения цели) плазмиды pBud-VEGF, например, с помощью полимеразной цепной реакции (далее по тексту - ПЦР) с использованием праймеров:

VEGF165-F-Kpnl (CCGGTACCATGAACTTTCTGCTGTCTTGGG) и

VEGF165-R-Stop-Xhol (CCGGTACCATGAACTTTCTGCTGTCTTGGG), специфичных к клонируемым ДНК-последовательностям. Получение создаваемой для достижения цели плазмиды pBud-VEGF подтверждают путем применения ДНК-секвенирования, например, с использованием праймеров EF-1a-forward (TCAAGCCTCAGACAGTGGTTC) и BGH-reverse (TAGAAGGCACAGTCGAGG) на автоматическом секвенаторе ABI Prism 310 Genetic Analyzer (фирма-производитель Applied Biosystems, США). В результате клонирования гена VEGF в плазмиду pBudCE 4.1 получают промежуточную генетическую конструкцию pBud-VEGF.

Далее полученную плазмиду pBud-VEGF используют для второго этапа субклонирования, в ходе которого в плазмиду встраивают ген GDNF. Для этого плазмиды pBud-VEGF и pcDNA-GDNF подвергают расщеплению рестрикционными ферментами, имеющими сайты рестрикции в используемых генетических конструкциях, например рестрикционных ферментов Hindlll и Xbal. Результаты рестрикционного расщепления анализируют, например, с помощью электрофореза в агарозном геле с окраской ДНК бромистым этидием. Субклонируемые ДНК-фрагменты вырезают из геля и очищают, например, с использованием набора EZ-10 Spin Column DNA Gel Extraction Kit (фирма-производитель BioBasic Inc., Китай). Векторный фрагмент плазмиды pBud-VEGF очищают от других компонентов реакционной смеси, например - с использованием набора EZ-10 Spin Column PCR Purification Kit (BioBasic Inc., Китай). Векторный фрагмент обрабатывают щелочной фосфатазой с целью уменьшения количества клонов, не несущих вставку.

Векторный и вставочные фрагменты ковалентно сшивают, например, с использованием ДНК-лигазы бактериофага Т4. Продукты реакции лигирования трансформируют в компетентные клетки Е.coli, например в штамм XL1blue с использованием CaCl2-метода [5]. Проводят скрининг колоний на наличие потребной (создаваемой для достижения цели) плазмиды pBud-VEGF-GDNF, например, с помощью ПЦР с использованием праймеров:

GDNF-F-Kpnl (GGTACCACCATGAAGTTATGGGATGTCGTG) и

GDNF-R-Xhol (CTCGAGTCAGATACATCCACACCTTTTAGC), специфичных к клонируемым ДНК-последовательностям. Подтверждение получения создаваемой для достижения цели плазмиды pBud-VEGF подтверждают путем применения ДНК-секвенирования, например, с использованием праймеров SV40polyA-seqR (CTGCATTCTAGTTGTGGTTTGTCC) и Т7 (TAATACGACTCACTATAGGG).

В результате клонирования гена GDNF в плазмиду pBud-VEGF получают генетическую конструкцию pBud-VEGF-GDNF.

Полученный продукт (генетическая конструкция pBud-VEGF-GDNF) является генетическим компонентом лекарственного препарата, обладающего повышенным (по сравнению с прототипом) лечебным действием.

Получением генетического компонента завершают ПЕРВЫЙ этап осуществления предлагаемого способа и приступают ко второму этапу.

Второй этап

Далее получают клеточный компонент лекарственного препарата повышенного (по сравнению с прототипом) лечебного действия.

Для этого ядросодержащие белые клетки (мононуклеарную фракцию) биологической ткани человека, например пуповинной крови, выделяют с помощью центрифугирования в градиенте фиколла [6]. Для выделения используют свежую кровь, хранящуюся не более 24 часов после сбора. В пробирку, например объемом 50 мл, вносят раствор фиколла, например, в количестве 10 мл, плотностью 1,077 г/мл. Затем поверх слоя фиколла медленно наносят пуповинную кровь, например, в количестве 30 мл. Пробирку с содержимым центрифугируют, например, 20 минут при 1900 об/мин на центрифуге LMC-3000 (фирма-производитель BioSan, Латвия). Мононуклеарные клетки (мононуклеарная фракция крови) концентрируют на границе фиколла и плазмы крови. Серологической пипеткой клетки отбирают и переносят их в другую, чистую, пробирку. Объем содержимого пробирки доводят до 50 мл, например, добавлением раствора PBS, не содержащим ионы Ca и Mg.

Содержимое пробирки перемешивают и центрифугированием, например, в течение 15 мин при 1400 об/мин на центрифуге LMC-3000 (фирма-производитель BioSan, Латвия) осаждают клетки мононуклеарной фракции крови. Супернатант сливают и клеточный осадок ресуспензируют, например, в 50 мл гипотонического раствора для лизиса эритроцитов (8,99 г NH4Cl, 1 г KHCO3, 37 мг EDTA, растворить в 1 л воды).

Клетки инкубируют в течение от 3 до 12 минут при комнатной температуре и осаждают на дне пробирки центрифугированием, например, в течение 15 мин при 1400 об/мин на центрифуге LMC-3000 (фирма-производитель BioSan, Латвия). Клеточный осадок ресуспензируют, например, в 50 мл раствора PBS, не содержащим ионы Ca и Mg. Ресуспензированные клетки повторно осаждают центрифугированием, например, в течение 15 мин при 1400 об/мин на центрифуге LMC-3000 (фирма-производитель BioSan, Латвия). Клеточный осадок повторно ресуспензируют в питательной среде, например в RPMI-1640, не содержащей сыворотки крови. Полученный продукт является клеточным компонентом лекарственного препарата. Получением клеточного компонента завершают второй этап и переходят к выполнению третьего этапа осуществления предлагаемого способа.

Третий этап

Получают генно-клеточный лекарственный препарат повышенного (по сравнению с прототипом) лечебного действия. Для этого генетический и клеточный компоненты объединяют, например, в соотношении 20 мкг плазмидной ДНК pBud-VEGF-GDNF на 1×106 очищенных клеток мононуклеарной фракции пуповинной крови. Проводят генетическую модификацию клеток, например, с помощью электропорации (электропорация - пропускание электрического разряда через клеточную суспензию, что приводит к временному образованию пор в клеточной мембране, через которую рекомбинантная ДНК проникает внутрь клетки). Для электропорации 400 мкл смеси плазмидной ДНК и клеток помещают в кювету электропоратора Gene Pulser Xcell (фирма-производитель BioRad, Великобритания). Параметры электропорации: кювета 4 мм, напряжение 300 В, конденсатор 1000 мкф, режим экспоненциального затухания. После электропорации клетки (находящиеся в суспензии) помещают в питательную среду, например DMEM, содержащую 10% телячьей эмбриональной сыворотки и однократного (далее по тексту - 1х) раствора пенициллина-стрептомицина. Генетически модифицированные клетки инкубируют в питательной среде, например, в течение 12-24 часов. Генетически модифицированные клетки концентрируют, например, центрифугированием в течение 15 мин при 1400 об/мин на центрифуге LMC-3000 (фирма-производитель BioSan, Латвия). Концентрат клеток очищают от культуральной среды, например, раствором PBS, не содержащим ионы Ca и Mg. Клетки ресуспензируют, например, в физиологическом растворе. Затем проводят оценку количества, концентрации и жизнеспособности клеток, например, окраской трипановым синим и подсчетом окрашенных (мертвых) и неокрашенных (живых) клеток в камере Горяева. По результату анализа определяют оптимальную терапевтическую дозу генетически модифицированных клеток. Так завершают третий, заключительный, этап осуществления предлагаемого способа.

Полученный по завершении третьего этапа продукт является лекарственным препаратом, содержащим генетически модифицированные клетки, обладающий повышенным (по сравнению с прототипом) лечебным действием.

Полученный лекарственный препарат, содержащий генетически модифицированные клетки, обладает преимуществом перед известными препаратами. Предлагаемая генетическая конструкция, одновременно и независимо экспрессирующая два терапевтических гена VEGF и GDNF, существенно повышает выход генетически модифицированных клеток по сравнению с прототипом, в котором используют две отдельные генетические конструкции.

Одновременное использование двух терапевтических генов (в отличие от прототипа с одним терапевтическим геном) позволяет существенно повысить лечебные свойства предлагаемого препарата за счет комплексной стимуляции нейропротекции и нейротрофии (функции питания нервных клеток).

Лекарственный препарат по способу используют в лечебных целях по конкретному назначению, например, путем непосредственного введения (трансплантации) пациенту. При необходимости препарат замораживают для хранения и последующего применения

Приведенный пример осуществления предлагаемого способа не ограничивает применение иных, по сравнению с приведенными в примере, генных и клеточных компонентов.

Полученный препарат полезен для лечения нейродегенеративных заболеваний, например болезни Хантигтона, Паркинсона, Апьцгеймера, бокового амиотрофического склероза, инсульта, травмы спинного мозга и периферических нервов.

Приведенный пример применения предлагаемого изобретения показывает его полезность для лечения людей в медицине. Применение предлагаемого способа способствует получению лекарственного препарата с высоким лечебным свойством и повышению качества лечения. Предлагаемое изобретение удовлетворяет критериям новизны, так как при определении уровня техники не обнаружено средство, которому присущи признаки, идентичные (то есть совпадающие по исполняемой ими функции и форме выполнения этих признаков) всем признакам, перечисленным в формуле изобретения, включая характеристику назначения.

Предлагаемый способ имеет изобретательский уровень, поскольку не выявлены технические решения, имеющие признаки, совпадающие с отличительными признаками данного изобретения, и не установлена известность влияния отличительных признаков на указанный технический результат.

Заявленное техническое решение можно реализовать в промышленном производстве лекарственного препарата генетически модифицированных клеток и применять препарат в деятельности организаций здравоохранения посредством использования известных стандартных технических устройств и оборудования. Это соответствует критерию «промышленная применимость», предъявляемому к изобретениям.

Использованные источники

1. Ikeda, Y., et al., Development of angiogenic cell and gene therapy by transplantation of umbilical cord blood with vascular endothelial growth factor gene. Hypertens Res, 2004.27(2): p.119-28.

2. Suzuki, M., et al., Direct muscle delivery of GDNF with human mesenchymal stem cells improves motor neuron survival and function in a rat model of familial ALS. Mol Ther, 2008.16(12): p.2002-10.

3. Zavalishin, I.A., et al., Gene therapy of amyotrophic lateral sclerosis. Bull Exp Biol Med, 2008. 145(4): p.483-6.

4. Rizvanov, A.A., et al., Human umbilical cord blood cells transfected with VEGF and L(1)CAM do not differentiate into neurons but transform into vascular endothelial cells and secrete neuro-trophic factors to support neuro-genesis-a novel approach in stem cell therapy. Neurochem Int, 2008. 53(6-8): p.389-94.

5. Sambrook, J. and D.W. Russell, Molecular Cloning: A Laboratory Manual. 3 ed. 2001: Cold Spring Harbor Laboratory Press. 2344.

6. Fuss, I.J., et al., Isolation of whole mononuclear cells from peripheral blood and cord blood. Curr Protoc Immunol, 2009. Chapter 7: p. Unit7 1.

1. Способ получения лекарственного препарата генетически модифицированных клеток, заключающийся в том, что получают двухкассетную генетическую плазмидную конструкцию pBud-VEGF-GDNF, содержащую фрагменты ДНК, кодирующие VEGF и GDNF, из биологической ткани человека выделяют мононуклеарные клетки, выделенные клетки генетически модифицируют генетической конструкцией pBud-VEGF-GDNF, генетически модифицированные клетки культивируют, концентрируют, очищают от культуральной среды, ресуспензируют.

2. Способ по п.1, где после ресуспензирования проводят стадию замораживания.



 

Похожие патенты:
Изобретение относится к биотехнологии. .

Изобретение относится к области медицины и касается агентов и способов, основанных на применении домена EDA фибронектина. .

Изобретение относится к области молекулярной биологии и генетики и может быть использовано в медицине. .

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантных биомаркеров полипептидной природы, и может быть использовано в диагностике рассеянного склероза.

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантных биомаркеров полипептидной природы, и может быть использовано в диагностике рассеянного склероза.

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантных биомаркеров полипептидной природы, и может быть использовано в диагностике рассеянного склероза.

Изобретение относится к области биотехнологии, конкретно к способам иммунохимической оценки пролиферации лимфоцитов человека, и может быть использовано в фундаментальных исследованиях и в клинико-лабораторной практике для оценки пролиферативной активности клеток при онкологических и онкогематологических заболеваниях

Изобретение относится к области медицины и касается опосредованного PHKi ингибирования RHO-киназы для лечения глазных нарушений
Наверх