Набор праймеров, используемый для определения дрожжей рода saccharomyces



Набор праймеров, используемый для определения дрожжей рода saccharomyces
Набор праймеров, используемый для определения дрожжей рода saccharomyces
Набор праймеров, используемый для определения дрожжей рода saccharomyces
Набор праймеров, используемый для определения дрожжей рода saccharomyces
Набор праймеров, используемый для определения дрожжей рода saccharomyces
Набор праймеров, используемый для определения дрожжей рода saccharomyces
Набор праймеров, используемый для определения дрожжей рода saccharomyces
Набор праймеров, используемый для определения дрожжей рода saccharomyces
Набор праймеров, используемый для определения дрожжей рода saccharomyces
Набор праймеров, используемый для определения дрожжей рода saccharomyces
Набор праймеров, используемый для определения дрожжей рода saccharomyces
Набор праймеров, используемый для определения дрожжей рода saccharomyces
Набор праймеров, используемый для определения дрожжей рода saccharomyces

 


Владельцы патента RU 2432402:

КИРИН БИР КАБУСИКИ КАЙСЯ (JP)

Изобретение относится к биотехнологии и представляет собой наборы праймеров для проведения LIMP или ПЦР, используемые для детекции Saccharomyces pastorianus. Также представлены наборы для детекции Saccharomyces pastorianus, содержащие набор праймеров по изобретению в сочетании с набором праймеров для проведения LAMP используемым для детекции Saccharomyces bayanus, а также в сочетании с набором праймеров для проведения LAMP, используемым для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus. Представлены способы детекции Saccharomyces pastorianus. Изобретение позволяет точно, быстро и легко идентифицировать дрожжи Saccharomyces pastorianus посредством ПЦР или LIMP. 8 н. и 11 з.п. ф-лы, 4 ил., 5 табл.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к набору праймеров, используемому для идентификации дрожжей рода Saccharomyces, и конкретно, к набору праймеров для LAMP и набору праймеров для ПЦР, которые используют для определения дрожжей рода Saccharomyces. Кроме того, настоящее изобретение относится к способу определения и количественной оценки дрожжей рода Saccharomyces, в котором используется такой набор праймеров.

Уровень техники

Дрожжи рода Saccharomyces широко используются в хлебопечении, а также в производстве алкогольных напитков, таких как пиво, вино, японская рисовая водка, дистиллированные спирты и виски. Дрожжи Saccharomyces cerevisiae используют в производстве алкогольных напитков, получаемых путем брожения, включая верхнебродильное пиво, такое как светлое пиво (эль), вино, японская рисовая водка и фруктовое вино, такое как сидр, а также в производстве очищенной перегонкой жидкости, такой как дистиллированные спирты и виски. Дрожжи Saccharomyces bayanus используют в производстве вина, хереса, игристого вина и т.д. Дрожжи низового брожения, используемые в производстве легкого пива высокого качества, до настоящего времени относили к виду Saccharomyces pastorianus (Kurtzman, C. P. & Fell, J. W. The Yeasts, A Taxonomic Study, 4th edition, 1998, Elsevier Science, B. V., The Netherlands, Back, W.: Farbatlas und Handbuch der Geraenkebiologie, Teil I, 1994, Verlag Hans Carl. Nuernberg, Barnett, J. A. et al.: Yeasts, characteristics and identification, 3rd edition, 2000, Cambridge University Press, UK, Seishu Kobo/Koji Kenkyukai (Study Group for Sake Yeasts and Rice Malts): “Studies of Sake Yeasts”, 2003, Shinnihon Printing Inc., Tokyo). Таким образом, чтобы понять, являются ли дрожжи, используемые в производстве пищевых продуктов и алкогольных напитков, подходящими дрожжами, важно иметь методику идентификации штамма дрожжей рода Saccharomyces.

Однако если такие дрожжи сохраняются в отфильтрованном алкогольном напитке или они привносятся извне, то возникает избыточное брожение, что приводит к помутнению и появлению специфического привкуса. Так, такое избыточное брожение, кроме того, вызывает появление острого горького привкуса, что влияет на качество продукции. (Back, W.: Farbatlas und Handbuch der Geraenkebiologie, Teil I, 1994, Verlag Hans Carl, Nuernberg, European Brewery Convention: ANALYTICA-MICROBIOLOGICA-EBC, 2nd ed. 2005 Fachverlag Hans Carl, Nuernberg).

Более того, дрожжи рода Saccharomyces также могут быть выделены из безалкогольных напитков и, в частности, из фруктовых соков. Наличие дрожжей в продуктах приводит к выделению из сахаров, таких как глюкоза или сахароза, углекислого газа, этанола и к появлению неприятного привкуса, а качество продуктов вследствие этого значительно ухудшается (Back, W.: Farbatlas und Handbuch der Geraenkebiologie, Teil II, 1999, Verlag Hans Carl, Nuernberg).

Таким образом, пролиферация дрожжей рода Saccharomyces в продуктах существенно влияет на промышленное производство. Соответственно, для контроля качества важна методика быстрого определения и/или идентификации таких дрожжей. Кроме того, если дрожжи рода Saccharomyces, выделенные из продуктов, представляют собой дрожжи, используемые в процессе производства, то делают вывод о том, что их присутствие связано с утечкой в процессе производства, недостаточной стадией фильтрации и т.д. Если дрожжи, выделенные из продуктов, привносятся извне, то делается вывод о недостаточной промывке фильтра, наличии пыли в банке и т.д. Следовательно, для решения проблем при обнаружении контаминации важна методика идентификации дрожжей, выделенных из продуктов.

Однако, с точки зрения таксономии, Saccharomyces pastorianus, Saccharomyces cerevisiae и Saccharomyces bayanus являются близкородственными видами. Вместе с несколькими другими видами дрожжей, такими как Saccharomyces paradoxus и Saccharomyces mikatae, они образуют таксономическую группу, называемую Saccharomyces sensustricto (Naumov., G. I. et al., Int. J. Syst. Evol. Microbiol., 2000, vol. 50, 1931-1942). Кроме того, необходимо учитывать, что Saccharomyces pastorianus представляет собой вид, полученный путем скрещивания Saccharomyces cerevisiae и Saccharomyces bayanus, и на генном уровне и на хромосомном уровне было подтверждено, что Saccharomyces pastorianus представляет собой гибрид вышеуказанных видов дрожжей (Kielland-Brandt, M.C. et al.: Genetics of brewing yeast. The Yeast, 2nd edn, vol. 6, pp. 223-254, Edited by Wheals, et al., Academic Press, New York, Ryu, S.-L. et al.: Yeast, 1996, vol. 12, 757, Tamai, Y. et al.: Yeast, 1998, vol. 14, 923-933, Tamai, Y. et al.: Yeast, 2000, vol. 16, 1335-1343). В качестве традиционных способов идентификации дрожжей используют морфологический, физиологический и биохимический способы. В частности, в большинстве случаев оценивали способность к ассимиляции и ферментации большого числа сахаров. Тем не менее, поскольку фенотипы штаммов, относящихся к таксономической группе Saccharomyces sensustricto, подобны друг другу, затруднительно такими традиционными способами отличать штаммы друг от друга (Naumova, E. S. et al.: Antonievan Leeuwenhoek, 2003, vol. 83, 155-166). В качестве молекулярно-биологических подходов для различия таких штаммов были известны ПЦР-фингерпринтинг, кинетический анализ рекомбинации ДНК/ДНК, анализ кариотипа, рестрикционный анализ митохондриальной ДНК, анализ нуклеотидной последовательности генов рРНК, рестрикционный анализ рДНК, ПЦР с универсальными праймерами, анализ изозимов, электрофорез продуктов ПЦР в геле с градиентом температуры, ПЦР в режиме реального времени и т.д.

К настоящему времени был разработан способ, который включает амплификацию части гена FLO1 дрожжей рода Saccharomyces методом ПЦР или амплификацию части гена рРНК методом ПЦР и затем идентификацию с помощью RFLP, являются ли дрожжи рода Saccharomyces дрожжами другого рода, дрожжами, используемыми в брожении, или дрожжами, используемыми в целях, отличных от брожения (выложенная публикация патента Японии № 11-56366). Кроме того, основываясь на обнаружении того, что между геном 26S рРНК и геном 5S рРНК дрожжей низового брожения существуют два типа последовательностей спейсерных областей, были разработаны наборы праймеров для проведения ПЦР, специфичные для двух типов последовательностей (выложенная публикация патента Японии № 2001-8684). Кроме того, были сконструированы праймеры, специфичные для конгенного гена Lg-FLO1, в котором N-концевой участок Lg-FLO1 лигируют с геном хромосомы IX дрожжей (выложенная публикация патента Японии № 2002-233382).

Однако, поскольку для проведения ПЦР или ПЦР в режиме реального времени необходим высокий уровень контролирования температуры и наблюдения флуоресценции, эти способы требуют дорогостоящего оборудования. Кроме того, по окончании реакции ПЦР необходимо проведение электрофореза, окрашивания, фотографирования и т.д., и, таким образом, для этого способа необходим длительный период времени после амплификации генов до получения результатов. Более того, для проведения RAPD PCR, обработки продукта амплификации рестриктазами, анализа нуклеотидной последовательности, анализа изозимов, гель-электрофореза в градиенте температуры и т.д. требуются более продолжительный период времени и более сложные операции, чем при обычной ПЦР, и поэтому эти способы оказались сложными при осуществлении в качестве ежедневных анализов микроорганизмов.

С другой стороны, Saccharomyces pastorianus обладает как субгеномом, полученным от Saccharomyces cerevisiae (Sc-тип), так и субгеномом, полученным от Saccharomyces bayanus (Lg-тип). Согласно недавним исследованиям у дрожжей низового брожения отсутствует часть правого плеча хромосомы XVI Sc-типа, часть правого плеча хромосомы III Lg-типа и часть левого плеча хромосомы VII Lg-типа (Naoyuki Umemoto et al., “Production of physical map of beer yeasts and comparative genomic science”, 24th Annual Meeting of the Molecular Biology Society of Japan (2001); Nakao et al., Proceedings of the 29th EBC Congress (2003); Yoshihiro Nakao: Chemistry and Organisms, 2005, vol. 43, No. 9, 559-561; and Japanese Patent Laid-Open Publication No. 2004-283169). Однако в существующих условиях до сих пор не получена подробная информация относительно хромосомной транслокации Saccharomyces pastorianus.

Кроме того, был создан набор праймеров для способа LAMP (изотермальной петлевой амплификации), используемый для детекции Saccharomyces pastorianus (WO2005/093059). Однако по-прежнему существует необходимость в повышении точности определения.

Сущность изобретения

Авторы настоящего изобретения идентифицировали положения хромосомных транслокаций правого плеча хромосомы XVI, правого плеча хромосомы III и левого плеча хромосомы VII дрожжей Saccharomyces pastorianus, а также проанализировали геном вокруг этих положений транслокаций. Кроме того, на основании этой информации авторам настоящего изобретения удалось разработать набор праймеров для точного детектирования дрожжей рода Saccharomyces.

В дальнейшем в настоящем документе изобретение, относящееся к хромосомной транслокации правого плеча хромосомы XVI, обозначают как первый и второй варианты осуществления, изобретение, относящееся к хромосомной транслокации правого плеча хромосомы III, обозначают как третий вариант осуществления, а изобретение, относящееся к хромосомной транслокации левого плеча хромосомы VII, обозначают как четвертый вариант осуществления.

Первый вариант осуществления

Авторы настоящего изобретения провели геномный анализ дрожжей низового брожения, относящихся к виду Saccharomyces pastorianus, и в результате было обнаружено, что хромосома XVI Sc-типа дрожжей низового брожения транслоцируется при участии хромосомы Lg-типа по ORF гена GPH1 правого плеча, и дополнительно, что она вновь транслоцируется по ORF гена QCR2 в окончательном направлении правого плеча, таким образом, она возвращается к Sc-типу. То есть авторы настоящего изобретения обнаружили, что в области, фланкированной генами GPH1 и QCR2 правого плеча хромосомы XVI, у дрожжей низового брожения находится только нуклеотидная последовательность Lg-типа.

Авторы настоящего изобретения разработали набор праймеров для LAMP, используемый для детекции Saccharomyces pastorianus на основании последовательности (SEQ ID NO: 6) гена МЕТ16 Lg-типа, расположенного в области, фланкированной генами GPH1 и QCR2, и было обнаружено, что, используя сконструированный таким образом набор праймеров, можно точно определить Saccharomyces pastorianus. Последовательность гена МЕТ16 Lg-типа представляет собой новую последовательность, которая до сих пор не была описана ни в одной из опубликованных баз данных.

Конкретно, первый вариант осуществления настоящего изобретения относится к зонду или праймеру, используемому для детекции Saccharomyces pastorianus, который состоит из полинуклеотида, состоящего по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим нуклеотидную последовательность SEQ ID NO: 6, или полинуклеотида, состоящего по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную нуклеотидной последовательности SEQ ID NO: 6.

В соответствии с первым вариантом осуществления настоящее изобретение также относится к набору праймеров для проведения LAMP, используемому для детекции Saccharomyces pastorianus, который состоит из двух или более типов вышеуказанных праймеров.

В соответствии с первым вариантом осуществления настоящее изобретение также относится к набору праймеров для проведения ПЦР, используемому для детекции Saccharomyces pastorianus, который состоит из двух или более типов вышеуказанных праймеров.

В соответствии с первым вариантом осуществления настоящее изобретение предпочтительно относится к набору праймеров для проведения LAMP, используемому для детекции Saccharomyces pastorianus, который содержит следующие полинуклеотиды:

полинуклеотид (FIP) с нуклеотидной последовательностью SEQ ID NO: 1 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности;

полинуклеотид (F3) с нуклеотидной последовательностью SEQ ID NO: 2 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности;

полинуклеотид (BIP) с нуклеотидной последовательностью SEQ ID NO: 3 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности; и

полинуклеотид (В3) с нуклеотидной последовательностью SEQ ID NO: 4 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности.

На основании расположения хромосомной транслокации правого плеча хромосомы XVI дрожжей низового брожения авторы настоящего изобретения разработали набор праймеров для проведения ПЦР, используемый для детекции Saccharomyces pastorianus, и затем обнаружили, что дрожжи Saccharomyces pastorianus можно точно определить, используя этот набор праймеров.

Конкретно, в соответствии с первым вариантом осуществления настоящее изобретение относится к набору праймеров для проведения ПЦР, используемому для детекции Saccharomyces pastorianus, который содержит: полинуклеотид с нуклеотидной последовательностью SEQ ID NO: 27 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности; и полинуклеотид с нуклеотидной последовательностью SEQ ID NO: 28 или ере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности.

В соответствии с первым вариантом осуществления настоящее изобретение также относится к набору праймеров для проведения ПЦР, используемому для детекции Saccharomyces pastorianus, который содержит: полинуклеотид с нуклеотидной последовательностью SEQ ID NO: 29 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности; и полинуклеотид с нуклеотидной последовательностью SEQ ID NO: 30 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности.

В соответствии с первым вариантом осуществления настоящее изобретение также относится к набору праймеров для проведения ПЦР, используемому для детекции Saccharomyces pastorianus, в котором один из праймеров представляет собой полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим нуклеотидную последовательность SEQ ID NO: 6, или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную нуклеотидной последовательности SEQ ID NO: 6, а другой праймер представляет собой полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с нуклеотидной последовательностью Sc-типа, которая находится вне области, фланкированной генами GPH1 и QCR2 правого плеча хромосомы XVI дрожжей низового брожения, или с комплементарной ей последовательностью.

В соответствии с первым вариантом осуществления настоящее изобретение относится к способу детекции Saccharomyces pastorianus, который включает проведение реакции амплификации нуклеиновой кислоты способом LAMP, используя набор праймеров для проведения LAMP в соответствии с первым вариантом осуществления.

В соответствии с первым вариантом осуществления настоящее изобретение также относится к способу детекции Saccharomyces pastorianus, который включает проведение реакции амплификации нуклеиновой кислоты способом ПЦР, используя набор праймеров для проведения ПЦР в соответствии с первым вариантом осуществления.

В соответствии с первым вариантом осуществления настоящее изобретение дополнительно относится к способу детекции Saccharomyces pastorianus, который включает определение гибридного комплекса, содержащего зонд в соответствии с первым вариантом осуществления.

Второй вариант осуществления

Авторы настоящего изобретения обнаружили, что у дрожжей низового брожения в области, фланкированной генами GPH1 и QCR2 правого плеча хромосомы XVI, находится только нуклеотидная последовательность Lg-типа. То есть это означает, что у Saccharomyces pastorianus или Saccharomyces bayanus в области, фланкированной генами GPH1 и QCR2 правого плеча хромосомы XVI, отсутствует нуклеотидная последовательность Sc-типа, и, таким образом, вышеупомянутая нуклеотидная последовательность Sc-типа специфична для Saccharomyces cerevisiae.

На основании последовательности гена МЕТ16 Sc-типа, расположенного в области, фланкированной генами GPH1 и QCR2, авторы настоящего изобретения разработали набор праймеров для проведения LAMP, используемый для детекции Saccharomyces cerevisiae. Авторы изобретения позднее обнаружили, что, используя данный набор праймеров, можно с высокой точностью детектировать Saccharomyces cerevisiae.

Конкретно, в соответствии со вторым вариантом осуществления настоящее изобретение относится к набору праймеров для проведения LAMP, используемому для детекции Saccharomyces cerevisiae, который содержит следующие полинуклеотиды:

полинуклеотид (FIP) с нуклеотидной последовательностью SEQ ID NO: 7 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности;

полинуклеотид (F3) с нуклеотидной последовательностью SEQ ID NO: 8 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности;

полинуклеотид (BIP) с нуклеотидной последовательностью SEQ ID NO: 9 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности; и

полинуклеотид (В3) с нуклеотидной последовательностью SEQ ID NO: 10 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности.

В соответствии со вторым вариантом осуществления настоящее изобретение относится к способу детекции Saccharomyces cerevisiae, который включает проведение реакции амплификации нуклеиновой кислоты способом LAMP, используя набор праймеров для проведения LAMP в соответствии со вторым вариантом осуществления.

Третий вариант осуществления

Авторы настоящего изобретения обнаружили, что хромосома III Lg-типа дрожжей низового брожения транслоцируется при участии хромосомы Sc-типа по локусу МАТ правого плеча и что у дрожжей низового брожения от локуса МАТ правого плеча хромосомы III до его конца присутствует только нуклеотидная последовательность Sc-типа. То есть это означает, что, поскольку у Saccharomyces cerevisiae или Saccharomyces pastorianus на протяжении от локуса МАТ правого плеча хромосомы III до его конца отсутствует нуклеотидная последовательность Lg-типа, то нуклеотидная последовательность Saccharomyces bayanus, соответствующая этой области, специфична для Saccharomyces bayanus.

На основании последовательности гена, гомологичного RAD18, расположенного в области, находящейся между локусом МАТ и концом правого плеча хромосомы, авторы настоящего изобретения разработали набор праймеров для проведения LAMP, используемый для определения Saccharomyces bayanus. Авторы изобретения позднее обнаружили, что, используя данный набор праймеров, можно с высокой точностью детектировать Saccharomyces bayanus.

Конкретно, в соответствии с третьим вариантом осуществления настоящее изобретение относится к набору праймеров для проведения LAMP, используемому для определения Saccharomyces bayanus, который содержит следующие полинуклеотиды:

полинуклеотид (FIP) с нуклеотидной последовательностью SEQ ID NO: 13 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности;

полинуклеотид (F3) с нуклеотидной последовательностью SEQ ID NO: 14 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности;

полинуклеотид (BIP) с нуклеотидной последовательностью SEQ ID NO: 15 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности; и

полинуклеотид (В3) с нуклеотидной последовательностью SEQ ID NO: 16 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности.

Авторы настоящего изобретения также разработали набор праймеров для проведения ПЦР, используемый для детекции Saccharomyces pastorianus, основываясь на положении хромосомной транслокации правого плеча хромосомы III дрожжей низового брожения. Авторы изобретения позднее обнаружили, что, используя такой набор праймеров, можно с высокой точностью детектировать Saccharomyces pastorianus.

Конкретно, в соответствии с третьим вариантом осуществления настоящее изобретение относится к набору праймеров для проведения ПЦР, используемому для детекции Saccharomyces pastorianus, который содержит: полинуклеотид с нуклеотидной последовательностью SEQ ID NO: 23 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности; и полинуклеотид с нуклеотидной последовательностью SEQ ID NO: 24 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности.

В соответствии с третьим вариантом осуществления настоящее изобретение относится к способу определения Saccharomyces bayanus, который включает проведение реакции амплификации нуклеиновой кислоты способом LAMP, используя набор праймеров для проведения LAMP в соответствии с третьим вариантом осуществления.

В соответствии с третьим вариантом осуществления настоящее изобретение также относится к способу определения Saccharomyces pastorianus, который включает проведение реакции амплификации нуклеиновой кислоты способом ПЦР, используя набор праймеров для проведения ПЦР в соответствии с третьим вариантом осуществления.

Четвертый вариант осуществления

Авторы настоящего изобретения обнаружили, что хромосома VII Lg-типа дрожжей низового брожения транслоцируется при участии хромосомы Sc-типа по ORF гена КЕМ1, расположенного на левом плече. То есть авторы изобретения обнаружили, что у дрожжей низового брожения на протяжении от локуса КЕМ1 левого плеча хромосомы VII до конца левого плеча существует только нуклеотидная последовательность Sc-типа.

Авторы настоящего изобретения также разработали набор праймеров для проведения ПЦР, используемый для детекции Saccharomyces pastorianus, на основании положения хромосомной транслокации левого плеча хромосомы VII дрожжей низового брожения. Авторы изобретения позднее обнаружили, что, используя такой набор праймеров, можно с высокой точностью детектировать Saccharomyces pastorianus.

Конкретно, в соответствии с четвертым вариантом осуществления настоящее изобретение относится к набору праймеров для проведения ПЦР, используемому для детекции Saccharomyces pastorianus, который содержит: полинуклеотид с нуклеотидной последовательностью SEQ ID NO: 25 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности; и полинуклеотид с нуклеотидной последовательностью SEQ ID NO: 26 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности.

В соответствии с четвертым вариантом осуществления настоящее изобретение относится к способу детекции Saccharomyces pastorianus, который включает проведение реакции амплификации нуклеиновой кислоты способом ПЦР, используя набор праймеров для проведения ПЦР в соответствии с четвертым вариантом осуществления.

С помощью наборов праймеров по настоящему изобретению дрожжи рода Saccharomyces могут быть определены с высокой точностью до вида. В частности, наборы праймеров для проведения LAMP в соответствии с настоящим изобретением могут быть использованы в реакции амплификации нуклеиновой кислоты способом LAMP и для детекции мишеневых видов на основании наличия или отсутствия амплифицированного продукта. Таким образом, с помощью наборов праймеров для проведения LAMP по настоящему изобретению дрожжи рода Saccharomyces могут быть с высокой точностью, быстро и легко идентифицированы до вида.

С помощью наборов праймеров для проведения LAMP в соответствии с настоящим изобретением также можно измерить количество клеток, содержащихся в образце. Таким образом, с помощью наборов праймеров для проведения LAMP в соответствии с настоящим изобретением можно с точностью количественно оценить наличие Saccharomyces pastorianus, Saccharomyces cerevisiae и Saccharomyces bayanus.

Дрожжи рода Saccharomyces представляют собой виды дрожжей, которые делают мутными различные виды напитков, такие как алкогольные и безалкогольные напитки. Таким образом, наличие или отсутствие этих видов дрожжей можно использовать в качестве одного из показателей контроля качества различных видов напитков. Соответственно, наборы праймеров в соответствии с настоящим изобретением можно использовать для контроля качества различных видов напитков (например, алкогольных и безалкогольных напитков, в частности, пива, пива с низким содержанием солода (фальшивое пиво), вина) и оценки образцов окружающей среды.

Краткое описание чертежей

На фигуре 1 показана специфичность реакции с набором праймеров (LGM1LB1), используемым для детекции Saccharomyces pastorianus, в отношении определяемых мишеневых видов. Были использованы следующие штаммы: Saccharomyces cerevisiae NBRC10217, Saccharomyces bayanus NBRC11022, Saccharomyces pastorianus NBRC11024, NBRC11023 и NBRC10610, Saccharomyces cerevisiae var. diastaticus DSM70487, Saccharomyces paradoxus NBRC10609, Saccharomyces cariocanus NBRC10947, Saccharomyces mikatae NBRC1815, Saccharomyces kudriavzevii NBRC 1802, Saccharomyces exiguous NBRC1128, Saccharomyces servazzii NBRC1838, Saccharomyces unisporus NBRC0316, Saccharomyces dairenensis NBRC0211, Saccharomyces kluyveri NBRC1685, Nega: без добавления геномной ДНК.

На фигуре 2 показана аппроксимированная кривая, построенная, исходя из количества колониеобразующих единиц Saccharomyces pastorianus и времени детекции способом LAMP, используя LGM1LB1. Пороговое время на горизонтальной оси координат указывает время проведения реакции, когда мутность превышает 0,1.

На фигуре 3 показана специфичность реакции с набором праймеров (SSC1LB1), используемым для детекции рода Saccharomyces, в отношении детектируемых мишеневых видов. Были использованы следующие штаммы: Saccharomyces cerevisiae NBRC10217, Saccharomyces bayanus NBRC11022, Saccharomyces pastorianus NBRC11024, NBRC11023 и NBRC10610, Saccharomyces cerevisiae var. diastaticus DSM70487, Saccharomyces paradoxus NBRC10609, Saccharomyces cariocanus NBRC10947, Saccharomyces mikatae NBRC1815, Saccharomyces kudriavzevii NBRC 1802, Saccharomyces exiguous NBRC1128, Saccharomyces servazzii NBRC1838, Saccharomyces unisporus NBRC0316, Saccharomyces dairenensis NBRC0211, Saccharomyces kluyveri NBRC1685, Nega: без добавления геномной ДНК.

На фигуре 4 показана специфичность реакции с набором праймеров (SBFY1LF1LB1), используемым для детекции дрожжей низового брожения, в отношении детектируемых мишеневых видов. Были использованы следующие штаммы: Saccharomyces cerevisiae NBRC10217, Saccharomyces bayanus NBRC11022, Saccharomyces pastorianus NBRC11024, NBRC11023 и NBRC10610, Saccharomyces cerevisiae var. diastaticus DSM70487, Saccharomyces paradoxus NBRC10609, Saccharomyces cariocanus NBRC10947, Saccharomyces mikatae NBRC1815, Saccharomyces kudriavzevii NBRC 1802, Saccharomyces exiguous NBRC1128, Saccharomyces servazzii NBRC1838, Saccharomyces unisporus NBRC0316, Saccharomyces dairenensis NBRC0211, Saccharomyces kluyveri NBRC1685, Nega: без добавления геномной ДНК.

Подробное описание изобретения

Праймеры и наборы праймеров

Набор праймеров для проведения LAMP в соответствии с настоящим изобретением состоит из 4 типов праймеров, обозначаемых FIP, F3, BIP и B3. Эти праймеры соответствуют 6 областям мишеневой нуклеотидной последовательности. Конкретно, области F3c, F2c, F1c, В1, В2 и В3 определяются в данном порядке от 3'-конца до 5'-конца мишеневой нуклеотидной последовательности. Далее, принимая во внимание данные 6 областей, создают 4 типа праймеров, обозначаемых FIP, F3, BIP и B3. В данном документе областями, комплементарными областям F3c, F2c и F1c, являются F3, F2 и F1 соответственно. Кроме того, областями, комплементарными областям В1, В2 и В3, являются В1с, В2с и В3с соответственно.

FIP представляет собой праймер, созданный таким образом, что он имеет область F2, комплементарную области F2c мишеневой последовательности на 3'-концевой стороне, и имеет последовательность, аналогичную последовательности области F1c мишеневого гена на 5'-концевой стороне. При необходимости, в участок между областями F1c и F2 праймера FIP может быть встроен сайт рестрикции.

F3 представляет собой праймер, созданный таким образом, что он имеет область F3, комплементарную области F3c мишеневого гена.

BIP представляет собой праймер, созданный таким образом, что он имеет область В2, комплементарную области В2с мишеневой последовательности на 3'-концевой стороне, и имеет последовательность, аналогичную последовательности области В1с мишеневого гена на 5'-концевой стороне. При необходимости, в участок между областями В1с и В2 праймера BIP может быть встроен сайт рестрикции.

В3 представляет собой праймер, созданный таким образом, что он имеет область В3, комплементарную области В3с мишеневого гена.

Если в праймерах FIP и BIP имеются сайты рестрикции, после окончания реакции амплификации нуклеиновой кислоты способом LAMP амплифицированный продукт обрабатывают рестриктазами, чтобы можно было увидеть, что после проведения электрофореза образовалась единичная полоса. В том случае, когда мишеневая последовательность уже содержит сайт рестрикции, необходимости в искусственном встраивании такого сайта рестрикции в праймеры может не быть.

Если используется набор праймеров для проведения LAMP в соответствии с настоящим изобретением, для ускорения реакции амплификации нуклеиновой кислоты можно добавить один или два типа петлевых праймеров (праймер LF или праймер LB). Такой петлевой праймер конструируют таким образом, чтобы он отжигался в области между F1 и F2 или области между В1 и В2, и затем его добавляют в реакционную систему для проведения LAMP. Таким образом, эти праймеры связываются с петлевыми участками, которые не используются в процессе амплификации нуклеиновой кислоты для усиления реакции амплификации нуклеиновой кислоты, используя все петлевые участки в качестве матриц, благодаря чему можно ускорить реакцию амплификации нуклеиновой кислоты (например, выложенная публикация японского патента № 2002-345499).

Конкретно, среди наборов праймеров для проведения LAMP в соответствии с первым вариантом осуществления набор праймеров для проведения LAMP, состоящий из полинуклеотидов, имеющих нуклеотидные последовательности SEQ ID №: 1-4, или гомологичных им полинуклеотидов, может дополнительно содержать в качестве петлевого праймера полинуклеотид (LB) c нуклеотидной последовательностью SEQ ID №: 5 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности.

Набор праймеров для проведения LAMP в соответствии со вторым вариантом осуществления может дополнительно содержать в качестве петлевого(ых) праймера(ов) один из или оба полинуклеотида, выбранных из полинуклеотида (LF) с нуклеотидной последовательностью SEQ ID №: 11 или полинуклеотида, состоящего по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности; и полинуклеотида (LB) с нуклеотидной последовательностью SEQ ID №: 12 или полинуклеотида, состоящего по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности.

Набор праймеров для проведения LAMP в соответствии с третьим вариантом осуществления может дополнительно содержать в качестве петлевого праймера полинуклеотид (LB) с нуклеотидной последовательностью SEQ ID №: 17 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности.

В соответствии с настоящим изобретением в качестве праймеров или зондов могут использоваться не только полинуклеотиды, имеющие нуклеотидные последовательности SEQ ID №: 1-5 и 7-30, но также полинуклеотиды, гибридизующиеся с полинуклеотидами, имеющими последовательности, комплементарные данным нуклеотидным последовательностям SEQ ID №: 1-5 и 7-30 (которые в настоящем описании также могут быть обозначены как «гомологичные полинуклеотиды»).

Кроме того, в соответствии с настоящим изобретением в качестве праймеров для проведения LAMP, праймеров для проведения ПЦР и зондов могут быть использованы полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим нуклеотидную последовательность SEQ ID №: 6, и полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную нуклеотидной последовательности SEQ ID №: 6.

Под термином «гибридизоваться» в настоящем описании понимают, что определенный полинуклеотид гибридизуется с мишеневым полинуклеотидом, но при этом он по существу не гибридизуется с полинуклеотидами, отличными от мишеневого полинуклеотида. Такую гибридизацию можно осуществлять в жестких условиях. В данном документе «жесткие условия» могут быть определены в зависимости от Tm (°C) двойной цепи, включающей последовательность праймера и комплементарную ему цепь, необходимой концентрации соли и т.д. Методика выбора последовательности, используемой в качестве зонда, и затем определения жестких условий, подходящих для этого, хорошо известна специалистам в данной области (см., например, J. Sambrook, E. F. Frisch, T. Maniatis; Molecular Cloning 2nd edition, Cold Spring Harbor Laboratory (1989) и т.д.). В отношении таких жестких условий, реакцию гибридизации осуществляют при температуре немного ниже, чем Tm, определенной на основании нуклеотидной последовательности (например, при температуре, которая примерно на 0-5°C ниже, чем Tm), в подходящем буферном растворе, обычно используемом при гибридизации. Кроме того, в отношении других жестких условий, отмывку после реакции гибридизации осуществляют при высокой концентрации низкоконцентрированного раствора соли. Примерами таких жестких условий являются условия отмывки, при которых отмывку осуществляют в 6-кратном SSC/0,05% растворе пирофосфата натрия при температуре 37°C (для олигонуклеотида, состоящего примерно из 14 оснований), 48°C (для олигонуклеотида, состоящего примерно из 17 оснований), 55°C (для олигонуклеотида, состоящего примерно из 20 оснований) и 60°C (для олигонуклеотида, состоящего примерно из 23 оснований).

Длина нуклеотидов гомологичного полинуклеотида составляет по меньшей мере 10 оснований.

В случае праймеров для проведения LAMP, длина нуклеотидов каждого из полинуклеотидов, гомологичных FIP и BIP, может предпочтительно составлять по меньшей мере 30 нуклеотидов (например, от 30 до 60 нуклеотидов) и, более предпочтительно, по меньшей мере 42 нуклеотида (например, от 42 до 57 нуклеотидов).

Кроме того, длина нуклеотидов каждого из полинуклеотидов, гомологичных F3, В3, LF и LB, предпочтительно, может составлять по меньшей мере 12 оснований (например, от 12 до 30 оснований) и, более предпочтительно, по меньшей мере 18 оснований (например, от 18 до 25 оснований и от 18 до 30 оснований).

В случае праймеров для проведения ПЦР, длина в нуклеотидах каждого из полинуклеотидов, гомологичных полинуклеотидам, имеющим нуклеотидные последовательности SEQ ID №: 23-30, предпочтительно, может составлять по меньшей мере 15 оснований (например, от 15 до 30 оснований), более предпочтительно, по меньшей мере 18 оснований (например, от 18 до 24 оснований и от 18 до 30 оснований) и, особенно предпочтительно, по меньшей мере 20 оснований (например, от 20 до 25 оснований и от 20 до 30 оснований).

Такой гомологичный полинуклеотид может представлять собой полинуклеотид, содержащий по меньшей мере 10, предпочтительно, по меньшей мере 15, более предпочтительно, по меньшей мере 18, особенно предпочтительно, по меньшей мере 20 последовательных нуклеотидов соответствующей нуклеотидной последовательности.

Ниже приведены примеры полинуклеотидов, гомологичных полинуклеотидам, имеющим нуклеотидные последовательности SEQ ID №: 1-5 и 7-30.

Полинуклеотид, гомологичный полинуклеотиду FIP, имеющему нуклеотидную последовательность SEQ ID NO: 1: полинуклеотид, содержащий по меньшей мере 42 (от 42 до 52) и, более предпочтительно, по меньшей мере 47 (от 47 до 52) последовательных нуклеотидов SEQ ID NO: 1 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 60 оснований и, предпочтительно, не более 57 оснований).

Полинуклеотид, гомологичный полинуклеотиду F3, имеющему нуклеотидную последовательность SEQ ID NO: 2: полинуклеотид, содержащий по меньшей мере 15 (от 15 до 19) и, более предпочтительно, по меньшей мере 18 (18 или 19) последовательных нуклеотидов SEQ ID NO: 2 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований, предпочтительно, не более 25 оснований и, более предпочтительно, не более 21 оснований).

Полинуклеотид, гомологичный полинуклеотиду BIP, имеющему нуклеотидную последовательность SEQ ID NO: 3: полинуклеотид, содержащий по меньшей мере 36 (от 36 до 42) и, более предпочтительно, по меньшей мере 38 (от 38 до 42) последовательных нуклеотидов SEQ ID NO: 3 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 60 оснований, предпочтительно, не более 53 оснований и, более предпочтительно, не более 47 оснований).

Полинуклеотид, гомологичный полинуклеотиду В3, имеющему нуклеотидную последовательность SEQ ID NO: 4: полинуклеотид, содержащий по меньшей мере 19 (от 19 до 23) и, более предпочтительно, по меньшей мере 21 (от 21 до 23) последовательных нуклеотидов SEQ ID NO: 4 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований и, более предпочтительно, не более 25 оснований).

Полинуклеотид, гомологичный полинуклеотиду LB, имеющему нуклеотидную последовательность SEQ ID NO: 5: полинуклеотид, содержащий по меньшей мере 18 (от 18 до 22) и, более предпочтительно, по меньшей мере 20 (от 20 до 22) последовательных нуклеотидов SEQ ID NO: 5 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований и, предпочтительно, не более 25 оснований).

Полинуклеотид, гомологичный полинуклеотиду FIP, имеющему нуклеотидную последовательность SEQ ID NO: 7: полинуклеотид, содержащий по меньшей мере 38 (от 38 до 47) и, более предпочтительно, по меньшей мере 42 (от 42 до 47) последовательных нуклеотидов SEQ ID NO: 7 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 60 оснований и, предпочтительно, не более 53 оснований).

Полинуклеотид, гомологичный полинуклеотиду F3, имеющему нуклеотидную последовательность SEQ ID NO: 8: полинуклеотид, содержащий по меньшей мере 18 (от 18 до 22) и, более предпочтительно, по меньшей мере 19 (от 19 до 22) последовательных нуклеотидов SEQ ID NO: 8 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований, предпочтительно, не более 25 оснований и, более предпочтительно, не более 23 оснований).

Полинуклеотид, гомологичный полинуклеотиду BIP, имеющему нуклеотидную последовательность SEQ ID NO: 9: полинуклеотид, содержащий по меньшей мере 42 (от 42 до 57), более предпочтительно, по меньшей мере 47 (от 47 до 57), особенно предпочтительно, по меньшей мере 51 (от 51 до 57) и, наиболее предпочтительно, по меньшей мере 53 (от 53 до 57) последовательных нуклеотидов SEQ ID NO: 9 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 60 оснований).

Полинуклеотид, гомологичный полинуклеотиду В3, имеющему нуклеотидную последовательность SEQ ID NO: 10: полинуклеотид, содержащий по меньшей мере 19 (от 19 до 25) и, более предпочтительно, по меньшей мере 22 (от 22 до 25) последовательных нуклеотидов SEQ ID NO: 10 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований).

Полинуклеотид, гомологичный полинуклеотиду LF, имеющему нуклеотидную последовательность SEQ ID NO: 11: полинуклеотид, содержащий по меньшей мере 19 (от 19 до 25) и, более предпочтительно, по меньшей мере 22 (от 22 до 25) последовательных нуклеотидов SEQ ID NO: 11 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований).

Полинуклеотид, гомологичный полинуклеотиду LB, имеющему нуклеотидную последовательность SEQ ID NO: 12: полинуклеотид, содержащий по меньшей мере 19 (от 19 до 25) и, более предпочтительно, по меньшей мере 22 (от 22 до 25) последовательных нуклеотидов SEQ ID NO: 12 (в которую могут быть встроены одна или несколько мутаций) (у которого длина нуклеотидах может составлять не более 30 оснований).

Полинуклеотид, гомологичный полинуклеотиду FIP, имеющему нуклеотидную последовательность SEQ ID NO: 13: полинуклеотид, содержащий по меньшей мере 42 (от 42 до 53) и, более предпочтительно, по меньшей мере 48 (от 48 до 53) последовательных нуклеотидов SEQ ID NO: 12 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 60 оснований и, предпочтительно, не более 57 оснований).

Полинуклеотид, гомологичный полинуклеотиду F3, имеющему нуклеотидную последовательность SEQ ID NO: 14: полинуклеотид, содержащий по меньшей мере 18 (от 18 до 21) и, более предпочтительно, по меньшей мере 19 (от 19 до 21) последовательных нуклеотидов SEQ ID NO: 13 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований, предпочтительно, не более 25 оснований и, более предпочтительно, не более 23 оснований).

Полинуклеотид, гомологичный полинуклеотиду BIP, имеющему нуклеотидную последовательность SEQ ID NO: 15: полинуклеотид, содержащий по меньшей мере 37 (от 37 до 44) и, более предпочтительно, по меньшей мере 42 (от 42 до 44) последовательных нуклеотидов SEQ ID NO: 14 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 60 оснований, предпочтительно, не более 53 оснований и, более предпочтительно, не более 47 оснований).

Полинуклеотид, гомологичный полинуклеотиду В3, имеющему нуклеотидную последовательность SEQ ID NO: 16: полинуклеотид, содержащий по меньшей мере 19 (от 19 до 25) и, более предпочтительно, по меньшей мере 22 (от 22 до 25) последовательных нуклеотидов SEQ ID NO: 15 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований).

Полинуклеотид, гомологичный полинуклеотиду LB, имеющему нуклеотидную последовательность SEQ ID NO: 17: полинуклеотид, содержащий по меньшей мере 14 (от 14 до 18) и, более предпочтительно, по меньшей мере 16 (от 16 до 18) последовательных нуклеотидов SEQ ID NO: 16 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований, предпочтительно, не более 25 оснований и, более предпочтительно, не более 22 оснований).

Полинуклеотид, гомологичный полинуклеотиду FIP, имеющему нуклеотидную последовательность SEQ ID NO: 18: полинуклеотид, содержащий по меньшей мере 38 (от 38 до 47) и, более предпочтительно, по меньшей мере 42 (от 42 до 47) последовательных нуклеотидов SEQ ID NO: 18 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 60 оснований и, предпочтительно, не более 53 оснований).

Полинуклеотид, гомологичный полинуклеотиду F3, имеющему нуклеотидную последовательность SEQ ID NO: 19: полинуклеотид, содержащий по меньшей мере 18 (от 18 до 20) и, более предпочтительно, по меньшей мере 19 (19 или 20) последовательных нуклеотидов SEQ ID NO: 19 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований, предпочтительно, не более 25 оснований и, более предпочтительно, не более 22 оснований).

Полинуклеотид, гомологичный полинуклеотиду BIP, имеющему нуклеотидную последовательность SEQ ID NO: 20: полинуклеотид, содержащий по меньшей мере 36 (от 36 до 42) и, более предпочтительно, по меньшей мере 38 (от 38 до 42) последовательных нуклеотидов SEQ ID NO: 20 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 60 оснований, предпочтительно, не более 53 оснований и, более предпочтительно, не более 47 оснований).

Полинуклеотид, гомологичный полинуклеотиду В3, имеющему нуклеотидную последовательность SEQ ID NO: 21: полинуклеотид, содержащий по меньшей мере 18 (от 18 до 20) и, более предпочтительно, по меньшей мере 19 (19 или 20) последовательных нуклеотидов SEQ ID NO: 21 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований, предпочтительно, не более 25 оснований и, более предпочтительно, не более 22 оснований).

Полинуклеотид, гомологичный полинуклеотиду LB, имеющему нуклеотидную последовательность SEQ ID NO: 22: полинуклеотид, содержащий по меньшей мере 18 (от 18 до 20) и, более предпочтительно, по меньшей мере 19 (19 или 20) последовательных нуклеотидов SEQ ID NO: 22 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований, предпочтительно, не более 25 оснований и, более предпочтительно, не более 22 оснований).

Полинуклеотид, гомологичный полинуклеотиду, имеющему нуклеотидную последовательность SEQ ID NO: 23: полинуклеотид, содержащий по меньшей мере 19 (от 19 до 23) и, более предпочтительно, по меньшей мере 21 (от 21 до 23) последовательных нуклеотидов SEQ ID NO: 17 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований и, предпочтительно, не более 25 оснований).

Полинуклеотид, гомологичный полинуклеотиду, имеющему нуклеотидную последовательность SEQ ID NO: 24: полинуклеотид, содержащий по меньшей мере 20 (от 20 до 24) и, более предпочтительно, по меньшей мере 22 (от 22 до 24) последовательных нуклеотидов SEQ ID NO: 18 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований и, предпочтительно, не более 25 оснований).

Полинуклеотид, гомологичный полинуклеотиду, имеющему нуклеотидную последовательность SEQ ID NO: 25: полинуклеотид, содержащий по меньшей мере 18 (от 18 до 21) и, более предпочтительно, по меньшей мере 19 (от 19 до 21) последовательных нуклеотидов SEQ ID NO: 19 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований и, предпочтительно, не более 25 оснований).

Полинуклеотид, гомологичный полинуклеотиду, имеющему нуклеотидную последовательность SEQ ID NO: 26: полинуклеотид, содержащий по меньшей мере 14 (от 14 до 18) и, более предпочтительно, по меньшей мере 16 (от 16 до 18) последовательных нуклеотидов SEQ ID NO: 20 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований, предпочтительно, не более 25 оснований и, более предпочтительно, не более 23 оснований).

Полинуклеотид, гомологичный полинуклеотиду, имеющему нуклеотидную последовательность SEQ ID NO: 27: полинуклеотид, содержащий по меньшей мере 16 (от 16 до 20) и, более предпочтительно, по меньшей мере 18 (от 18 до 20) последовательных нуклеотидов SEQ ID NO: 21 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований, предпочтительно, не более 25 оснований и, более предпочтительно, не более 23 оснований).

Полинуклеотид, гомологичный полинуклеотиду, имеющему нуклеотидную последовательность SEQ ID NO: 28: полинуклеотид, содержащий по меньшей мере 16 (от 16 до 20) и, более предпочтительно, по меньшей мере 18 (от 18 до 20) последовательных нуклеотидов SEQ ID NO: 22 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований, предпочтительно, не более 25 оснований и, более предпочтительно, не более 23 оснований).

Полинуклеотид, гомологичный полинуклеотиду, имеющему нуклеотидную последовательность SEQ ID NO: 29: полинуклеотид, содержащий по меньшей мере 16 (от 16 до 20) и, более предпочтительно, по меньшей мере 18 (от 18 до 20) последовательных нуклеотидов SEQ ID NO: 23 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований, предпочтительно, не более 25 оснований и, более предпочтительно, не более 23 оснований).

Полинуклеотид, гомологичный полинуклеотиду, имеющему нуклеотидную последовательность SEQ ID NO: 30: полинуклеотид, содержащий по меньшей мере 16 (от 16 до 20) и, более предпочтительно, по меньшей мере 18 (от 18 до 20) последовательных нуклеотидов SEQ ID NO: 24 (в которую могут быть встроены одна или несколько мутаций) (у которого длина в нуклеотидах может составлять не более 30 оснований, предпочтительно, не более 25 оснований и, более предпочтительно, не более 23 оснований).

Полинуклеотид в соответствии с настоящим изобретением, состоящий по меньшей мере из 10 оснований, гибридизующийся с полинуклеотидом, имеющим нуклеотидную последовательность SEQ ID NO: 6, и полинуклеотид, состоящий по меньшей мере из 10 оснований, гибридизующийся с полинуклеотидом, имеющим последовательность, комплементарную нуклеотидной последовательности SEQ ID NO: 6, могут представлять собой полинуклеотид, содержащий по меньшей мере 10 последовательных нуклеотидов последовательности, комплементарной нуклеотидной последовательности SEQ ID NO: 6, и полинуклеотид, содержащий по меньшей мере 10 последовательных нуклеотидов нуклеотидной последовательности SEQ ID NO: 6, соответственно.

Если полинуклеотид, созданный на основе нуклеотидной последовательности SEQ ID NO: 6, используют в качестве праймера для проведения LAMP (FIP и BIP), то в качестве праймера можно использовать полинуклеотид, содержащий по меньшей мере 42 (например, от 42 до 57) последовательных нуклеотида (в который могут быть встроены одна или несколько мутаций) нуклеотидной последовательности SEQ ID NO: 6 или последовательности, комплементарной ей (где длина в нуклеотидах может составлять не более 60 оснований и, предпочтительно, не более 57 оснований).

Если полинуклеотид, созданный на основе нуклеотидной последовательности SEQ ID NO: 6, используют в качестве праймера для проведения LAMP (F3, В3, LB и LF), то в качестве праймера можно использовать полинуклеотид, содержащий по меньшей мере 18 (например, от 18 до 25) последовательных нуклеотидов (в который могут быть встроены одна или несколько мутаций) нуклеотидной последовательности SEQ ID NO: 6 или последовательности, комплементарной ей (где длина в нуклеотидах может составлять не более 30 оснований и, предпочтительно, не более 25 оснований).

Если полинуклеотид, созданный на основе нуклеотидной последовательности SEQ ID NO: 6, используют в качестве праймера для проведения ПЦР, то в качестве праймера можно использовать полинуклеотид, содержащий по меньшей мере 15 (например, от 15 до 30), более предпочтительно, по меньшей мере 18 (например, от 18 до 24 и от 18 до 30) и, особенно предпочтительно, по меньшей мере 20 (например, от 20 до 25 и от 20 до 30) последовательных нуклеотидов (в который могут быть встроены одна или несколько мутаций) нуклеотидной последовательности SEQ ID NO: 6 или последовательности, комплементарной ей (где длина в нуклеотидах может составлять не более 30 оснований, предпочтительно, не более 25 оснований и, более предпочтительно, не более 24 оснований).

В соответствии с настоящим изобретением на основании полинуклеотида, имеющего нуклеотидную последовательность SEQ ID NO: 6, может быть выбрана пара праймеров для проведения ПЦР для детекции Saccharomyces pastorianus. Конкретно, праймеры для проведения ПЦР могут быть выбраны таким образом, чтобы один из двух праймеров спаривался с нуклеотидной последовательностью SEQ ID NO: 6, при этом другой праймер спаривался с последовательностью, комплементарной нуклеотидной последовательности SEQ ID NO: 6, и чтобы один из праймеров спаривался с растущей цепью, удлиняемой с помощью другого праймера.

Кроме того, в соответствии с настоящим изобретением на основании полинуклеотида, имеющего нуклеотидную последовательность SEQ ID NO: 6, может быть выбран набор праймеров для проведения LAMP для детекции Saccharomyces pastorianus. Конкретно, разработано 4 типа праймеров, необходимых для осуществления способа LAMP, обозначаемых FIP, F3, BIP и B3, как описано выше, и при необходимости также можно использовать петлевые праймеры, такие как LF и LB.

Кроме того, каждый гомологичный полинуклеотид и полинуклеотид, созданный на основании нуклеотидной последовательности SEQ ID NO: 6, могут представлять собой полинуклеотид, гомология которого составляет по меньшей мере 90%, предпочтительно, по меньшей мере 95% с каждой соответствующей нуклеотидной последовательностью. Количественно величина гомологии может быть рассчитана в соответствии с алгоритмом, хорошо известным в данной области. Например, количественно величина гомологии может быть рассчитана с использованием BLAST (http://www.ddbj.nig.ac.jp/search/blast-j.html).

Более того, такой гомологичный полинуклеотид и полинуклеотид, созданный на основании нуклеотидной последовательности SEQ ID NO: 6, могут представлять собой полинуклеотид, который состоит из модифицированной нуклеотидной последовательности, в которую встраивают одну или несколько мутаций по сравнению с соответствующей нуклеотидной последовательностью, и гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную соответствующей нуклеотидной последовательности.

В данном документе под термином «мутация», которая может быть той же самой или отличной, понимают замену, делецию, вставку и добавление. Такая мутация может быть выбрана, предпочтительно, из «однонуклеотидной замены», при которой определенное основание замещается другим основанием, «однонуклеотидной делеции», при которой определенное основание выпадает, «однонуклеотидной вставки», при которой определенное основание встраивается, и «однонуклеотидной добавки», при которой определенное основание добавляется. Количество мутировавших нуклеотидов может составлять от 1 до 6 оснований, 1, 2, 3 или 4 основания, 1 или 2 основания, или 1 основание.

В соответствии с настоящим изобретением под термином «полинуклеотид» понимают ДНК, РНК и PNA (пептидную нуклеиновую кислоту).

Полинуклеотид, который составляет набор праймеров в соответствии с настоящим изобретением, может быть получен химическим синтезом нуклеиновой кислоты согласно стандартному способу, такому как способ синтеза через сложный триэфир фосфата (Hunkapiller, M. et al., Nature, 310, 105, 1984). В ином случае, может быть получена суммарная ДНК штамма в виде детектируемой мишени, и затем при необходимости может быть получен фрагмент ДНК, содержащий интересующую нуклеотидную последовательность, способом ПЦР или подобным на основании нуклеотидных последовательностей, раскрытых в настоящем описании.

Конкретный вариант осуществления способа детекции в соответствии с настоящим изобретением может включать способ детекции, который включает проведение реакции амплификации нуклеиновой кислоты на образце, содержащем нуклеиновую кислоту, способом LAMP и затем детекцию наличия или отсутствия продукта амплификации нуклеиновой кислоты. Конкретно, предлагаются следующие способы.

В первом варианте осуществления настоящее изобретение относится к способу определения Saccharomyces pastorianus, который включает:

(а) проведение реакции амплификации нуклеиновой кислоты на нуклеиновой кислоте, содержащейся в образце, способом LAMP, используя набор праймеров для проведения LAMP в соответствии с первым вариантом осуществления настоящего изобретения; и

(b) определение наличия или отсутствия продукта амплификации,

где образование амплифицированного продукта указывает на присутствие Saccharomyces pastorianus.

Во втором варианте осуществления настоящее изобретение относится к способу детекции Saccharomyces cerevisiae, который включает:

(с) проведение реакции амплификации нуклеиновой кислоты на нуклеиновой кислоте, содержащейся в образце, способом LAMP, используя набор праймеров для проведения LAMP в соответствии со вторым вариантом осуществления настоящего изобретения; и

(d) определение наличия или отсутствия продукта амплификации,

где образование амплифицированного продукта указывает на присутствие Saccharomyces cerevisiae.

В третьем варианте осуществления настоящее изобретение относится к способу детекции Saccharomyces bayanus, который включает:

(е) проведение реакции амплификации нуклеиновой кислоты на нуклеиновой кислоте, содержащейся в образце, способом LAMP, используя набор праймеров для проведения LAMP в соответствии с третьим вариантом осуществления настоящего изобретения; и

(f) определение наличия или отсутствия продукта амплификации,

где образование амплифицированного продукта указывает на присутствие Saccharomyces bayanus.

Образец, подвергаемый процессу амплификации нуклеиновой кислоты способом LAMP, может быть получен способом, при котором культивируют клетки, содержащиеся в образце, и нуклеиновую кислоту экстрагируют из культивированных клеток, или такую нуклеиновую кислоту экстрагируют без такого процесса культивирования. Получение образца, содержащего нуклеиновую кислоту, такого как культура клеток, экстракция нуклеиновой кислоты, будут описаны ниже.

В процессе амплификации нуклеиновой кислоты способом LAMP реакцию амплификации осуществляют на нуклеиновой кислоте, содержащейся в образце. Такая реакция амплификации нуклеиновой кислоты способом LAMP будет описана ниже.

В том случае, когда детектируемый мишеневый вид присутствует в образце, в качестве мишени амплифицируется специфическая область и образуется продукт амплификации. При образовании такого продукта амплификации раствор, содержащий образец, подвергаемый реакции амплификации нуклеиновой кислоты, становится мутным. Таким образом, наличие или отсутствие продукта амплификации можно определить, измерив мутность раствора, содержащего образец. Измерение мутности способом LAMP хорошо известно. Мутность можно измерить, используя коммерчески доступный прибор для измерения мутности конечной точки (например, LA-100 производства фирмы Teramecs Co., Ltd.) или прибор для измерения мутности в режиме реального времени (например, LA-200 производства фирмы Teramecs Co., Ltd.).

Как описывается в приводимых ниже примерах, для определения количества клеток, содержащихся в испытуемом образце, измеряют время, требуемое для достижения раствором, содержащим образец, определенной мутности. Конкретно, в другом аспекте способа детекции в соответствии с настоящим изобретением предлагается способ количественной оценки Saccharomyces pastorianus, Saccharomyces cerevisiae и Saccharomyces bayanus, который включает осуществление реакции амплификации нуклеиновой кислоты в образце, содержащем нуклеиновую кислоту, способом LAMP, и одновременно измерение времени, необходимого от начала реакции амплификации нуклеиновой кислоты до достижения раствором, содержащим образец, определенной мутности, и определение числа клеток, содержащихся в образце, исходя из измеренного времени. Способ количественной оценки по настоящему изобретению конкретно следующий.

В первом варианте осуществления настоящее изобретение относится к способу количественной оценки Saccharomyces pastorianus, который включает:

(а) проведение реакции амплификации нуклеиновой кислоты на нуклеиновой кислоте, содержащейся в образце, способом LAMP, используя набор праймеров для проведения LAMP в соответствии с первым вариантом осуществления настоящего изобретения;

(b') измерение времени, требуемого от начала реакции амплификации нуклеиновой кислоты до достижения раствором, содержащим образец, определенной мутности; и

(b”) определение числа клеток, содержащихся в образце, исходя из измеренного времени.

Во втором варианте осуществления настоящее изобретение относится к способу количественной оценки Saccharomyces cerevisiae, который включает:

(с) проведение реакции амплификации нуклеиновой кислоты на нуклеиновой кислоте, содержащейся в образце, способом LAMP, используя набор праймеров для проведения LAMP в соответствии со вторым вариантом осуществления настоящего изобретения;

(d') измерение времени, требуемого от начала реакции амплификации нуклеиновой кислоты до достижения раствором, содержащим образец, определенной мутности; и

(d”) определение числа клеток, содержащихся в образце, исходя из измеренного времени.

В третьем варианте осуществления настоящее изобретение относится к способу количественной оценки Saccharomyces bayanus, который включает:

(е) проведение реакции амплификации нуклеиновой кислоты на нуклеиновой кислоте, содержащейся в образце, способом LAMP, используя набор праймеров для проведения LAMP в соответствии с третьим вариантом осуществления настоящего изобретения;

(f') измерение времени, требуемого от начала реакции амплификации нуклеиновой кислоты до достижения раствором, содержащим образец, определенной мутности; и

(f”) определение числа клеток, содержащихся в образце, исходя из измеренного времени.

В способе количественной оценки в соответствии с настоящим изобретением предварительно была построена калибровочная кривая с использованием числа клеток и времени, требуемого для достижения раствором, содержащим образец, определенной мутности. После этого на основании калибровочной кривой, исходя из измеренного времени, можно получить число клеток, содержащихся в образце. Калибровочную кривую можно получить, например, готовя образцы путем поэтапного разведения клеток, после чего проводя амплификацию нуклеиновой кислоты в каждом образце согласно способу LAMP, и затем нанося на график время, требуемое от начала реакции амплификации нуклеиновой кислоты до достижения мутности 0,1, относительно логарифма колониеобразующего числа клеток.

В способе детекции и способе количественной оценки в соответствии с настоящим изобретением к набору праймеров, состоящему из FIP, F3, BIP и В3, может быть добавлен(ы) петлевой(ые) праймер(ы) (LF и/или LB), после чего реакция амплификации нуклеиновой кислоты может быть осуществлена способом LAMP. Конкретно, в способе детекции и способе количественной оценки в соответствии с первым вариантом осуществления настоящего изобретения, используя набор праймеров для проведения LAMP, состоящий из полинуклеотидов, имеющих нуклеотидные последовательности SEQ ID NO: 1-4, или гомологичных им полинуклеотидов, может быть добавлен и использован в качестве петлевого праймера полинуклеотид с нуклеотидной последовательностью SEQ ID NO: 5 или гомологичный ему полинуклеотид. В способе детекции и способе количественной оценки в соответствии со вторым вариантом осуществления настоящего изобретения может быть добавлен и использован в качестве петлевого(ых) праймера(ов) один из или оба следующих полинуклеотидов: полинуклеотид с нуклеотидной последовательностью SEQ ID NO: 11 или гомологичный ему полинуклеотид, полинуклеотид с нуклеотидной последовательностью SEQ ID NO: 12 или гомологичный ему полинуклеотид. В способе детекции и способе количественной оценки в соответствии с третьим вариантом осуществления настоящего изобретения может быть добавлен и использован в качестве петлевого праймера полинуклеотид с нуклеотидной последовательностью SEQ ID NO: 17 или гомологичный ему полинуклеотид.

Наборы праймеров для проведения LAMP в соответствии с настоящим изобретением можно использовать самостоятельно или в сочетании, в зависимости от конкретных обстоятельств. Используя наборы праймеров в соответствии с настоящим изобретением в сочетании, становится возможным с точностью отличить друг от друга Saccharomyces pastorianus, Saccharomyces cerevisiae и Saccharomyces bayanus.

Кроме того, наборы праймеров для проведения LAMP в соответствии с настоящим изобретением могут быть представлены в виде набора, самостоятельно или в комбинации. Таким образом, настоящее изобретение относится к набору для детекции дрожжей рода Saccharomyces, который содержит набор праймеров, выбранный из группы, состоящей из набора праймеров для проведения LAMP по первому варианту осуществления; набора праймеров для проведения LAMP по второму варианту осуществления; набора праймеров для проведения LAMP по третьему варианту осуществления; и комбинации части или всех этих наборов праймеров.

Набор в соответствии с настоящим изобретением, который содержит набор праймеров для проведения LAMP, может включать реагенты (например, ДНК-полимеразу Bst, раствор для смешивания реагентов для проведения реакции) и расходный материал (например, пробирку для проведения реакции), которые необходимы для осуществления реакции амплификации нуклеиновой кислоты способом LAMP.

Набор в соответствии с настоящим изобретением, который содержит набор праймеров для проведения ПЦР, может включать реагенты (например, ДНК-полимеразу, очищенную воду) и расходный материал (например, пробирку для проведения реакции), которые необходимы для осуществления реакции амплификации нуклеиновой кислоты способом ПЦР.

Набор праймеров для проведения LAMP в соответствии с первым вариантом осуществления настоящего изобретения нацелен на ген МЕТ16 Lg-типа, и, возможно, он может вступать в реакцию с Saccharomyces bayanus, который не является единообразным с точки зрения геномной структуры. С другой стороны, набор праймеров для проведения LAMP в соответствии с третьим вариантом осуществления настоящего изобретения нацелен на ген Saccharomyces bayanus, гомологичный гену RAD18, который отсутствует у Saccharomyces cerevisiae или Saccharomyces pastorianus, и это дает возможность определять Saccharomyces bayanus с высокой точностью. Соответственно, при необходимости более точно детектировать Saccharomyces pastorianus предпочтительно использовать набор праймеров для проведения LAMP в соответствии с первым вариантом осуществления настоящего изобретения в сочетании с набором праймеров для проведения LAMP, используемым для детекции Saccharomyces bayanus (предпочтителен набор праймеров для проведения LAMP в соответствии с третьим вариантом осуществления). В этом случае, при прохождении реакции амплификации как с набором праймеров для проведения LAMP в соответствии с первым вариантом осуществления настоящего изобретения, так и с набором праймеров для проведения LAMP, используемым для детекции Saccharomyces bayanus, или при отсутствии такой реакции амплификации с набором праймеров для проведения LAMP в соответствии с первым вариантом осуществления, но прохождении ее с набором праймеров для проведения LAMP, используемым для детекции Saccharomyces bayanus, можно определить, что в образце присутствует Saccharomyces bayanus. При обнаружении реакции амплификации с набором праймеров для проведения LAMP в соответствии с первым вариантом осуществления настоящего изобретения и отсутствии такой реакции амплификации с набором праймеров для проведения LAMP, используемым для детекции Saccharomyces bayanus, можно определить, что в образце присутствует Saccharomyces pastorianus.

Таким образом, настоящее изобретение относится к набору для детекции Saccharomyces pastorianus, который содержит набор праймеров для проведения LAMP в соответствии с первым вариантом осуществления настоящего изобретения в сочетании с набором праймеров для проведения LAMP, используемым для детекции Saccharomyces bayanus.

Кроме того, в соответствии с настоящим изобретением, способ детекции Saccharomyces pastorianus в соответствии с первым вариантом осуществления настоящего изобретения может дополнительно включать стадию проведения реакции амплификации нуклеиновой кислоты способом LAMP с набором праймеров для проведения LAMP, используемым для детекции Saccharomyces bayanus. Эта стадия может включать стадию проведения реакции амплификации нуклеиновой кислоты в образце, содержащем нуклеиновую кислоту, способом LAMP и стадию определения наличия или отсутствия продукта амплификации нуклеиновой кислоты.

В вышеуказанных описаниях в качестве набора праймеров для проведения LAMP, используемого для детекции Saccharomyces bayanus, предпочтительным является набор праймеров для проведения LAMP в соответствии с третьим вариантом осуществления настоящего изобретения.

Кроме того, если необходимо точно определить Saccharomyces pastorianus, используя набор праймеров для проведения LAMP в соответствии с первым вариантом осуществления настоящего изобретения, предпочтительно использовать набор праймеров для проведения LAMP в соответствии с первым вариантом осуществления настоящего изобретения в сочетании с набором праймеров для проведения LAMP, способным детектировать Saccharomyces cerevisiae и Saccharomyces pastorianus. Набор праймеров для проведения LAMP, используемый для детекции Saccharomyces pastorianus в соответствии с первым вариантом осуществления настоящего изобретения, может перекрестно взаимодействовать с Saccharomyces bayanus, который не является единообразным с точки зрения геномной структуры. Набор праймеров для проведения LAMP, используемый для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus, взаимодействует с геномной последовательностью Saccharomyces cerevisiae, содержащейся в Saccharomyces pastorianus, но Saccharomyces bayanus не имеет такой геномной последовательности Saccharomyces cerevisiae. Таким образом, набор праймеров для проведения LAMP, используемый для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus, не взаимодействует с Saccharomyces bayanus. В этом случае, при прохождении реакции амплификации как с набором праймеров для проведения LAMP, используемым для детекции Saccharomyces pastorianus, в соответствии с настоящим изобретением, так и с набором праймеров для проведения LAMP, используемым для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus, можно определить, что в образце присутствует Saccharomyces pastorianus. Если реакция амплификации проходит с набором праймеров для проведения LAMP, используемым для детекции Saccharomyces pastorianus, в соответствии с настоящим изобретением, но такая реакция амплификации не проходит с набором праймеров для проведения LAMP, используемым для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus, можно определить, что в образце присутствует Saccharomyces bayanus.

Таким образом, настоящее изобретение относится к набору для детекции Saccharomyces pastorianus, который содержит набор праймеров для проведения LAMP в соответствии с первым вариантом осуществления настоящего изобретения в сочетании с набором праймеров для проведения LAMP, используемым для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus.

Кроме того, в соответствии с настоящим изобретением, способ детекции Saccharomyces pastorianus в соответствии с первым вариантом осуществления настоящего изобретения может дополнительно включать стадию проведения реакции амплификации нуклеиновой кислоты способом LAMP с набором праймеров для проведения LAMP, используемым для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus. Эта стадия может включать стадию проведения реакции амплификации нуклеиновой кислоты в образце, содержащем нуклеиновую кислоту, способом LAMP и стадию определения наличия или отсутствия продукта амплификации нуклеиновой кислоты.

В вышеуказанных вариантах осуществления набор праймеров для проведения LAMP, используемый для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus, предпочтительно содержит следующие полинуклеотиды:

полинуклеотид (FIP) с нуклеотидной последовательностью SEQ ID NO: 18 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности;

полинуклеотид (F3) с нуклеотидной последовательностью SEQ ID NO: 19 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности;

полинуклеотид (BIP) с нуклеотидной последовательностью SEQ ID NO: 20 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности; и

полинуклеотид (В3) с нуклеотидной последовательностью SEQ ID NO: 21 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности.

Вышеупомянутый набор праймеров для проведения LAMP, используемый для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus, может дополнительно содержать в качестве петлевого праймера полинуклеотид (LB) с нуклеотидной последовательностью SEQ ID NO: 22 или полинуклеотид, состоящий по меньшей мере из 10 оснований, который гибридизуется с полинуклеотидом, имеющим последовательность, комплементарную данной нуклеотидной последовательности.

Среди способов детекции в соответствии с настоящим изобретением конкретный вариант осуществления способа детекции путем ПЦР может включать способ детекции, который предусматривает проведение реакции амплификации нуклеиновой кислоты в образце, содержащем нуклеиновую кислоту, способом ПЦР и затем детекцию наличия или отсутствия продукта амплификации нуклеиновой кислоты.

Конкретно, изобретение относится к способу детекции Saccharomyces pastorianus, который включает:

(g) реакцию амплификации нуклеиновой кислоты на нуклеиновой кислоте, содержащейся в образце, способом ПЦР с использованием набора праймеров для проведения ПЦР в соответствии с первым вариантом осуществления, третьим вариантом осуществления или четвертым вариантом осуществления настоящего изобретения; и

(h) определение наличия или отсутствия продукта амплификации,

где образование продукта амплификации указывает на наличие Saccharomyces pastorianus.

В качестве образца, подвергаемого процессу амплификации нуклеиновой кислоты способом ПЦР, могут быть культивированы клетки, содержащиеся в образце, и после этого может быть экстрагирована нуклеиновая кислота, или эта нуклеиновая кислота может быть экстрагирована без культивирования. Получение образца, содержащего нуклеиновую кислоту, такого как культура клеток, или экстракция нуклеиновой кислоты, будут описаны далее.

В процессе амплификации нуклеиновой кислоты способом ПЦР реакцию амплификации проводят на нуклеиновой кислоте, содержащейся в образце. Такая реакция амплификации нуклеиновой кислоты, проводимая способом ПЦР, широко известна. Специалисты в данной области могут соответствующим образом определить условия проведения способа ПЦР или его модификации и могут осуществить способ ПЦР.

Среди способов детекции в соответствии с настоящим изобретением конкретный вариант осуществления способа детекции с применением зонда может включать способ детекции, который предусматривает проведение гибридизации зонда в соответствии с настоящим изобретением с образцом, содержащим нуклеиновую кислоту, и затем детекцию наличия или отсутствия комплекса с нуклеиновой кислотой.

Конкретно, изобретение относится к способу детекции Saccharomyces pastorianus, который включает:

(i) приведение в контакт зонда в соответствии с первым вариантом осуществления настоящего изобретения с нуклеиновой кислотой, содержащейся в образце; и

(j) определение наличия или отсутствия гибридного комплекса,

где образование гибридного комплекса указывает на наличие Saccharomyces pastorianus.

В таком способе определения, использующем зонды, перед применением зонды могут быть помечены. Примерами меток являются радиоактивные элементы (например, 32P и 14С), флуоресцирующие соединения (например, FITC) и молекулы, ассоциированные с ферментативной реакцией (например, пероксидаза, щелочная фосфатаза).

Гибридный комплекс можно определить известными способами, такими как гибридизация по Нозерну, гибридизация по Саузерну и гибридизация колоний микроорганизмов.

Если реакцию амплификации нуклеиновой кислоты проводят с использованием набора праймеров в соответствии с настоящим изобретением, дрожжи рода Saccharomyces, которые вызывают снижение качества алкогольных напитков или безалкогольных напитков, могут быть с точностью идентифицированы до вида. Соответственно, набор праймеров и набор в соответствии с настоящим изобретением можно использовать для контроля качества алкогольных напитков (например, пива, пива с низким содержанием солода, вина, плодово-ягодного вина, японской рисовой водки) и/или безалкогольных напитков (например, фруктового сока) и оценки образца из окружающей среды (например, исходной воды).

В качестве видов дрожжей, вызывающих ухудшение качества в процессе производства пива и пива с низким содержанием солода или их конечной продукции, могут быть обнаружены Saccharomyces pastorianus, Saccharomyces cerevisiae и Saccharomyces bayanus. Поэтому для контроля качества пива и пива с низким содержанием солода можно, предпочтительно, использовать набор праймеров для проведения LAMP и набор праймеров для проведения ПЦР в соответствии с первым вариантом осуществления; набор праймеров для проведения LAMP в соответствии со вторым вариантом осуществления; набор праймеров для проведения LAMP и набор праймеров для проведения ПЦР в соответствии с третьим вариантом осуществления; набор праймеров для проведения ПЦР в соответствии с четвертым вариантом осуществления; и комбинацию части или всех этих наборов праймеров.

В качестве видов дрожжей, вызывающих ухудшение качества в процессе производства вина или его конечной продукции, могут быть обнаружены Saccharomyces cerevisiae и Saccharomyces bayanus. Поэтому для контроля качества вина можно, предпочтительно, использовать набор праймеров для проведения LAMP в соответствии со вторым вариантом осуществления; набор праймеров для проведения LAMP в соответствии с третьим вариантом осуществления; и их комбинацию.

В качестве видов дрожжей, вызывающих ухудшение качества в процессе производства безалкогольных напитков (в частности, фруктового сока) или их конечной продукции, могут быть обнаружены Saccharomyces cerevisiae и Saccharomyces bayanus. Поэтому для контроля качества безалкогольных напитков (в частности, фруктового сока) можно, предпочтительно, использовать набор праймеров для проведения LAMP в соответствии со вторым вариантом осуществления; набор праймеров для проведения LAMP в соответствии с третьим вариантом осуществления; и их комбинацию.

Реакция амплификации нуклеиновой кислоты способом LAMP

Набор праймеров для проведения LAMP в соответствии с настоящим изобретением можно использовать в качестве праймеров для реакции амплификации нуклеиновой кислоты способом LAMP. Набор праймеров в соответствии с настоящим изобретением также можно использовать в качестве праймеров не только для реакции амплификации нуклеиновой кислоты способом LAMP, но также для реакции амплификации нуклеиновой кислоты модифицированным способом LAMP. Принцип способа LAMP и способ амплификации нуклеиновой кислоты с его использованием хорошо известны. В качестве ссылочного материала для осуществления реакции амплификации нуклеиновой кислоты способом LAMP можно использовать описания, изложенные в патенте WO00/28082, и Notomi T. et al., Nucleic Acids Research, 28(12), e63(2000).

Реакцию амплификации нуклеиновой кислоты способом LAMP можно осуществить, используя коммерчески доступный набор реагентов для амплификации генов способом LAMP. Реакцию амплификации нуклеиновой кислоты можно осуществить, например, смешиванием образца ДНК, раствора, содержащего праймеры, и реагентов, включенных в коммерчески доступный набор реагентов для амплификации генов способом LAMP (например, набор для амплификации ДНК Loopamp производства фирмы Eiken Chemical Co., Ltd.) согласно инструкциям, содержащимся в наборе, и затем сохранением полученной смеси при определенной температуре (от 60°C до 65°C), чтобы реакция могла продолжаться определенный период времени (как правило, 1 час).

Реакцию амплификации нуклеиновой кислоты способом LAMP можно осуществить с помощью следующих процессов.

(i) Цепь ДНК, комплементарную матричной ДНК, синтезируют с помощью ДНК-полимеразы с активностью по типу вытеснения цепи, использующей 3'-конец области F2 полинуклеотида FIP в качестве начальной точки.

(ii) Праймер F3 отжигается на сайте вне полинуклеотида FIP, и синтез ДНК продолжается под действием ДНК-полимеразы с активностью по типу вытеснения цепи, использующей его 3'-конец в качестве начальной точки, по мере удаления ранее синтезированной цепи ДНК с FIP.

(iii) Двойная цепь образуется цепью ДНК, синтезированной с праймера F3, и матричной ДНК.

(iv) Цепь ДНК, ранее синтезированная с FIP, удаляется благодаря цепи ДНК с праймера F3, таким образом, ДНК становится одноцепочечной. Однако эта цепь ДНК имеет комплементарные области F1c и F1 на 5'-концевом участке, и это вызывает самоотжиг с образованием петли.

(v) BIP отжигается на цепи ДНК, которая образовала петлю в вышеописанном процессе (iv), и комплементарная ДНК синтезируется, используя 3'-конец полинуклеотида BIP в качестве начальной точки. В этом процессе петля перемещается и удлиняется. Далее, праймер В3 отжигается на сайте вне BIP, и синтез ДНК продолжается под действием ДНК-полимеразы с активностью по типу вытеснения цепи, использующей его 3'-конец в качестве начальной точки, по мере удаления ранее синтезированной цепи ДНК с BIP.

(vi) Двухцепочечная ДНК образуется в вышеуказанном процессе (v).

(vii) Поскольку цепь ДНК, синтезированная с BIP, которая была удалена в вышеуказанном процессе (v), имеют комплементарные последовательности на обоих концах, это вызывает самоотжиг с образованием петли, таким образом, она приобретает гантелевидную структуру.

(viii) Используя в качестве матрицы вышеупомянутую цепь ДНК, имеющую гантелевидную структуру, осуществляют цикл амплификации желаемой ДНК путем отжига FIP и затем отжига BIP.

Специалисту в данной области было бы понятно, как осуществить реакцию амплификации нуклеиновой кислоты способом LAMP с помощью подходящим образом модифицированных вышеупомянутых процессов. В таком модифицированном способе также можно использовать набор праймеров в соответствии с настоящим изобретением.

Набор праймеров для проведения LAMP в соответствии с настоящим изобретением вызывает синтез цепи ДНК при температуре примерно от 60°C до примерно 65°C (например, 65°C), а также отжиг. Реакцию проводят в течение примерно 1 часа через реакцию отжига и синтеза цепи ДНК с тем, чтобы нуклеиновая кислота могла быть амплифицирована в 109-1010 раз.

Если набор праймеров для проведения LAMP в соответствии с настоящим изобретением оставляют взаимодействовать с нуклеиновой кислотой из образца в условиях, подходящих для реакции амплификации нуклеиновой кислоты способом LAMP, то в качестве детектируемой мишени амплифицируется мишеневая область цепи. Если такая реакция амплификации происходит, реакционный раствор мутнеет вследствие влияния пирофосфата магния, образующегося в качестве побочного продукта. Таким образом, на основании мутности можно визуально определить наличие или отсутствие амплификации. Наличие или отсутствие амплификации также можно определить, оптически измерив мутность, используя прибор для измерения мутности. Альтернативно, для подтверждения и детекции наличия или отсутствия фрагмента ДНК можно использовать электрофорез в агарозном геле или тому подобное.

Обнаружение амплификации нуклеиновой кислоты означает присутствие мишеневой нуклеотидной последовательности, указывая, что штамм в качестве детектируемой мишени набора праймеров является положительным (+). Наоборот, если амплификация нуклеиновой кислоты не наблюдается, это означает отсутствие мишеневой нуклеотидной последовательности, указывая, что штамм в качестве детектируемой мишени набора праймеров является отрицательным (-).

Реакция амплификации нуклеиновой кислоты способом ПЦР

Набор праймеров для проведения ПЦР в соответствии с настоящим изобретением применяют для идентификации дрожжей рода Saccharomyces, используя способы амплификации нуклеиновой кислоты, такие как способ ПЦР, способ ОТ-ПЦР, способ ПЦР в режиме реального времени или способ ПЦР in situ.

Обнаружение амплификации нуклеиновой кислоты означает присутствие мишеневой нуклеотидной последовательности, указывая, что штамм в качестве детектируемой мишени набора праймеров является положительным (+). Наоборот, если такая амплификация нуклеиновой кислоты не наблюдается, это означает отсутствие мишеневой нуклеотидной последовательности, указывая, что штамм в качестве детектируемой мишени набора праймеров является отрицательным (-).

В способе ПЦР продукт амплификации нуклеиновой кислоты можно детектировать в соответствии с известными способами, такими как электрофорез в агарозном геле. Кроме того, в способе ПЦР в режиме реального времени такой продукт амплификации нуклеиновой кислоты может быть детектирован в течение времени на приборе, созданном путем совмещения термоциклера со спектрофотофлуориметром, с использованием интеркалятора или флуоресцентно меченного зонда.

Образец, содержащий детектируемую мишень, и его получение

Примеры образца, используемого в качестве детектируемой мишени набора праймеров и набора в соответствии с настоящим изобретением, включают алкогольные напитки, такие как пиво, пиво с низким содержанием солода и вино; безалкогольные напитки, такие как сидр, лимонад и газированная вода; образцы из окружающей среды, такие как вода, собранная для использования в качестве сырья; и полуфабрикаты, собранные в процессе производства алкогольных напитков, безалкогольных напитков и т.д.

Если эти продукты используют в качестве образцов для способа LAMP или способа ПЦР, в качестве предварительной обработки могут быть осуществлены такие процедуры, как концентрирование, выделение и культивирование клеток, присутствующих в образце, выделение из клеток нуклеиновой кислоты и концентрирование нуклеиновой кислоты. Способы концентрирования и выделения клеток, присутствующих в образце, включают фильтрацию и центрифугирование, и такие способы, в случае необходимости, могут быть выбраны. Кроме того, клетки, сконцентрированные и выделенные из образца, могут быть дополнительно культивированы, чтобы увеличить количество клеток. С целью культивирования можно использовать твердую агаровую среду или жидкую среду, которая подходит для пролиферации мишеневого дрожжевого штамма. Кроме того, для отбора мишеневого дрожжевого штамма может быть добавлен агент, такой как сульфат меди. Для высвобождения нуклеиновой кислоты из клеток, присутствующих в образце напитка или образце из окружающей среды, или из культивированных клеток, можно выбрать, например, способ с использованием коммерчески доступного набора или способ обработки клеток щелочным раствором и затем нагревания клеток до 100°C с высвобождением из них нуклеиновой кислоты. Кроме того, если необходимо дополнительно очистить нуклеиновую кислоту, ее можно очистить обработкой смесью фенол/хлороформ, осаждением этанолом, центрифугированием и т.д., и очищенную нуклеиновую кислоту можно в заключение вновь растворить в ТЕ-буфере или подобном, чтобы ее можно было использовать в испытаниях в качестве матричной ДНК (European Brewery Convention: ANALYTICA-MICROBIOLOGICA-EBC, 2nd ed. 2005, Fachverlag Hans Carl, Nuernberg; Rolf et al.: PCR-Clinical diagnostics and research, Springer-Verlag, Berlin, 1992; Yasuji Oshima et al.: Tanpaku kakusan koso (Proteins, Nucleic acids, Enzymes), Vol. 35, 2523-2541, 1990).

Детекцию дрожжей рода Saccharomyces можно провести, используя набор праймеров и набор в соответствии с настоящим изобретением, например, как описано ниже.

Во-первых, дрожжи рода Saccharomyces, которые предполагается найти в образце, культивируют в подходящей среде. Затем из колонии, образованной на агаровой среде, выделяют ДНК и затем к ДНК применяют способ LAMP или способ ПЦР, используя набор праймеров в соответствии с настоящим изобретением, с тем, чтобы амплифицировать специфическую область гена дрожжей рода Saccharomyces. Присутствие продукта амплификации гена указывает на наличие штамма как мишени набора праймеров.

Примеры

Далее в данном документе настоящее изобретение будет конкретно описано в следующих примерах. Однако эти примеры не предназначены для ограничения объема настоящего изобретения.

Пример 1: Детекция дрожжей рода Saccharomyces

(а) Способ экстракции геномной ДНК

Клетки, культивированные на чашке Петри с агаровой средой, собирали со среды и затем их суспендировали в стерильной дистиллированной воде. Эту суспензию центрифугировали (15000 об/мин, 5 минут), после чего удаляли супернатант. К осажденным клеткам вновь добавляли стерильную дистиллированную воду, затем смешанный раствор суспендировали и центрифугировали. Супернатант удаляли и затем к полученным клеткам добавляли раствор PrepMan Ultra (производства фирмы Applied Biosystems) в количестве 100 мкл. Смесь нагревали при 95°C в течение 10 минут. После этого полученный продукт центрифугировали при 15000 об/мин в течение 1 минуты и супернатант использовали в качестве раствора геномной ДНК. В ином случае, к отмытым клеткам добавляли 0,1 N раствор NaOH в количестве 100 мкл и затем смесь нагревали при 95°C в течение 10 минут. После этого полученный продукт нейтрализовали 1М Трис-буфером (рН 7,0) и супернатант использовали в качестве раствора геномной ДНК.

(b) Праймеры, используемые в LAMP

Праймеры, используемые для различных штаммов дрожжей рода Saccharomyces, описанные ниже, синтезировали, используя базу данных eGenome (http://genome.e-mp.jp/index.html), продукция фирмы Fujitsu System Solutions Ltd., или способом, эквивалентным этому, и затем их растворяли в ТЕ-буфере (рН 8,0) до концентрации 100 мкМ. Эти растворы смешивали так, чтобы каждый из них имел предварительно определенные концентрации (праймеры FIP и BIP: 16 мкМ; праймеры F3 и В3: 2 мкМ; и праймеры LF и LB: 8 мкМ) и затем их разбавляли.

[Набор праймеров, используемый для детекции дрожжей низового брожения (LGM1LB1)]

FIP:

CCTTCAGTGTTAAAGTCTGTGGGAAATGACTATCCGGGAAATACTATATGCC (SEQ ID NO: 1)

F3: TCACCATCGACATGCTGTC (SEQ ID NO: 2)

BIP: TCAGCCCCAGAAGCAAACTATCCAAATTCCGCCTCTGAGACG (SEQ ID NO: 3)

B3: CCATAGGAAATCACCGTACTTCG (SEQ ID NO: 4)

LB: ATGTTTATAAGCCAGATGGATG (SEQ ID NO: 5)

[Набор праймеров, используемый для детекции Saccharomyces cerevisiae (SCM1LF2LB1)]

FIP:

GGCAGAACCTTGTGATTTTCTTCTACCAAAGTGGAACCTGCACATCG (SEQ ID NO: 7)

F3: TGACAAGTACGATTATCTGGCC (SEQ ID NO: 8)

BIP:

ACTGTCGATTATTGAAATAGACGAACTTAATGGAATACTGTTTAACCTGCTCGAACG (SEQ ID NO: 9)

B3: GTTGTATGGTACATTGTTTGCATCT (SEQ ID NO: 10)

LF: CACTTATATGTAGCTCTTTGTAGGC (SEQ ID NO: 11)

LB: AAAAATAAATCCATTGATCAATTGG (SEQ ID NO: 12)

[Набор праймеров, используемый для детекции Saccharomyces bayanus (SBR2LB1)]

FIP:

TCCCTCATTACCATCTTCATGAATATGCAACTGAAAATAAAAACCAGTTCGCC (SEQ ID NO: 13)

F3: CCAGGCTCATAAAGGAAGCAA (SEQ ID NO: 14)

BIP: CCGCAAGGTGTTCAAGAAACCTTCACCTCTTGTTCTTCTGTGAG (SEQ ID NO: 15)

B3: CTGCATCTGTTAAATCTTCATTTGG (SEQ ID NO: 16)

LB: CAAATGGAGGAGGGGCAA (SEQ ID NO: 17)

[Набор праймеров, используемый для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus (SCC1LB1)]

FIP:

CCTCTTCCAGTTCTTGACTCTTTTCCTAAGATGAAAGTGCCGGGAGA (SEQ ID NO: 18)

F3: ACGAAGATGAGAAAGAGGCG (SEQ ID NO: 19)

BIP: TGACAGCAAGGAGAAGAGCACCCCTCGTTGTTTTCCTCCTCA (SEQ ID NO: 20)

B3: GTGCTGTATGCTCGTTTTCG (SEQ ID NO: 21)

LB: GAGCAAGGGGACGAAGGTGA (SEQ ID NO: 22)

(с) Получение реакционного раствора для амплификации способом LAMP

Для способа LAMP в качестве набора реагентов для амплификации генов использовали набор для амплификации ДНК Loopamp производства фирмы Eiken Chemical Co., Ltd. В пробирку для проведения реакции добавляли раствор геномной ДНК в количестве 2,5 мкл, раствор праймеров в количестве 2,5 мкл, реакционный буфер в 2-кратной концентрации в количестве 12,5 мкл, ДНК-полимеразу Bst в количестве 1 мкл и стерилизованную воду в количестве 6,5 мкл и, таким образом, получали реакционный раствор в общем количестве 25 мкл.

(d) Реакция LAMP

Для проведения реакции LAMP использовали турбидиметр LA-200, работающий в режиме реального времени, производства фирмы Teramecs Co., Ltd., или LA-320C производства фирмы Eiken Chemical Co., Ltd. Помещали в него реакционную пробирку и реакционный раствор оставляли для проведения реакции при постоянной температуре 65°C (крышка: 75°C), и каждые 6 секунд измеряли изменение мутности во время реакции. Реакционный раствор, мутность которого повышалась, определяли как положительный, а реакционный раствор, мутность которого не повышалась, определяли как отрицательный.

(е) Оценка специфичности праймеров, используемых для различных штаммов дрожжей

Что касается праймеров, специфичных для дрожжей низового брожения, Saccharomyces cerevisiae и Saccharomyces bayanus, которые были получены для вышеупомянутых штаммов дрожжей, их специфичность оценивали способом LAMP, используя стандартные штаммы дрожжей рода Saccharomyces, включая все штаммы таксономической группы Saccharomyces sensustricto. В результате повышение мутности наблюдали по ходу амплификации ДНК в течение 60 минут после начала реакции у Saccharomyces pastorianus (дрожжи низового брожения) в случае использования LGM1LB1, у Saccharomyces cerevisiae и Saccharomyces cerevisiae var. diastaticus в случае использования SCM1LF2LB1, у Saccharomyces bayanus в случае использования SBR2LB1 и у Saccharomyces cerevisiae и Saccharomyces pastorianus (дрожжи низового брожения) в случае использования SCC1LB1 (таблица 1). Кроме того, если праймер оставляли взаимодействовать со штаммом, используемым в качестве его мишени для детекции, амплификация происходила в течение 60 минут после начала реакции, и мутность в реакционной пробирке повышалась (фигура 1).

Таблица 1
Оценка праймеров с использованием большого числа стандартных штаммов дрожжей рода Saccharomyces (число в каждой клетке таблицы: время реакции, необходимое для проведения амплификации; -: отсутствие амплификации в течение 80 минут; nt: не испытывали)
Стандартные штаммы дрожжей рода Saccharomyces LGM1LB1 SCM1LF2LB1 SBR2LB1 SCC1LB1
S. cerevisiae NBRC10217 - 40 мин - 20 мин
S. bayanus NBRC11022 - - 30 мин -
S. bayanus NBRC1948 - - 40 мин -
S. bayanus NBRC0615 - - 40 мин -
S. bayanus NBRC10563 - - 40 мин -
S. pastorianus NBRC11024 40 мин - - 20 мин
S. pastorianus NBRC11023 40 мин - - 30 мин
S. pastorianus NBRC10610 40 мин - - 30 мин
S. diastaticus DSM70487 - 40 мин - 20 мин
S. paradoxus NBRC10609 - - - -
S. paradoxus NBRC0259 - - - -
S. paradoxus NBRC10695 - - - -
S. cariocanus NBRC10947 - - - -
S. mikatae NBRC1815 - - - -
S. kudriavzevii NBRC1802 - - - -
S. exiguus NBRC1128 - - - -
S. servazzii NBRC1838 - - - -
S. unisporus NBRC0316 - - - -
S. dairenensis NBRC0211 - - - -
S. kluyveri NBRC1685 - - - -

Кроме того, для оценки специфичности различных праймеров, таких как LGM1LB1, SCM1LF2LB1 и SBR2LB1, использовали большое число стандартных штаммов дрожжей, штаммы дрожжей, используемые в пивоварении, штаммы дрожжей дикого типа, выделенные на пивоваренном заводе, и штаммы дрожжей дикого типа, выделенные из вина. В результате у штаммов дрожжей, отличных от используемых в качестве детектируемых мишеней вышеупомянутых праймеров, амплификации практически не наблюдалось (таблицы 2, 3 и 4).

Таблица 2
Оценка праймеров с использованием большого числа типов стандартных штаммов дрожжей (число в каждой клетке таблицы: время реакции, необходимое для проведения амплификации; -: отсутствие амплификации в течение 80 минут)
Стандартные штаммы дрожжей LGM1LB1 SCM1LF2LB1 SBR2LB1 SCC1LB1
Pichia anomala NBRC0127 - - - -
Williopsis saturnus NBRC0941 - - - -
Kluyveromyces lactis NBRC1090 - - - -
Candida utilis NBRC0988 - - - -
C. boidinii ATCC48180 - - - -
Zygosaccharomyces bailii NBRC1137 - - - -
Dekkera anomala DSM70727 - - - -
D. bruxellensis DSM70001 - - - -
D. bruxellensis ATCC64276 - - - -
D. custersiana DSM70736 - - - -
Brettanomyces naardenensis NBRC1588 - - - -
Таблица 3
Оценка праймеров с использованием большого числа типов штаммов дрожжей, используемых в пивоварении, и штаммов дрожжей дикого типа, выделенных на пивоваренном заводе (число в каждой клетке таблицы: время реакции, необходимое для проведения амплификации; -: отсутствие амплификации в течение 80 минут)
Пивоваренные дрожжи, пивные дрожжи дикого типа LGM1LB1 SCM1LF2LB1 SBR2LB1 SCC1LB1
Дрожжи низового брожения BFY61 40 мин - - 20 мин
Дрожжи низового брожения BFY70 40 мин - - 20 мин
Дрожжи низового брожения BFY84 40 мин - - 20 мин
Дрожжи низового брожения BFY448 50 мин - - 20 мин
Верхнебродильные дрожжи TFY3 - 40 мин - 20 мин
Верхнебродильные дрожжи TFY23 - 40 мин - 20 мин
Trichosporon cutaneum WY54 - - - -
C. intermedia WY55-1 - - - -
Debaryomyces hansenii WY69 - - - -
P. membranifaciens WY75 - - - -
Rhodotorula graminis WY93 - - - -
D. bruxellensis WY97 - - - -
S. cerevisiae WY101 - 40 мин - 20 мин
S. diastaticus WY126 - 50 мин - 20 мин
Таблица 4
Оценка праймеров с использованием штаммов дрожжей дикого типа, выделенных из большого числа сортов вин (число в каждой клетке таблицы: время реакции, необходимое для проведения амплификации; -: отсутствие амплификации в течение 80 минут)
Винные дрожжи дикого типа LGM1LB1 SCM1LF2LB1 SBR2LB1 SCC1LB1
Z. bailii WLY9 - - - -
S. cerevisiae WLY10 - 40 мин - 20 мин
P. membranifaciens WLY13 - - - -
Lodderomyces elongisporus WLY14 - - - -
Aureobasidium pullulans WLY15 - - - -
Rhodosporidium fluviale WLY16 - - - -
P. anomala WLY17 - - - -
P. guilliermondii WLY18 - - - -

Вышеприведенные результаты показали, что наборы праймеров в соответствии с настоящим изобретением, созданные для различных штаммов дрожжей рода Saccharomyces, могут с высокой точностью определять в качестве детектируемых мишеней дрожжи рода Saccharomyces до вида. Согласно предшествующим сообщениям, используя те же праймеры, у дрожжей были амплифицированы фрагменты генов и затем, используя профиль расщепления рестриктазами, DGGE и т.д., во многих случаях было проанализировано отличие нуклеотидных последовательностей. Используя праймеры в соответствии с настоящим изобретением, однако, можно идентифицировать и определить только 3 вида штаммов дрожжей, относящихся к роду Saccharomyces, подтверждая наличие или отсутствие амплификации генов.

Пример 2: Предел чувствительности способа LAMP

Для анализа эффективности амплификации способа LAMP клетки дрожжей низового брожения (BFY70, Saccharomyces pastorianus), Saccharomyces cerevisiae NBRC10217 и Saccharomyces bayanus NBRC1948, которые были культивированы на чашке Петри с агаровой средой, последовательно разбавляли стерильной водой и затем экстрагировали ДНК вышеупомянутым способом. Экстрагированную ДНК подвергали способу LAMP. В результате, в случае использования способа LAMP, амплификацию наблюдали даже при незначительном количестве клеток, таком как уровень от 102 до 103 КОЕ.

Кроме того, при использовании геномной ДНК, экстрагированной из разбавленного раствора клеток на каждой стадии разведения, время, за которое мутность в реакции LAMP превышала 0,1, определяли как детектируемое время и строили график, исходя из логарифма детектируемого времени каждого праймера и количества образованных колоний. В результате экспоненциальной аппроксимации можно построить аппроксимированный график высокого коэффициента корреляции (R2=0,98-0,99). На фигуре 2 показан аппроксимированный график LGM1LB1. Кроме того, существует связь между пределом чувствительности каждого праймера и коэффициентом корреляции калибровочного графика, как описывается ниже. Показано, что, построив такую калибровочную кривую, можно количественно оценить наличие дрожжей рода Saccharomyces, содержащихся в образце, в интервале от 102 до 107 КОЕ или от 103 до 107 КОЕ.

[Предел чувствительности каждого праймера и коэффициент корреляции калибровочной кривой]

Предел чувствительности Аппроксимированная формула калибровочной кривой Коэффициент корреляции калибровочной кривой (R2)
LGM1LB1 5,2×102 КОЕ у=28179х-2,4039 0,992
SCM1LF2LB1 4,4×103 КОЕ у=6875х-1,8959 0,981
SBR2LB1 1,9×102 КОЕ у=1431,3х-1,8361 0,982

Пример 3: Детекция клеток в вине и пиве

В процессе производства вина, как правило, к фруктовому соку для брожения добавляют значительное количество дрожжей рода Saccharomyces, используемых в качестве винных дрожжей. Количество дрожжевых клеток, которое контаминирует фруктовый сок извне, гораздо меньше, чем количество дрожжей рода Saccharomyces. Таким образом, в вине суспендировали значительное количество Saccharomyces cerevisiae и после этого с ним смешивали разбавленный раствор клеток Saccharomyces bayanus NBRC1948, полученный разведением вином, с последующими сбором и отмывкой клеток. После этого клетки собирали и затем из них экстрагировали ДНК. Используя SBR2LB1 в качестве набора праймеров, осуществляли способ LAMP и, таким образом, анализировали возможность детекции Saccharomyces bayanus. В результате было обнаружено, что независимо от ингибирования реакции вином и присутствия Saccharomyces cerevisiae дрожжи Saccharomyces bayanus могут быть определены практически с тем же пределом чувствительности, что и при суспендировании их в стерильной воде. Кроме того, те же результаты получали даже при суспендировании дрожжей низового брожения в пиве и добавлении туда разбавленного раствора клеток Saccharomyces bayanus.

Предел чувствительности Saccharomyces bayanus
Вино + Saccharomyces cerevisiae (5×107 клеток) 3,9×102 КОЕ
Пиво + дрожжи низового брожения (1×107 клеток) 3,2×102 КОЕ

Пример 4: Оценка праймеров, описанных в патентной публикации

(а) Праймеры, описанные в патентной публикации

Для получения растворов праймеров, используемых в способе LAMP аналогично описанному в примере 1(b), применяли описанные ниже набор праймеров, используемый для детекции рода Saccharomyces (SSC1LB1), и набор праймеров, используемый для детекции дрожжей низового брожения (SBFY1LF1LB1), которые были описаны в патентной публикации Tsuchiya et al. (WO2005/093059). Набор праймеров, используемый для детекции рода Saccharomyces (SSC1LB1), нацелен на область D2 гена рРНК, тогда как набор праймеров, используемый для детекции дрожжей низового брожения (SBFY1LF1LB1), нацелен на ген мелибиазы.

[Набор праймеров, используемый для детекции рода Saccharomyces (SSC1LB1)]

FIP: TGCGAGATTCCCCTACCCCAGACATGGTGTTTTGTGCC (SEQ ID NO: 31)

F3: AGACCGATAGCGAACAAGTA (SEQ ID NO: 32)

BIP: CTGTGGGAATACTGCCAGCTGGCCGTGTTTCAAGACGGGCGG (SEQ ID NO: 33)

В3: CTTGGTCCGTGTTTCAAGAC (SEQ ID NO: 34)

LB: CAAGGATGCTGGCATAATGGTT (SEQ ID NO: 35)

[Набор праймеров, используемый для детекции дрожжей низового брожения (SBFY1LF1LB1)]

FIP: GCAATTGCTCACTGACGTCGCACACCCCTCAAATGGGTTGG (SEQ ID NO: 36)

F3: CCGAGTTACAATGGCCTTGG (SEQ ID NO: 37)

BIP: ACCGCTGACCGGATTTCTGAAAACTAGACCAGCAGTCATCCA (SEQ ID NO: 38)

B3: CCTTGTCTGCAACGAGTGT (SEQ ID NO: 39)

LF: GGCAAATGTGTTCCAATTGTC (SEQ ID NO: 40)

LB: GGACTAAAGGATTTGGGTTACAC (SEQ ID NO: 41)

Согласно изложенному в примерах 1(с) и (d), используя вышеупомянутые наборы праймеров, способом LAMP детектировали большое число штаммов. Результаты представлены на фигурах 3 и 4.

(b) Оценка праймеров

В результате было обнаружено, что SSC1LB1 участвовал в реакции практически со всеми оцениваемыми клеточными штаммами дрожжей рода Saccharomyces и поэтому его нельзя использовать для идентификации дрожжей рода Saccharomyces. Кроме того, SBFY1LF1LB1 участвовал в реакции с Saccharomyces bayanus, а также с дрожжами низового брожения. Такой набор SBFY1LF1LB1 сконструировали на основании гена мелибиазы дрожжей низового брожения. Поскольку в области, используемой при создании набора праймеров, присутствовала нуклеотидная последовательность, гомология которой с геномом Saccharomyces bayanus составляет 96%, полагали, что имела место перекрестная реакция.

Пример 3: Оценка праймеров для проведения ПЦР, используемых для областей хромосомной транслокации Sc-типа-Lg-типа

Как указано выше, хромосома XVI Sc-типа дрожжей низового брожения транслоцировалась при участии хромосомы Lg-типа внутри области от ORF гена GPH1, расположенного в правом плече, до ORF гена QCR2. Хромосома III Lg-типа таких дрожжей низового брожения транслоцировалась при участии хромосомы Sc-типа от локуса МАТ правого плеча до его конца. Кроме того, хромосома VII Lg-типа дрожжей низового брожения транслоцировалась при участии хромосомы Sc-типа от ORF гена КЕМ1 левого плеча до его конца. Праймеры, используемые для способа ПЦР, разрабатывали на основании нуклеотидной последовательности хромосомы Sc-типа и нуклеотидной последовательности хромосомы Lg-типа так, чтобы положения хромосомной транслокации хромосомы III, хромосомы VII и хромосомы XVI дрожжей низового брожения можно было фланкировать с их помощью. Праймеры оценивали, используя большое число видов дрожжей рода Saccharomyces.

В способе ПЦР использовали полимеразу Ex Taq производства фирмы Takara Bio Inc. Ниже приведены нуклеотидные последовательности праймеров, используемых для проведения ПЦР.

[Набор праймеров, используемый для области транслокации хромосомы III (амплифицированный продукт: примерно 3,2 т.н.)]

IIIjunc1 (для хромосомы Lg-типа): TGTTGGGGTGTACTATGGTCTTT (SEQ ID NO: 23)

IIIjunc2 (для хромосомы Sc-типа): ACAAAGAATGATGCTAAGAATTGA (SEQ ID NO: 24)

[Набор праймеров, используемый для области транслокации хромосомы VII (амплифицированный продукт: примерно 350 п.н.)]

VIISL1 (для хромосомы Lg-типа): CGACTCAAACTGTATTACTCC (SEQ ID NO: 25)

VIISL2 (для хромосомы Sc-типа): AATTTTGATGTTCAAGCG (SEQ ID NO: 26)

[Набор праймеров, используемый для области транслокации хромосомы XVI (амплифицированный продукт: XVISL1-2 примерно 720 п.н.; XVISL3-4 примерно 630 п.н.)]

XVISL1 (для хромосомы Lg-типа): CGACAGAGTTGACCAGTTTG (SEQ ID NO: 27)

XVISL2 (для хромосомы Sc-типа): GTTCTTCTTGCAAGATGTGG (SEQ ID NO: 28)

XVISL3 (для хромосомы Lg-типа): CCTTGGCAGATGTGTTGTAT (SEQ ID NO: 29)

XVISL4 (для хромосомы Sc-типа): CTTGCCCTTCTTCAAATCCG (SEQ ID NO: 30)

Эти реагенты смешивали друг с другом согласно инструкции по применению полимеразы Ex Taq производства фирмы Takara Bio Inc. (общее количество: 15 мкл), и смесь затем помещали в термоциклер. Температурную программу: 94°C-30 секунд, 55°C-30 секунд и 72°C-1 минута (в случае праймера, используемого для области транслокации хромосомы III, 72°C-2 минуты) повторяли 30 раз, чтобы осуществить реакцию ПЦР. В результате обнаружили полосу с предполагаемой молекулярной массой при использовании каждого набора праймеров для проведения ПЦР в отношении дрожжей низового брожения. В таблице 5 показано наличие или отсутствие продукта амплификации.

Таблица 5
Оценка праймеров с использованием большого числа видов штаммов дрожжей рода Saccharomyces (+: наличие амплификации; -: отсутствие амплификации)
IIIjunc1-2 VIISL1-2 XVISL1-2 XVISL3-4
Дрожжи низового брожения BFY70 + + + +
Дрожжи низового брожения BFY84 + + + +
Дрожжи низового брожения BFY85 + + + +
Дрожжи низового брожения W34/70 + + + +
Дрожжи низового брожения BFY427 + + + +
Дрожжи низового брожения BFY253 + + + +
S. cerevisiae S288C - - - -
S. bayanus NBRC11022 - - - -

1. Набор праймеров для проведения LAMP, используемый для детекции Saccharomyces pastorianus, который содержит следующие полинуклеотиды:
полинуклеотид (FIP), имеющий нуклеотидную последовательность SEQ ID NO:1,
полинуклеотид (F3), имеющий нуклеотидную последовательность SEQ ID NO:2,
полинуклеотид (BIP), имеющий нуклеотидную последовательность SEQ ID NO:3, и
полинуклеотид (В3), имеющий нуклеотидную последовательность SEQ ID NO:4.

2. Набор праймеров для проведения LAMP по п.1, который дополнительно содержит полинуклеотид (LB), имеющий нуклеотидную последовательность SEQ ID NO:5.

3. Набор праймеров для проведения ПЦР, используемый для детекции Saccharomyces pastorianus, который содержит следующие полинуклеотиды:
полинуклеотид, имеющий нуклеотидную последовательность SEQ ID NO:25, и
полинуклеотид, имеющий нуклеотидную последовательность SEQ ID NO:26.

4. Набор праймеров для проведения ПЦР, используемый для детекции Saccharomyces pastorianus, который содержит следующие полинуклеотиды:
полинуклеотид, имеющий нуклеотидную последовательность SEQ ID NO:27, и
полинуклеотид, имеющий нуклеотидную последовательность SEQ ID NO:28.

5. Набор праймеров для проведения ПЦР, используемый для детекции Saccharomyces pastorianus, который содержит следующие полинуклеотиды:
полинуклеотид, имеющий нуклеотидную последовательность SEQ ID NO:29, и
полинуклеотид, имеющий нуклеотидную последовательность SEQ ID NO:30.

6. Набор для детекции Saccharomyces pastorianus, который содержит набор праймеров по п.1 или 2 в сочетании с набором праймеров для проведения LAMP, используемый для детекции Saccharomyces bayanus.

7. Набор для детекции по п.6, где набор праймеров для проведения LAMP используется для детекции Saccharomyces bayanus и содержит следующие полинуклеотиды:
полинуклеотид (FIP), имеющий нуклеотидную последовательность SEQ ID NO:13,
полинуклеотид (F3), имеющий нуклеотидную последовательность SEQ ID NO:14,
полинуклеотид (BIP), имеющий нуклеотидную последовательность SEQ ID NO:15, и
полинуклеотид (В3), имеющий нуклеотидную последовательность SEQ ID NO:16.

8. Набор для детекции по п.7, где набор праймеров для проведения LAMP дополнительно содержит полинуклеотид (LB), имеющий нуклеотидную последовательность SEQ ID NO:17, в качестве праймера для проведения LAMP, используемого для детекции Saccharomyces bayanus.

9. Набор для детекции Saccharomyces pastorianus, который содержит набор праймеров для проведения LAMP по п.1 или 2 в сочетании с набором праймеров для проведения LAMP, используемым для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus.

10. Набор для детекции по п.9, в котором набор праймеров для проведения LAMP, используемый для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus, содержит следующие полинуклеотиды:
полинуклеотид (FIP), имеющий нуклеотидную последовательность SEQ ID NO:18,
полинуклеотид (F3), имеющий нуклеотидную последовательность SEQ ID NO:19,
полинуклеотид (BIP), имеющий нуклеотидную последовательность SEQ ID NO:20, и
полинуклеотид (В3), имеющий нуклеотидную последовательность SEQ ID NO:21.

11. Набор для детекции по п.10, который дополнительно содержит полинуклеотид (LB), имеющий нуклеотидную последовательность SEQ ID NO:22, в качестве праймера для проведения LAMP, используемого для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus.

12. Способ детекции Saccharomyces pastorianus, который включает проведение реакции амплификации нуклеиновой кислоты способом LAMP, используя набор праймеров по п.1 или 2.

13. Способ детекции по п.12, который дополнительно включает проведение реакции амплификации нуклеиновой кислоты способом LAMP, используя набор праймеров для проведения LAMP, используемый для детекции Saccharomyces bayanus.

14. Способ детекции по п.13, в котором набор праймеров для проведения LAMP, используемый для детекции Saccharomyces bayanus, содержит следующие полинуклеотиды:
полинуклеотид (FIP), имеющий нуклеотидную последовательность SEQ ID NO:13,
полинуклеотид (F3), имеющий нуклеотидную последовательность SEQ ID NO:14,
полинуклеотид (BIP), имеющий нуклеотидную последовательность SEQ ID NO:15, и
полинуклеотид (В3), имеющий нуклеотидную последовательность SEQ ID NO:16.

15. Способ по п.14, который дополнительно содержит полинуклеотид (LB), имеющий нуклеотидную последовательность SEQ ID NO:17, в качестве праймера для проведения LAMP, используемого для детекции Saccharomyces bayanus.

16. Способ детекции по п.12, который дополнительно включает проведение реакции амплификации нуклеиновой кислоты способом LAMP, используя набор праймеров для проведения LAMP, для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus.

17. Способ детекции по п.16, в котором набор праймеров для проведения LAMP, используемый для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus, содержит следующие полинуклеотиды:
полинуклеотид (FIP), имеющий нуклеотидную последовательность SEQ ID NO:18,
полинуклеотид (F3), имеющий нуклеотидную последовательность SEQ ID NO:19,
полибнуклеотид (BIP), имеющий нуклеотидную последовательность SEQ ID NO:20, и
полинуклеотид (В3), имеющий нуклеотидную последовательность SEQ ID NO:21.

18. Способ детекции по п.17, который дополнительно включает полинуклеотид (LB), имеющий нуклеотидную последовательность SEQ ID NO:22, в качестве праймера для проведения LAMP, используемого для детекции Saccharomyces cerevisiae и Saccharomyces pastorianus.

19. Способ детекции Saccharomyces pastorianus, который включает проведение реакции амплификации нуклеиновой кислоты способом ПЦР, используя набор праймеров для проведения ПЦР по любому из пп.3-5.



 

Похожие патенты:

Изобретение относится к биотехнологии. .

Изобретение относится к области медицины, в частности к области гематологии, онкологии и клинической лабораторной диагностики, кроме того, оно может быть использовано в ветеринарии и биологии.

Изобретение относится к области биотехнологии и медицины. .

Изобретение относится к области биотехнологии и молекулярной генетики. .
Изобретение относится к области биотехнологии и может быть использовано в исследованиях при разработке лекарственных препаратов нового поколения для лечения онкологических, нейродегенеративных и вирусных заболеваний.

Изобретение относится к иммунологии и биотехнологии. .

Изобретение относится к области молекулярной биологии и может быть использовано в медицине при составлении прогноза развития заболевания у пациентов с хроническим лимфолейкозом.

Изобретение относится к области медицины, а именно к молекулярной генетике
Изобретение относится к области биотехнологии, а именно к способу измерения длины теломер клеток лейкоконцентрата пуповинной крови

Изобретение относится к области биотехнологии и вирусологии

Изобретение относится к биотехнологии, к способу введения молекулы пептидной нуклеиновой кислоты (ПНК) в цитозоль или в ядро клетки

Изобретение относится к высокопроизводительному мультиплексному тестированию на микроорганизмы, которые могут присутствовать в биологическом образце, с применением ферментных методов на основе нуклеиновых кислот
Изобретение относится к области медицины и ветеринарии

Изобретение относится к области молекулярной биологии и может быть использовано в диагностических тест-системах различного назначения
Наверх