Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения



Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения
Гетеродимерные полипептиды il-17 a/f и возможности их лечебного применения

 


Владельцы патента RU 2440134:

ДЖЕНЕНТЕК, ИНК. (US)

Группа изобретений относится к медицине, а именно иммунологии, и может быть использована для лечения иммуноопосредованного заболевания у нуждающегося в этом млекопитающего. Для этого вводят эффективное количество одного или более антагонистов, способных ингибировать как IL-17А (SEQ ID NO:3), так и IL-17F (SEQ ID NO:4) в полипептиде IL-17A/F. Изобретения обеспечивают повышенную эффективность лечения иммуноопосредованных заболеваний за счет нового полипептида семейства интерлейкина 17 (IL-17). 6 н. и 19 з.п. ф-лы, 20 ил., 9 табл.

 

Область техники, к которой относится изобретение

Настоящее изобретение в целом относится к идентификации и выделению нового цитокина человека, обозначенного здесь как интерлейкин 17A/F (IL-17A/F).

Уровень техники

Внеклеточные белки играют важную роль, помимо всего прочего, в образовании, дифференцировке и поддержании многоклеточных организмов. Судьба многих индивидуальных клеток, например их пролиферация, миграция, дифференцировка или взаимодействие с другими клетками, обычно определяется информацией, полученной от других клеток и/или ближайшей окружающей среды. Эта информация часто передается секретируемыми полипептидами (например, митогенными факторами, факторами выживания, цитотоксическими факторами, факторами дифференцировки, нейропептидами и гормонами), которые, в свою очередь, воспринимаются и интерпретируются различными клеточными рецепторами или мембраносвязанными белками. Для того чтобы достичь места своего действия во внеклеточном окружении, эти секретируемые полипептиды или сигнальные молекулы обычно проходят через клеточный секреторный путь.

Секретируемые белки имеют различное промышленное применение, включая их использование в качестве фармацевтических препаратов, диагностических средств, биосенсоров и биореакторов. Большинство доступных в настоящее время белковых лекарств, таких как тромболитические средства, интерфероны, интерлейкины, эритропоэтины, колониестимулирующие факторы и разные другие цитокины представляют собой секреторные белки. Их рецепторы, которые относятся к мембранным белкам, также имеют потенциал применения в качестве терапевтических или диагностических средств.

Мембраносвязанные белки и рецепторы могут играть важную роль, помимо прочего, в образовании, дифференцировке и поддержании многоклеточных организмов. Судьба многих индивидуальных клеток, например их пролиферация, миграция, дифференцировка или взаимодействие с другими клетками, обычно определяется информацией, полученной от других клеток и/или ближайшей окружающей среды. Эта информация часто передается секретируемыми полипептидами (например, митогенными факторами, факторами выживания, цитотоксическими факторами, факторами дифференцировки, нейропептидами и гормонами), которые, в свою очередь, воспринимаются и интерпретируются различными клеточными рецепторами или мембраносвязанными белками. Такие мембраносвязанные белки и клеточные рецепторы включают, но не ограничиваясь ими, рецепторы к цитокинам, рецепторные киназы, рецепторные фосфатазы, рецепторы, участвующие в межклеточных взаимодействиях, а также молекулы клеточной адгезии типа селектинов и интегринов. Например, трансдукция сигналов, которые управляют ростом и дифференцировкой клеток, частично регулируется фосфорилированием различных клеточных белков. Белки тирозинкиназы, ферменты, катализирующие этот процесс, могут также действовать как рецепторы к факторам роста. Примеры включают рецептор к фактору роста фибробластов и рецептор к фактору роста нервов.

Мембраносвязанные белки и рецепторные молекулы, подобно секретируемым белкам, имеют различное промышленное применение, включая их использование в качестве фармацевтических и диагностических средств. Например, рецепторные иммуноадгезины можно применять в качестве терапевтических средств для блокады взаимодействий рецепторов с лигандами. Мембраносвязанные белки можно также применять для скрининга потенциальных пептидных или мелкомолекулярных ингибиторов релевантных взаимодействий рецепторов с лигандами.

Как в промышленности, так и в академической науке предпринимаются усилия по идентификации новых, секретируемых естественным образом белков и природных рецепторов или мембраносвязанных белков. Многие усилия сосредоточены на скрининге библиотек рекомбинантных ДНК млекопитающих с целью идентификации кодирующих последовательностей для новых секретируемых белков. В литературе описаны примеры способов и методик скрининга [см., например, Klein et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); патент США № 5536637].

В этом отношении настоящее изобретение относится к идентификации новых секретируемых полипептидов семейства интерлейкина 17 (IL-17), которые по имеющимся данным связаны с иммунообусловленными и воспалительными заболеваниями. Иммунообусловленные и воспалительные заболевания представляют собой проявление или результат довольно сложных биологических путей метаболизма (часто с множеством взаимосвязей), которые в аспекте нормальной физиологии крайне важны для ответа на повреждение или травму, инициируя восстановление после повреждения или травмы, а также создавая врожденную и приобретенную защиту против чужеродных организмов. Заболевание или патология проявляется в той ситуации, когда эти нормальные физиологические пути метаболизма вызывают дополнительное повреждение или травму, которые либо непосредственно связаны с интенсивностью ответа вследствие нарушений его регуляции, либо отражают избыточную стимуляцию в связи с реакцией на собственные факторы, либо представляют собой комбинацию того и другого.

Хотя генез этих заболеваний часто вовлекает многоступенчатые пути метаболизма и часто различные сложно организованные биологические системы/пути, вмешательство в критических точках одного или более таких путей может произвести улучшающий или лечебный эффект. Терапевтическое вмешательство может быть основано либо на антагонизме с вредоносным процессом/метаболическим путем, либо на стимуляции полезного процесса/метаболического пути.

Известны и в значительной степени изучены многие иммунообусловленные заболевания. Такие заболевания включают иммуноопосредованные воспалительные заболевания (такие, как ревматоидный артрит, заболевание почек, гепатобилиарные заболевания, воспалительное заболевание кишечника (IBD), псориаз и астма), воспалительные заболевания, не опосредованные иммунной системой, инфекционные заболевания, иммунодефицитные заболевания, неоплазии и т.д.

Важным компонентом иммунного ответа у млекопитающих являются T-лимфоциты (T-клетки). T-клетки распознают антигены, которые ассоциированы с собственными молекулами, кодируемыми генами главного комплекса гистосовместимости (MHC). Антиген вместе с молекулами MHC может демонстрироваться на поверхности антигенпредставляющих клеток, клеток, инфицированных вирусом, раковых клеток, трансплантатов и т.д. Система T-клеток элиминирует эти измененные клетки, которые представляют угрозу для здоровья организма-хозяина млекопитающего. T-клетки включают хелперные T-клетки и цитотоксические T-клетки. После распознавания комплекса антиген-MHC на антигенпредставляющих клетках хелперные T-клетки сильно пролиферируют. Хелперные T-клетки также секретируют ряд цитокинов, например лимфокины, играющие центральную роль в активации B-клеток, цитотоксических T-клеток и многих других клеток, которые участвуют в иммунном ответе.

Активация и клональная экспансия хелперных T-клеток представляет собой центральное явление как в гуморальном, так и в клеточно-опосредованном иммунном ответе. Активацию хелперных T-клеток инициирует взаимодействие комплекса рецептора T-клеток (TCR) - CD3 со связкой антиген-MHC на поверхности антигенпредставляющей клетки. Это взаимодействие опосредует каскад биохимических событий, который индуцирует находящиеся в состоянии покоя хелперные T-клетки к вхождению в клеточный цикл (превращение G0 в G1) и приводит к экспрессии высокоаффинных рецепторов к IL-2 и иногда к IL-4. Активированные T-клетки продвигаются по циклу пролиферации и дифференцировки в клетки памяти или эффекторные клетки.

В дополнение к сигналам, опосредованным через TCR, активация T-клеток вовлекает добавочную костимуляцию, которую индуцируют цитокины, высвобождаемые антигенпредставляющими клетками, или взаимодействия с мембраносвязанными молекулами на антигенпредставляющих клетках и T-клетках. Было показано, что цитокины IL-1 и IL-6 создают костимулирующий сигнал. К тому же активации T-клеток способствует взаимодействие между молекулой B7, экспрессируемой на поверхности антигенпредставляющих клеток, и молекулами CD28 и CTLA-4, экспрессируемыми на поверхности T-клеток. Активированные T-клетки экспрессируют намного больше молекул клеточной адгезии, таких как ICAM-1, интегрины, VLA-4, LFA-1, CD56 и т.д.

Установленными способами определить, способно ли какое-либо соединение стимулировать иммунную систему, являются пролиферация T-клеток в смешанной культуре лимфоцитов или реакция смешанных лимфоцитов (MLR). При многих разновидностях иммунного ответа в месте повреждения или в очаге инфекции возникает инфильтрат воспалительных клеток. Мигрирующие клетки, как это можно продемонстрировать гистологическим исследованием пораженных тканей, могут представлять собой нейтрофилы, эозинофилы, моноциты или лимфоциты. Current Protocols in Immunology, ed. John E. Coligan, 1994, John Wiley & Sons, Inc.

Связанные с иммунной системой заболевания можно лечить, подавляя иммунный ответ. В лечении иммуноопосредованных и воспалительных заболеваний было бы полезно применять нейтрализующие антитела, которые способны подавлять молекулы, обладающие иммуностимулирующей активностью. Для подавления иммунного ответа, то есть улучшения связанных с иммунитетом заболеваний, можно использовать молекулы, подавляющие иммунный ответ (белки, которые могут действовать прямым образом или через применение агонистов антител).

Интерлейкин 17 (IL-17) представляет собой полученную из T-клеток провоспалительную молекулу, которая стимулирует эпителиальные, эндотелиальные и фибробластные клетки к выработке других воспалительных цитокинов и хемокинов, включая IL-6, IL-8, G-CSF и MCP-1 [см., Yao, Z. et al., J. Immunol., 122(12):5483-5486 (1995); Yao, Z. et al., Immunity, 3(6):811-821 (1995); Fossiez, F., et al., J. Exp. Med., 183(6): 2593-2603 (1996); Kennedy, J., et al., J. Interferon Cytokine Res., 16(8):611-7 (1996); Cai, X. Y., et al., Immunol. Lett, 62(1):51-8 (1998); Jovanovic, D.V., et al., J. Immunol., 160(7):3513-21 (1998); Laan, M., et al., J. Immunol., 162(4):2347-52 (1999); Linden, A., et al., Eur Respir J, 15(5):973-7 (2000); and Aggarwal, S. and Gurney, A.L., J Leukoc Biol, 71(1):1-8 (2002)]. IL-17 также проявляет синергизм с другими цитокинами, включая TNF-α и IL-1β, дополнительно индуцируя экспрессию хемокинов (Chabaud, M., et al., J. Immunol. 161(1):409-14 (1998)). Интерлейкин 17 (IL-17), воздействуя на различные типы клеток, проявляет плейотропную биологическую активность. IL-17 также способен индуцировать поверхностную экспрессию ICAM-1, пролиферацию T-клеток, а также рост клеток-предшественников человека CD34+ и их дифференцировку в нейтрофилы. Было также установлено, что IL-17 вовлечен в костный метаболизм, и высказано предположение о том, что он играет важную роль в патологических состояниях, характеризующихся наличием активированных T-клеток и выработкой TNF-α, например, в ревматоидном артрите и ослаблении костных имплантатов (Van Bezooijen et al., J. Bone Miner. Res., 14: 1513-1521 [1999]). Было обнаружено, что активированные T-клетки синовиальной ткани, полученные от больных с ревматоидным артритом, секретируют большее количество IL-17 по сравнению с такими же клетками, полученными от здоровых лиц или от больных с остеоартритом (Chabaud et al., Arthritis Rheum., 42: 963-970 [1999]). Было высказано предположение о том, что этот провоспалительный цитокин принимает активное участие в синовиальном воспалении при ревматоидном артрите. Помимо этой провоспалительной роли IL-17, по-видимому, дает вклад в патологический процесс при ревматоидном артрите, действуя по другому механизму. Например, было показано, что IL-17 индуцирует экспрессию мРНК фактора дифференцировки остеокластов (ODF) в остеобластах (Kotake et al., J. Clin. Invest., 103: 1345-1352 [1999]). ODF стимулирует дифференцировку клеток-предшественников в остеокласты, клетки, участвующие в резорбции кости. Поскольку в синовиальной жидкости больных с ревматоидным артритом уровень IL-17 значительно повышен, следует полагать, что образование остеокластов, индуцированное IL-17, играет решающую роль в резорбции кости при ревматоидном артрите. Также полагают, что IL-17 играет ключевую роль при некоторых других аутоиммунных заболеваниях, в частности при рассеянном склерозе (Matusevicius et al., Mult. Scler., 5: 101-104 (1999); Kurasawa, K., et al., Arthritis Rheu 43(11):2455-63 (2000)) и псориазе (Teunissen, M.B., et al., J Invest Dermatol 111(4):645-9 (1998); Albanesi, C., et al., J Invest Dermatol 115(1):81-7 (2000); and Homey, B., et al., J. Immunol. 164(12:6621-32 (2000)).

Далее было показано, что IL-17 посредством внутриклеточной передачи сигналов стимулирует приток Ca2+ и снижение [cAMP]i в макрофагах человека (Jovanovic et al., J. Immunol., 160:3513 [1998]). Фибробласты, обработанные IL-17, индуцируют активацию NF-κB, [Yao et al., Immunity, 3:811 (1995), Jovanovic et al., выше], тогда как обработанные им макрофаги активируют NF-κB и митогенно активированные протеинкиназы (Shalom-Barek et al., J. Biol. Chem., 273:27467 [1998]). В дополнение к этому отметим, что IL-17 также имеет сходство последовательности с цитокинподобным фактором 7 млекопитающих, который участвует в росте костей и хряща. Другими белками, с которыми полипептиды IL-17 имеют сходные последовательности, являются эмбриональный фактор человека, связанный с интерлейкином (EDIRF), и интерлейкин 20.

В полном соответствии с широким спектром эффектов IL-17 было обнаружено, что рецептор клеточной поверхности к IL-17 широко экспрессируется во многих типах тканей и клеток (Yao et al., Cytokine, 9:794 [1997]). Хотя аминокислотная последовательность рецептора к IL-17 человека (IL-R) (866 аминокислот) предсказывает белок с единственным трансмембранным доменом и длинным внутриклеточным доменом из 525 аминокислот, последовательность рецептора уникальна и не похожа на последовательность любого рецептора из семейства рецепторов к цитокинам/факторам роста. Это обстоятельство наряду с утратой сходства IL-17 с другими известными белками указывает на то, что IL-17 и его рецептор могут быть частью нового семейства сигнальных белков и рецепторов. Было продемонстрировано, что активность IL-17 опосредована через его связывание с уникальным рецептором на клеточной поверхности (обозначенным здесь как IL-17R человека), в отношении чего предыдущие исследования показали, что контакт T-клеток с растворимой формой рецепторного полипептида IL-17 подавляет пролиферацию T-клеток и выработку IL-2, индуцируемую фитогемагглютинином (PHA), конканаваллином A и моноклональными анти-TCR-антителами (Yao et al., J. Immunol., 155:5483-5486 [1995]). По существу имеется значительный интерес к идентификации и изучению свойств новых полипептидов, обладающих гомологией с известными рецепторами цитокинов, особенно рецепторами к IL-17.

В настоящее время интерлейкин 17 признан как прототип нового семейства цитокинов. Крупномасштабное секвенирование геномов человека и других позвоночных позволило открыть существование дополнительных генов, которые кодируют белки, явно родственные IL-17, что послужило основой для определения нового семейства цитокинов. Существуют по меньшей мере 6 членов семейства IL-17 у человека и мышей, включая IL-17B, IL-17C, IL-17D, IL-17E и IL-17F, а также новых рецепторов IL-17RH1, IL-17RH2, IL-17RH3 и IL-17RH4 (см. документ WO 01/46420, опубликованный 28 июня 2001 г.). Было продемонстрировано, что один из членов семейства IL-17 (обозначенный как IL-17F) связывается с рецептором человека к IL-17 (IL-17R) (Yao et al., Cytokine, 9(11):794-800 (1997)). Первичное изучение характерных свойств позволяет предположить, что, подобно IL-17, некоторые из этих новых молекул способны модулировать иммунную функцию. Мощные воспалительные эффекты, которые были идентифицированы для некоторых из этих факторов, и выясняющиеся ассоциации с крупными заболеваниями человека позволяют предположить, что эти белки могут играть значительную роль в воспалительных процессах и могут создать возможности для лечебных вмешательств.

Ген, кодирующий IL-17F человека, локализован по соседству с IL-17 (Hymowitz, S.G., et al., Embo J, 20(19):5332-41 (2001)). IL-17 и IL-17F идентичны по аминокислотной последовательности на 44%, в то время как другие члены семейства IL-17 имеют меньшую аминокислотную идентичность (15-27%), и это позволяет предположить, что IL-17 и IL-17F образуют особую подгруппу в семействе IL-17 (Starnes, T., et al., J Immunol, 167(8):4137-40 (2001); Aggarwal, S. and Gurney, A.L., J. Leukoc Biol, 71(1):1-8 (2002)). Оказалось, что IL-17F проявляет сходные биологические эффекты с IL-17, будучи способным стимулировать выработку IL-6, IL-8 и G-CSF в широком ряду клеток. Подобно IL-17, он способен индуцировать секрецию хрящевой основы и подавлять синтез новой хрящевой основы (см. документ US 20020177188 A1, опубликованный 28 ноября 2002 г.). Таким образом, подобно IL-17, IL-17F потенциально может давать вклад в патологию воспалительных заболеваний. Недавно эти авторы сделали наблюдение о том, что и IL-17, и IL-17F индуцируются в T-клетках под воздействием интерлейкина 23 (IL-23) (Aggarwal, S., et al., J. Biol. Chem., 278(3):1910-4 (2003)). То наблюдение, что IL-17 и IL-17F имеют сходную хромосомную локализацию и значительное сходство последовательностей, а также тот факт, что IL-17 и IL-17F индуцируются в одной и той же клеточной популяции в ответ на специфические стимулы, привели к идентификации нового цитокина человека, который заключает в себе ковалентный гетеродимер IL-17 и IL-17F (обозначаемый здесь IL-17A/F). IL-17A/F человека представляет собой бесспорно новый цитокин, отличающийся от IL-17 и IL-17F человека, как по белковой структуре, так и по анализам активности на клеточной основе. Использование очищенного рекомбинантного IL-17A/F человека в качестве стандарта позволило разработать специфическую методику ELISA для IL-17A/F человека. С помощью этой специфической методики ELISA была выявлена индуцированная экспрессия IL-17A/F человека, а это подтвердило, что IL-17A/F естественным образом вырабатывается активированными T-клетками человека в культуре. Следовательно, IL-17A/F, несомненно, является новым цитокином, определяемым как естественный продукт выделенных активированных T-клеток человека, причем его рекомбинантная форма была охарактеризована по белковой структуре и по анализам на клеточной основе как иная и отличимая от родственных цитокинов. Таким образом, эти исследования выявляют и идентифицируют новый иммуностимулятор (т.е. IL-17A/F), способный помочь иммунной системе отреагировать на специфический антиген, который до этого не проявлял иммунологической активности. По существу новооткрытый иммуностимулятор имеет важные возможности клинического применения. Следовательно, этот новый цитокин IL-17A/F или его агонисты могли бы найти полезное практическое применение в качестве иммуностимуляторов, в то время как молекулы, подавляющие активность IL-17A/F (антагонисты) по нашим ожиданиям могли бы найти полезное практическое применение в тех случаях, когда желательно подавить иммунный ответ, например при аутоиммунных заболеваниях. В особенности следует отметить, что антитела к этому новому цитокину, которые либо имитируют иммунологическую активность IL-17A/F (агонистические антитела), либо подавляют ее (антагонистические антитела), могли бы обладать лечебными качествами. Потенциальное лечебное применение могли бы найти и мелкие молекулы, способные подавлять активность этого нового цитокина.

Сущность изобретения

A. Варианты реализации изобретения

Настоящее изобретение относится к композициям и способам, полезным для диагностики и лечения заболеваний, связанных с иммунитетом, у млекопитающих, включая человека. Настоящее изобретение основано на идентификации белков (включая агонистические и антагонистические антитела), которые либо стимулируют, либо подавляют иммунный ответ у млекопитающих. Связанные с иммунной системой заболевания можно лечить, подавляя иммунный ответ. Молекулы, которые усиливают иммунный ответ, стимулируют или потенцируют иммунную реакцию на антиген. Молекулы, которые стимулируют иммунный ответ, можно использовать в лечебных целях тогда, когда полезным было бы усиление иммунного ответа. В альтернативном варианте в лечебных целях можно использовать молекулы, которые подавляют, ослабляют или уменьшают иммунный ответ на антиген (например, нейтрализующие антитела), и это целесообразно в тех ситуациях, когда полезно было бы ослабить иммунный ответ (например, при воспалении). В соответствии с этим полипептиды IL-17A/F, предлагаемые настоящим изобретением, а также их агонисты и антагонисты также полезны в изготовлении лекарств и медикаментов, применяемых для лечения связанных с иммунитетом и воспалительных заболеваний. В специфическом аспекте такие лекарства и медикаменты содержат терапевтически эффективное количество полипептида IL-17A/F, его агониста или антагониста в комбинации с фармацевтически приемлемым носителем. Предпочтительно, чтобы компоненты, добавляемые в смесь, были стерильными.

В дальнейшем варианте осуществления изобретения предложен способ идентификации агонистов или антагонистов полипептида IL-17A/F, который заключает в себе контакт полипептида IL-17A/F с молекулой-кандидатом и мониторинг биологической активности, опосредованной указанным полипептидом IL-17A/F. Предпочтительно, чтобы полипептид IL-17A/F представлял собой природную последовательность полипептида IL-17A/F. В специфическом аспекте агонист или антагонист IL-17A/F представляет собой анти-IL-17A/F-антитело.

Еще в одном варианте осуществления изобретение предлагает композицию вещества, содержащую полипептид IL-17A/F, либо агонистическое или антагонистическое антитело к нему, которое связывает полипептид в смеси с носителем или наполнителем. В одном из аспектов композиция содержит терапевтически эффективное количество полипептида или антитела. Еще в одном аспекте, когда композиция содержит иммуностимулирующую молекулу, композиция полезна для: (a) усиления инфильтрации воспалительных клеток в ткань млекопитающего, нуждающегося в этом, (b) стимуляции или усиления иммунного ответа у млекопитающего, нуждающегося в этом, (c) увеличения пролиферации T-лимфоцитов в ответ на антиген у млекопитающего, нуждающегося в этом, (d) стимуляции активности T-лимфоцитов или (e) увеличения проницаемости сосудов. В дальнейшем аспекте, когда композиция содержит иммуноингибиторную молекулу, композиция полезна для: (a) уменьшения инфильтрации воспалительных клеток в ткань млекопитающего, нуждающегося в этом, (b) подавления или уменьшения иммунного ответа у млекопитающего, нуждающегося в этом, (c) снижения активности T-лимфоцитов или (d) уменьшения пролиферации T-лимфоцитов в ответ на антиген у млекопитающего, нуждающегося в этом. Еще в одном аспекте композиция содержит добавочный активный ингредиент, который может быть, например, добавочным антителом, цитотоксическим или химиотерапевтическим средством. Предпочтительно, чтобы композиция была стерильной.

Еще в одном варианте осуществления изобретения предложен способ лечения заболевания, связанного с иммунитетом, у млекопитающего, нуждающегося в этом, причем этот способ заключает в себе введение млекопитающему терапевтически эффективного количества полипептида IL-17A/F, его агониста или антагониста с той же целью. В предпочтительном аспекте заболевание, связанное с иммунитетом, выбирают из группы, состоящей из: системной красной волчанки, ревматоидного артрита, остеоартрита, ювенильного хронического артрита, спондилоартропатий, системной склеродермии, идиопатических воспалительных миопатий, синдрома Шегрена, системного васкулита, саркоидоза, аутоиммунной гемолитической анемии, аутоиммунной тромбоцитопении, тиреоидита, сахарного диабета, иммуноопосредованного почечного заболевания, демиелинизирующих заболеваний центральной и периферической нервной системы, таких как рассеянный склероз, идиопатическая демиелинизирующая полинейропатия или синдром Гийена-Барре и хроническая воспалительная демиелинизирующая полинейропатия, гепатобилиарных заболеваний, таких как инфекционный, аутоиммунный хронический активный гепатит, первичный билиарный цирроз, гранулематозный гепатит и склерозирующий холангит, воспалительного заболевания кишечника, целиакии и болезни Уипла, аутоиммунных или иммуноопосредованных кожных заболеваний, включая буллезные кожные заболевания, экссудативную многоформную эритему и контактный дерматит, псориаз, аллергических заболеваний, таких как астма, аллергический ринит, атопический дерматит, пищевую аллергию и крапивницу, иммунологических заболеваний легких, таких как эозинофильная пневмония, идиопатический легочный фиброз и гиперчувствительный пневмонит, заболеваний, связанных с трансплантацией, включая отторжение трансплантата и болезнь "трансплантат против хозяина".

Еще в одном варианте осуществления изобретение предлагает антитело, которое специфически связывается с любым из описанных выше или ниже полипептидов. По выбору антитело может быть моноклональным антителом, гуманизированным антителом, фрагментом антитела или одноцепочечным антителом. В одном из аспектов настоящее изобретение предлагает выделенное антитело, которое связывается с полипептидом IL-17A/F. Еще в одном аспекте антитело имитирует активность полипептида IL-17A/F (агонистическое антитело) либо, наоборот, антитело подавляет или нейтрализует активность полипептида IL-17A/F (антагонистическое антитело). Еще в одном аспекте антитело представляет собой моноклональное антитело, которое, предпочтительно, имеет остатки гипервариабельного региона (CDR) нечеловеческого происхождения и остатки каркасного региона (FR) человека. Антитело может быть снабжено меткой и может быть иммобилизовано на твердой опоре. Еще в одном аспекте антитело представляет собой фрагмент антитела, моноклональное антитело, одноцепочечное антитело или антиидиотипическое антитело. Еще в одном аспекте фрагмент антитела или одноцепочечное антитело содержит фрагмент Fab, выбранный из группы, которая состоит из аминокислотной последовательности, показанной на фигуре 6 как SEQ ID NO:9, SEQ ID NO:10; SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41 и SEQ ID NO:42, в которой указанный фрагмент Fab дополнительно включает три вариабельных региона тяжелой цепи, содержащих CDR-H1, который состоит из аминокислотных остатков с 7 по 16 из SEQ ID NO:9-42, CDR-H2, который состоит из аминокислотных остатков с 30 по 46 из SEQ ID NO:9-42, и CDR-H3, который состоит из аминокислотных остатков с 78 до по меньшей мере остатка 96 из SEQ ID NO:9-42, причем указанный фрагмент Fab способен связываться с IL-17A/F. Еще в одном аспекте фрагмент антитела или одноцепочечное антитело содержит фрагмент Fab, выбранный из группы, которая состоит из аминокислотной последовательности, показанной на фигуре 6 как SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41 и SEQ ID NO:42, в которой указанный фрагмент Fab дополнительно включает по меньшей мере вариабельный регион тяжелой цепи, содержащий CDR-H1, который состоит из аминокислотных остатков с 7 по 16 из SEQ ID NO:9-42, и CDR-H2, который состоит из аминокислотных остатков с 30 по 46 из SEQ ID NO:9-42, причем указанный фрагмент Fab способен связываться с IL-17A/F. Еще в одном аспекте фрагмент антитела или одноцепочечное антитело содержит фрагмент Fab, выбранный из группы, которая состоит из аминокислотной последовательности, показанной на фигуре 6 как SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41 и SEQ ID NO:42, в которой указанный фрагмент Fab дополнительно включает по меньшей мере вариабельные регионы тяжелой цепи, содержащие CDR-H1, который состоит из аминокислотных остатков с 7 по 16 из SEQ ID NO:9-42 и CDR-H3, который состоит из аминокислотных остатков с 78 до по меньшей мере остатка 96 из SEQ ID NO:9-42, причем указанный фрагмент Fab способен связываться с IL-17A/F. Еще в одном аспекте фрагмент антитела или одноцепочечное антитело содержит фрагмент Fab, выбранный из группы, которая состоит из аминокислотной последовательности, показанной на фигуре 6 как SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41 и SEQ ID NO:42, в которой указанный фрагмент Fab дополнительно содержит по меньшей мере вариабельные регионы тяжелой цепи, содержащие CDR-H2, который состоит из аминокислотных остатков с 30 по 46 из SEQ ID NO:9-42, и CDR-H3, который состоит из аминокислотных остатков с 78 до по меньшей мере остатка 96 из SEQ ID NO:9-42, причем указанный фрагмент Fab способен связываться с IL-17A/F. Еще в одном аспекте фрагмент антитела или одноцепочечное антитело содержит фрагмент Fab, выбранный из группы, которая состоит из аминокислотной последовательности, показанной на фигуре 6 как SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41 и SEQ ID NO:42, в которой указанный фрагмент Fab дополнительно включает по меньшей мере один вариабельный регион тяжелой цепи, содержащий CDR-H1, который состоит из аминокислотных остатков с 7 по 16 из SEQ ID NO:9-42, CDR-H2, который состоит из аминокислотных остатков с 30 по 46 из SEQ ID NO:9-42, или CDR-H3, который состоит из аминокислотных остатков с 78 до по меньшей мере остатка 96 из SEQ ID NO:9-42, причем указанный фрагмент Fab способен связываться с IL-17A/F. Еще в одном аспекте указанный регион CDR-H1 из SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41 или SEQ ID NO:42 содержит по меньшей мере аминокислотные остатки 7-10, соответствующие аминокислотной последовательности GFTI (обозначенной здесь как SEQ ID NO:77), причем указанная SEQ ID NO:77 способна связываться с IL-17A/F. Еще в одном аспекте указанный регион CDR-H2 из SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41 или SEQ ID NO:42 содержит по меньшей мере аминокислотные остатки 41-46, соответствующие аминокислотной последовательности YADSVK (обозначенной здесь как SEQ ID NO:78), причем указанная SEQ ID NO:78 способна связываться с IL-17A/F.

Еще в одном варианте осуществления изобретение предлагает выделенную молекулу нуклеиновой кислоты, выбранную из группы, которая состоит из нуклеотидной последовательности SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75 и SEQ ID NO:76, в которой указанная молекула нуклеиновой кислоты кодирует фрагмент Fab, показанный как SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41 или SEQ ID NO:42, причем указанный фрагмент Fab способен связываться с IL-17A/F.

Еще в одном аспекте изобретение предлагает выделенный фрагмент Fab, способный связываться с IL-17A/F, который кодируется нуклеотидной последовательностью, кодирующей такую аминокислотную последовательность, которая описана здесь выше. Здесь также описаны процессы выработки этих веществ, причем такие процессы включают культивирование клетки-хозяина, содержащей вектор, в котором содержится соответствующая молекула кодирующей нуклеиновой кислоты в условиях, пригодных для экспрессии указанного фрагмента Fab, и извлечение указанного фрагмента Fab из клеточной культуры.

Еще в одном варианте осуществления настоящее изобретение предлагает композицию, содержащую анти-IL-17A/F-антитело в смеси с фармацевтически приемлемым носителем. В одном из аспектов композиция содержит терапевтически эффективное количество антитела. Предпочтительно, чтобы композиция была стерильной. Композицию можно вводить в виде жидкого фармацевтического состава, который можно консервировать для того, чтобы обеспечить стабильность при длительном хранении. В альтернативном варианте антитело может быть моноклональным антителом, фрагментом антитела, гуманизированным антителом или одноцепочечным антителом.

В дальнейшем варианте осуществления изобретение предлагает продукт производства, содержащий:

(a) композицию веществ, содержащую полипептид IL-17A/F или его агонист, антагонист, или антитело, которое специфически связывается с указанным полипептидом,

(b) контейнер, содержащий указанную композицию, и

(c) этикетку, прикрепленную к указанному контейнеру, или упаковочный вкладыш, вложенный в указанный контейнер, где указаны сведения по применению указанного полипептида IL-17A/F, его агониста или антагониста для лечения заболевания, связанного с иммунитетом. Композиция может содержать терапевтически эффективное количество полипептида IL-17A/F или его агониста, или его антагониста.

Еще в одном варианте осуществления настоящее изобретение предлагает способ диагностики заболевания, связанного с иммунитетом, у млекопитающего, причем этот способ включает определение уровня экспрессии гена, кодирующего полипептид IL-17A/F, (a) в испытуемом образце клеток ткани, полученном от млекопитающего, и (b) в контрольном образце заведомо нормальных клеток ткани того же клеточного типа, причем повышенный или пониженный уровень экспрессии в испытуемом образце по сравнению с контрольным образцом указывает на наличие заболевания, связанного с иммунитетом, у млекопитающего, от которого получен испытуемый образец клеток ткани.

Еще в одном варианте осуществления настоящее изобретение предлагает способ диагностики иммунного заболевания у млекопитающего, включающий (a) контакт анти-IL-17A/F-антитела с испытуемым образцом клеток ткани, полученным от млекопитающего, и (b) выявление образования комплекса между антителом и полипептидом IL-17A/F в испытуемом образце, причем образование указанного комплекса свидетельствует о наличии или отсутствии указанного заболевания. Выявление может быть качественным или количественным, и его можно осуществлять, проводя сравнение с мониторингом образования комплекса в контрольном образце заведомо нормальных клеток ткани того же клеточного типа. Большее количество комплексов, образовавшихся в испытуемом образце, свидетельствует о наличии или отсутствии иммунного заболевания у млекопитающего, от которого был получен испытуемый образец клеток ткани. Предпочтительно, чтобы антитело было снабжено поддающейся обнаружению меткой. Образование комплексов можно мониторировать, например, при помощи световой микроскопии, проточной цитометрии, флуорометрии или других методик, известных в данной области техники. Испытуемый образец обычно получают от индивида (особи), у которого подозревается дефицит или аномалия иммунной системы.

Еще в одном варианте осуществления изобретения предложен способ определения наличия полипептида IL-17A/F в образце, который заключается в контакте испытуемого образца клеток, подозрительных на содержание полипептида IL-17A/F, с анти-IL-17A/F-антителом и последующем определении связывания указанного антитела с указанным образцом клеток. В специфическом аспекте образец содержит клетку, подозрительную на наличие полипептида IL-17A/F, а антитело связывается с этой клеткой. Предпочтительно, чтобы антитело было снабжено поддающейся выявлению меткой и/или было фиксировано к твердой опоре.

Еще в одном варианте осуществления настоящее изобретение предлагает диагностический набор для заболевания, связанного с иммунитетом, содержащий анти-IL-17A/F-антитело и носитель в соответствующей упаковке. Предпочтительно, чтобы набор содержал инструкции по применению антитела для выявления наличия полипептида IL-17A/F. Предпочтительно, чтобы носитель был фармацевтически приемлемым.

Еще в одном варианте осуществления настоящее изобретение предлагает диагностический набор, содержащий анти-IL-17A/F-антитело в соответствующей упаковке. Предпочтительно, чтобы набор содержал инструкции по применению антитела для выявления полипептида IL-17A/F.

Еще в одном варианте осуществления настоящее изобретение предлагает способ диагностики связанного с иммунитетом заболевания у млекопитающего, который заключается в определении наличия или отсутствия полипептида IL-17A/F в испытуемом образце клеток ткани, полученном от указанного млекопитающего, причем наличие или отсутствие полипептида IL-17A/F в указанном образце клеток ткани свидетельствует о наличии связанного с иммунитетом заболевания у указанного млекопитающего.

Еще в одном варианте осуществления настоящее изобретение предлагает способ идентификации агониста полипептида IL-17A/F, включающий:

(a) контакт клеток и испытуемого соединения, подлежащего скринингу, в условиях, пригодных для индукции клеточного ответа, который в норме индуцируется полипептидом IL-17A/F, и (b) определение индукции указанного клеточного ответа, чтобы можно было установить, является ли испытуемое соединение эффективным агонистом, причем индукция указанного клеточного ответа свидетельствует о том, что указанное испытуемое соединение является эффективным агонистом.

Еще в одном варианте осуществления изобретения предложен способ идентификации соединения, способного подавлять активность полипептида IL-17A/F, причем этот способ включает контакт соединения-кандидата с полипептидом IL-17A/F в таких условиях и в течение такого времени, которые позволяют этим двум компонентам взаимодействовать друг с другом, а также определение того, подавлена ли активность полипептида IL-17A/F. В специфическом аспекте либо соединение-кандидат, либо полипептид IL-17A/F иммобилизованы на твердой опоре. Еще в одном аспекте неиммобилизованный компонент имеет метку, поддающуюся обнаружению. В предпочтительном аспекте этот способ включает следующие этапы:

(a) контакт клеток и испытуемого соединения, подлежащего скринингу, в присутствии полипептида IL-17A/F и при условиях, способствующих индукции клеточного ответа, который в норме индуцируется полипептидом IL-17A/F, и (b) определение индукции указанного клеточного ответа для установления того, является ли испытуемое соединение эффективным антагонистом.

Еще в одном варианте осуществления изобретения предложен способ идентификации соединения, которое подавляет экспрессию полипептида IL-17A/F в клетках, в норме экспрессирующих полипептид, причем этот способ включает контакт клеток с испытуемым соединением и определение того, подавлена ли экспрессия полипептида IL-17A/F. В предпочтительном аспекте этот способ включает следующие этапы:

(a) контакт клеток и испытуемого соединения, подлежащего скринингу в таких условиях, которые способствуют экспрессии полипептида IL-17A/F, и (b) определение подавления экспрессии указанного полипептида.

Еще в одном варианте осуществления настоящее изобретение предлагает способ лечения связанного с иммунитетом заболевания у млекопитающего, которое страдает этим заболеванием, причем этот способ включает введение млекопитающему молекулы нуклеиновой кислоты, которая кодирует либо (a) полипептид IL-17A/F, (b) агонист полипептида IL-17A/F, либо (c) антагонист полипептида IL-17A/F, причем указанные агонист или антагонист могут представлять собой анти-IL-17A/F-антитело. В предпочтительном варианте осуществления изобретения млекопитающим является человек. Еще в одном предпочтительном варианте осуществления изобретения нуклеиновую кислоту вводят посредством генотерапии ex vivo. В дальнейшем предпочтительном варианте осуществления изобретения нуклеиновая кислота заключена в векторе, более предпочтительно, в аденовирусном, аденоассоциированном вирусном, лентивирусном или ретровирусном векторе.

Еще в одном аспекте изобретение предлагает рекомбинантную вирусную частицу, содержащую вирусный вектор, который, по существу, состоит из промотора, нуклеиновой кислоты, кодирующей (a) полипептид IL-17A/F, (b) полипептид - агонист полипептида IL-17A/F или (c) полипептид - антагонист полипептида IL-17A/F, и сигнальной последовательности для клеточной секреции полипептида, причем вирусный вектор ассоциирован со структурными вирусными белками. Предпочтительно, чтобы сигнальная последовательность имела происхождение от млекопитающего, например от природного полипептида IL-17A/F.

Еще в одном варианте осуществления изобретение предлагает клетку-продуцент ex vivo, содержащую конструкцию нуклеиновой кислоты, которая экспрессирует ретровирусные структурные белки и заключает в себе ретровирусный вектор, по существу, состоящий из промотора, нуклеиновой кислоты, кодирующей (a) полипептид IL-17A/F, (b) полипептид - агонист полипептида IL-17A/F или (c) полипептид - антагонист полипептида IL-17A/F, а также сигнальной последовательности для клеточной секреции полипептида, причем указанная клетка-продуцент упаковывает ретровирусный вектор в молекулярной ассоциации со структурными белками для продуцирования рекомбинантных ретровирусных частиц.

Еще в одном варианте осуществления изобретения предложен способ усиления инфильтрации воспалительных клеток из сосудистой сети в ткань млекопитающего, который заключается во введении указанному млекопитающему (a) полипептида IL-17A/F или (b) агониста полипептида IL-17A/F, в результате чего инфильтрация воспалительных клеток из сосудистой сети млекопитающего усиливается.

Еще в одном варианте осуществления изобретения предложен способ уменьшения инфильтрации воспалительных клеток из сосудистой сети в ткань млекопитающего, который заключается во введении указанному млекопитающему (a) полипептида IL-17A/F или (b) антагониста полипептида IL-17A/F, в результате чего инфильтрация воспалительных клеток из сосудистой сети млекопитающего уменьшается.

Еще в одном варианте осуществления изобретения предложен способ увеличения активности T-лимфоцитов у млекопитающего, который заключается во введении указанному млекопитающему (a) полипептида IL-17A/F или (b) агониста полипептида IL-17A/F, в результате чего активность T-лимфоцитов у млекопитающего увеличивается.

Еще в одном варианте осуществления изобретения предложен способ снижения активности T-лимфоцитов у млекопитающего, который заключается во введении указанному млекопитающему (a) полипептида IL-17A/F или (b) антагониста полипептида IL-17A/F, в результате чего активность T-лимфоцитов у млекопитающего снижается.

Еще в одном варианте осуществления изобретения предложен способ увеличения пролиферации T-лимфоцитов у млекопитающего, который заключается во введении указанному млекопитающему (a) полипептида IL-17A/F или (b) агониста полипептида IL-17A/F, в результате чего пролиферация T-лимфоцитов у млекопитающего увеличивается.

Еще в одном варианте осуществления изобретения предложен способ уменьшения пролиферации T-лимфоцитов у млекопитающего, который заключается во введении указанному млекопитающему (a) полипептида IL-17A/F или (b) антагониста полипептида IL-17A/F, в результате чего пролиферация T-лимфоцитов у млекопитающего уменьшается.

Еще в одном варианте осуществления изобретение относится к применению полипептида IL-17A/F, его агониста или антагониста, как это описано выше, или анти-IL-17A/F-антитела для изготовления медикамента, полезного при лечении патологического состояния, которое поддается лечебному действию полипептида IL-17A/F, его агониста или антагониста (например, анти-IL-17A/F-антитела). В конкретном аспекте изобретение относится к применению полипептида IL-17A/F, его агониста или антагониста в способе лечения дегенеративного хрящевого заболевания.

Еще в одном варианте осуществления изобретение относится к способу лечения дегенеративного хрящевого заболевания у млекопитающего, который заключается во введении указанному млекопитающему, страдающему указанным заболеванием, терапевтически эффективного количества полипептида IL-17A/F, его агониста или антагониста.

Еще в одном варианте реализации изобретение относится к набору, включающему полипептид IL-17A/F, или его агонист, или его антагонист в смеси с фармацевтически приемлемым носителем, контейнер, в котором содержится указанная композиция, и этикетку, прикрепленную к указанному контейнеру, где приведены указания по применению указанной композиции для лечения дегенеративного хрящевого заболевания.

Еще в одном аспекте изобретение предлагает способ лечения заболевания, связанного с иммунитетом, у нуждающегося в этом млекопитающего, причем этот способ заключается во введении млекопитающему терапевтически эффективного количества одного или более антагонистов, способных подавлять как IL-17A (SEQ ID NO:3), так и IL-17F (SEQ ID NO:4) в полипептиде IL-17A/F. В предпочтительном варианте осуществления изобретения млекопитающим является человек.

В одном из вариантов осуществления изобретения этот способ заключается во введении больному антагониста IL-17A и антагониста IL-17F.

Еще в одном варианте осуществления изобретения антагонист IL-17A представляет собой антитело, которое специфически связывается с IL-17A (SEQ ID NO:3) или с его фрагментом.

Еще в одном варианте осуществления изобретения антагонист IL-17F представляет собой антитело, которое специфически связывается с IL-17F (SEQ ID NO:4) или с его фрагментом.

В следующем варианте осуществления изобретения антагонист IL-17A представляет собой антитело, которое специфически связывается с IL-17A (SEQ ID NO:3) или с его фрагментом, а антагонист IL-17F представляет собой антитело, которое специфически связывается с IL-17F (SEQ ID NO:4) или с его фрагментом.

Еще в одном варианте осуществления изобретения антагонист представляет собой антитело, специфически связывающееся как с IL-17A (SEQ ID NO:3), так и с IL-17F (SEQ ID NO:4) в полипептиде IL-17A/F или в его фрагменте.

В другом варианте осуществления изобретения антитело представляет собой перекрестно реагирующее антитело, которое распознает идентичные или сходные эпитопы, представленные как в IL-17A (SEQ ID NO:3), так и в IL-17F (SEQ ID NO:4).

В следующем варианте осуществления изобретения антитело представляет собой биспецифическое антитело, имеющее специфичность по отношению как к IL-17A, так и к IL-17F или к их фрагментам.

Во всех вариантах осуществления изобретения антитело может представлять собой моноклональное антитело, которое может быть химерным, гуманизированным антителом или антителом человека.

Еще в одном варианте осуществления изобретения предложен способ лечения заболевания, связанного с иммунитетом, у нуждающегося в этом млекопитающего, заключающийся в одновременном нацеливании на IL-17A и IL-17F у указанного млекопитающего, причем указанный способ заключается в одновременном введении указанному млекопитающему терапевтически эффективного количества двух разных антител, одно из которых специфически связывается с IL-17A, а другое специфически связывается с IL-17F. Заболевание, связанное с иммунитетом, может представлять собой системную красную волчанку, ревматоидный артрит, остеоартрит, ювенильный хронический артрит, спондилоартропатию, системную склеродермию, идиопатическую воспалительную миопатию, синдром Шегрена, системный васкулит, саркоидоз, аутоиммунную гемолитическую анемию, аутоиммунную тромбоцитопению, тиреоидит, сахарный диабет, иммуноопосредованное почечное заболевание, демиелинизирующее заболевание центральной и периферической нервной системы, идиопатическую демиелинизирующую полинейропатию, синдром Гийена-Барре, хроническую воспалительную демиелинизирующую полинейропатию, гепатобилиарное заболевание, инфекционный или аутоиммунный хронический активный гепатит, первичный билиарный цирроз, гранулематозный гепатит, склерозирующий холангит, воспалительное заболевание кишечника, целиакию, болезнь Уипла, аутоиммунное или иммуноопосредованное кожное заболевание, буллезное кожное заболевание, экссудативную многоформную эритему, контактный дерматит, псориаз, аллергическое заболевание, астму, аллергический ринит, атопический дерматит, пищевую аллергию, крапивницу, иммунологическое заболевание легких, эозинофильную пневмонию, идиопатический легочный фиброз, гиперчувствительный пневмонит, заболевание, связанное с трансплантацией, отторжение трансплантата или болезнь "трансплантат против хозяина".

Еще в одном варианте осуществления изобретения предложен способ лечения заболевания, связанного с иммунитетом, у нуждающегося в этом млекопитающего, заключающийся в одновременном нацеливании на IL-17A и IL-17F у указанного млекопитающего, причем указанный способ заключается во введении указанному млекопитающему терапевтически эффективного количества перекрестно реагирующего антитела, причем указанное антитело распознает идентичные или сходные эпитопы, представленные как в IL-17A, полипептиде, имеющем аминокислотную последовательность SEQ ID NO:3, так и в IL-17F, полипептиде, имеющем аминокислотную последовательность SEQ ID NO:4. Заболевание, связанное с иммунитетом, может представлять собой системную красную волчанку, ревматоидный артрит, остеоартрит, ювенильный хронический артрит, спондилоартропатию, системную склеродермию, идиопатическую воспалительную миопатию, синдром Шегрена, системный васкулит, саркоидоз, аутоиммунную гемолитическую анемию, аутоиммунную тромбоцитопению, тиреоидит, сахарный диабет, иммуноопосредованное почечное заболевание, демиелинизирующее заболевание центральной и периферической нервной системы, идиопатическую демиелинизирующую полинейропатию, синдром Гийена-Барре, хроническую воспалительную демиелинизирующую полинейропатию, гепатобилиарное заболевание, инфекционный или аутоиммунный хронический активный гепатит, первичный билиарный цирроз, гранулематозный гепатит, склерозирующий холангит, воспалительное заболевание кишечника, целиакию, болезнь Уипла, аутоиммунное или иммуноопосредованное кожное заболевание, буллезное кожное заболевание, экссудативную многоформную эритему, контактный дерматит, псориаз, аллергическое заболевание, астму, аллергический ринит, атопический дерматит, пищевую аллергию, крапивницу, иммунологические заболевания легких, эозинофильную пневмонию, идиопатический легочный фиброз, гиперчувствительный пневмонит, заболевание, связанное с трансплантацией, отторжение трансплантата или болезнь "трансплантат против хозяина".

Еще в одном варианте осуществления изобретения предложен способ лечения заболевания, связанного с иммунитетом, у нуждающегося в этом млекопитающего, заключающийся в одновременном нацеливании на IL-17A и IL-17F у указанного млекопитающего, причем указанный способ заключается во введении указанному млекопитающему терапевтически эффективного количества биспецифического антитела, причем указанное антитело состоит из двух ветвей, одна из которых специфически распознает IL-17A, а другая специфически распознает IL-17F. Заболевание, связанное с иммунитетом, может представлять собой системную красную волчанку, ревматоидный артрит, остеоартрит, ювенильный хронический артрит, спондилоартропатию, системную склеродермию, идиопатическую воспалительную миопатию, синдром Шегрена, системный васкулит, саркоидоз, аутоиммунную гемолитическую анемию, аутоиммунную тромбоцитопению, тиреоидит, сахарный диабет, иммуноопосредованное почечное заболевание, демиелинизирующее заболевание центральной и периферической нервной системы, идиопатическую демиелинизирующую полинейропатию, синдром Гийена-Барре, хроническую воспалительную демиелинизирующую полинейропатию, гепатобилиарное заболевание, инфекционный или аутоиммунный хронический активный гепатит, первичный билиарный цирроз, гранулематозный гепатит, склерозирующий холангит, воспалительное заболевание кишечника, целиакию, болезнь Уипла, аутоиммунное или иммуноопосредованное кожное заболевание, буллезное кожное заболевание, экссудативную многоформную эритему, контактный дерматит, псориаз, аллергическое заболевание, астму, аллергический ринит, атопический дерматит, пищевую аллергию, крапивницу, иммунологические заболевания легких, эозинофильную пневмонию, идиопатический легочный фиброз, гиперчувствительный пневмонит, заболевание, связанное с трансплантацией, отторжение трансплантата или болезнь "трансплантат против хозяина".

Еще в одном варианте осуществления изобретения предложен способ лечения заболевания, связанного с иммунитетом, у нуждающегося в этом млекопитающего, заключающийся в одновременном нацеливании на IL-17A и IL-17F у указанного млекопитающего, причем указанный способ заключается во введении указанному млекопитающему терапевтически эффективного количества биспецифического антитела, причем указанное антитело состоит из тяжелой цепи, которая распознает IL-17A, и легкой цепи, которая распознает IL-17F. Заболевание, связанное с иммунитетом, может представлять собой системную красную волчанку, ревматоидный артрит, остеоартрит, ювенильный хронический артрит, спондилоартропатию, системную склеродермию, идиопатическую воспалительную миопатию, синдром Шегрена, системный васкулит, саркоидоз, аутоиммунную гемолитическую анемию, аутоиммунную тромбоцитопению, тиреоидит, сахарный диабет, иммуноопосредованное почечное заболевание, демиелинизирующее заболевание центральной и периферической нервной системы, идиопатическую демиелинизирующую полинейропатию, синдром Гийена-Барре, хроническую воспалительную демиелинизирующую полинейропатию, гепатобилиарное заболевание, инфекционный или аутоиммунный хронический активный гепатит, первичный билиарный цирроз, гранулематозный гепатит, склерозирующий холангит, воспалительное заболевание кишечника, целиакию, болезнь Уипла, аутоиммунное или иммуноопосредованное кожное заболевание, буллезное кожное заболевание, экссудативную многоформную эритему, контактный дерматит, псориаз, аллергическое заболевание, астму, аллергический ринит, атопический дерматит, пищевую аллергию, крапивницу, иммунологическое заболевание легких, эозинофильную пневмонию, идиопатический легочный фиброз, гиперчувствительный пневмонит, заболевание, связанное с трансплантацией, отторжение трансплантата или болезнь "трансплантат против хозяина".

Еще в одном варианте осуществления изобретения предложен способ лечения заболевания, связанного с иммунитетом, у нуждающегося в этом млекопитающего, заключающийся в одновременном нацеливании на IL-17A и IL-17F у указанного млекопитающего, причем указанный способ заключается во введении указанному млекопитающему терапевтически эффективного количества биспецифического антитела, причем указанное антитело состоит из тяжелой цепи, которая распознает IL-17F, и легкой цепи, которая распознает IL-17A. Заболевание, связанное с иммунитетом, может представлять собой системную красную волчанку, ревматоидный артрит, остеоартрит, ювенильный хронический артрит, спондилоартропатию, системную склеродермию, идиопатическую воспалительную миопатию, синдром Шегрена, системный васкулит, саркоидоз, аутоиммунную гемолитическую анемию, аутоиммунную тромбоцитопению, тиреоидит, сахарный диабет, иммуноопосредованное почечное заболевание, демиелинизирующее заболевание центральной и периферической нервной системы, идиопатическую демиелинизирующую полинейропатию, синдром Гийена-Барре, хроническую воспалительную демиелинизирующую полинейропатию, гепатобилиарное заболевание, инфекционный или аутоиммунный хронический активный гепатит, первичный билиарный цирроз, гранулематозный гепатит, склерозирующий холангит, воспалительное заболевание кишечника, целиакию, болезнь Уипла, аутоиммунное или иммуноопосредованное кожное заболевание, буллезное кожное заболевание, экссудативную многоформную эритему, контактный дерматит, псориаз, аллергическое заболевание, астму, аллергический ринит, атопический дерматит, пищевую аллергию, крапивницу, иммунологическое заболевание легких, эозинофильную пневмонию, идиопатический легочный фиброз, гиперчувствительный пневмонит, заболевание, связанное с трансплантацией, отторжение трансплантата или болезнь "трансплантат против хозяина".

B. Дополнительные варианты осуществления изобретения

В других вариантах осуществления настоящее изобретение предлагает молекулу выделенной нуклеиновой кислоты, содержащую нуклеотидную последовательность, которая кодирует полипептид IL-17A/F.

В одном из аспектов молекула выделенной нуклеиновой кислоты содержит нуклеотидную последовательность, имеющую по меньшей мере приблизительно 80% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 81% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 82% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 83% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 84% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 85% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 86% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 87% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 88% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 89% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 90% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 91% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 92% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 93% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 94% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 95% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 96% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 97% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 98% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 99% идентичность последовательности нуклеиновой кислоты (a) с молекулой ДНК, кодирующей полипептид IL-17A/F, который имеет полноразмерную аминокислотную последовательность, как это раскрыто здесь, аминокислотную последовательность с утратой сигнального пептида, как это раскрыто здесь, или любой другой специфически определяемый фрагмент полноразмерной аминокислотной последовательности, как это раскрыто здесь, или (b) с комплементом молекулы ДНК по пункту (a).

В других аспектах молекула выделенной нуклеиновой кислоты содержит нуклеотидную последовательность, имеющую по меньшей мере приблизительно 80% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 81% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 82% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 83% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 84% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 85% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 86% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 87% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 88% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 89% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 90% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 91% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 92% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 93% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 94% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 95% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 96% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 97% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 98% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 99% идентичность последовательности нуклеиновой кислоты (a) с молекулой ДНК, содержащей кодирующую последовательность кДНК полноразмерного полипептида IL-17A/F, как это раскрыто здесь, кодирующую последовательность полипептида IL-17A/F с утратой сигнального пептида, как это раскрыто здесь, или кодирующую последовательность любого другого специфически определяемого фрагмента полноразмерной аминокислотной последовательности, как это раскрыто здесь, или (b) с комплементом молекулы ДНК по пункту (a).

В следующем аспекте изобретение предлагает молекулу выделенной нуклеиновой кислоты, которая содержит нуклеотидную последовательность, имеющую по меньшей мере приблизительно 80% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 81% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 82% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 83% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 84% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 85% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 86% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 87% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 88% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 89% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 90% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 91% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 92% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 93% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 94% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 95% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 96% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 97% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 98% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 99% идентичность последовательности нуклеиновой кислоты (a) с молекулой ДНК, кодирующей тот же самый зрелый полипептид, который кодируется любой из кДНК белков человека, депонированной в ATCC, как это раскрыто здесь, или (b) с комплементом молекулы ДНК по пункту (a).

Еще один вариант осуществления изобретения направлен на фрагменты кодирующей последовательности полипептида IL-17A/F, или на их комплементы, которые могут найти применение, например, в качестве зондов гибридизации для кодирующих фрагментов полипептида IL-17A/F, способных необязательно кодировать полипептид, содержащий сайт связывания для анти-IL-17A/F-антитела или в качестве антисмысловых олигонуклеотидных зондов. Такие фрагменты нуклеиновой кислоты обычно имеют длину по меньшей мере приблизительно 20 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 30 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 40 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 50 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 60 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 70 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 80 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 90 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 100 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 110 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 120 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 130 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 140 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 150 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 160 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 170 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 180 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 190 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 200 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 250 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 300 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 350 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 400 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 450 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 500 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 600 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 700 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 800 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 900 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере приблизительно 1000 нуклеотидов, причем в этом контексте термин "приблизительно" означает, что фактическая длина упоминаемой нуклеотидной последовательности составляет от плюс 10% до минус 10% указанной длины. Отметим, что нуклеотидные последовательности, кодирующие новые фрагменты полипептида IL-17A/F, можно определять обычным способом, выверяя нуклеотидную последовательность, кодирующую полипептид IL-17A/F, в сравнении с другими известными нуклеотидными последовательностями при помощи любой из множества хорошо известных программ для выравнивания последовательностей и определяя, какой фрагмент (фрагменты) нуклеотидной последовательности, кодирующей полипептид, является новым. Все такие нуклеотидные последовательности, кодирующие полипептид, рассматриваются здесь. Также рассматриваются фрагменты полипептида, кодируемые этими нуклеотидными фрагментами молекулы, предпочтительно, такие фрагменты полипептида IL-17A/F, которые содержат сайт связывания для анти-IL-17A/F-антитела.

Еще в одном варианте осуществления изобретение предлагает выделенный полипептид IL-17A/F, кодируемый любой из выделенных последовательностей нуклеиновой кислоты, которые были определены выше.

В определенном аспекте изобретение предлагает выделенный полипептид IL-17A/F, содержащий аминокислотную последовательность, которая имеет по меньшей мере приблизительно 80% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 81% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 82% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 83% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 84% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 85% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 86% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 87% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 88% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 89% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 90% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 91% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 92% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 93% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 94% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 95% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 96% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 97% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 98% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 99% идентичность аминокислотной последовательности с полипептидом IL-17A/F, который имеет полноразмерную аминокислотную последовательность, как это раскрыто здесь, аминокислотную последовательность с утратой сигнального пептида, как это раскрыто здесь, или любой другой специфически определяемый фрагмент полноразмерной аминокислотной последовательности, как это раскрыто здесь.

В следующем аспекте изобретение предлагает выделенный полипептид IL-17A/F, содержащий аминокислотную последовательность, которая имеет по меньшей мере приблизительно 80% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 81% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 82% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 83% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 84% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 85% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 86% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 87% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 88% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 89% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 90% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 91% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 92% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 93% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 94% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 95% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 96% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 97% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 98% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 99% идентичность аминокислотной последовательности с аминокислотную последовательностью, кодируемой любой из кДНК белков человека, депонированной в ATCC, как это раскрыто здесь.

В следующем аспекте изобретение предлагает выделенный полипептид IL-17A/F, содержащий аминокислотную последовательность, которая насчитывает по меньшей мере приблизительно 80% позитивов, в альтернативном варианте по меньшей мере приблизительно 81% позитивов, в альтернативном варианте по меньшей мере приблизительно 82% позитивов, в альтернативном варианте по меньшей мере приблизительно 83% позитивов, в альтернативном варианте по меньшей мере приблизительно 84% позитивов, в альтернативном варианте по меньшей мере приблизительно 85% позитивов, в альтернативном варианте по меньшей мере приблизительно 86% позитивов, в альтернативном варианте по меньшей мере приблизительно 87% позитивов, в альтернативном варианте по меньшей мере приблизительно 88% позитивов, в альтернативном варианте по меньшей мере приблизительно 89% позитивов, в альтернативном варианте по меньшей мере приблизительно 90% позитивов, в альтернативном варианте по меньшей мере приблизительно 91% позитивов, в альтернативном варианте по меньшей мере приблизительно 92% позитивов, в альтернативном варианте по меньшей мере приблизительно 93% позитивов, в альтернативном варианте по меньшей мере приблизительно 94% позитивов, в альтернативном варианте по меньшей мере приблизительно 95% позитивов, в альтернативном варианте по меньшей мере приблизительно 96% позитивов, в альтернативном варианте по меньшей мере приблизительно 97% позитивов, в альтернативном варианте по меньшей мере приблизительно 98% позитивов и в альтернативном варианте по меньшей мере приблизительно 99% позитивов по сравнению с аминокислотной последовательностью полипептида IL-17A/F, имеющего полноразмерную аминокислотную последовательность, как это раскрыто здесь, аминокислотную последовательность с утратой сигнального пептида, как это раскрыто здесь, или любой другой специфически определяемый фрагмент полноразмерной аминокислотной последовательности, как это раскрыто здесь.

В специфическом аспекте изобретение предлагает выделенный полипептид IL-17A/F без N-концевой сигнальной последовательности и/или инициирующего метионина, кодируемый нуклеотидной последовательностью, которая кодирует такую аминокислотную последовательность, как это описано выше. Здесь также описаны процессы выработки этих веществ, причем такие процессы включают культивирование клетки-хозяина, содержащей вектор, в котором содержится соответствующая молекула кодирующей нуклеиновой кислоты в условиях, пригодных для экспрессии полипептида IL-17A/F, и извлечение указанного полипептида IL-17A/F из клеточной культуры.

Еще в одном варианте осуществления изобретение предлагает агонисты и антагонисты природного полипептида IL-17A/F, который был определен здесь. В особом варианте осуществления изобретения агонист или антагонист представляет собой анти-IL-17A/F-антитело или небольшую молекулу.

В дальнейшем варианте осуществления изобретения предложен способ идентификации агонистов или антагонистов полипептида IL-17A/F, который заключает в себе контакт полипептида IL-17A/F с молекулой-кандидатом и мониторинг биологической активности, опосредованной указанным полипептидом IL-17A/F. Предпочтительно, чтобы полипептид IL-17A/F представлял собой природный полипептид IL-17A/F.

Еще в одном варианте осуществления изобретение предлагает композицию или вещество, содержащие полипептид IL-17A/F либо агонист или антагонист полипептида IL-17A/F, как это определено здесь, либо анти-IL-17A/F-антитело в комбинации с носителем. По выбору, носитель представляет собой фармацевтически приемлемый носитель.

Еще один вариант осуществления изобретения направлен на применение полипептида IL-17A/F, его агониста или антагониста, как это описано выше, или анти-IL-17A/F-антитела для изготовления медикамента, полезного при лечении патологического состояния, которое поддается лечебному действию полипептида IL-17A/F, его агониста или антагониста, или анти-IL-17A/F-антитела.

В дополнительных вариантах своего осуществления настоящее изобретение предлагает векторы, содержащие ДНК, которая кодирует любой из описанных здесь полипептидов. Также предлагается клетка-хозяин, содержащая любой подобный вектор. В качестве примера клетки-хозяева могут представлять собой клетки CHO, E. coli, дрожжи или клетки насекомых, инфицированные бакуловирусом. Далее предлагается процесс выработки любого из описанных здесь полипептидов, который включает культивирование клетки-хозяина в таких условиях, которые способствуют экспрессии нужного полипептида, и извлечение нужного полипептида из клеточной культуры.

В других вариантах осуществления изобретение предлагает химерные молекулы, содержащие любой из описанных здесь полипептидов, который объединен с гетерологичным полипептидом или аминокислотной последовательностью. Примеры таких химерных молекул включают любой из описанных здесь полипептидов, объединенный с концевой последовательностью эпитопа или с участком Fc иммуноглобулина.

Еще в одном варианте осуществления изобретение предлагает антитело, которое специфически связывается с любым из описанных выше или ниже полипептидов. По выбору антитело может быть моноклональным антителом, гуманизированным антителом, фрагментом антитела или одноцепочечным антителом.

В других возможных вариантах осуществления изобретение предлагает олигонуклеотидные зонды, полезные для выделения нуклеотидных последовательностей геномной ДНК и кДНК, или антисмысловые зонды, причем эти зонды могут быть получены из любой нуклеотидной последовательности, описанной здесь выше или ниже.

Краткое описание чертежей

На фигуре 1 показаны результаты экспрессии и выделения нового цитокина человека, обозначенного IL-17A/F. Почечные клетки человека линии 293 были трансфицированы векторами экспрессии кДНК, кодирующей IL-17 и IL-17F человека, поодиночке или в комбинации, как это показано на фигуре 1A и фигуре 1B. Кондиционированная среда от трансфицированных клеток была подвергнута иммунопреципитации (IP) с использованием антител, которые способны распознавать IL-17 (дорожки 1-5) или IL-17F (дорожки 6-10), как это показано на фигуре 1A и фигуре 1B. Показан анализ по методике вестерн-блоттинга, демонстрирующий наличие димерного комплекса IL-17A/F в дорожке 8 на фигуре 1A и в дорожке 3 на фигуре 1B. Димерный комплекс IL-17A/F по размеру согласуется с ковалентными гетеродимерными разновидностями, состоящими из одной полипептидной цепи IL-17 и одной полипептидной цепи IL-17F.

На фигуре 2 показана очистка рекомбинантного IL-17A/F. На фигуре 2A приведены результаты окрашивания серебром по методике SDS-PAGE белковых фракций, полученных при первоначальном фракционировании IL-17A/F в колонке с S-сефарозой. Фракции 31 и 32 содержат белок со средним молекулярным весом приблизительно 33 kD, соответствующим IL-17A/F. На фигуре 2B показаны результаты дальнейшей очистки IL-17A/F с применением колоночной хроматографии Vydac C4. Показана хроматограмма элюированных белков при длине волны 214 нм и 280 нм. На фигуре 2C показано, что очищенные белковые фракции IL-17A/F из очистительной колонки Vydac C4 индуцируют выработку IL-8 в клетках TK-10.

На фигуре 3 приведены результаты анализа аминокислотной последовательности IL-17A/F. На фигуре 3A показан нередуцирующий анализ очищенного IL-17A/F по методике SDS-PAGE. Разрешенный белок был перенесен на мембрану PVDF и окрашен белковым красителем кумасси голубым. Справа показаны положения маркеров молекулярного веса. На фигуре 3B приведены результаты анализа N-концевой последовательности выделенного IL-17A/F (аминокислотных остатков, определяемых в результате секвенирования N-концевой последовательности полосы, показанной на фигуре 3A). Секвенирование показало наличие двух N-концевых последовательностей (последовательность 1 обозначена SEQ ID NO:1, а последовательность 2 обозначена SEQ ID NO:2 соответственно). На фигуре 3C показана аминокислотная последовательность IL-17 человека (показанная на фигурах 3C и 8 и обозначенная SEQ ID NO:3), а также аминокислотная последовательность IL-17F человека (показанная на фигурах 3C и 10 и обозначенная SEQ ID NO:4). Сигнальные последовательности IL-17 и IL-17F подчеркнуты. Последовательности, обладающие идентичностью по двум N-концевым пептидным последовательностям (SEQ ID NO:1 и SEQ ID NO:2) и представленные в IL-17A/F, выделены жирным шрифтом в показанных полипептидных последовательностях IL-17 и IL-17F.

На фигуре 4 приведен масс-спектрометрический анализ IL-17A/F. Фигура 4A представляет собой схематическое отображение аминокислотной последовательности с межцепочечными и внутрицепочечными дисульфидными связями в зрелом гетеродимере IL-17A/F (SEQ ID NO:77). Цистеины, вовлеченные в дисульфидные связи, показаны маркером (•) и порядковым номером остатка. Дисульфидные связи показаны черными линиями, соединяющими связанные цистеины. Те дисульфидные связи, которые образуют межцепочечные дисульфидные мостики, выделены жирными черными линиями. На фигуре 4B показаны схематические фрагменты пептида IL-17A/F #1 и #2, содержащие дисульфидные связи между цепью IL-17 и цепью IL-17F, которые, как можно ожидать, будут возникать при расщеплении IL-17A/F трипсином [фрагмент #1 дисульфидной связи IL-17A/F обозначен SEQ ID NO:7, а фрагмент #2 дисульфидной связи IL-17A/F обозначен IL-17A/F SEQ ID NO:8 соответственно]. Аминокислоты, содержащиеся в этих фрагментах, показаны и пронумерованы относительно начального метионина в каждой цепочке. Также указана расчетная приблизительная молекулярная масса тех фрагментов, которые, как можно ожидать, будут наблюдаться при масс-спектрометрии. На фигуре 4C приведена пептидная карта IL-17A/F, полученная по методике времяпролетной масс-спектрометрии с лазерной ионизацией и десорбцией из жидкой матрицы (MALDI-TOF). Результирующая пептидная карта содержит пики с [M+H]+ = 2420,12 Da и 3410,60 Da, соответствующие пептидам с дисульфидными связями. На фигуре 4D дополнительно охарактеризованы свойства нередуцированных образцов IL-17A/F при анализе по методике жидкостной хроматографии и масс-спектрометрии с ионизацией электрораспылением и ионной ловушкой (LC-ESI-MS). Ионные хроматограммы представляют (сверху вниз) тотальную ионную хроматограмму, реконструированную ионную хроматограмму (RIC) дисульфидно связанного фрагмента IL-17A/F #2 [M+2H]2+ и дисульфидно связанного фрагмента IL-17A/F #1 [M+2H]3+. Пики соответствуют обоим гетеродимерам, наблюдавшимся несмотря на то, что при ожидаемых массах для гомодимерных пептидов не наблюдалось никаких пиков, превышавших фоновый химический шум.

На фигуре 5A показаны кривые дозовой зависимости эффекта при сравнении провоспалительной реакции, индуцированной IL-17A/F, IL-17 и IL-17F. IL-17A/F, IL-17 и IL-17F инкубировали с клетками TK-10 в номинальных концентрациях в течение 24 часов. Было показано, что IL-17A/F обладает мощной активностью по индукции IL-8, причем достаточная активность наблюдалась при субнормальных концентрациях. На фигуре 5B показаны кривые дозовой зависимости эффекта при сравнении индукции IL-6, вызываемой IL-17A/F, IL-17 и IL-17F. IL-17A/F, IL-17 и IL-17F инкубировали с клетками TK-10 в номинальных концентрациях в течение 24 часов. Кондиционированную среду из-под TK-10 собирали и анализировали методом IL-6 ELISA.

На фигуре 6 приведена аминокислотная последовательность участка вариабельного региона тяжелой цепи, содержащего CDR H1-H3 из Fab, который связывается с IL-17A/F. Показано выравнивание области предсказанной аминокислотной последовательности тридцати четырех (34) клонов (от SEQ ID NO:9 до SEQ ID NO:42 соответственно), которые кодируют отдельные последовательности тяжелой цепи антитела, способные связываться с IL-17A/F. Три участка CDR тяжелой цепи (CDR-H1, CDR-H2, CDR-H3) затенены.

На фигуре 7 показана нуклеотидная последовательность (SEQ ID NO:5) природной последовательности кДНК IL-17.

На фигуре 8 показана аминокислотная последовательность (SEQ ID NO:3), производная от кодирующей последовательности SEQ ID NO:5, показанной на фигуре 7.

На фигуре 9 показана нуклеотидная последовательность (SEQ ID NO:6) природной последовательности кДНК IL-17F.

На фигуре 10 показана аминокислотная последовательность (SEQ ID NO:4), производная от кодирующей последовательности SEQ ID NO:6, показанной на фигуре 9.

На фигуре 11 показаны измерения по методике ELISA для IL-17A/F, полученного из T-клеток человека, активированных анти-CD3/анти-CD28-антителами.

На фигуре 12 показана специфичность ELISA для IL-17A/F, где было показано, что три параллельно анализируемые фракции #31-#33 содержат примерно одинаковое количество IL-17A/F (IL-17A и IL-17F были использованы в качестве контроля).

На фигуре 13 показан повышенный уровень выработки как IL-17A, так и IL-17F при индукции T-клеток под действием IL-6 и TGFβ.

На фигуре 14 изображено семейство цитокинов IL-17 и сложная картина перекрывающихся специфичностей рецептор-лиганд. В направлении слева направо на фигуре 14 показано, что лиганд IL-17 связывается с рецептором IL-17 (IL-17R, обозначенным здесь как PRO1), лиганд IL-17B (PRO1031) связывается с рецептором IL-17RH1 (PRO5801), лиганд IL-17E (PRO10272) связывается с рецептором IL-17RH1 (PRO5801), лиганд IL-17F (PRO20110) связывается как с рецептором IL-17 (IL-17R, обозначенным здесь как PRO1), так и с рецептором IL-17RH2 (PRO20040), лиганд IL-17C (PRO1122) и лиганд IL-17D (PRO21175) не взаимодействуют с рецепторами IL-17R, IL-17RH1 или IL-17RH2.

На фигуре 15 показана структура IL-17F. На фигуре 15A показана ленточная траектория мономера IL-17F. Нити маркированы. Дисульфиды показаны как шаростержневые изображения с атомами серы, окрашенными в желтый цвет. Приблизительные положения добавочных цистеинов показаны оранжевыми шариками. Врезка показывает схематически упрощенное изображение канонического узла. На фигуре 15B показана ленточная траектория димера IL-17F красным и синим цветом. Дисульфиды показаны так же, как и на фигуре 15A. На фигуре 15C показана структура NGF из комплекса NGF-TrkA (Weismann et al., Nature 401:184-188 (1999)). Беспорядочная петля соединяет нити 2 и 3.

На фигуре 16 показано выравнивание последовательности IL-17F с другими членами семейства IL-17. Регионы идентичности и консервативные последовательности между IL-17 и IL-17F выделены зеленым и желтым цветом соответственно. Если другие члены семейства также имеют в этих регионах консервативные или идентичные остатки, они окрашены аналогичным образом. Цистеиновые остатки показаны оранжевым цветом. Консервативные серины, замещающие цистеины канонического узла, выделены белыми буквами. Дисульфидные мостики, которые ожидаются как консервативные во всех IL-17, показаны черной линией, соединяющей связанные цистины. Два цистина, образующих внутрицепочечный дисульфид в IL-17F, маркированы звездочкой. Вторичные структурные элементы в IL-17F показаны выше последовательностей синими стрелками (β-нити) или цилиндрами (α-спираль). Нумерация остатков дается от начала зрелых последовательностей.

На фигуре 17 приведена сравнительная молекулярная структура IL-17F (PRO20110) и IL-17. Две ортогональные проекции, "боковая" (A) и "передняя" (B) молекулярной поверхности IL-17F, окрашены в соответствии с консерватизмом последовательности между IL-17 и IL-17F, как это показано на фигуре 16. Поверхность остатков, идентичных между двумя белками, окрашена в зеленый цвет, гомологичные остатки окрашены в желтый цвет, тогда как существенно различающиеся остатки окрашены в белый цвет. Проекция в части (B) расположена с поворотом приблизительно на 15° относительно проекции на фигуре 15B). Остатки, формирующие полость, помечены. Фигура 17C представляет собой вид "в разрезе" поверхности на фигуре 17B, демонстрирующий, насколько глубоко большие полости на обеих сторонах IL-17F проникают в тело димера.

На фигурах 18 показано сравнение поверхности IL-17F и TrkA-связывающего сайта NGF. На фигурах 18A и 18B показана молекулярная структура IL-17F, ориентированная так же, как и на фигуре 17. Окраска IL-17F дана в соответствии с электростатическим потенциалом поверхности: красный, -5 kT, белый, 0 kT и синий, +5 kT. Положения полостей показаны кружками. На фигуре 18C показана молекулярная структура NGF в той же ориентации, что и для IL-17F на панели (B); домен 5 TrkA показан как зеленая лента (Weismann et al., Nature 401:184-188 (1999); pdb code 1WWW).

На фигурах 19 и 20 показана эффективность анти-IL-17A/F-антител на мышиной модели артрита, индуцированного коллагеном (CIA).

Подробное описание предпочтительных вариантов осуществления изобретения

I. Определения

Понятие "полипептид IL-17A/F с природной последовательностью" включает в себя полипептид, имеющий такую же аминокислотную последовательность, что и соответствующий природный полипептид IL-17A/F. Такие полипептиды IL-17A/F с природной последовательностью могут быть выделены из природы либо произведены рекомбинантными или синтетическими средствами. Термин "полипептид IL-17A/F с природной последовательностью" специфически охватывает встречающиеся в природе усеченные или секретируемые формы специфического полипептида IL-17A/F (например, последовательность внеклеточного домена), встречающиеся в природе вариантные формы (например, варианты альтернативного сплайсинга) и встречающиеся в природе аллельные варианты пептида. В различных вариантах осуществления изобретения раскрытые здесь полипептиды IL-17A/F с природной последовательностью представляют собой зрелые или полноразмерные природные последовательности полипептида, содержащие полноразмерные аминокислотные последовательности, показанные на сопроводительных фигурах. Стартовые кодоны и стоп-кодоны показаны на фигурах полужирным шрифтом и подчеркнуты. Однако, хотя раскрытые в сопроводительных фигурах полипептиды IL-17A/F показаны начинающимися с метиониновых остатков, обозначенных здесь на фигурах как аминокислотное положение 1, возможно, и вполне вероятно, что другие метиониновые остатки, расположенные на фигурах или выше, или ниже аминокислотного положения 1, могут использоваться как стартовые аминокислотные остатки для полипептидов IL-17A/F.

Приблизительное расположение "сигнальных пептидов" в раскрытых здесь различных полипептидах IL-17A/F показано в настоящем описании изобретения и/или сопроводительных фигурах. Однако необходимо отметить, что C-концевой участок сигнального пептида может варьироваться, но, вероятнее всего, не более чем приблизительно по 5 аминокислотам с каждой стороны C-концевого участка сигнального пептида, как это изначально определено здесь, причем C-концевой участок сигнального пептида можно идентифицировать в соответствии с критериями, которые обычно используются в данной области техники для идентификации этого типа элементов в аминокислотной последовательности (например, Nielsen et al., Prot. Eng., 10:1-6 (1997) and von Heinje et al., Nucl. Acids. Res., 14:4683-4690 (1986)). Кроме того, также общепризнано, что в некоторых случаях расщепление сигнальной последовательности секретируемого полипептида не вполне однородно, что приводит к появлению более чем одной секретируемой разновидности. В настоящем изобретении рассматриваются те зрелые полипептиды, в которых сигнальный пептид расщеплен в пределах не более чем приблизительно 5 аминокислот с любой стороны C-концевого участка сигнального пептида, как это определено здесь, а также кодирующие их полипептиды.

Терминологическое определение "вариант полипептида IL-17A/F" означает активный полипептид IL-17A/F в соответствии с определениями, данными выше или ниже, имеющий идентичность аминокислотной последовательности по меньшей мере приблизительно 80% с полноразмерной природной последовательностью полипептида IL-17A/F, как это раскрыто здесь, с полипептидом IL-17A/F, утратившим сигнальный пептид, как это раскрыто здесь, или с любым другим фрагментом полноразмерной последовательности полипептида IL-17A/F, как это раскрыто здесь. Такие варианты полипептида IL-17A/F включают, например, полипептиды IL-17A/F, в которых на C-конце полноразмерной природной аминокислотной последовательности добавлены или делетированы один или несколько аминокислотных остатков. Обычно вариант полипептида IL-17A/F имеет по меньшей мере приблизительно 80% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 81% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 82% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 83% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 84% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 85% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 86% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 87% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 88% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 89% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 90% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 91% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 92% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 93% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 94% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 95% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 96% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 97% идентичность аминокислотной последовательности, в альтернативном варианте приблизительно 98% идентичность аминокислотной последовательности и в альтернативном варианте приблизительно 99% идентичность аминокислотной последовательности с полноразмерной природной последовательностью полипептида IL-17A/F, как это раскрыто здесь, с аминокислотной последовательностью, в которой утрачен сигнальный пептид, как это раскрыто здесь, или с любым другим специфически определяемым фрагментом полноразмерной аминокислотной последовательности, как это раскрыто здесь. Обычно вариантные полипептиды IL-17A/F имеют длину по меньшей мере 10 аминокислот, в альтернативном варианте имеют длину по меньшей мере 20 аминокислот, в альтернативном варианте имеют длину по меньшей мере 30 аминокислот, в альтернативном варианте имеют длину по меньшей мере 40 аминокислот, в альтернативном варианте имеют длину по меньшей мере 50 аминокислот, в альтернативном варианте имеют длину по меньшей мере 60 аминокислот, в альтернативном варианте имеют длину по меньшей мере 70 аминокислот, в альтернативном варианте имеют длину по меньшей мере 80 аминокислот, в альтернативном варианте имеют длину по меньшей мере 90 аминокислот, в альтернативном варианте имеют длину по меньшей мере 100 аминокислот, в альтернативном варианте имеют длину по меньшей мере 150 аминокислот, в альтернативном варианте имеют длину по меньшей мере 200 аминокислот и в альтернативном варианте имеют длину по меньшей мере 300 аминокислот или более.

"Процентный показатель (%) идентичности аминокислотной последовательности" в отношении идентифицированных здесь последовательностей полипептида IL-17A/F определяется как процентная доля аминокислотных остатков в последовательности-кандидате, которые идентичны аминокислотным остаткам в специфической последовательности полипептида IL-17A/F после выравнивания последовательностей и, при необходимости, введения гэпов для достижения максимальной процентной идентичности последовательностей, не принимая во внимание любые консервативные замещения как часть идентичности последовательностей. Выравнивание с целью определения процентной идентичности аминокислот можно осуществить разными способами, известными компетентному специалисту, например, используя общедоступные компьютерные программы, такие как BLAST, BLAST-2, ALIGN или Megalign (DNASTAR). Компетентные специалисты могут определить соответствующие параметры для измерения выравнивания, включая любые алгоритмы, необходимые для достижения выравнивания по всей длине сравниваемых последовательностей. Однако в тех целях, которые здесь подразумеваются, процентные величины идентичности аминокислотных последовательностей генерируются компьютерной программой ALIGN-2 для сравнения последовательностей, причем полный исходный текст программы ALIGN-2 приводится ниже в таблице 1. Компьютерная программа ALIGN-2 по сравнению последовательностей написана в компании Genentech, Inc., а ее исходный текст, приведенный ниже в таблице 1, был занесен в файл вместе с документацией для пользователей в U.S. Copyright Office, Washington D.C., 20559, где он зарегистрирован (U.S. Copyright Registration № TXU510087). Свободный доступ к программе ALIGN-2 можно получить через компанию Genentech, Inc., South San Francisco, California, либо эту программу можно компилировать самостоятельно по исходному тексту, приведенному ниже в таблице 1. Программу ALIGN-2 рекомендуется компилировать в операционной системе UNIX, предпочтительно, Digital UNIX V4.0D. Все параметры сравнения последовательностей заданы программой ALIGN-2 и не варьируются.

В тех ситуациях, когда для сравнения аминокислотных последовательностей используют программу ALIGN-2, процентный показатель идентичности данной аминокислотной последовательности к, с или по отношению к данной аминокислотной последовательности B (что можно перефразировать так: "Данная аминокислотная последовательность A имеет или содержит определенную процентную идентичность аминокислотной последовательности к, с или по отношению к данной аминокислотной последовательности B) рассчитывают следующим образом:

100-кратное соотношение X/Y,

где X представляет собой число аминокислотных остатков, учтенных как идентичные совпадения программой выравнивания последовательностей ALIGN-2 при выравнивании последовательностей A и B, а Y представляет собой общее число аминокислотных остатков в последовательности B. Надо принимать во внимание, что в тех случаях, когда длина аминокислотной последовательности A не равна длине аминокислотной последовательности B, процентный показатель аминокислотной идентичности A к B не будет равен процентному показателю идентичности B к A. В качестве примеров расчета процентной идентичности аминокислотных последовательностей по этому способу приведенные ниже таблицы 2 и 3 демонстрируют, каким образом проводится расчет процентной идентичности аминокислотной последовательности, обозначенной "Белок сравнения" по сравнению с аминокислотной последовательностью представляющего интерес гипотетического полипептида. Понятие "белок сравнения" представляет аминокислотную последовательность полипептида, по отношению к которому проводят сравнение полипептида, представляющего интерес, а каждый из символов "X, "Y" и "Z" представляет различные гипотетические аминокислотные остатки.

Если специально не указано иное, все процентные величины идентичности аминокислотных последовательностей, которые использованы здесь, получены таким образом, как это описано в ближайших предыдущих абзацах с использованием компьютерной программы ALIGN-2. Однако процентные величины идентичности аминокислотных последовательностей можно также получить, как это описано ниже с использованием компьютерной программы WU-BLAST-2 (Altschul et al., Methods in Enzymology 266:460-480 (1996)). Большинство параметров поиска WU-BLAST-2 заданы как значения по умолчанию. Те параметры, которые не заданы по умолчанию, то есть настраиваемые параметры, задаются следующими величинами: overlap span = 1, overlap fraction = 0,125, word threshold (T) = 11 и scoring matrix = BLOSUM62. Если используют программу WU-BLAST-2, то процентную величину идентичности аминокислотной последовательности рассчитывают делением (a) числа совпадающих идентичных аминокислотных остатков между аминокислотной последовательностью полипептида, представляющего интерес, который имеет производную последовательность от природного полипептида, и представляющей интерес последовательностью сравнения (то есть последовательностью, по отношению к которой проводится сравнение представляющего интерес полипептида, который может представлять собой вариантный полипептид IL-17A/F), как это определяется программой WU-BLAST-2, на (b) общее число аминокислотных остатков в представляющем интерес полипептиде. Например, в формулировке "полипептид, содержащий аминокислотную последовательность A, которая имеет (или имеющая) по меньшей мере 80% идентичность аминокислотной последовательности к аминокислотной последовательности B", аминокислотная последовательность A - это аминокислотная последовательность сравнения "белка сравнения", представляющего интерес, а аминокислотная последовательность B - это аминокислотная последовательность полипептида, представляющего интерес.

Процентный показатель идентичности аминокислотной последовательности можно также определить, используя программу сравнения последовательностей NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)). Программу сравнения последовательностей NCBI-BLAST2 можно загрузить с сайта http://www.ncbi.nlm.nih.gov или получить по запросу из National Institute of Health, Bethesda, MD. Программа NCBI-BLAST2 использует несколько поисковых параметров, причем все эти поисковые параметры задаются величинами по умолчанию, включая, например: unmask = yes, strand = all, expected occurrences = 10, minimum low complexity length = 15/5, multi-pass e-value = 0.01, constant for multi-pass = 25, dropoff for final gapped alignment = 25 и scoring matrix = BLOSUM62.

В тех ситуациях, когда для сравнения аминокислотных последовательностей используют программу NCBI-BLAST2, процентный показатель идентичности данной аминокислотной последовательности к, с или по отношению к данной аминокислотной последовательности B (что можно перефразировать так: "Данная аминокислотная последовательность A имеет или содержит определенную процентную идентичность аминокислотной последовательности к, с или по отношению к данной аминокислотной последовательности B) рассчитывают следующим образом:

100-кратное соотношение X/Y,

где X представляет собой число аминокислотных остатков, учтенных как идентичные совпадения программой выравнивания последовательностей NCBI-BLAST2 при выравнивании последовательностей A и B, а Y представляет собой общее число аминокислотных остатков в последовательности B. Надо принимать во внимание, что в тех случаях, когда длина аминокислотной последовательности A не равна длине аминокислотной последовательности B, процентный показатель аминокислотной идентичности A к B не будет равен процентному показателю идентичности B к A.

Терминологическое определение "вариантный полинуклеотид IL-17A/F" или "вариантная последовательность нуклеиновой кислоты IL-17A/F" означает молекулу нуклеиновой кислоты, которая кодирует активный полипептид IL-17A/F, как это определено ниже, и которая имеет по меньшей мере приблизительно 80% идентичность последовательности нуклеиновой кислоты с последовательностью нуклеиновой кислоты, кодирующей полноразмерную природную последовательность полипептида IL-17A/F, как это раскрыто здесь, полноразмерную природную последовательность полипептида IL-17A/F с утратой сигнального пептида, как это раскрыто здесь, или любой другой фрагмент полноразмерной природной последовательности полипептида IL-17A/, как это раскрыто здесь. Обычно вариантный полинуклеотид IL-17A/F имеет по меньшей мере приблизительно 80% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 81% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 82% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 83% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 84% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 85% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 86% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 87% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 88% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 89% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 90% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 91% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 92% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 93% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 94% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 95% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 96% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 97% идентичность последовательности нуклеиновой кислоты, в альтернативном варианте приблизительно 98% идентичность последовательности нуклеиновой кислоты и в альтернативном варианте приблизительно 99% идентичность последовательности нуклеиновой кислоты с последовательностью нуклеиновой кислоты, кодирующей полноразмерную природную последовательность полипептида IL-17A/F, как это раскрыто здесь, полноразмерную природную последовательность полипептида IL-17A/F, в которой утрачен сигнальный пептид, как это раскрыто здесь, или любой другой фрагмент полноразмерной последовательности полипептида IL-17A/F, как это раскрыто здесь. Варианты не охватывают природную нуклеотидную последовательность.

Обычно вариантные полинуклеотиды IL-17A/F имеют длину по меньшей мере 30 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере 60 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере 90 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере 120 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере 150 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере 180 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере 210 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере 240 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере 270 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере 300 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере 450 нуклеотидов, в альтернативном варианте имеют длину по меньшей мере 600 нуклеотидов и в альтернативном варианте имеют длину по меньшей мере 900 нуклеотидов или более.

"Процентная (%) идентичность последовательности нуклеиновой кислоты" в отношении идентифицированных здесь последовательностей нуклеиновой кислоты, кодирующих IL-17A/F, определяется как процентная доля нуклеотидов в последовательности-кандидате, которые идентичны нуклеотидам в последовательности нуклеиновой кислоты IL-17A/F, представляющей интерес, после выравнивания последовательностей и, при необходимости, введения гэпов для достижения максимальной процентной идентичности последовательностей. Выравнивание с целью определения процентной идентичности нуклеиновых кислот можно осуществить разными способами, известными компетентному специалисту, например, используя общедоступные компьютерные программы, такие как BLAST, BLAST-2, ALIGN или Megalign (DNASTAR). Однако в тех целях, которые подразумеваются здесь, процентные величины идентичности последовательностей нуклеиновых кислот генерируются компьютерной программой ALIGN-2 для сравнения последовательностей, причем полный исходный текст программы ALIGN-2 приводится ниже в таблице 1. Компьютерная программа ALIGN-2 по сравнению последовательностей написана в компании Genentech, Inc., а ее исходный текст, приведенный ниже в таблице 1, был занесен в файл вместе с документацией для пользователей в U.S. Copyright Office, Washington D.C., 20559, где он зарегистрирован (U.S. Copyright Registration № TXU510087). Свободный доступ к программе ALIGN-2 можно получить через компанию Genentech, Inc., South San Francisco, California, либо эту программу можно компилировать самостоятельно по исходному тексту, приведенному ниже в таблице 1. Программу ALIGN-2 рекомендуется компилировать в операционной системе UNIX, предпочтительно, Digital UNIX V4.0D. Все параметры сравнения последовательностей заданы программой ALIGN-2 и не варьируются.

В тех ситуациях, когда для сравнения последовательностей нуклеиновых кислот используют программу ALIGN-2, процентный показатель идентичности данной последовательности нуклеиновой кислоты C к, с или по отношению к данной последовательности нуклеиновой кислоты D (что можно перефразировать так: "Данная последовательность нуклеиновой кислоты C имеет или содержит определенную процентную идентичность последовательности нуклеиновой кислоты к, с или по отношению к данной последовательности нуклеиновой кислоты D) рассчитывают следующим образом:

100-кратное соотношение W/Z,

где W представляет собой число нуклеотидов, учтенных как идентичные совпадения программой выравнивания последовательностей ALIGN-2 при выравнивании последовательностей C и D, а Z представляет собой общее число нуклеотидов в последовательности D. Надо принимать во внимание, что в тех случаях, когда длина последовательности нуклеиновой кислоты C не равна длине последовательности нуклеиновой кислоты D, процентный показатель идентичности последовательности нуклеиновой кислоты C к D не будет равен процентному показателю идентичности последовательности нуклеиновой кислоты D к C. В качестве примеров расчета процентной идентичности последовательностей нуклеиновой кислоты таблицы 4 и 5 демонстрируют, каким образом надо рассчитывать процентную идентичность последовательности нуклеиновой кислоты, обозначенной "ДНК сравнения", к последовательности нуклеиновой кислоты, обозначенной "ДНК-IL-17A/F", причем "ДНК-IL-17A/F" представляет гипотетическую последовательность нуклеиновой кислоты, кодирующую IL-17A/F и представляющую интерес. "ДНК сравнения" представляет нуклеотидную последовательность молекулы нуклеиновой кислоты, по отношению к которой проводится сравнение представляющей интерес "молекулы нуклеиновой кислоты, кодирующей IL-17A/F", а каждый из символов "N", "L" и "V" представляет различные гипотетические нуклеотиды.

Если специально не указано иное, все процентные величины идентичности последовательностей нуклеиновых кислот, которые использованы здесь, получены таким образом, как это описано в ближайших предыдущих абзацах с использованием компьютерной программы ALIGN-2. Однако процентные величины идентичности последовательностей нуклеиновых кислот можно также получить, как это описано ниже, с использованием компьютерной программы WU-BLAST-2 (Altschul et al., Methods in Enzymology 266:460-480 (1996)). Большинство параметров поиска WU-BLAST-2 заданы как значения по умолчанию. Те параметры, которые не заданы по умолчанию, то есть настраиваемые параметры, задаются следующими величинами: overlap span = 1, overlap fraction = 0,125, word threshold (T) = 11 и scoring matrix = BLOSUM62. Если используется программа WU-BLAST-2, то процентную идентичность последовательностей нуклеиновой кислоты определяют посредством деления (a) числа совпадающих идентичных нуклеотидов между последовательностью представляющей интерес нуклеиновой кислоты, которая кодирует полипептид IL-17A/F, причем эта последовательность получена из природной последовательности нуклеиновой кислоты, кодирующей полипептид IL-17A/F и представляющей интерес молекулой нуклеиновой кислоты сравнения (то есть последовательностью, по отношению к которой проводят сравнение представляющей интерес молекулы нуклеиновой кислоты, кодирующей полипептид IL-17A/F, которая может представлять собой вариантный полинуклеотид IL-17A/F), как это определяется программой WU-BLAST-2, на (b) общее число нуклеотидов в представляющей интерес молекуле нуклеиновой кислоты, которая кодирует полипептид IL-17A/F. Например, в формулировке "выделенная молекула нуклеиновой кислоты, содержащая последовательность нуклеиновой кислоты A, которая имеет (или имеющая) по меньшей мере 80% идентичность последовательности нуклеиновой кислоты B", последовательность нуклеиновой кислоты A является последовательностью представляющей интерес сравнительной молекулы нуклеиновой кислоты, а последовательность нуклеиновой кислоты B является последовательностью молекулы представляющей интерес нуклеиновой кислоты, которая кодирует полипептид IL-17A/F.

Процентный показатель идентичности последовательности нуклеиновой кислоты можно также определить, используя программу сравнения последовательностей NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)). Программу сравнения последовательностей NCBI-BLAST2 можно загрузить с сайта http://www.ncbi.nlm.nih.gov или получить по запросу из National Institute of Health, Bethesda, MD. Программа NCBI-BLAST2 использует несколько поисковых параметров, причем все эти поисковые параметры задаются величинами по умолчанию, включая, например: unmask = yes, strand = all, expected occurrences = 10, minimum low complexity length = 15/5, multi-pass e-value = 0.01, constant for multi-pass = 25, dropoff for final gapped alignment = 25 и scoring matrix = BLOSUM62.

В тех ситуациях, когда для сравнения последовательностей нуклеиновых кислот используют программу NCBI-BLAST2-2, процентный показатель идентичности данной последовательности нуклеиновой кислоты C к, с или по отношению к данной последовательности нуклеиновой кислоты D (что можно перефразировать так: "Данная последовательность нуклеиновой кислоты C имеет или содержит определенную процентную идентичность последовательности нуклеиновой кислоты к, с или по отношению к данной последовательности нуклеиновой кислоты D) рассчитывают следующим образом:

100-кратное соотношение W/Z,

где W представляет собой число нуклеотидов, учтенных как идентичные совпадения программой выравнивания последовательностей NCBI-BLAST2 при выравнивании последовательностей C и D, а Z представляет собой общее число нуклеотидов в последовательности D. Надо принимать во внимание, что в тех случаях, когда длина последовательности нуклеиновой кислоты C не равна длине последовательности нуклеиновой кислоты D, процентный показатель идентичности последовательности нуклеиновой кислоты C к D не будет равен процентному показателю идентичности последовательности нуклеиновой кислоты D к C.

В других вариантах осуществления изобретения вариантные полинуклеотиды IL-17A/F представляют собой молекулы нуклеиновой кислоты, которые кодируют активный полипептид IL-17A/F и которые способны гибридизироваться, предпочтительно, в жестких условиях гибридизации и отмывания с нуклеотидной последовательностью, кодирующей полноразмерный полипептид IL-17A/F, как это раскрыто здесь. Вариантные полипептиды IL-17A/F могут кодироваться вариантными полинуклеотидами IL-17A/F.

Термин "выделенный" при его использовании для описания различных полипептидов, раскрытых здесь, означает полипептид, который был идентифицирован и отделен от и/или восстановлен из компонентов, окружающих его в природе. Загрязняющие компоненты природного окружения представляют собой материалы, которые обычно создают помехи при диагностическом или терапевтическом применении полипептида и могут включать ферменты, гормоны, а также другие белковые или небелковые растворенные вещества. В предпочтительных вариантах осуществления изобретения полипептид будет очищен (1) в такой степени, которая достаточна для получения по меньшей мере 15 остатков N-концевой или внутренней аминокислотной последовательности, за счет применения секвенатора с вращающимся стаканом или (2) до достижения гомогенности по методике SDS-PAGE при нередуцирующих или редуцирующих условиях с применением окраски кумасси голубым или, предпочтительно, серебрением. Выделенный полипептид включает полипептид in situ, находящийся в рекомбинантных клетках, когда будет отсутствовать по меньшей мере один компонент природного окружения полипептида IL-17A/F. Однако обычно выделенный полипептид бывает приготовлен с применением по меньшей мере одного этапа очистки.

"Выделенная" нуклеиновая кислота, кодирующая полипептид IL-17A/F, или нуклеиновая кислота, кодирующая другой полипептид, представляет собой молекулу нуклеиновой кислоты, которая идентифицирована и отделена по меньшей мере от одной загрязняющей молекулы нуклеиновой кислоты, с которой она обычно соединена в природном источнике нуклеиновой кислоты, кодирующей полипептид. Выделенная молекула нуклеиновой кислоты, кодирующая полипептид, отличается от той формы или окружающей обстановки, с которыми она встречается в природе. Следовательно, выделенные молекулы нуклеиновой кислоты, кодирующие полипептид, отличаются от специфической молекулы нуклеиновой кислоты, кодирующей полипептид в том виде, в котором она существует в природных клетках. Однако выделенная молекула нуклеиновой кислоты, кодирующая полипептид, включает молекулы нуклеиновой кислоты, кодирующие полипептид, которые содержатся в клетках, обычно экспрессирующих полипептид, где, например, молекула нуклеиновой кислоты имеет другую хромосомную локализацию по сравнению с природными клетками.

Термин "контрольные последовательности" относится к последовательностям ДНК, необходимым для экспрессии функционально связанной с ними кодирующей последовательности в конкретном организме-хозяине. Например, контрольные последовательности, пригодные для прокариот, включают промотор, необязательную последовательность оператора и сайт связывания с рибосомами. Известно, что эукариотические клетки используют промоторы, сигналы полиаденилирования и энхансеры.

Нуклеиновая кислота "функционально связана", когда она находится в функциональной взаимосвязи с другой последовательностью нуклеиновой кислоты. Например, ДНК для предпоследовательности или секреторной лидерной последовательности функционально связана с ДНК, кодирующей полипептид, если она экспрессируется в виде белка-предшественника, который участвует в секреции полипептида; промотор или энхансер функционально связан с кодирующей последовательностью, если он влияет на транскрипцию этой последовательности; сайт связывания рибосом функционально связан с кодирующей последовательностью, если он расположен так, что облегчает трансляцию. В общем, понятие "функционально связанный" означает, что последовательности ДНК сцеплены, прилегая друг к другу, а в случае секреторного лидера прилегают друг к другу и в фазе считывания. Однако энхансеры необязательно должны быть расположены по соседству. Сцепление достигается посредством сшивания в подходящих сайтах рестрикции. Если таких сайтов нет, то в соответствии с общепринятой практикой используются адаптеры или линкеры.

"Строгость" реакций гибридизации достаточно легко поддается определению специалистом с обычным уровнем компетентности в данной области техники, и обычно ее определение основано на эмпирическом расчете (в зависимости от длины зонда, температуры отмывания и концентрации соли). В целом, более длинные зонды требуют повышенной температуры для правильного отжига, тогда как для отжига более коротких зондов нужны пониженные температуры. Гибридизация обычно зависит от способности денатурированной ДНК проходить вторичный отжиг, когда комплементарные нити присутствуют в окружающей среде при температуре ниже точки их плавления. Чем выше степень желательной гомологии между зондом и гибридизируемой последовательностью, тем выше относительная температура, которую можно использовать. В результате из этого следует, что более высокие температуры проявляют тенденцию к тому, чтобы сделать условия реакции более строгими, в то время как пониженные температуры делают их менее строгими. Для получения дополнительных подробностей и разъяснений по поводу строгости реакций гибридизации см. ссылку Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers (1995).

"Жесткие условия" или "условия высокой строгости", как они определяются здесь, можно идентифицировать по следующим признакам: (1) использование низкой ионной силы и высокой температуры для отмывания, например, 0,015 M хлорида натрия/0,0015 M цитрата натрия/0,1% додецилсульфата натрия при 50°C, (2) использование во время гибридизации денатурирующего агента, такого как формамид, например, 50% (объем/объем) формамида с 0,1% альбумином сыворотки крупного рогатого скота/0,1% фиколл/0,1% поливинилпирролидон/50 мМ буфера из фосфата натрия при pH 6,5 с 750 мМ хлорида натрия, 75 цитрата натрия при 42°C, или (3) использование 50% формамида, 5 × SSC (0,75 M NaCl, 0,075 M цитрата натрия), 50 мМ фосфата натрия (pH 6,8), 0,1% пирофосфата натрия, 5 × раствора Денхардта, обработанной ультразвуком ДНК из спермы лосося (50 мкг/мл), 0,1% SDS и 10% декстрансульфата при 42°C, c отмыванием при 42°C в 0,2 × SSC (хлорид натрия/цитрат натрия) и 50% формамиде при 55°C, сопровождающимся отмыванием высокой строгости, состоящим из 0,1 × SSC с содержанием EDTA при 55°C.

"Умеренно жесткие условия" можно идентифицировать, как это описано в ссылке Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989: они включают применение отмывочного раствора и таких условий гибридизации (например, температуры, ионной силы и %SDS), которые отличаются меньшей строгостью по сравнению в описанными выше. Примером умеренно жестких условий являются инкубация в течение ночи при 37°C в растворе, содержащем: 20% формамида, 5 × SSC (150 мМ NaCl, 15 мМ тринатрийцитрата), 50 мМ фосфата натрия (pH 7,6), 5 × раствора Денхардта, 10% декстрансульфата и 20 мг/мл денатурированной ДНК из стриженой спермы лосося с последующим отмыванием фильтров в 1 × SSC приблизительно при 37-50°C. Компетентный специалист поймет, как надо регулировать температуру, ионную силу и т.д., чтобы приспособиться к таким факторам, как длина зонда и т.п.

Термин "меченый эпитопом" при использовании здесь относится к химерному полипептиду, содержащему полипептид IL-17A/F, слитый с "маркировочным полипептидом". Маркировочный полипептид имеет достаточное число остатков, чтобы создать эпитоп, против которого могут вырабатываться антитела, но при этом и достаточно короткий, чтобы не мешать проявлению активности полипептида, с которым он гибридизирован. Маркировочный полипептид, предпочтительно, также достаточно уникален, чтобы антитело не давало существенной перекрестной реакции с другими эпитопами. Подходящие маркировочные полипептиды, как правило, имеют по меньшей мере шесть аминокислотных остатков и обычно приблизительно от 8 до 50 аминокислотных остатков (предпочтительно, приблизительно от 10 до 20 аминокислотных остатков).

При использовании здесь термин "иммуноадгезин" обозначает молекулы типа антител, в которых сочетается специфичность связывания гетерологичного белка ("адгезина") с эффекторными функциями постоянных доменов иммуноглобулина. В структурном аспекте иммуноадгезины содержат гибрид аминокислотной последовательности с желательной специфичностью связывания, которая отличается от распознавания антигена и сайта связывания антитела (то есть "гетерологична"), и последовательности постоянного домена иммуноглобулина. Адгезиновая часть молекулы иммуноадгезина в типичном случае представляет собой непрерывную аминокислотную последовательность, содержащую по меньшей мере сайт связывания рецептора или лиганда. Последовательность постоянного домена иммуноглобулина в иммуноадгезине может быть получена из любого иммуноглобулина, например из подтипов IgG-1, IgG-2, IgG-3 или IgG-4, из IgA (включая IgA-1 и IgA-2), из IgE, IgD или IgM.

Термин "антагонист" используется здесь в самом широком смысле и включает любую молекулу, которая частично или полностью блокирует, подавляет или нейтрализует биологическую активность раскрытого здесь природного полипептида IL-17A/F. Подобным образом, термин "агонист" используется в самом широком смысле и включает любую молекулу, которая имитирует биологическую активность раскрытого здесь природного полипептида IL-17A/F. Подходящие молекулы агонистов или антагонистов включают агонистические или антагонистические антитела или фрагменты антител, фрагменты вариантов аминокислотной последовательности природных полипептидов IL-17A/F, пептиды, антисмысловые олигонуклеотиды, мелкие органические молекулы и т.п. Способы идентификации агонистов или антагонистов полипептида IL-17A/F могут включать контакт полипептида IL-17A/F с молекулой - кандидатом на роль агониста или антагониста и измерение поддающихся выявлению изменений в одной или более биологических активностей, которые в норме присущи полипептиду IL-17A/F.

Термин "лечение" относится как к терапевтическому лечению, так и к профилактическим или превентивным мероприятиям, целью которых является предупреждение или торможение (замедление развития) целевого патологического состояния или заболевания. Субъекты, нуждающиеся в лечении, включают тех, кто уже страдает заболеванием, а также тех, кто предрасположен к развитию заболевания, и тех, у кого необходимо предотвратить заболевание.

Понятие "хроническое" введение относится к введению агента (агентов) в непрерывном режиме, в противоположность острому режиму, что необходимо для поддержания начального лечебного эффекта (активности) на протяжении длительного временного периода. "Перемежающееся" введение лекарства представляет собой такой режим, когда лечение не проводят по непрерывной схеме, а скорее оно является по существу циклическим.

Термин "млекопитающее" в лечебном представлении относится к любому животному, классифицированному как млекопитающее, включая человека, домашних и сельскохозяйственных животных, а также животных зоопарков, спортивных животных, в частности собак, кошек, крупный рогатый скот, лошадей, овец, свиней, коз, кроликов и т.д. В предпочтительном варианте под млекопитающим подразумевается человек.

Введение одного или более добавочных терапевтических агентов "в комбинации с" включает их одновременное (параллельное) или последовательное введение в любом порядке.

Термин "носители" при использовании здесь включает фармацевтически приемлемые носители, наполнители или стабилизаторы, которые в используемых дозах и концентрациях нетоксичны по отношению к клеткам или млекопитающему, вступающим с ними в контакт. Часто физиологически приемлемым носителем является забуференный водный раствор с определенным уровнем pH. Примеры физиологически приемлемых носителей включают такие буферы, как фосфат, цитрат и другие органические кислоты, антиоксиданты, включая аскорбиновую кислоту, полипептиды низкого молекулярного веса (менее 10 аминокислотных остатков), белки, такие как сывороточный альбумин, желатин или иммуноглобулины, гидрофильные полимеры, такие как поливинилпирролидон, аминокислоты, такие как глицин, глутамин, аспарагин, аргинин или лизин, моносахариды, дисахариды и другие углеводы, включая глюкозу, маннозу или декстрины, хелатообразующие агенты, такие как EDTA, сахарные спирты, такие как маннит или сорбит, солеобразующие противоионы, такие как натрий, и/или неионные сурфактанты, такие как TWEEN™, полиэтиленгликоль (PEG) и PLURONICS™.

Термин "антитело" используется здесь в самом широком смысле и специфически охватывает, например, единичные моноклональные анти-IL-17A/F-антитела (включая агонистические, антагонистические и нейтрализующие антитела), композиции анти-IL-17A/F-антитела с полиэпитопными специфичностями (например, биспецифические антитела, настолько длинные, что они проявляют желательную биологическую активность), поликлональные антитела, одноцепочечные анти-IL-17A/F-антитела и фрагменты анти-IL-17A/F-антител (см. ниже below), настолько длинные, что они проявляют желательную биологическую или иммунологическую активность. Термин "иммуноглобулин" (Ig) используется здесь взаимозаменяемо с термином антитело.

"Выделенное антитело" - это такое антитело, которое было идентифицировано и отделено от и/или восстановлено из его природного окружения. Загрязняющие компоненты его природного окружения представляют собой материалы, которые создают помехи при диагностическом или терапевтическом применении антитела и могут включать ферменты, гормоны, а также другие белковые или небелковые растворенные вещества. В предпочтительных вариантах осуществления изобретения антитело будет очищено (1) более чем на 95% по весу антитела, определяемому по методу Лоури, и наиболее предпочтительно, более чем на 99% по весу, (2) в такой степени, которая достаточна для получения по меньшей мере 15 остатков N-концевой или внутренней аминокислотной последовательности за счет применения секвенатора с вращающимся стаканом, или (3) до гомогенности по методике SDS-PAGE в редуцирующих или нередуцирующих условиях с окрашиванием кумасси голубым или, предпочтительно, серебрением. Выделенное антитело включает антитело in situ, находящееся в рекомбинантных клетках, поскольку в этом случае будет отсутствовать по меньшей мере один компонент природного окружения полипептида IL-17A/F. Однако обычно выделенное антитело бывает приготовлено с применением по меньшей мере одного этапа очистки.

Основной 4-цепочечный блок антитела представляет собой гетеротетрамерный белок, состоящий из двух идентичных легких (L) цепей и двух идентичных тяжелых (H) цепей (антитело IgM состоит из 5 основных гетеротетрамерных блоков наряду с дополнительным полипептидом, называемым J-цепью, и, следовательно, содержит антигенсвязывающих сайтов, тогда как секретируемые антитела IgA могут полимеризироваться, образуя поливалентные агрегаты, в составе которых имеется 2-5 основных 4-цепочечных блоков наряду с J-цепью). В случае иммуноглобулинов IgG 4-цепочечный блок обычно имеет молекулярную массу приблизительно 150000 дальтон. Каждая L-цепь соединена с H-цепью одной ковалентной дисульфидной связью, тогда как две H-цепи соединены друг с другом одной или более дисульфидных связей в зависимости от изотипа H-цепи. Каждая H- и L-цепь также имеет регулярно расположенные на определенном расстоянии друг от друга внутрицепочечные дисульфидные мостики. Каждая H-цепь имеет на N-конце вариабельный домен (VH), сопровождающийся тремя постоянными доменами (CH) для каждой α- и γ-цепей и четырьмя CH-доменами для изотипов μ и ε. Каждая L-цепь имеет на N-конце вариабельный домен (VL), сопровождающийся на ее другом конце постоянным доменом (CL). Домен VL смыкается с VH, а домен CL смыкается с первым постоянным доменом тяжелой цепи (CH 1). Полагают, что стык между вариабельными доменами легкой цепи и тяжелой цепи образуют специфические аминокислотные остатки. Спаривание VH и VL формирует одиночный антигенсвязывающий сайт. Дополнительные сведения о структуре и свойствах различных классов антител см., например, в ссылке Basic and Clinical Immunology, 8th edition, Daniel P. Stites, Abba I. Terr and Tristram G. Parslow (eds.), Appleton & Lange, Norwalk, CT, 1994, страница 71 и глава 6.

Цепь L от любого биологического вида позвоночных может быть приписана к одному из двух четко различающихся типов, называемых каппа и лямбда, основываясь на аминокислотных последовательностях их постоянных доменов. Иммуноглобулины могут быть приписаны к различным классам или изотипам в соответствии с аминокислотной последовательностью постоянного домена их тяжелых цепей (CH). Существуют пять классов иммуноглобулинов: IgA, IgD, IgE, IgG и IgM, тяжелые цепи которых обозначаются α, δ, ε, γ и μ соответственно. Классы γ и α далее подразделяются на подклассы на основе относительно малых различий в последовательности и функции CH, например человек экспрессирует следующие подклассы: IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2.

Термин "вариабельный" относится к тому факту, что некоторые сегменты вариабельных доменов в значительной степени различаются по последовательности в массиве антител. Домен V опосредует связывание антигена и определяет специфичность конкретного антитела к его конкретному антигену. Однако вариабельность неравномерно распределена по участку вариабельных доменов протяженностью 110 аминокислот. Вместо этого V-регионы состоят из относительно неизменных отрезков, называемых каркасными регионами (FR), длиной по 15-30 аминокислот, разделенных более короткими участками с предельно выраженной вариабельностью, называемых "гипервариабельными регионами", длина каждого из которых составляет 9-12 аминокислот. Каждый из вариабельных доменов природных тяжелых и легких цепей содержит четыре FR, в значительной степени принимающих конфигурацию β-листка, которые соединены тремя гипервариабельными регионами, образующими петлевое соединение, а в некоторых случаях становящихся частью структуры β-листка. Гипервариабельные регионы каждой цепи удерживаются вместе в непосредственной близости посредством FR и совместно с гипервариабельными регионами другой цепи дают вклад в образование антигенсвязывающего сайта антител (см. Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)). Постоянные домены не вовлечены непосредственно в связывание антитела с антигеном, но проявляют различные эффекторные функции, такие как участие антитела в антителозависимой клеточноопосредованной цитотоксичности (ADCC).

Термин "гипервариабельный регион" при использовании здесь относится к аминокислотным остаткам антитела, которые отвечают за связывание с антигеном. Гипервариабельный регион обычно содержит аминокислотные остатки из "региона, определяющего комплементарность" или "CDR" (например, приблизительно остатки 24-34 (L1), 50-56 (L2) и 89-97 (L3) в VL, и приблизительно 1-35 (H1), 50-65 (H2) и 95-102 (H3) в VH; Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)) и/или такие остатки из "гипервариабельной петли" (например, остатки 26-32 (L1), 50-52 (L2) и 91-96 (L3) в VL, а также 26-32 (H1), 53-55 (H2) и 96-101 (H3) в VH; Chothia and Lesk J. Mol. Biol. 196:901-917 (1987)).

Термин "моноклональное антитело" при использовании здесь относится к антителу, полученному из популяции по существу гомогенных антител, то есть отдельные антитела, составляющие популяцию, идентичны за исключением возможных спонтанных природных мутаций, которые могут быть представлены в небольших количествах. Моноклональные антитела высокоспецифичны, будучи направленными на единственный антигенный сайт. Кроме того, в отличие от препаратов поликлональных антител, которые включают различные антитела, направленные на различные детерминанты (эпитопы), каждое моноклональное антитело направлено на единственную детерминанту антигена. В дополнение к их специфичности моноклональные антитела имеют то преимущество, что их можно синтезировать без загрязнения другими антителами. Атрибут "моноклональное" не следует истолковывать в том смысле, что для выработки такого антитела требуется какой-либо особенный способ. Например, моноклональные антитела, полезные в настоящем изобретении, можно изготовить по методологии гибридом, впервые описанной в ссылке Kohler et al., Nature, 256:495 (1975), или методами рекомбинантной ДНК в бактериальных, эукариотических животных или растительных клетках (см., например, патент США № 4816567). "Моноклональные антитела" можно также выделять из библиотек фаговых антител, используя методики, описанные, например, в ссылках Clackson et al., Nature, 352:624-628 (1991) and Marks et al., J. Mol. Biol., 222:581-597 (1991).

В этом тексте моноклональные антитела включают "химерные" антитела, в которых часть тяжелой и/или легкой цепи идентична или гомологична соответствующим последовательностям в антителах, полученных от другого биологического вида, либо принадлежащих к другому классу или подклассу антител, а также может представлять собой фрагменты таких антител, поскольку они проявляют желательную биологическую активность (см. патент США № 4816567 и ссылку Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)). Химерные антитела, которые представляют интерес здесь, включают "приматизированные" антитела, содержащие варьирующиеся доменные антигенсвязывающие последовательности, полученные от приматов (кроме человека), например мартышек, низших узконосых обезьян и т.д., а также последовательности постоянного региона человека.

"Интактное" антитело - это такое антитело, которое содержит антигенсвязывающий сайт, а также CL и по меньшей мере постоянные домены тяжелой цепи CH 1, CH 2 и CH 3. Постоянные домены могут представлять собой постоянные домены с природной последовательностью (например, постоянные домены с природной последовательностью человека) или их вариантные по аминокислотной последовательности формы. Предпочтительно, чтобы интактное антитело имело одну или более эффекторных функций.

"Фрагменты антител" содержат часть интактного антитела, предпочтительно, сайт связывания антигена или вариабельный регион интактного антитела. Примеры фрагментов антитела включают фрагменты Fab, Fab', F(ab')2 и Fv, диатела, линейные антитела (см. Патент США № 5641870, пример 2, ссылку Zapata et al., Protein Eng. 8(10): 1057-1062 [1995]), одноцепочечные молекулы антитела и полиспецифические антитела, образовавшиеся из фрагментов антител.

Расщепление антител папаином приводит к появлению двух идентичных антигенсвязывающих фрагментов, так называемых фрагментов "Fab", и остаточного фрагмента "Fc", обозначение которого отражает его способность легко и быстро кристаллизоваться. Фрагмент Fab состоит из полной L-цепи, наряду с доменом вариабельного региона H-цепи (VH) и первым постоянным доменом тяжелой цепи (CH 1). Каждый фрагмент Fab моновалентен в отношении связывания антигена, то есть имеет единственный антигенсвязывающий сайт. Обработка антитела пепсином дает на выходе один большой фрагмент F(ab')2, который грубо соответствует двум фрагментам Fab, соединенным дисульфидными связями, имеющим бивалентную антигенсвязывающую активность и еще способным к перекрестному связыванию антигенов. Фрагменты Fab' отличаются от фрагментов Fab наличием нескольких дополнительных аминокислотных остатков на карбоксильном конце домена CH 1, включая один или более цистеиновых остатков из области талии антитела. Здесь обозначение Fab'-SH дается для фрагмента Fab', в котором цистеиновый остаток (остатки) постоянного домена несет свободную тиольную группу. Фрагменты антитела F(ab')2 были изначально получены как пары фрагментов Fab', между которыми расположены шарнирные цистеины. Известны также другие химические соединения фрагментов антитела.

Фрагмент Fc содержит карбокси-концевые части обеих H-цепей, удерживаемых вместе дисульфидными связями. Эффекторные функции антител определяются последовательностями региона Fc, который также является компонентом, распознаваемым рецепторами к Fc (FcR), присутствующими на некоторых типах клеток.

"Fv" представляет собой минимальный фрагмент антитела, который содержит полный сайт распознавания антигена и связывания антигена. Этот фрагмент состоит из димера доменов вариабельного региона одной тяжелой и одной легкой цепи, находящихся в прочной нековалентной связи. В результате свертывания этих двух доменов получаются шесть гипервариабельных петель (по 3 петли из H- и L-цепи), которые вкладывают аминокислотные остатки в связывание антигена и придают антителу антигенсвязывающую специфичность. Однако даже единственный вариабельный домен (или половина фрагмента Fv, содержащая три специфичных для антигена CDR) способен распознавать и связывать антиген, хотя и с меньшей аффинностью, чем полный сайт связывания.

"Одноцепочечные Fv", также обозначаемые аббревиатурой "sFv" или "scFv", представляют собой фрагменты антитела, которые содержат домены антитела VH и VL, соединенные в одну полипептидную цепь. Предпочтительно, чтобы полипептид sFv дополнительно содержал полипептидный линкер между доменами VH и VL, который позволяет фрагменту sFv формировать желательную структуру для связывания антигена. Для получения обзорной информации по sFv см. ссылку Pluckthun в The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, p. 269-315 (1994); Borrebaeck 1995, ниже.

Термин "диатела" относится к маленьким фрагментам антител, полученным посредством конструирования фрагментов sFv (см. предшествующий абзац) с короткими линкерами (приблизительно 5-10 остатков) между доменами VH и VL, посредством чего достигается внутрицепочечное, но не межцепочечное спаривание V-доменов, приводящее к образованию бивалентного фрагмента, то есть фрагмента, имеющего два антигенсвязывающих сайта. Биспецифические диатела представляют собой гетеродимеры двух "кроссоверных" фрагментов sFv, в которых домены VH и VL двух антител представлены на разных полипептидных цепях. Диатела более подробно описаны, например, в документах EP 404097, WO 93/11161 и в ссылке Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993).

"Гуманизированные" формы антител, происходящих не от человека (например, от грызунов), представляют собой химерные антитела, отличающиеся минимальным содержанием последовательностей, являющихся производными антител нечеловеческого происхождения. По большей части гуманизированные антитела представляют собой иммуноглобулины человека (реципиентные антитела), в которых аминокислотные остатки из гипервариабельного региона реципиента замещены остатками из гипервариабельного региона другого биологического вида (донорские антитела), например, мыши, крысы, кролика или обезьяны, имеющего антитела с достаточным уровнем специфичности, аффинности и дееспособности. В некоторых случаях аминокислотные остатки каркасного региона (FR) иммуноглобулина человека замещены соответствующими остатками, происходящими не от человека. Кроме того, гуманизированные антитела могут содержать аминокислотные остатки, отсутствующие в реципиентном антителе или в донорском антителе. Эти модификации направлены на дальнейшее повышение функциональной эффективности антитела. Как правило, гуманизированное антитело содержит, по существу, все или по меньшей мере один, более типично, два вариабельных домена, в которых все или, по существу, все гипервариабельные петли соответствуют таковым в иммуноглобулине человека, а все или, по существу, все FR имеют такую же последовательность, как и в иммуноглобулине человека. Гуманизированное тело может также (необязательно) содержать по меньшей мере часть постоянного региона (Fc) иммуноглобулина, в типичном варианте - иммуноглобулина человека. Для получения дополнительных сведений см. ссылки Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol. 2:593-596 (1992).

"Антитело с видовой зависимостью", например антитело млекопитающего IgE против человека, представляет собой антитело, обладающее более сильной аффинностью связывания с антигеном от первого вида млекопитающего, чем с гомологом этого антигена от второго вида млекопитающего. В норме антитело с видовой зависимостью "специфически связывается" с антигеном человека (то есть обладает аффинностью связывания (Kd), величина которой приблизительно составляет не более 1 × 10-7 M, предпочтительно, приблизительно не более 1 × 10-8 и, наиболее предпочтительно, приблизительно не более 1 × 10-9 M), но имеет аффинность связывания с гомологом антигена от другого вида млекопитающих (не человека), которая слабее аффинности связывания с антигеном человека по меньшей мере приблизительно в 50 раз, или по меньшей мере приблизительно в 500 раз, или по меньшей мере приблизительно в 1000 раз. Антитело с видовой зависимостью может принадлежать к любому из различных типов антител, как это было определено выше, но, предпочтительно, представляет собой гуманизированное антитело или антитело человека.

"Олигопептид, связывающий IL-17A/F", представляет собой олигопептид, который связывается, предпочтительно, специфически с полипептидом IL-17A/F, как это описано выше. Олигопептиды, связывающие IL-17A/F, могут быть синтезированы химически с применением известной методологии синтеза олигопептидов или изготовлены и очищены с применением рекомбинантной технологии. Олигопептиды, связывающие IL-17A/F, обычно имеют длину по меньшей мере приблизительно 5 аминокислот, в альтернативных вариантах по меньшей мере приблизительно 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100 аминокислот и более, причем такие олигопептиды способны связываться, предпочтительно, специфически с полипептидом IL-17A/F, как это описано здесь. Олигопептиды, связывающие IL-17A/F, можно идентифицировать без излишнего экспериментирования, применяя хорошо известные методики. В этом отношении следует отметить, что методики скрининга библиотек олигопептидов для выявления олигопептидов, способных специфически связываться с целевым полипептидом, хорошо известны в данной области техники (см., например, патенты США № 5556762, 5750373, 4708871, 4833092, 5223409, 5403484, 5571689, 5663143, публикации PCT № WO 84/03506 и WO 84/03564, ссылки Geysen et al., Proc. Natl. Acad. Sci. U.S.A., 81:3998-4002 (1984); Geysen et al., Proc. Natl. Acad. Sci. U.S.A., 82:178-182 (1985); Geysen et al., in Synthetic Peptides as Antigens, 130-149 (1986); Geysen et al., J. Immunol. Meth., 102:259-274 (1987); Schoofs et al., J. Immunol., 140:611-616 (1988), Cwirla, S. E. et al. (1990) Proc. Natl. Acad. Sci. USA, 87:6378; Lowman, H.B. et al. (1991) Biochemistry, 30:10832; Clackson, T. et al. (1991) Nature, 352: 624; Marks, J. D. et al. (1991), J. Mol. Biol., 222:581; Kang, A.S. et al. (1991) Proc. Natl. Acad. Sci. USA, 88:8363, and Smith, G. P. (1991) Current Opin. Biotechnol., 2:668).

"Органическая молекула, связывающая IL-17A/F", представляет собой органическую молекулу, отличающуюся от определенных здесь олигопептида или антитела, которая способна связываться, предпочтительно, специфически, с полипептидом IL-17A/F, как это описано здесь. Органические молекулы, связывающиеся с IL-17A/F, можно идентифицировать и синтезировать химически, применяя известную методологию (см., например, публикации PCT № WO 00/00823 и WO 00/39585). Органические молекулы, связывающиеся с IL-17A/F, обычно имеют приблизительный размер менее 2000 дальтон, в альтернативных вариантах приблизительный размер менее 1500, 750, 500, 250 или 200 дальтон, причем такие органические молекулы, способные связываться, предпочтительно, специфически с полипептидом IL-17A/F, как это описано здесь, можно идентифицировать без излишнего экспериментирования, применяя хорошо известные методики. В этом отношении следует отметить, что методики скрининга библиотек органических молекул для выявления молекул, способных специфически связываться с целевым полипептидом, хорошо известны в данной области техники (см., например, публикации PCT № WO 00/00823 и WO 00/39585).

Антитело, олигопептид или другая органическая молекула, "которая связывает" представляющий интерес антиген, например полипептидную антигенную цель, ассоциированную с опухолью, представляют собой такую структуру, которая связывает антиген с достаточной аффинностью, в результате чего указанные антитело, олигопептид или органическая молекула полезны в качестве диагностического и/или лечебного средства, нацеленного на клетку или ткань, экспрессирующую антиген, не давая существенной перекрестной реакции с другими белками. В таких вариантах осуществления изобретения степень связывания антитела, олигопептида или другой органической молекулы с "нецелевым" белком составит менее приблизительно 10% связывания антитела, олигопептида или другой органической молекулы со специфическим целевым белком, что можно определить посредством анализа по сортировке клеток с активацией флуоресценции (FACS) или радиоиммунопреципитации (RIA). В отношении связывания антитела, олигопептида или другой органической молекулы с целевой молекулой терминологические определения "специфическое связывание", "специфически связывается с" или "специфический для" применительно к определенному полипептиду или эпитопу, связывающемуся с определенным целевым полипептидом, означает связывание, которое в известной степени отличается от неспецифического взаимодействия. Специфическое связывание можно измерять, например, определяя связывание испытуемой молекулы в сравнении со связыванием контрольной молекулы, которая обычно представляет собой молекулу со сходной структурой, но без связывающей активности. Например, специфическое связывание можно определить по конкуренции с контрольной молекулой, которая похожа на целевую молекулу, например, по избытку цели, не имеющей метки. В этом случае специфическое связывание определяется тогда, когда связывание меченой цели с зондом конкурентно подавляется избытком цели, не имеющей метки. Терминологические определения "специфическое связывание", "специфически связывается с" или "специфический для" по отношению к определенному полипептиду или эпитопу, связывающемуся с определенным целевым полипептидом, при использовании здесь можно представить, например, молекулой, имеющей Kd для цели по меньшей мере приблизительно 10-4 M, в альтернативном варианте по меньшей мере приблизительно 10-5 M, в альтернативном варианте по меньшей мере приблизительно 10-6 M, в альтернативном варианте по меньшей мере приблизительно 10-7 M, в альтернативном варианте по меньшей мере приблизительно 10-8 M, в альтернативном варианте по меньшей мере приблизительно 10-9 M, в альтернативном варианте по меньшей мере приблизительно 10-10 M, в альтернативном варианте по меньшей мере приблизительно 10-11 M, в альтернативном варианте по меньшей мере приблизительно 10-12 M или более. В одном из вариантов осуществления изобретения термин "специфическое связывание" относится к такому связыванию, когда молекула связывается с определенным полипептидом или с эпитопом на определенном полипептиде без существенного связывания с любым другим полипептидом или эпитопом полипептида.

Антитело, олигопептид или другая органическая молекула, которая "подавляет рост опухолевых клеток, экспрессирующих полипептид IL-17A/F", иначе говоря, антитело, олигопептид или другая органическая молекула с функцией "ингибитора роста" - это такая структура, которая приводит к измеримому подавлению роста раковых клеток, экспрессирующих или избыточно экспрессирующих полипептид IL-17A/F. Предпочтительные ингибиторные анти-IL-17A/F-антитела, олигопептиды или органические молекулы подавляют рост опухолевых клеток, экспрессирующих IL-17A/F, более чем на 20%, предпочтительнее, приблизительно от 20 до 50% и, еще предпочтительнее, более чем на 50% (например, приблизительно от 50 до 100%) по сравнению с подходящим контролем, причем в качестве контроля обычно используют опухолевые клетки, не обработанные испытуемым антителом, олигопептидом или другой органической молекулой. В одном из вариантов осуществления изобретения подавление роста можно измерить при концентрации антитела в клеточной культуре приблизительно от 0,1 до 30 мкг/мл или приблизительно от 0,5 нМ до 200 нМ, если подавление роста измеряют через 1-10 дней после обработки опухолевых клеток антителом. Подавление роста опухолевых клеток in vivo можно определять разными способами. Антитело проявляет себя как ингибитор роста in vivo, если введение анти-IL-17A/F-антитела в приблизительной дозе от 1 мкг/кг до 100 мкг/кг веса тела приводит к снижению размеров опухоли или уменьшению пролиферации опухолевых клеток в сроке приблизительно от 5 дней до 3 месяцев после первого введения антитела, предпочтительнее, приблизительно от 5 до 30 дней.

Антитело, олигопептид или другая органическая молекула, которая "индуцирует апоптоз", - это такая биологическая структура, которая индуцирует запрограммированную гибель клеток, определяемую по связыванию аннексина V, фрагментации ДНК, сморщиванию клеток, расширению эндоплазматического ретикулума, фрагментации клеток и/или образованию мембранных везикул (так называемых апоптотических телец). Указанная клетка обычно представляет собой такую клетку, которая избыточно экспрессирует полипептид IL-17A/F. Предпочтительная клетка является опухолевой клеткой, например клеткой рака предстательной железы, молочной железы, яичника, желудка, эндометрия, легких, почки, толстой кишки, мочевого пузыря. Имеются различные способы, позволяющие оценивать клеточные события, ассоциированные с апоптозом. Например, транслокацию фосфатидилсерина (PS) можно измерить связыванием аннексина, фрагментацию ДНК можно оценить посредством ее электрофоретического расщепления (эффект лестницы), а ядерную/хроматиновую конденсацию наряду с фрагментацией ДНК можно оценить по выраженному в любой степени увеличению количества гиподиплоидных клеток. Предпочтительно, чтобы в анализе по связыванию аннексина антитело, олигопептид или другая органическая молекула, индуцирующая апоптоз, приводила приблизительно к 2-50-кратной, предпочтительнее, приблизительно к 5-50-кратной или, наиболее предпочтительно, приблизительно, к 10-50-кратной индукции связывания аннексина по сравнению с необработанными клетками.

Понятие "эффекторные функции" антитела относится к тем видам биологической активности, которые можно приписать региону Fc антитела (природная последовательность региона Fc или вариант аминокислотной последовательности региона Fc), причем эффекторные функции варьируются в зависимости от изотипа антитела. Примеры эффекторных функций антитела включают: связывание с C1q и комплементзависимую цитотоксичность, связывание с рецептором Fc, антителозависимую клеточноопосредованную цитотоксичность (ADCC), фагоцитоз, понижающую регуляцию рецепторов на клеточной поверхности (например, рецепторов B-клеток) и активацию B-клеток.

Понятие "антителозависимая клеточноопосредованная цитотоксичность" или "ADCC" относится к такой форме цитотоксичности, при которой секретируемый Ig, который связан с рецепторами Fc (FcR), представленными на поверхности некоторых цитотоксических клеток (например, природных клеток-киллеров (NK), нейтрофилов и макрофагов), придает этим цитотоксическим эффекторным клеткам способность специфически связываться с несущими антиген клетками-мишенями и вслед за этим уничтожать клетки-мишени цитотоксинами. Для такого уничтожения абсолютно необходимо наличие "ветви" антител в цитотоксических клетках. Основные клетки, опосредующие ADCC (NK-клетки), экспрессируют только FcγRIII, тогда как моноциты экспрессируют FcγRI, FcγRII и FcγRIII. Экспрессия FcR на гемопоэтических клетках в обобщенном виде представлена в таблице 3 на странице 464 ссылки Ravetch and Kinet, Annu. Rev. Immunol. 9:457-92 (1991). Чтобы оценить активность типа ADCC для представляющей интерес молекулы, можно провести анализ ADCC in vitro, например, как это описано в патенте США № 5500362 или 5821337. Пригодные для таких анализов эффекторные клетки включают периферические мононуклеары крови (PBMC) и природные клетки-киллеры (NK). Альтернативно или дополнительно активность типа ADCC для представляющей интерес молекулы можно оценить in vivo, например, на животной модели, как это раскрыто в ссылке Clynes et al. Proc. Natl. Acad. Sci. U.S.A. 95:652-656 (1998).

Термин "рецептор Fc" или "FcR" описывает рецептор, который связывается с регионом Fc антитела. Предпочтительным вариантом FcR является природная последовательность FcR человека. Кроме того, предпочтительным FcR является такой FcR, который связывается с антителом IgG (гамма-рецептор), включая подклассы рецепторов FcγRI, FcγRII и FcγRIII, в том числе аллельные варианты и альтернативно сплайсированные формы этих рецепторов. Рецепторы FcγRII включают FcγRIIA ("активирующий рецептор") и FcγRIIB ("ингибирующий рецептор"), которые имеют похожие аминокислотные последовательности, различающиеся, главным образом, в их цитоплазматических доменах. Активирующий рецептор FcγRIIA содержит в своем цитоплазматическом домене иммунорецепторный активирующий мотив на основе тирозина (ITAM). Ингибирующий рецептор FcγRIIB содержит в своем цитоплазматическом домене ингибирующий мотив на основе тирозина (ITIM). (См. обзор в ссылке Daëron, Annu. Rev. Immunol. 15:203-234 (1997).) Обзор по FcR приведен в ссылках Ravetch and Kinet, Annu. Rev. Immunol. 9:457-492 (1991); Capel et al., Immunomethods 4:25-34 (1994), и de Haas et al., J. Lab. Clin. Med. 126:330-41 (1995). Здесь термин "FcR" охватывает и другие варианты FcR, включая те, которые будут идентифицированы в будущем. Данный термин также включает рецептор новорожденных, FcRn, который отвечает за перенос материнских IgG в организм плода (Guyer et al., J. Immunol. 117:587 (1976) и Kim et al., J. Immunol. 24:249 (1994)).

"Эффекторные клетки человека" представляют собой лейкоциты, экспрессирующие один или более FcR и выполняющие эффекторные функции. Предпочтительные клетки экспрессируют по меньшей мере FcγRIII и выполняют эффекторную функцию ADCC. Примеры лейкоцитов человека, которые опосредуют ADCC, включают периферические мононуклеары крови (PBMC), природные клетки-киллеры (NK), моноциты, цитотоксические T-клетки и нейтрофилы, а предпочтительными из них являются клетки PBMC и NK. Эффекторные клетки можно выделить из природного источника, например из крови.

Понятие "комплементзависимая цитотоксичность" или "CDC" относится к лизису клеток-мишеней в присутствии комплемента. Активацию классического метаболического пути комплемента инициирует связывание первого компонента системы комплемента (C1q) с антителами (соответствующего подкласса), которые связываются с их родственным антигеном. Для оценки активации комплемента можно провести анализ CDC, например, как это описано в ссылке Gazzano-Santoro et al., J. Immunol. Methods 202:163 (1996).

Термин "метка" при использовании здесь относится к выявляемому соединению или композиции, которые конъюгируют прямым или непрямым образом с антителом, образуя в результате "меченое" антитело. Метка может поддаваться выявлению сама по себе (например, радиоизотопные метки или флуоресцентные метки) либо, в случае ферментативной метки, может катализировать химическое изменение субстратного соединения или композиции, которые предстоит выявить.

Под "твердой фазой" подразумевается безводная матрица, к которой может прилипнуть антитело, предлагаемое настоящим изобретением. Примеры твердых фаз, рассматриваемых здесь, включают твердые фазы, сформированные частично или полностью из стекла (например, стекло с контролируемым размером пор), полисахаридов (например, агарозы), полиакриламидов, полистирола, поливинилового спирта и силиконов. В одних вариантах осуществления изобретения в зависимости от контекста твердая фаза может быть организована в виде лунок на аналитическом планшете, а в других она представляет собой колонку очистки (например, колонку аффинной хроматографии). Этот термин также включает непрерывную твердую фазу из дискретных частиц, например, такую, как это описано в патенте США № 4275149.

"Липосома" представляет собой маленький пузырек, состоящий из различных типов липидов, фосфолипидов и/или сурфактантов, который полезен для доставки лекарства (например, полипептида IL-17A/F или антитела к нему) в организм млекопитающего. Компоненты липосомы обычно организованы в виде двухслойного образования, напоминающего организацию липидов в биологических мембранах.

"Мелкая молекула" определяется здесь как молекула с молекулярным весом менее приблизительно 500 дальтон.

Термин "модулировать" означает воздействовать (например, регулировать повышающим или понижающим образом либо управлять иначе) на уровень сигнального метаболического пути. Клеточные процессы, находящиеся под управлением сигнальной трансдукции, включают, но не ограничиваясь ими, транскрипцию специфических генов, нормальные клеточные функции, такие как метаболизм, пролиферация, дифференцировка, адгезия, апоптоз и выживание, а также аномальные процессы, такие как трансформация, блокировка дифференцировки и метастазирование.

Термины "активный" или "активность" в тех целях, которые преследуются здесь, относятся к форме (формам) полипептида IL-17A/F, которые сохраняют биологическую и/или иммунологическую активность нативных или встречающихся в природе полипептидов IL-17A/F, причем понятие "биологическая" активность относится к биологической функции (либо ингибиторной, либо стимулирующей), обусловленной нативным или встречающимся в природе полипептидом IL-17A/F, отличающейся от способности индуцировать выработку антител против антигенного эпитопа, которым обладает нативный или встречающийся в природе полипептид IL-17A/F, а понятие "иммунологическая" активность относится к способности индуцировать выработку антител против антигенного эпитопа, которым обладает нативный или встречающийся в природе полипептид IL-17A/F. Одно из предпочтительных проявлений биологической активности включает индукцию активации NF-κB и стимуляцию выработки провоспалительных хемокинов IL-8 и IL-6. Другое предпочтительное проявление биологической активности заключается в стимуляции мононуклеарных клеток периферической крови или клеток CD4+. Еще одно предпочтительное проявление биологической активности заключается в стимулировании пролиферации T-лимфоцитов. Еще одно предпочтительное проявление биологической активности заключается, например, в высвобождении TNF-α из клеток THP1. Еще одно проявление биологической активности заключается в улучшении матричного синтеза в суставном хряще. Альтернативное проявление биологической активности заключается в стимуляции разрушения матрицы суставного хряща, а также в подавлении матричного синтеза. Еще одно предпочтительное проявление биологической активности заключается в модуляции уровня сигнального пути интерлейкина-17 на среднетяжелой или тяжелой стадии воспалительного заболевания кишечника или во время внезапного приступа.

Понятие "иммунологическая" активность относится только к способности индуцировать выработку антител против антигенного эпитопа, которым обладает нативный или встречающийся в природе полипептид IL-17A/F.

Терминологическое определение "дегенеративное заболевание хряща" описывает совокупность заболеваний, которые характеризуются, главным образом, деструкцией хрящевой матрицы. Дополнительные проявления патологии включают выработку окиси азота и усиленное разрушение протеогликанов. Типичные заболевания, подпадающие под это определение, включают, например, артриты (в частности, остеоартрит, ревматоидный артрит, псориатический артрит).

Термин "иммунозависимое заболевание" означает такое заболевание, при котором компонент иммунной системы вызывает, опосредует заболеваемость млекопитающих или иным образом вносит вклад в нее. Сюда же можно включить такие заболевания, при которых стимуляция иммунного ответа или вмешательство в него дает благоприятный эффект в отношении прогрессирования болезни. В число заболеваний, охватываемых этим термином, входят иммуноопосредованные воспалительные заболевания, воспалительные заболевания, не опосредованные иммунной системой, инфекционные заболевания, иммунодефицитные заболевания, неоплазии и т.д.

Терминологическое определение "заболевание, опосредованное T-клетками", означает заболевание, при котором T-клетки прямым или непрямым образом опосредуют заболеваемость млекопитающих или иным образом вносят вклад в нее. Заболевание, опосредованное T-клетками, может быть связано с клеточноопосредованными, лимфокиноопосредованными эффектами и т.д., включая даже эффекты, ассоциированные с B-клетками, если, например, B-клетки стимулируются лимфокинами, секретируемыми T-клетками.

Примеры иммунозависимых и воспалительных заболеваний, некоторые из которых опосредованы иммунитетом или T-клетками и которые можно лечить в соответствии с настоящим изобретением, включают системную красную волчанку, ревматоидный артрит, хронический ювенильный артрит, спондилоартропатии, системный склероз (склеродермию), идиопатические воспалительные миопатии (дерматомиозит, полимиозит), синдром Шегрена, системный васкулит, саркоидоз, аутоиммунную гемолитическую анемию (иммунную панцитопению, пароксизмальную ночную гемоглобинурию), аутоиммунную тромбоцитопению (идиопатическую тромбоцитопеническую пурпуру, иммуноопосредованную тромбоцитопению), тиреоидит (базедову болезнь, тиреоидит Хасимото, ювенильный лимфоцитарный тиреоидит, атрофический тиреоидит), сахарный диабет, иммуноопосредованное почечное заболевание (гломерулонефрит, тубулоинтерстициальный нефрит), демиелинизирующие заболевания центральной и периферической нервной системы, такие как рассеянный склероз, идиопатическая демиелинизирующая полиневропатия или синдром Гийена-Барре и хроническая воспалительная демиелинизирующая полиневропатия, гепатобилиарные заболевания, такие как инфекционные гепатиты (гепатит A, B, C, D, E и другие негепатотропные вирусы), аутоиммунный хронический активный гепатит, первичный билиарный цирроз, гранулематозный гепатит и склерозирующий холангит, воспалительное заболевание кишечника (язвенный колит: болезнь Крона [Crohn]), глютензависимую энтеропатию (целиакию) и болезнь Уиппла [Whipple], аутоиммунные или иммуноопосредованные кожные заболевания, включая буллезные кожные заболевания, экссудативную многоформную эритему и контактный дерматит, псориаз, аллергические заболевания, такие как астма, аллергический ринит, атопический дерматит, пищевую аллергию и крапивницу, иммунологические заболевания легких, такие как эозинофильная пневмония, идиопатический легочный фиброз и гиперчувствительный пневмонит, заболевания, связанные с трансплантацией, включая отторжение трансплантата и болезнь "трансплантат против хозяина". Инфекционные заболевания, включая вирусные заболевания, такие как СПИД [AIDS] (ВИЧ-инфекция), гепатит A, B, C, D и E, герпес и т.д., бактериальные инфекции, грибковые инфекции, протозойные инфекции и паразитические инфекции. Терминологическое определение "эффективное количество" означает концентрацию или количество полипептида IL-17A/F и/или его агониста/антагониста, которое приводит к достижению конкретной поставленной цели. "Эффективное количество" полипептида IL-17A/F или его агониста/антагониста можно определить эмпирически. Кроме того, "терапевтически эффективное количество" означает концентрацию или количество полипептида IL-17A/F и/или его агониста/антагониста, которое достаточно для достижения намеченного терапевтического результата. Это количество также можно определить эмпирически.

Терминологическое определение "цитотоксический агент" при использовании здесь относится к веществу, которое подавляет или предотвращает функцию клеток и/или вызывает разрушение клеток. Этот термин предназначен для охвата радиоактивных изотопов (например, I131, I125, Y90 и Re186), химиотерапевтических средств и токсинов, таких как ферментативно активные токсины бактериального, грибкового, растительного или животного происхождения либо их фрагменты.

Термином "химиотерапевтический агент" обозначается химическое соединение, полезное для лечения рака. Примеры химиотерапевтических агентов включают адриамицин, доксорубицин, эпирубицин, 5-фторурацил, цитозинарабинозид ("Ara-C"), циклофосфамид, тиотепа, бусульфан, цитоксин, таквоиды, например паклитаксел (Taxol, Bristol-Myers Squibb Oncology, Принстон, штат Нью-Джерси) и доксетаксел (Taxotere, Rhône-Poulenc Rorer, Антони, Франция), токсотер, метотрексат, цисплатин, мелфалан, винбластин, блеомицин, этопозид, ифосфамид, митомицин C, митоксантрон, винкристин, винорелбин, карбоплоплатин, тенипозид, дауномицин, карминомицин, аминоптерин, дактиномицин, митомицины, эсперамицины (см. Патент США № 4675187), мелфалан и другие родственные азотистые иприты. Под это определение также подпадают гормональные агенты, роль которых заключается в регуляции или подавлении гормонального воздействия на опухоли, а их примерами являются такие средства, как тамоксифен и онапристон.

Понятие "ингибитор роста" при использовании здесь относится к соединению или композиции, подавляющим рост клеток, особенно раковых клеток, избыточно экспрессирующих любой из идентифицированных здесь генов либо in vitro, либо in vivo. Таким образом, ингибитор роста представляет собой такой фактор, который значительно снижает процентное содержание клеток, избыточно экспрессирующих такие гены в S-фазе клеточного цикла. Примеры ингибиторов роста включают такие средства, которые блокируют прогрессирование клеточного цикла (на других этапах кроме S-фазы), то есть эти средства индуцируют задержку G1 и M-фазы. Классические блокаторы M-фазы включают винкас (винкристин и винбластин), таксол и ингибиторы топо II, такие как доксорубицин, эпирубицин, даунорубицин, этопозид и блеомицин. Те агенты, которые задерживают фазу G1, также распространяют свое действие на задержку S-фазы, например, следует упомянуть такие средства, алкилирующие ДНК, как тамоксифен, преднизон, дакарбазин, мехлорэтамин, цисплатин, метотрексат, 5-фторурацил и ara-C. Дополнительную информацию можно найти в ссылке The Molecular Basis of Cancer, Mendelsohn and Israel, eds., глава 1, озаглавленная "Cell cycle regulation, oncogens, and antineoplastic drugs" by Murakami et al., (WB Saunders: Philadelphia, 1995), особенно стр. 13.

Термин "цитокин" представляет собой общий термин для белков, выбрасываемых одной клеточной популяцией, которые действуют на другие клетки как межклеточные медиаторы. Примерами таких цитокинов являются лимфокины, монокины и традиционные полипептидные гормоны. К цитокинам относятся гормоны роста, такие как гормон роста человека, N-метионил гормон роста человека и гормон роста крупного рогатого скота, паратгормон, тироксин, инсулин, проинсулин, релаксин, прорелаксин, гликопротеиновые гормоны, такие как фолликулостимулирующий гормон (FSH), тиреотропный гормон (TSH) и лютеинизирующий гормон (LH), печеночный фактор роста, фактор роста фибробластов, пролактин, плацентарный лактоген, α-фактор и β-фактор опухолевого некроза, мюллерова ингибирующая субстанция, мышиный пептид, ассоциированный с гонадотропином, ингибин, активин, фактор роста эндотелия сосудов, интегрин, тромбобпоэтин (TPO), факторы роста нервов, такие как NGF-β, фактор роста тромбоцитов, трансформирующие факторы роста (TGF), такие как TGF-α и TGF-β, инсулиноподобные факторы роста I и II, эритропоэтин (EPO), остеоиндуктивные факторы, интерфероны, такие как α-, β- и γ-интерферон, колониестимулирующие факторы (CSF), такие как CSF макрофагов (M-CSF), CSF гранулоцитов-макрофагов (GM-CSF) и CSF гранулоцитов (G-CSF), интерлейкины (IL), такие как IL-1, IL-1a, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12 или IL-17, факторы опухолевого некроза, такие как TNF-α или TNF-β, а также другие полипептидные факторы, индуцирующие ингибиторный фактор лейкоза (LIF) и кит-лиганд (KL). При использовании здесь термин цитокин включает белки из природных источников или из культуры рекомбинантных клеток, а также биологически активные эквиваленты цитокинов с природной последовательностью.

Таблица 1
Таблица 2
Белок IL-17A/F XXXXXXXXXXXXXXX (длина = 15 аминокислот)
Белок сравнения XXXXXYYYYYYY (длина = 12 аминокислот)

% идентичности аминокислотной последовательности = (число идентично совпадающих аминокислотных остатков между двумя полипептидными последовательностями, определяемое программой ALIGN-2), деленное на (общее число аминокислотных остатков в белке IL-17A/F) = 5, деленное на 15 = 33,3%

Таблица 3
Белок IL-17A/F XXXXXXXXXX (длина = 10 аминокислот)
Белок сравнения XXXXXYYYYYYZZYZ (длина = 15 аминокислот)

% идентичности аминокислотной последовательности = (число идентично совпадающих аминокислотных остатков между двумя полипептидными последовательностями, определяемое программой ALIGN-2), деленное на (общее число аминокислотных остатков в белке IL-17A/F) = 5, деленное на 10 = 50%

Таблица 4
ДНК IL-17A/F NNNNNNNNNNNNNN (длина = 14 нуклеотидов)
ДНК сравнения NNNNNNLLLLLLLLLL (длина = 16 нуклеотидов)

% идентичности последовательности нуклеиновой кислоты = (число идентично совпадающих нуклеотидов между двумя последовательностями нуклеиновой кислоты, определяемое программой ALIGN-2), деленное на (общее число нуклеотидов в последовательности нуклеиновой кислоты ДНК IL-17A/F) = 6, деленное на 14 = 42,9%

Таблица 5
ДНК IL-17A/F NNNNNNNNNNNN (длина = 12 нуклеотидов)
ДНК сравнения NNNNLLLVV (длина = 9 нуклеотидов)

% идентичности последовательности нуклеиновой кислоты = (число идентично совпадающих нуклеотидов между двумя последовательностями нуклеиновой кислоты, определяемое программой ALIGN-2), деленное на (общее число нуклеотидов в последовательности нуклеиновой кислоты ДНК IL-17A/F) = 4, деленное на 12 = 33,3%.

II. Композиции и способы, предлагаемые изобретением

A. Полноразмерные полипептиды IL-17A/F

Настоящее изобретение предлагает недавно идентифицированные и выделенные нуклеотидные последовательности, кодирующие полипептиды, которые упоминаются в настоящей заявке как полипептиды IL-17A/F. В частности, были идентифицированы и выделены кДНК, кодирующие различные полипептиды IL-17A/F, как это будет более подробно раскрыто в приведенных ниже примерах.

B. Варианты полипептида IL-17A/F

В дополнение к описанным здесь полипептидам IL-17A/F с природной последовательностью рассматривается возможность получения вариантов IL-17A/F. Варианты IL-17A/F можно получить, вводя соответствующие нуклеотидные изменения в ДНК IL-17A/F DNA и/или осуществляя синтез желательного полипептида IL-17A/F. Компетентные специалисты поймут, что аминокислотные изменения могут изменить посттрансляционные процессы IL-17A/F, например произвести изменение числа и расположения сайтов гликозилирования или изменить характеристики мембранной фиксации.

Описанные здесь вариации в природной полноразмерной последовательности IL-17A/F или в различных доменах IL-17A/F можно осуществить, например, используя любую из методик и руководящих указаний по консервативным и неконсервативным мутациям, изложенных, например, в патенте США № 5364934. Вариации могут представлять собой замещение, делецию или вставку одного и более кодонов, кодирующих IL-17A/F, что приводит к изменению аминокислотной последовательности IL-17A/F по сравнению с природной последовательностью IL-17A/F. Факультативная вариация заключается в замещении по меньшей мере одной аминокислоты другой аминокислотой в одном или более доменов IL-17A/F. Руководящие указания по определению того, какой аминокислотный остаток можно вставить, заместить или делетировать без отрицательных последствий для нужной активности, можно получить путем сравнения последовательности IL-17A/F с последовательностью молекул известного гомологичного белка и сведения к минимуму числа изменений аминокислотной последовательности в участках с высокой гомологией. Аминокислотные замещения могут быть результатом замены одной аминокислоты на другую аминокислоту, имеющую сходные структурные и/или химические свойства, например замена лейцина серином, то есть они представляют собой консервативные аминокислотные замещения. Вставки или делеции факультативно могут осуществляться в диапазоне приблизительно от 1 до 5 аминокислот. Допустимые вариации можно определить, систематически проводя вставки, делеции или замещения в последовательности и тестируя полученные варианты на активность в сравнении с полноразмерной или зрелой природной последовательностью.

Здесь же предлагаются фрагменты полипептида IL-17A/F. Такие фрагменты могут быть усечены на N-конце или C-конце либо могут утратить внутренние остатки, например, по сравнению с полноразмерным природным белком. Некоторые фрагменты утрачивают аминокислотные остатки, которые несущественны для нужной биологической активности полипептида IL-17A/F.

Фрагменты IL-17A/F могут быть изготовлены по любой из множества традиционных методик. Желательные фрагменты пептида можно синтезировать химически. Альтернативный подход заключается в генерировании фрагментов IL-17A/F посредством ферментативного расщепления, например, при обработке белка таким ферментом, который заведомо расщепляет белки в сайтах, определяемых конкретными аминокислотными остатками, или посредством расщепления ДНК подходящими рестрикционными ферментами с последующим выделением желательного фрагмента. Еще одна подходящая методика связана с выделением и амплификацией фрагмента ДНК, кодирующего желательный фрагмент полипептида, посредством полимеразной цепной реакции (PCR). Олигонуклеотиды, которые определяют заданные концы фрагмента ДНК, задействованы в 5' и 3' праймерах PCR. Предпочтительно, чтобы фрагменты полипептида IL-17A/F имели по меньшей мере одно общее проявление иммунологической активности с описанным здесь природным полипептидом IL-17A/F.

В специфических вариантах осуществления изобретения представляющие интерес консервативные замещения показаны в таблице 6 в колонке Предпочтительные замещения. Если такие замещения приводят к изменению биологической активности, то вносят более существенные изменения, которые в таблице 6 обозначены как Примерные замещения, а также описаны ниже по классам аминокислот.

Таблица 6
Первоначальный остаток Примерные замещения Предпочтительные замещения
Ala (A) val, leu, ile val
Arg (R) lys, gln, asn lys
Asn (N) gln, his, lys, arg gln
Asp (D) Glu glu
Cys (C) Ser ser
Gln (Q) Asn asn
Glu (E) Asp asp
Gly (G) pro, ala ala
His (H) asn, gln, lys, arg arg
Ile (I) leu, val, met, ala, phe, норлейцин leu
Leu (L) норлейцин, ile, val, met, ala, phe ile
Lys (K) arg, gln, asn arg
Met (M) leu, phe, ile leu
Phe (F) leu, val, ile, ala, tyr leu
Pro (P) ala ala
Ser (S) thr Thr
Thr (T) ser ser
Trp (W) tyr, phe tyr
Tyr (Y) trp, phe, thr, ser phe
Val (V) ile, leu, met, phe, ala, норлейцин leu

Существенные модификации в функциональной или иммунологической идентичности полипептида IL-17A/F осуществляются посредством выбора замещений, эффект которых значительно различается по поддержанию (a) структуры полипептидного каркаса в области замещения, например дает листовую или спиральную конформацию, (b) заряда или гидрофобности молекулы в целевом сайте или (c) массы боковой цепи. Встречающиеся в природе остатки подразделяются на группы в зависимости от общих свойств боковой цепи:

(1) гидрофобные: норлейцин, met, ala, val, leu, ile;

(2) нейтральные гидрофобные: cys, ser, thr;

(3) кислотные: asp, glu;

(4) щелочные: asn, gln, his, lys, arg;

(5) остатки, влияющие на ориентацию цепи: gly, pro; и

(6) ароматические: trp, tyr, phe.

Неконсервативные замещения повлекут за собой замену члена одного из этих классов на другой класс. Такие замещенные остатки также можно вводить в сайты консервативного замещения или, что более предпочтительно, в остальные (неконсервативные) сайты.

Вариации можно осуществить, применяя способы, известные в данной области техники, например олигонуклеотидноопосредованный сайт-специфический мутагенез, сканирование аланином и PCR-мутагенез. Для того чтобы получить вариант ДНК, кодирующей IL-17A/F, на клонированной ДНК можно провести сайт-специфический мутагенез [Carter et al., Nucl. Acids Res., 13:4331 (1986); Zoller et al., Nucl. Acids Res., 10:6487 (1987)], кассетный мутагенез (Wells et al., Gene, 34:315 [1985]), мутагенез с отбором по рестрикции (Wells et al., Philos. Trans. R. Soc. London SerA, 317:415 [1986]) или мутагенные изменения по другим известным методикам.

Для идентификации одной или более аминокислот в смежной последовательности можно также провести сканирующий аминокислотный анализ. Предпочтительными для сканирования являются относительно маленькие, нейтральные аминокислоты. К числу таких аминокислот относятся аланин, глицин, серин и цистеин. Типичной предпочтительной сканирующей аминокислотой в этой группе является аланин, поскольку он элиминирует боковую цепь за пределами бета-углерода и с меньшей вероятностью изменяет конформацию основной цепи варианта (Cunningham and Wells, Science, 244: 1081-1085 [1989]). Обычно предпочтение аланину отдают еще и потому, что он является наиболее распространенной аминокислотой. Кроме того, аланин часто обнаруживается как в скрытых, так и в открытых положениях (Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. Mol. Biol., 150:1 [1976]). Если аланиновое замещение не дает адекватного количества варианта, можно использовать изотерическую аминокислоту.

C. Модификации IL-17A/F

В сферу этого изобретения также включены ковалентные модификации IL-17A/F. Один из типов ковалентной модификации включает взаимодействие целевых аминокислотных остатков полипептида IL-17A/F с органическим дериватизирующим агентом, который способен реагировать с избранными боковыми цепями или с N- либо C-концевыми остатками IL-17A/F. Дериватизация с применением бифункциональных агентов полезна, например, для перекрестного сшивания IL-17A/F с нерастворимой в воде опорной матрицей или поверхностью для использования в способе очистки анти-IL-17A/F-антител и наоборот. Часто используемые для перекрестного сшивания агенты включают, например, 1,1-бис(диазоацетил)-2-фенилэтан, глутаровый альдегид, N-гидроксисукцинимидные эфиры, например эфиры с 4-азидосалициловой кислотой, гомобифункциональные имидоэфиры, включая дисукцинимидильные эфиры, такие как 3,3'-дитиобис (сукцинимидилпропионат), бифункциональные малеимиды, такие как бис-N-малеимидо-1,8-октан и такие агенты, как метил-3-[(p-азидофенил)дитио]пропиоимидат.

Другие модификации включают деамидирование глутаминиловых и аспарагиниловых остатков до соответствующих глутамиловых и аспартиловых остатков, гидроксилирование пролина и лизина, фосфорилирование гидроксильных групп сериловых или треониловых остатков, метилирование α-амино-групп в боковых цепях лизина, аргинина и гистидина [T.E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, p. 79-86 (1983)], ацетилирование N-концевого амина и амидирование любых C-концевых карбоксильных групп.

Еще один тип ковалентной модификации полипептида IL-17A/F, входящий в сферу этого изобретения, заключается в изменении природного характера гликозилирования полипептида. Терминологическое определение "изменение природного характера гликозилирования" при использовании здесь предназначено для обозначения делеции одного или более углеводных компонентов, обнаруживаемых в природной последовательности IL-17A/F (либо посредством удаления нижележащего сайта гликозилирования, либо посредством элиминации гликозилирования химическими и/или ферментативными средствами), и/или добавления одного или более сайтов гликозилирования, отсутствующих в природной последовательности IL-17A/F. Кроме того, эта фраза включает качественные изменения в гликозилировании природных белков, затрагивающие изменение сущности и пропорций различных углеводных компонентов, представленных в белке.

Добавление сайтов гликозилирования к полипептиду IL-17A/F может осуществляться за счет изменения аминокислотной последовательности. Изменение может быть проведено, например, посредством добавления или замещения на один или более сериновых или треониновых остатков в природной последовательности IL-17A/F (для сайтов O-гликозилирования). Аминокислотную последовательность IL-17A/F по выбору можно изменить через изменения на уровне ДНК, особенно мутированием ДНК, кодирующей полипептид IL-17A/F, в заранее отобранных основаниях, что приводит к образованию кодонов, которые транслируются в желательные аминокислоты.

Другим средством для увеличения числа углеводных компонентов в полипептиде IL-17A/F является химическое или ферментативное присоединение гликозидов к полипептиду. Такие способы описаны в данной области техники, например в документе WO 87/05330, опубликованном 11 сентября 1987 года, и в ссылке Aplin and Wriston, CRC Crit. Rev. Biochem., p. 259-306 (1981).

Удаление углеводных компонентов, представленных в полипептиде IL-17A/F, можно осуществить химически, ферментативно или посредством мутационного замещения кодонов, кодирующих аминокислотные остатки, которые служат мишенями для гликозилирования. Методики химического дегликозилирования известны в данной области техники и описаны, например в ссылках Hakimuddin, et al., Arch. Biochem. Biophys., 259:52 (1987) и Edge et al., Anal. Biochem., 118:131 (1981). Ферментативное расщепление углеводных компонентов полипептидов можно осуществить, применяя различные эндо- и экзо-гликозидазы, как это описано в ссылке Thotakura et al., Meth. Enzymol., 138:350 (1987).

Еще один тип ковалентной модификации IL-17A/F заключается в соединении полипептида IL-17A/F с одним из многих небелковых полимеров, например полиэтиленгликолем (PEG), полипропиленгликолем или полиоксиалкиленами, способом, описанным в патентах США № 4640835, 4496689, 4301144, 4670417, 4791192 и 4179337.

Рассматриваемый в настоящем изобретении полипептид IL-17A/F можно также модифицировать таким образом, чтобы сформировать химерную молекулу, содержащую полипептид IL-17A/F, слитый с другим гетерологичным полипептидом или аминокислотной последовательностью.

В одном из вариантов осуществления изобретения такая химерная молекула содержит соединение IL-17A/F с полипептидом-меткой, несущим эпитоп, с которым может избирательно связываться антитело против метки. Эпитоп-метка обычно размещается на амино- или карбоксильном конце полипептида IL-17A/F. Присутствие таких меченых эпитопом форм IL-17A/F можно определить при помощи антитела против полипептида-метки. Кроме того, наличие эпитопной метки делает возможной легкую очистку IL-17A/F аффинным способом с применением антитела против метки или аффинной матрицы другого типа, которая связывает эпитопную метку. В данной области техники хорошо известны различные полипептиды-метки и соответствующие антитела к ним. Примеры включают такие метки, как полигистидин (poly-his) или полигистидинглицин (poly-his-gly), полипептид-метку flu HA и антитело к нему 12CA5 [Field et al., Mol. Cell. Biol., 8:2159-2165 (1988)], метку c-myc и антитела к ней 8F9, 3C7, 6E10, G4, B7 и 9E10 [Evan et al., Molecular and Cellular Biology, 5:3610-3616 (1985)], а также маркерный гликопротеин D (gD) вируса простого герпеса и антитело к нему [Paborsky et al., Protein Engineering, 3(6):547-553 (1990)]. Другие полипептиды-метки включают Flag-пептид [Hopp et al., BioTechnology, 6:1204-1210 (1988)]; пептид с эпитопом KT3 [Martin et al., Science, 255:192-194 (1992)]; пептид с эпитопом α-тубулина [Skinner et al., J. Biol. Chem., 266:15163-15166 (1991)] и белково-пептидную метку T7 gene 10 [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87:6393-6397 (1990)].

В альтернативном варианте осуществления изобретения химерная молекула может содержать соединение IL-17A/F с иммуноглобулином или особым участком молекулы иммуноглобулина. Для бивалентной формы химерной молекулы (также упоминаемой под названием "иммуноадгезин") такое соединение может произойти с участком Fc молекулы IgG. Гибриды Ig предпочтительно включают замещение с подстановкой растворимой формы полипептида IL-17A/F (в которой утрачен или инактивирован трансмембранный домен) вместо по меньшей мере одного вариабельного региона в молекуле Ig. В особенно предпочтительном варианте осуществления изобретения гибридное соединение иммуноглобулина включает шарнирные участки CH2 и CH3 или шарнирные участки CH1, CH2 и CH3 молекулы IgG1. Дополнительные сведения по выработке гибридов иммуноглобулинов см. также в патенте США № 5428130, выданном 27 июня 1995 г.

Еще в одном варианте осуществления изобретения предлагаемые этим изобретением полипептиды IL-17A/F могут быть также модифицированы таким образом, чтобы получить химерную молекулу, содержащую полипептид IL-17A/F, слитый с лейциновой застежкой. В данной области техники были описаны различные полипептиды с лейциновой застежкой. См., например, Landschulz et al., Science, 240:1759 (1988); WO 94/10308; Hoppe et al., FEBS Letters, 344:1991 (1994); Maniatis et al., Nature, 341:24 (1989). Считается, что применение лейциновой застежки, слитой с полипептидом IL-17A/F, желательно как вспомогательное средство для димеризации или тримеризации растворимого полипептида IL-17A/F в растворе. Компетентные специалисты поймут, что лейциновую застежку можно присоединить или на N-концевом или на C-концевом фланге молекулы IL-17A/F.

D. Изготовление IL-17A/F

Приведенное ниже описание относится, главным образом, к выработке IL-17A/F посредством культивирования клеток, трансформированных или трансфицированных вектором, содержащим нуклеиновую кислоту IL-17A/F. Разумеется, надо учитывать, что для изготовления IL-17A/F можно использовать альтернативные способы, которые хорошо известны в данной области техники. Например, последовательность IL-17A/F или ее части можно произвести прямым пептидным синтезом, применяя твердофазные методики [см., например, Stewart et al., Solid-Phase Peptide Synthesis, W.H. Freeman Co., San Francisco, CA (1969); Merrifield, J. Am. Chem. Soc., 85:2149-2154 (1963)]. Белковый синтез in vitro можно осуществить, применяя ручные или автоматизированные методики. Автоматический синтез можно осуществить, например, используя пептидный синтезатор фирмы Applied Biosystems (Фостер-Сити, штат Калифорния) и действуя в соответствии с инструкциями производителя. Различные части IL-17A/F можно синтезировать химически по отдельности и скомбинировать, применяя химические или ферментативные способы, позволяющие получить полноразмерный IL-17A/F.

1. Выделение ДНК, кодирующей IL-17A/F

ДНК, кодирующую IL-17A/F, можно получить из библиотеки кДНК, приготовленной из ткани, достоверно содержащей мРНК IL-17A/F и экспрессирующей ее на поддающемся определению уровне. В соответствии с этим ДНК IL-17A/F человека удобно получить из библиотеки кДНК, приготовленной из ткани человеческого происхождения, как это описано в последующих примерах. Ген, кодирующий IL-17A/F, можно также получить из геномной библиотеки или посредством известных процедур синтеза (например, автоматического синтеза нуклеиновой кислоты).

Библиотеки можно скринировать зондами (например, антителами к олигонуклеотидам IL-17A/F длиной по меньшей мере 20-80 оснований), сконструированными для идентификации представляющего интерес гена или кодируемого им белка. Скрининг библиотеки кДНК или геномной ДНК избранным зондом можно провести, применяя стандартные процедуры, как это описано в ссылке Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989). Альтернативным средством для выделения гена, кодирующего IL-17A/F, является применение методологии PCR [Sambrook et al., выше; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995)].

Приведенные ниже примеры описывают методики скрининга библиотек кДНК. Олигонуклеотидные последовательности, отобранные в качестве зондов, должны иметь достаточную длину и быть достаточно однозначными, чтобы свести к минимуму ложноположительные результаты. Предпочтительно, чтобы олигонуклеотид был меченым, то есть поддавался выявлению при гибридизации с ДНК в скринируемой библиотеке. Способы мечения хорошо известны в данной области техники и включают применение радиоизотопных меток, например АТФ, меченного изотопом 32P, обработку биотином или ферментативное мечение. Условия гибридизации, включая умеренную строгость и высокую строгость, приведены в ссылке Sambrook et al., см. выше.

Последовательности, идентифицированные такими способами скринирования библиотек, можно сравнить и выверить по другим известным последовательностям, депонированным и доступным в открытых базах данных, таких как GenBank, или в других частных базах данных по последовательностям. Идентичность последовательности (на аминокислотном или нуклеотидном уровне) в пределах определенных участков молекулы или по всей полноразмерной последовательности можно определить, применяя способы, хорошо известные в данной области техники, описанные здесь.

Нуклеиновую кислоту, обладающую кодирующей последовательностью белка, можно получить, скринируя отобранные библиотеки кДНК или геномной ДНК с применением в первый момент раскрытой здесь логически выведенной аминокислотной последовательности и, при необходимости, применяя традиционные процедуры удлинения праймеров, описанные в ссылке Sambrook et al., см. выше, для выявления предшественников и промежуточных продуктов процессинга мРНК, которая не могла подвергнуться обратной транскрпиции в кДНК.

2. Выбор и трансформация клеток-хозяев

Клетки-хозяева трансфицируют или трансформируют описанными здесь векторами экспрессии или клонирования для выработки IL-17A/F и культивируют в подходящих питательных средах, модифицированных нужным образом для индукции промоторов, отбора трансформантов или амплификации генов, кодирующих желательные последовательности. Компетентный специалист может подобрать условия культивирования (питательную среду, температуру, pH и т.п.) без излишнего экспериментирования. В целом, принципы, протоколы и практические методики для достижения максимальной продуктивности клеточных культур описаны в ссылках Mammalian Cell Biotechnology: a Practical Approach, M. Butler, ed. (IRL Press, 1991) и Sambrook et al., см. выше.

Рядовому специалисту известны способы трансфекции эукариотических клеток и трансформации прокариотических клеток, например, под действием CaCl2, CaPO4, способы, опосредованные липосомами, а также способ электропорации. В зависимости от используемой клетки-хозяина, трансформацию осуществляют, используя стандартные методики, соответствующие таким клеткам. Для прокариот обычно используют обработку кальцием, применяя хлорид кальция, как это описано в ссылке Sambrook et al., см. выше, или электропорацию. Для трансформации некоторых растительных клеток используют инфицирование Agrobacterium tumefaciens, как это описано в ссылке Shaw et al., Gene, 23:315 (1983) и в документе WO 89/05859, опубликованном 29 июня 1989 г. Для клеток млекопитающих без клеточной стенки можно использовать способ с осаждением фосфата кальция, описанный в ссылке Graham and van der Eb, Virology, 52:456-457 (1978). Общие аспекты трансфекции клеток-хозяев млекопитающих были описаны в патенте США № 4399216. Типичные трансформации в дрожжевых клетках проводят по способу, описанному в ссылках Van Solingen et al., J. Bact., 130:946 (1977) и Hsiao et al., Proc. Natl. Acad. Sci. (USA), 76:3829 (1979). Однако также можно применять и другие способы введения ДНК в клетки, в частности ядерную микроинъекцию, электропорацию, слияние бактериальных протопластов с интактными клетками или поликатионы, например полибрен, полиорнитин. Дополнительные сведения по различным методикам трансформации клеток млекопитающих см. в ссылках Keown et al., Methods in Enzymology, 185:527-537 (1990) и Mansour et al., Nature, 336:348-352 (1988).

Подходящие клетки-хозяева для клонирования или экспрессирования ДНК в упоминаемых здесь векторах включают прокариотические, дрожжевые или высшие эукариотические клетки. Подходящие прокариоты включают, но не ограничиваясь ими, эубактерии, грамотрицательные или грамположительные микроорганизмы, например, рода Enterobacteriaceae, такие как E. coli. Общедоступны различные штаммы E. coli, такие как штамм MM294 E. coli K12 (ATCC 31446), E. coli X1776 (ATCC 31537), штамм W3110 E. coli (ATCC 27325) и K5 772 (ATCC 53635). Другие подходящие прокариотические клетки-хозяева включают Enterobacteriaceae, такие как Escherichia, например E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, например Salmonella typhimurium, Serratia, например Serratia marcescans, и Shigella, а также Bacilli, такие как B. subtilis и B. licheniformis (например, B. licheniformis 41P, раскрытый в документе DD 266710, опубликованном 12 апреля 1989 г.), Pseudomonas, такие как P. aeruginosa и Streptomyces. Эти примеры скорее носят иллюстративный характер, чем являются ограничительными. Штамм W3110 является одним из особенно предпочтительных хозяев или предшественников хозяев, поскольку его часто используют как штамм-хозяин для канальной ферментации рекомбинантного IL-17A/F. Предпочтительно, чтобы клетка-хозяин секретировала минимальное количество протеолитических ферментов. Например, штамм W3110 можно модифицировать для получения генетической мутации в генах, кодирующих эндогенные для хозяина белки. Примеры таких хозяев включают штамм 1A2 E. coli W3110 strain 1A2, который имеет полный генотип tonA, штамм 9E4 E. coli W3110, который имеет полный генотип tonA ptr3, штамм 27C7 E. coli W3110 (ATCC 55244), который имеет полный генотип tonA ptr3 phoA E15 (argF-lac)169 degP ompT kan r, штамм 37D6 E. coli W3110, который имеет полный генотип tonA ptr3 phoA E15 (argF-lac)169 degP ompT rbs7 ilvG kan r, штамм 40B4 E. coli W3110, который представляет собой штамм 37D6 с делеционной мутацией degP неканамициновой устойчивости, и штамм E. coli, обладающий мутантной периплазматической протеазой, которая раскрыта в патенте США № 4946783, выданном 7 августа 1990 г. В альтернативном варианте можно использовать способы клонирования in vitro, например PCR или другие полимеразные реакции нуклеиновых кислот.

В дополнение к прокариотам подходящими хозяевами для клонирования или экспрессии векторов, кодирующих IL-17A/F, являются эукариотические микробы, такие как мицелиальные грибы (гифомицеты) или дрожжи. В качестве низшего эукариотического микроорганизма-хозяина часто используют Saccharomyces cerevisiae. Другие подходящие варианты хозяев включают Schizosaccharomyces pombe [Beach and Nurse, Nature, 290: 140 (1981); EP 139383, опубликован 2 мая 1985 г.], Kluyveromyces (патент США № 4943529, Fleer et al., Bio/Technology, 9:968-975 [1991]), такие как, например, K. lactis (MW98-8C, CBS683, CBS4574, Louvencourt et al., J. Bacteriol., 154(2):737-742 [1983]), K. fragilis (ATCC 12424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24178), K. waltii (ATCC 56500), K. drosophilarum (ATCC 36906; Van den Berg et al., Bio/Technology, 8:135 [1990]), K. thermotolerans, и K. marxianus, yarrowia (EP 402226), Pichia pastoris (EP 183070, Sreekrishna et al., J. Basic Microbiol., 28:265-278 [1988]), Candida, Trichoderma reesia (EP 244234), Neurospora crassa (Case et al., Proc. Natl. Acad. Sci. USA, 76:5259-5263 [1979]), Schwanniomyces, такие как Schwanniomyces occidentalis (EP 394538, опубликован 31 октября 1990 г.), и мицелиальные грибы, такие как, например, Neurospora, Penicillium, Tolypocladium (WO 91/00357, опубликован 10 января 1991 г.), и Aspergillus, такие как A. nidulans (Ballance et al., Biochem. Biophys. Res. Commun., 112:284-289 [1983], Tilburn et al., Gene, 26:205-221 [1983], Yelton et al., Proc. Natl. Acad. Sci. USA, 81:1470-1474 [1984]) и A. niger (Kelly and Hynes, EMBO J., 4:475-479 [1985]). Здесь также пригодны метилотрофные дрожжи, включая, но не ограничиваясь ими, дрожжи, способные расти на метаноле, выбранном из родов Hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis и Rhodotorula. Перечень специфических видов, представляющих собой примеры этого класса дрожжей, можно найти в ссылке C. Anthony, The Biochemistry of Methylotrophs, 269 (1982).

Подходящие клетки-хозяева для экспрессии гликозилированного IL-17A/F извлекают из многоклеточных организмов. Примеры клеток беспозвоночных включают клетки насекомых, в частности клетки Drosophila S2 и Spodoptera Sf9 или Spodoptera High 5, а также растительные клетки. Примеры полезных линий клеток-хозяев от млекопитающих включают клетки яичников китайского хомяка (CHO) и клетки COS. Более специфические примеры включают линию почечных клеток обезьяны CV1, трансформированную SV40 (COS-7, ATCC CRL 1651), линию эмбриональных почечных клеток человека (293 или клетки линии 293, субклонированные для выращивания в суспензионной культуре, Graham et al., J. Gen Virol., 36:59 (1977)), клетки яичников китайского хомяка/-DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77:4216 [1980]), клетки мышиной опухоли Сертоли (TM4, Mather, Biol. Reprod., 23:243-251 [1980]), клетки легких человека (W138, ATCC CCL 75), клетки печени человека (Hep G2, HB 8065) и клетки мышиной опухоли молочной железы (MMT 060562, ATCC CCL51). Выбор подходящей клетки-хозяина не выходит за пределы компетенции среднего специалиста.

3. Выбор и использование реплицируемого вектора

Нуклеиновую кислоту (например, кДНК или геномная ДНК), кодирующую IL-17A/F, можно вставить в реплицируемый вектор для клонирования (амплификации ДНК) или для экспрессии. Широко доступны различные векторы. Вектор может, например, существовать в форме плазмиды, космиды, вирусной частицы или фага. Необходимую последовательность нуклеиновой кислоты можно вставить в вектор посредством многих разнообразных процедур. В целом, ДНК вставляют в соответствующий сайт (сайты) рестрикционной эндонуклеазы, применяя методики, известные в данной области техники. Компоненты вектора обычно включают, но не ограничиваясь ими, одну или более сигнальных последовательностей, репликатор, один или более маркерных генов, энхансерный элемент, промотор и терминационную последовательность транскрипции. Конструирование подходящих векторов, содержащих один или более указанных компонентов, основано на применении стандартных методик лигирования, которые известны компетентным специалистам.

Полипептид IL-17A/F можно получить рекомбинантным способом не только напрямую, но и как гибрид с гетерологичным полипептидом, который может представлять собой сигнальную последовательность или другой полипептид, имеющий специфический сайт расщепления на N-конце зрелого белка или полипептида. В целом, сигнальная последовательность может представлять собой компонент вектора или может быть частью ДНК, кодирующей IL-17A/F, которая вставлена в вектор. Сигнальная последовательность может представлять собой прокариотическую сигнальную последовательность, выбранную, например, из группы щелочной фосфатазы, пенициллиназы, lpp или термостабильных лидеров энтеротоксина II. Для секреции в дрожжевых клетках сигнальная последовательность может представлять собой, например, лидер дрожжевой инвертазы, лидер альфа-фактора (включая лидеры α-фактора Saccharomyces и Kluyveromyces, последний описан в патенте США № 5010182) или лидер кислой фосфатазы, лидер глюкоамилазы C. albicans (EP 362179, опубликован 4 апреля 1990 г.) или сигналы, описанные в документе WO 90/13646, опубликованном 15 ноября 1990 г. При экспрессии в клетках млекопитающих для управления секрецией белка можно использовать сигнальные последовательности млекопитающих, например сигнальные последовательности от секретируемых полипептидов того же или родственного биологического вида, а также вирусные секреторные лидеры.

Как векторы экспрессии, так и векторы клонирования содержат последовательность нуклеиновой кислоты, которая придает вектору способность реплицироваться в одном или более отобранных вариантов клетки-хозяина. Такие последовательности хорошо известны для многих бактерий, дрожжей и вирусов. Репликатор плазмиды pBR322 подходит для большинства грамотрицательных бактерий, репликатор плазмиды 2μ подходит для дрожжей, а различные вирусные репликаторы (SV40, полиомы, аденовируса, VSV или BPV) полезны для клонирования векторов в клетках млекопитающих.

Типичные векторы экспрессии и клонирования содержат ген селекции, также известный под названием селектируемый маркер. Типичные гены селекции кодируют белки, которые (a) придают устойчивость к антибиотикам или другим токсинам, например ампициллину, неомицину, метотрексату или тетрациклину, (b) восполняют ауксотрофную недостаточность или (c) поставляют критически важные питательные вещества, отсутствующие в сложной питательной среде, например ген, кодирующий D-аланиновую рацемазу для рода Bacilli.

Примерами подходящих селектируемых маркеров для клеток млекопитающих являются такие маркеры, которые позволяют идентифицировать клетки, способные воспринимать нуклеиновую кислоту, кодирующую IL-17A/F, например DHFR или тимидинкиназа. Подходящей клеткой-хозяином при использовании DHFR дикого типа является клетка CHO с дефицитом активности DHFR, подготовленная и размноженная так, как это описано в ссылке Urlaub et al., Proc. Natl. Acad. Sci. USA, 77:4216 (1980). Подходящим геном селекции для использования в дрожжах является ген trp1, представленный в дрожжевой плазмиде YRp7 [Stinchcomb et al., Nature, 282:39 (1979), Kingsman et al., Gene, 7:141 (1979), Tschemper et al., Gene, 10:157 (1980)]. Ген trp1 предоставляет селектируемый маркер для мутантного штамма дрожжей, утратившего способность к росту на триптофане, например ATCC № 44076 или PEP4-1 [Jones, Genetics, 85:12 (1977)].

Векторы экспрессии и клонирования обычно содержат промотор, функционально связанный с последовательностью нуклеиновой кислоты, кодирующей IL-17A/F, для управления синтезом мРНК. Хорошо известны промоторы, распознаваемые широким рядом потенциальных клеток-хозяев. Промоторы, пригодные для использования в прокариотических хозяевах, включают системы промоторов β-лактамазы и лактозы [Chang et al., Nature, 275:615 (1978), Goeddel et al., Nature, 281:544 (1979)], систему промотора щелочной фосфатазы, триптофана (trp) [Goeddel, Nucleic Acids Res., 8:4057 (1980), EP 36776] и гибридные промоторы, такие как промотор tac [deBoer et al., Proc. Natl. Acad. Sci. USA, 80:21-25 (1983)]. Промоторы для использования в бактериальных системах также содержат последовательность Shine-Dalgarno (S.D.), функционально связанную с ДНК, кодирующей IL-17A/F.

Примеры подходящих промоторных последовательностей для применения в дрожжевых хозяевах включают промоторы для 3-фосфоглицераткиназы [Hitzeman et al., J. Biol. Chem., 255:2073 (1980)] или других гликолитических ферментов [Hess et al., J. Adv. Enzyme Reg., 7:149 (1968), Holland, Biochemistry, 17:4900 (1978)], таких как энолаза, глицеральдегид-3-фостатдегидрогеназа, гексокиназа, пируватдекарбоксилаза, фосфофруктокиназа, глюкозо-6-фосфатизомераза, 3-фосфоглицератмутаза, пируваткиназа, триозофосфатизомераза, фосфоглюкозоизомераза и глюкокиназа.

Другие дрожжевые промоторы, которые являются индуцируемыми промоторами, имеющими дополнительное преимущество транскрипции, контролируемой условиями роста, представляют собой участки промоторов для алкогольдегидрогеназы 2, изоцитохрома C, кислой фосфатазы, деградативных ферментов, связанных с метаболизмом азота, металлотионеина, глицеральдегид-3-фосфатдегидрогеназы и ферментов, ответственных за утилизацию мальтозы и галактозы. Подходящие векторы и промоторы для применения в дрожжевой экспрессии более подробно описаны в документе EP 73657.

Транскрипция IL-17A/F из векторов в клетках-хозяевах млекопитающих управляется, например, промоторами, полученными из геномов вирусов, таких как вирус полиомы, вирус птичьей оспы (fowlpox) (документ UK 2211504, опубликованный 5 июля 1989 г.), аденовирус (например, аденовирус 2), вирус папилломы крупного рогатого скота, вирус птичьей саркомы, цитомегаловирус, ретровирус, вирус гепатита B и вирус обезьян 40 (SV40), из гетерологичных промоторов млекопитающих, например промотора актина или промотора иммуноглобулина, а также из промоторов теплового шока (при том условии, что такие промоторы совместимы с системами клеток-хозяев).

Транскрипцию ДНК, кодирующей IL-17A/F, в клетках-хозяевах высших эукариот можно увеличить за счет вставки в вектор энхансерной последовательности. Энхансеры представляют собой элементы ДНК, действующие в цис-положении, с обычной длиной приблизительно от 10 до 300 пар оснований (bp), которые воздействуют на промотор, увеличивая его транскрипцию. Сейчас известны многие энхансерные последовательности из генов млекопитающих (глобина, эластазы, альбумина, α-фетопротеина и инсулина). Однако в типичном случае используется энхансер из вируса эукариотической клетки. Примеры включают энхансер SV40 на поздней стороне репликатора (bp 100-270), ранний энхансер промотора цитомегаловируса, энхансер полиомы на поздней стороне репликатора и энхансеры аденовируса. Энхансер может быть сплайсирован в вектор в положениях 5' или 3' кодирующей последовательности IL-17A/F, но, предпочтительно, чтобы он был локализован в сайте 5' относительно промотора.

Векторы экспрессии, используемые в эукариотических клетках-хозяевах (дрожжевых, грибковых, насекомых, растений, животных, человека или в ядерных клетках других многоклеточных организмов), также содержат последовательности, необходимые для терминации транскрипции и для стабилизации мРНК. Такие последовательности обычно имеются в 5' и в редких случаях в 3' нетранслируемых участках эукариотических или вирусных ДНК и кДНК. Такие участки содержат нуклеотидные сегменты, транскрибируемые как полиаденилированные фрагменты в нетранслируемую часть мРНК, кодирующей IL-17A/F.

Другие известные способы, векторы и клетки-хозяева, пригодные для адаптации к синтезу IL-17A/F в культуре рекомбинантных клеток позвоночных, описаны в ссылках Gething et al., Nature, 293:620-625 (1981), Mantei et al., Nature, 281:40-46 (1979), EP 117060 и EP 117058.

4. Выявление амплификации/экспрессии гена

Амплификацию и/или экспрессию гена в образце можно измерить прямым образом, например традиционными способами саузерн-блоттинга, нозерн-блоттинга для количественной оценки транскрипции мРНК (Thomas, Proc. Natl. Acad. Sci. USA, 77:5201-5205 [1980]), дот-блоттинга (анализа ДНК) или гибридизации in situ, используя соответственно меченый зонд на основе раскрытых здесь последовательностей. В альтернативном варианте можно использовать антитела, которые могут распознавать специфические дуплексы, включая дуплексы ДНК, дуплексы РНК и гибридные дуплексы ДНК-РНК или дуплкесы ДНК-белок. Антитела, в свою очередь, могут быть мечеными, что позволяет провести анализ связывания дуплекса с поверхностью, так что при формировании дуплекса на поверхности можно выявить присутствие антитела, связанного с дуплексом.

В альтернативном варианте можно измерить экспрессию гена иммунологическими способами, например иммуногистохимическим окрашиванием клеток или тканевых срезов и анализом культуры клеток или биологических жидкостей с целью прямого количественного определения экспрессии продукта гена. Антитела, полезные для иммуногистохимического окрашивания и/или анализа образцов жидкостей могут представлять собой либо моноклональные, либо поликлональные антитела и могут быть получены от любого млекопитающего. Удобно изготовить антитела против природной последовательности полипептида IL-17A/F или против синтетического пептида, основанного на предложенных здесь последовательностях ДНК, или против экзогенной последовательности, слитой с ДНК, кодирующей IL-17A/F и кодирующей эпитоп специфического антитела.

5. Очистка полипептида

Формы полипептида IL-17A/F можно восстановить из культуральной среды или из лизата клеток-хозяев. При связывании с мембраной полипептид можно высвободить из мембраны, применяя раствор подходящего детергента (например, Triton-X 100) или посредством ферментативного расщепления. Клетки, задействованные в экспрессии IL-17A/F, можно разрушить различными физическими или химическими средствами, например циклическим замораживанием-оттаиванием, обработкой ультразвуком, механическим разрушением или агентами, вызывающими лизис клеток.

Может оказаться желательной очистка IL-17A/F от белков или полипептидов рекомбинантных клеток. Образцовыми примерами подходящих процедур очистки являются следующие процедуры: фракционирование в ионообменной колонке, осаждение этанолом, обращенно-фазовая HPLC, хроматография на силикагелевой или катионообменной смоле, например на DEAE, хроматофокусирование, SDS-PAGE, осаждение сульфатом аммония, гель-фильтрация с применением, например, колонок Sephadex G-75 или protein A Sepharose для удаления таких загрязнений, как IgG, а также применение колонок с металлическим хелатообразованием для связывания форм IL-17A/F, меченых эпитопом. Можно применять различные способы очистки белков, которые известны в данной области техники и описаны, например, в ссылке Deutscher, Methods in Enzymology, 182 (1990); Scopes, Protein Purification: Principles and Practice, Springer-Verlag, New York (1982). Выбор этапа (этапов) очистки зависит, например, от сущности используемого процесса выработки и особенностей полученного полипептида IL-17A/F.

E. Возможности применения IL-17A/F

Нуклеотидные последовательности (или их комплементы), кодирующие IL-17A/F, имеют различные возможности применения в области молекулярной биологии, включая применение в качестве зондов гибридизации для картирования хромосом и генов, а также для получения антисмысловой РНК и ДНК. Нуклеиновая кислота IL-17A/F также полезна для изготовления полипептидов IL-17A/F посредством описанных здесь рекомбинантных методик.

Ген IL-17A/F с полноразмерной природной последовательностью или его части могут быть использованы как зонды гибридизации в библиотеке кДНК для выделения полноразмерной кДНК IL-17A/F или для выделения других кДНК (например, кДНК, кодирующих варианты IL-17A/F, встречающиеся в природе, или полипептиды IL-17A/F от других биологических видов), которые имеют желательную идентичность последовательности с раскрытой здесь природной последовательностью IL-17A/F. По выбору длина зондов может составлять приблизительно от 20 до 50 оснований. Зонды гибридизации могут быть получены из по меньшей мере частично новых участков полноразмерной природной нуклеотидной последовательности, в которой эти участки можно определить без излишнего экспериментирования, или из геномных последовательностей, включающих промоторные, энхансерные элементы и интроны природной последовательности IL-17A/F. В качестве примера, способ скрининга может включать выделение кодирующего региона гена IL-17A/F с применением известной последовательности ДНК для того, чтобы синтезировать выбранный зонд длиной приблизительно 40 оснований. Зонды гибридизации можно маркировать множеством меток, включая радионуклиды, такие как 32P или 35S, либо ферментативные метки, такие как щелочная фосфатаза, присоединенная к зонду посредством систем соединений биотин/авидин. Меченые зонды, имеющие комплементарную последовательность с последовательностью гена IL-17A/F, рассматриваемой в настоящем изобретении, можно применять для скрининга библиотек кДНК, геномной ДНК или мРНК человека, чтобы определить, с какими членами этих библиотек будет гибридизироваться зонд. Методики гибридизации более подробно описаны в приведенных ниже примерах.

Подобным образом, любые последовательности EST, раскрытые в настоящей заявке, можно применять в качестве зондов, используя раскрытые здесь же способы.

Другие полезные фрагменты нуклеиновых кислот IL-17A/F включают антисмысловые или смысловые олигонуклеотиды, содержащие однонитевую последовательность нуклеиновой кислоты (РНК или ДНК), способную связываться с целевыми последовательностями мРНК IL-17A/F (смысловой) или ДНК IL-17A/F (антисмысловой). В соответствии с настоящим изобретением антисмысловые или смысловые олигонуклеотиды содержат фрагмент кодирующего региона ДНК IL-17A/F. Такой фрагмент обычно содержит по меньшей мере приблизительно 14 нуклеотидов, предпочтительнее, приблизительно от 14 до 30 нуклеотидов. Возможность извлечения антисмыслового или смыслового олигонуклеотида на основе последовательности кДНК, кодирующей заданный белок, описана, например, в ссылках Stein and Cohen (Cancer Res. 48:2659, [1988]) и van der Krol et al. (BioTechniques, 6:958, [1988]).

Связывание смысловых или антисмысловых олигонуклеотидов с целевыми последовательностями нуклеиновой кислоты приводит к образованию дуплексов, которые блокируют транскрипцию или трансляцию целевой последовательности одним из нескольких способов, включая усиленное разрушение дуплексов, преждевременную терминацию транскрипции или трансляции или каким-либо иным способом. Таким образом, антисмысловые олигонуклеотиды можно использовать для блокирования экспрессии белков IL-17A/F. Кроме того, антисмысловые или смысловые олигонуклеотиды могут иметь модифицированные сахарно-фосфодиэфирные каркасы (или другие сахарные связи, например описанные в документе WO 91/06629), причем такие сахарные связи устойчивы к эндогенным нуклеазам. Такие олигонуклеотиды с устойчивыми сахарными связями стабильны in vivo (то есть способны противостоять ферментативному разрушению), но при этом сохраняют специфичность последовательности, будучи способными связываться с целевыми нуклеотидными последовательностями.

Другие примеры смысловых или антисмысловых олигонуклеотидов включают такие олигонуклеотиды, которые ковалентно связаны с органическими компонентами, например, описанными в документе WO 90/10048, а также с другими компонентами, которые повышают аффинность олигонуклеотида к целевой последовательности нуклеиновой кислоты, например, с поли-(L-лизином). Более того, к смысловым или антисмысловым олигонуклеотидам могут быть присоединены вставочные агенты, такие как эллиптицин, и алкилирующие агенты или комплексы металлов, модифицирующие специфичность связывания антисмыслового или смыслового олигонуклеотида с целевой нуклеотидной последовательностью.

Антисмысловые или смысловые олигонуклеотиды можно ввести в клетку, содержащую целевую последовательность нуклеиновой кислоты, посредством любого способа переноса генов, включая, например, CaPO4-опосредованную трансфекцию ДНК, электропорацию или применяя векторы для переноса генов, например вирус Эпштейна-Барра (Epstein-Barr). В предпочтительной процедуре антисмысловой или смысловой олигонуклеотид вставлен в подходящий ретровирусный вектор. Клетку, содержащую целевую последовательность нуклеиновой кислоты, вводят в контакт с рекомбинантным ретровирусным вектором или in vivo, или ex vivo. Подходящие ретровирусные векторы включают, но не ограничиваясь ими, векторы, полученные из мышиного ретровируса M-MuLV, N2 (ретровирус, полученный из M-MuLV), или двухкопийные векторы, обозначаемые DCT5A, DCT5B и DCT5C (см. документ WO 90/13641).

Смысловые и антисмысловые олигонуклеотиды можно также ввести в клетку, содержащую целевую нуклеотидную последовательность, посредством образования конъюгата с лигандсвязывающей молекулой, как это описано в документе WO 91/04753. Подходящие лигандсвязывающие молекулы включают, но не ограничиваясь ими, рецепторы клеточной поверхности, факторы роста, прочие цитокины или другие лиганды, которые связываются с рецепторами клеточной поверхности. Предпочтительно, чтобы конъюгация лигандсвязывающей молекулы существенно не нарушала способность лигандсвязывающей молекулы связываться с соответствующей ей молекулой или рецептором, а также не блокировала вход в клетку для смыслового или антисмыслового олигонуклеотида либо его конъюгированного варианта.

В альтернативном варианте смысловой или антисмысловой олигонуклеотид можно ввести в клетку, содержащую целевую нуклеиновую кислоту, посредством формирования олигонуклеотидно-липидного комплекса, как это описано в документе WO 90/10448. Предпочтительно, чтобы смысловой или антисмысловой олигонуклеотидно-липидный комплекс был диссоциирован в клетке эндогенной липазой.

Антисмысловые и смысловые молекулы РНК или ДНК обычно имеют длину по меньшей мере приблизительно 5 оснований, приблизительно 10 оснований, приблизительно 15 оснований, приблизительно 20 оснований, приблизительно 25 оснований, приблизительно 30 оснований, приблизительно 35 оснований, приблизительно 40 оснований, приблизительно 45 оснований, приблизительно 50 оснований, приблизительно 55 оснований, приблизительно 60 оснований, приблизительно 65 оснований, приблизительно 70 оснований, приблизительно 75 оснований, приблизительно 80 оснований, приблизительно 85 оснований, приблизительно 90 оснований, приблизительно 95 оснований, приблизительно 100 оснований или более.

Зонды также можно задействовать в методиках PCR для генерирования пула последовательностей с целью идентификации близкородственных последовательностей, кодирующих IL-17A/F.

Нуклеотидные последовательности, кодирующие IL-17A/F, можно также использовать для конструирования зондов гибридизации с целью картирования гена, который кодирует указанный полипептид IL-17A/F, а также для генетического анализа индивидов с генетическими заболеваниями. Предлагаемые здесь нуклеотидные последовательности можно картировать на хромосоме и в специфических участках хромосомы, применяя известные методики, такие как гибридизация in situ, анализ сцепления с известными хромосомными маркерами и гибридизационный скрининг библиотек.

В тех случаях, когда кодирующие последовательности для IL-17A/F кодируют белок, который связывается с другим белком (например, если белок является рецептором), такой белок можно использовать в анализах по идентификации других белков или молекул, вовлеченных во взаимодействие связывания. Применяя такие способы, можно идентифицировать взаимодействие ингибиторов взаимодействия рецепторов/лигандов при связывании. Белки, вовлеченные в такие взаимодействия связывания, можно также применять для скрининга пептидных или мелкомолекулярных ингибиторов или агонистов взаимодействия при связывании. Кроме того, рецепторный белок можно использовать для выделения коррелятивного лиганда (лигандов). Можно спланировать скринирующие анализы для нахождения соединений свинца, которые имитируют биологическую активность природного IL-17A/F или рецептора к IL-17A/F. Такие скринирующие анализы пригодны для высокопроизводительного скрининга химических библиотек, что делает их особенно удобными для идентификации мелких молекул-кандидатов на роль лекарства. Рассматриваемые здесь мелкие молекулы включают синтетические органические или неорганические соединения. Анализы можно выполнять во множестве форматов, включая анализы связывания белка с белком, анализы типа биохимического скрининга, иммунологические анализы и анализы на клеточной основе, которые хорошо описаны в данной области техники.

Нуклеиновые кислоты, которые кодируют IL-17A/F, или их модифицированные формы, можно также использовать при создании или трансгенных животных, или "нокаутных" животных, которые, в свою очередь, полезны для разработки и скрининга терапевтически полезных реактивов. Трансгенное животное (например, мышь или крыса) представляет собой животное, обладающее клетками, которые содержат трансген, причем этот трансген был введен в животное или в предшественника животного на пренатальной, например на эмбриональной, стадии развития. Трансген представляет собой ДНК, интегрированную в геном клетки, из которой развивается трансгенное животное. В одном из вариантов осуществления изобретения кДНК, кодирующую IL-17A/F, можно использовать для клонирования геномной ДНК, кодирующей IL-17A/F, в соответствии с признанными методиками, а также для клонирования геномных последовательностей, которые используются при создании трансгенных животных, содержащих клетки, которые экспрессируют ДНК, кодирующую IL-17A/F. Способы создания трансгенных животных, особенно таких, как мыши и крысы, стали вполне обычными в данной области и описаны, например, в патентах США № 4736866 и 4870009. В типичном варианте можно выбрать определенные клетки в качестве мишени для внедрения трансгена IL-17A/F вместе с тканеспецифическими энхансерами. Трансгенных животных, которые несут копию трансгена, кодирующего IL-17A/F, введенного в зародышевую линию клеток животного на эмбриональной стадии, можно использовать для исследования эффекта повышенной экспрессии ДНК, кодирующей IL-17A/F. Таких животных можно использовать в качестве тестеров для реактивов, предположительно, создающих защиту, например, от патологических состояний, связанных с избыточной экспрессией. В соответствии с этим аспектом изобретения животное подвергают воздействию испытуемого реактива, и сниженная частота патологического состояния по сравнению с животными, не получавшими лечения, но несущими трансген, будет указывать на потенциальное лечебное вмешательство при этом патологическом состоянии.

В альтернативном варианте можно использовать гомологи IL-17A/F нечеловеческого происхождения для конструирования "нокаутного" по IL-17A/F животного, которое имеет дефектный или измененный ген, кодирующий IL-17A/F в результате гомологичной рекомбинации между эндогенным геном, кодирующим IL-17A/F, и измененной геномной ДНК, кодирующей IL-17A/F, которая была введена в эмбриональную стволовую клетку животного. Например, кДНК, кодирующую IL-17A/F, можно использовать для клонирования геномной ДНК, кодирующей IL-17A/F, в соответствии с признанными методиками. Часть геномной ДНК, кодирующей IL-17A/F, можно делетировать или заместить другим геном, например геном, кодирующим селектируемый маркер, который можно использовать для мониторинга интеграции. В типичном случае несколько килобаз неизмененной фланкирующей ДНК (как на 5', так и на 3' концах) включают в вектор [см., например., Thomas and Capecchi, Cell, 51:503 (1987) для характеристики гомологичных векторов рекомбинации]. Далее отбирают вектор, введенный в линию эмбриональных стволовых клеток (например, посредством электропорации), и клетки, в которых введенная ДНК гомологично рекомбинирована с эндогенной ДНК [см., например., Li et al., Cell, 69:915 (1992)]. Затем отобранные клетки посредством инъекции вводят в бластоцисту животного (например, мыши или крысы) для формирования агрегированных химер [см., например, Bradley, в Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), p. 113-152]. Затем химерный эмбрион можно имплантировать подходящей ложнобеременной самке животного (суррогатной матери), которая выносит эмбрион до конца беременности, чтобы можно было получить "нокаутное" животное. Потомство, унаследовавшее гомологично рекомбинантную ДНК и несущее ее в своих зародышевых клетках, можно идентифицировать, применяя стандартные методики, и использовать для разведения животных, у которых все клетки организма содержат гомологично рекомбинированную ДНК. Нокаутных животных можно охарактеризовать, например, по их способности противостоять некоторым патологическим состояниям, а также по развитию у них патологических состояний, связанных с отсутствием полипептида IL-17A/F.

Нуклеиновую кислоту, кодирующую полипептиды IL-17A/F, можно также использовать в генотерапии. В приложениях генотерапии гены вводят в клетки, чтобы достичь in vivo синтеза терапевтически эффективного генетического продукта, например, для замещения дефектного гена. "Генотерапия" включает как традиционную генотерапию, при которой утраченный эффект компенсируется единственным лечебным замещением, так и введение генотерапевтических агентов, которое заключается в одноразовом или повторном введении терапевтически эффективной ДНК или мРНК. Антисмысловые РНК и ДНК можно использовать как терапевтические агенты для блокирования экспрессии определенных генов in vivo. Было показано, что короткие антисмысловые олигонуклеотиды можно импортировать в клетки, где они будут действовать как ингибиторы, несмотря на низкую внутриклеточную концентрацию, обусловленную их ограниченным поглощением через клеточную мембрану (Zamecnik et al., Proc. Natl. Acad. Sci. USA, 83:4143-4146 [1986]). Для того чтобы увеличить поглощение олигонуклеотидов, их можно модифицировать, например, посредством замещения отрицательно заряженных фосфодиэфирных групп на незаряженные группы.

Имеется множество доступных методик для введения нуклеиновых кислот в жизнеспособные клетки. Эти методики варьируются в зависимости от того, производится ли перенос нуклеиновой кислоты в культивируемые клетки in vitro или их переносят in vivo в клетки целевого хозяина. Методики, пригодные для переноса нуклеиновой кислоты в клетки млекопитающих in vitro, включают применение липосом, электропорацию, микроинъекцию, слияние клеток, DEAE-декстран, метод осаждения фосфатом кальция и т.д. Предпочтительные современные методики переноса генов in vivo включают трансфекцию вирусными (предпочтительно, ретровирусными) векторами и трансфекцию, опосредованную белками-липосомами вирусной оболочки (Dzau et al., Trends in Biotechnology, 11: 205-210 [1993]). В некоторых ситуациях желательно, чтобы источником доставки нуклеиновой кислоты служил агент, нацеленный на клетки-мишени, например антитело, специфичное к мембранному белку клеточной поверхности, или к целевой клетке, лиганд для рецептора на целевой клетке и т.д. В тех случаях, когда используются липосомы, белки, которые связываются с мембранным белком клеточной поверхности, ассоциированным с эндоцитозом, могут быть использованы для нацеливания и/или для облегчения поглощения, например, капсидных белков или их фрагментов, тропных к особому типу клеток, антител к белкам, которые подвергаются циклической интернализации, белков, которые нацелены на внутриклеточную локализацию и имеют увеличенный период внутриклеточного полураспада. Методика эндоцитоза, опосредованного рецепторами, описана, например, в ссылках Wu et al., J. Biol. Chem., 262: 4429-4432 (1987) и Wagner et al., Proc. Natl. Acad. Sci. USA, 87: 3410-3414 (1990). Обзор по протоколам маркирования генов и генотерапии см. в ссылке Anderson et al., Science, 256: 808-813 (1992).

Описанные здесь полипептиды IL-17A/F можно также использовать как маркеры молекулярного веса в целях белкового электрофореза, а выделенные последовательности нуклеиновой кислоты можно использовать для рекомбинантной экспрессии этих маркеров.

Описанные здесь молекулы нуклеиновой кислоты, кодирующие полипептиды IL-17A/F или их фрагменты, полезны для идентификации хромосом. В этом отношении имеется насущная потребность в идентификации новых хромосомных маркеров, и в настоящее время становятся доступными относительно новые реактивы, маркирующие хромосомы и основанные на фактических данных о последовательностях. Каждую молекулу нуклеиновой кислоты IL-17A/F, предлагаемую настоящим изобретением, можно использовать в качестве хромосомного маркера.

Предлагаемые настоящим изобретением полипептиды IL-17A/F и соответствующие молекулы нуклеиновых кислот можно также использовать в диагностических целях для тканевого типирования, при котором указанные полипептиды IL-17A/F могут по-разному дифференцироваться в одной ткани по сравнению с другой тканью, предпочтительно, в больной ткани по сравнению со здоровой тканью одного и того же тканевого типа. Молекулы нуклеиновых кислот IL-17A/F найдут применение при создании зондов для PCR, нозерн-анализа, саузерн-анализа и вестерн-анализа.

Описанные здесь полипептиды IL-17A/F можно также использовать в качестве терапевтических средств. Предлагаемые настоящим изобретением полипептиды IL-17A/F можно вводить в лекарственные рецептуры в соответствии с известными способами изготовления фармацевтически полезных композиций, в которых продукт IL-17A/F комбинируют с фармацевтически приемлемым носителем, осуществляющим доставку. Лекарственные составы готовят для хранения, смешивая активные ингредиенты, имеющие желательную степень чистоты с факультативными физиологически приемлемыми носителями, наполнителями или стабилизаторами (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)) в виде лиофилизированных композиций или водных растворов. Приемлемые носители, наполнители или стабилизаторы нетоксичны для реципиентов в применяемых дозах и концентрациях и включают такие буферы, как фосфат, цитрат и другие органические кислоты, антиоксиданты, включая аскорбиновую кислоту, полипептиды низкого молекулярного веса (менее 10 аминокислотных остатков), белки, такие как сывороточный альбумин, желатин или иммуноглобулины, гидрофильные полимеры, такие как поливинилпирролидон, аминокислоты, такие как глицин, глутамин, аспарагин, аргинин или лизин, моносахариды, дисахариды и другие углеводы, включая глюкозу, маннозу или декстрины, хелатообразующие агенты, такие как EDTA, сахарные спирты, такие как маннит или сорбит, солеобразующие противоионы, такие как натрий, и/или неионные сурфактанты, такие как TWEEN™, PLURONICSTM или PEG.

Лекарственные составы, предназначенные для введения in vivo, должны быть стерильными. Это легко достигается посредством фильтрации через стерильные фильтрующие мембраны, проводимой до или после лиофилизации и восстановления.

Рассматриваемые здесь терапевтические композиции обычно помещают в контейнер, имеющий стерильный канал для доступа, например пакет или флакон для внутривенного раствора с пробкой, которую можно проколоть иглой для подкожной инъекции.

Способ введения выбирают в соответствии с известными методиками, например инъекция или вливание через внутривенный, внутрибрюшинный, внутримозговой, внутримышечный, внутриглазной, внутриартериальный доступ или через доступ внутрь очага патологии, местное введение или введение при помощи системы пролонгированного высвобождения лекарства.

Дозировки и желательные концентрации лекарств в фармацевтических композициях, предлагаемых настоящим изобретением, могут варьироваться в зависимости от конкретной намеченной цели. Определение соответствующей дозировки или способа введения полностью находится в пределах компетенции среднего врача. Достаточно надежным и проверенным способом определить эффективные дозировки для человека являются эксперименты на животных. Межвидовой пересчет эффективных доз можно провести, следуя принципам, описанным в ссылке Mordenti, J. and Chappell, W. "The use of interspecies scaling in toxicokinetics" в книге Toxicokinetics and New Drug Development, Yacobi et al., Eds., Pergamon Press, New York 1989, p. 42-96.

Если применяют введение полипептида IL-17A/F или его агониста/антагониста in vivo, то количество активного вещества в нормальной дозировке может варьироваться в приблизительном диапазоне от 10 нг/кг до 100 мг/кг или более по весу тела млекопитающего в день, предпочтительно, приблизительно от 1 мкг/кг/день до 10 мг/кг/день (в зависимости от способа введения). Руководящие указания по конкретным дозировкам и способам доставки представлены в литературе (см., например, патенты США № 4657760, 5206344 или 5225212. Ожидается, что различные рецептурные составы будут эффективными для разных лекарственных соединений и для разных заболеваний, а введение лекарства, нацеленное, например, на какой-либо определенный орган или ткань, может потребовать доставки иным способом, чем в другой орган или другую ткань.

Если представляется желательным введение полипептида IL-17A/F с пролонгированным высвобождением в лекарственной композиции, обладающей такими характеристиками высвобождения, которые подходят для лечения какого-либо заболевания или расстройства, требующего введения полипептида IL-17A/F, целесообразно рассмотреть такой вариант, как микроинкапсулирование полипептида IL-17A/F. Микроинкапсулирование рекомбинантных белков для пролонгированного высвобождения было успешно осуществлено с гормоном роста человека (rhGH), интерфероном- (rhIFN- ), интерлейкином-2 и MN rgp120. Johnson et al., Nat. Med., 2:795-799 (1996); Yasuda, Biomed. Ther., 27:1221-1223 (1993); Hora et al., Bio/Technology, 8:755-758 (1990); Cleland, "Design and Production of Single Immunization Vaccines Using Polylactide Polyglycolide Microsphere Systems," in Vaccine Design: The Subunit and Adjuvant Approach, Powell and Newman, eds, (Plenum Press: New York, 1995), p. 439-462; WO 97/03692, WO 96/40072, WO 96/07399 и патент США № 5654010.

Были разработаны лекарственные рецептуры для пролонгированного высвобождения этих белков с применением полимера полимолочногликолевой кислоты (PLGA) вследствие его биологической совместимости и широкого спектра свойств биологического разложения. Продукты распада PLGA, молочная и гликолевая кислоты, могут быстро метаболизироваться в организме человека. Кроме того, временной профиль распада этого полимера можно отрегулировать от нескольких месяцев до нескольких лет в зависимости от его молекулярного веса и от состава композиции. Lewis, "Controlled release of bioactive agents from lactide/glycolide polymer," в книге: M. Chasin and R. Langer (Eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990), p. 1-41.

Настоящее изобретение охватывает способы скрининга соединений для идентификации имитаторов полипептида IL-17A/F (агонистов) или блокаторов действия полипептида IL-17A/F (антагонистов). Анализы скрининга кандидатов на роль антагониста направлены на то, чтобы выявить соединения, которые связываются или комплексируются с полипептидами IL-17A/F, кодируемыми идентифицированными здесь генами, либо иным образом создают помехи для взаимодействия кодируемых полипептидов с другими клеточными белками. Такие анализы скрининга включают анализы, позволяющие осуществлять высокопроизводительный скрининг химических библиотек, что делает их особенно удобными для идентификации мелкомолекулярных лекарств-кандидатов.

Анализы можно выполнять во множестве форматов, включая анализы связывания белка с белком, анализы типа биохимического скрининга, иммунологические анализы и анализы на клеточной основе, которые хорошо описаны в данной области техники.

Все анализы для скрининга антагонистов имеют то общее свойство, что они требуют обязательного контакта лекарства-кандидата с полипептидом IL-17A/F, кодируемым идентифицированной здесь нуклеиновой кислотой, в таких условиях и с течением такого времени, которые позволяют этим двум компонентам взаимодействовать друг с другом.

В анализах связывания взаимодействие представляет собой связывание, в результате которого образуется комплекс, который можно выделить из реакционной смеси или обнаружить в ней. В специфическом варианте осуществления изобретения полипептид IL-17A/F, кодируемый идентифицированным здесь геном, или лекарство-кандидат иммобилизуют на твердой фазе, например на титрационном микропланшете, посредством ковалентного или нековалентного присоединения. Нековалентное присоединение обычно осуществляется при покрытии твердой поверхности раствором полипептида IL-17A/F с последующим высушиванием. В альтернативном варианте можно использовать иммобилизованное антитело, например моноклональное антитело, специфичное к полипептиду IL-17A/F, для прикрепления этого полипептида к твердой поверхности. Анализ проводят, добавляя немобилизованный компонент, который может быть снабжен поддающейся выявлению меткой, к иммобилизованному компоненту, например к покрытой поверхности, содержащей фиксированный компонент. По окончании реакции непрореагировавшие компоненты удаляют, например, отмыванием, после чего проводят выявление комплексов, зафиксированных на твердой поверхности. Если поддающейся выявлению меткой снабжен компонент, который изначально не был иммобилизован, то выявление метки, иммобилизованной на поверхности, будет свидетельствовать о том, что произошло комплексирование. Если изначально неиммобилизованный компонент не был снабжен меткой, то комплексирование можно выявить, например, применяя меченое антитело, специфически связывающееся с иммобилизованным комплексом.

Если соединение-кандидат взаимодействует, но не связывается с конкретным полипептидом IL-17A/F, кодируемым идентифицированным здесь геном, его взаимодействие с этим полипептидом можно проанализировать хорошо известными способами для выявления взаимодействий белок-белок. Такие анализы включают традиционные подходы, например перекрестное сшивание, совместную иммунопреципитацию и совместную очистку при пропускании через градиенты или хроматографическую колонку. В дополнение к этому, взаимодействия типа белок-белок можно мониторировать, применяя основанную на дрожжах генетическую систему, описанную Fields с соавторами (Fields and Song, Nature (London), 340:245-246 [1989]), Chien et al., Proc. Natl. Acad. Sci. USA, 88:9578-9582 [1991]), как это раскрыто в ссылке Chevray and Nathans, Proc. Natl. Acad. Sci. USA, 89:5789-5793 (1991). Многие транскрипционные активаторы, такие как дрожжевой ядерный белок GAL4, состоят из двух физически раздельных модульных доменов, один из которых действует как домен, связывающий ДНК, а другой функционирует как домен, активирующий транскрипцию. Система дрожжевой экспрессии, описанная в указанных выше публикациях (обычно упоминаемая под названием "системах двойных гибридов"), имеет преимущество, связанное именно с этой особенностью, то есть использует два гибридных белка, один из которых представляет собой целевой белок, слитый с ДНК-связывающим доменом GAL4, а другой представляет собой белок-кандидат активации, слитый с доменом активации. Экспрессия гена-репортера GAL1-lacZ под контролем GAL4-активированного промотора зависит от восстановления активности GAL4 через взаимодействие белок-белок. Колонии, содержащие взаимодействующие полипептиды, выявляют с хромогенным субстратом для β-галактозидазы. Полный набор (MATCHMAKERTM) для идентификации взаимодействий белок-белок между двумя специфическими белками с применением методики двойных гибридов можно приобрести на коммерческой основе в компании Clontech. Применение этой системы также можно распространить на картирование белковых доменов, вовлеченных в специфические белковые взаимодействия, а также на высокоточное определение аминокислотных остатков, критически важных для этих взаимодействий.

Соединения, которые могут вмешиваться во взаимодействие идентифицированного здесь гена, кодирующего полипептид IL-17A/F, с другими внутриклеточными или внеклеточными компонентами, можно протестировать следующим образом: обычно готовят реакционную смесь, содержащую продукт гена и внутри- или внеклеточный компонент, в таких условиях и в течение такого времени, которые позволяют двум продуктам вступить во взаимодействие и связаться друг с другом. Для того чтобы проверить способность соединения-кандидата подавлять связывание, реакцию проводят как при наличии испытуемого соединения, так и в его отсутствие. В дополнение к этому, к третьему образцу реакционной смеси можно добавить плацебо в роли фактора положительного контроля. Связывание (образование комплекса) между испытуемым соединением и внутри- или внеклеточным компонентом, присутствующим в смеси, мониторируют так, как это описано здесь выше. Образование комплекса в контрольной реакции (реакциях), но не в реакционной смеси, содержащей испытуемое соединение, указывает на то, что испытуемое соединение препятствует взаимодействию продукта гена и его партнера в реакции.

Для скринирующего анализа антагонистов полипептид IL-17A/F можно добавить к клетке вместе с соединением, проходящим скрининг на подавление определенной активности, причем способность соединения подавлять указанную активность в присутствии полипептида IL-17A/F указывает на то, что это соединение является антагонистом полипептида IL-17A/F. В альтернативном варианте антагонисты можно выявлять, комбинируя полипептид IL-17A/F и потенциальный антагонист с мембранными рецепторами к полипептиду IL-17A/F или с рекомбинантными рецепторами в подходящих условиях для анализа на конкурентное ингибирование. Полипептид IL-17A/F может быть снабжен меткой, например радиоактивной, чтобы количество молекул полипептида IL-17A/F, связанных с рецептором, можно было использовать как критерий для оценки эффективности потенциального антагониста. Ген, кодирующий рецептор, можно идентифицировать многими способами, известными компетентному специалисту, например пэннингом лиганда и сортировкой FACS. Coligan et al., Current Protocols in Immun., 1(2): Chapter 5 (1991). В предпочтительном варианте используют клонирование экспрессии, для которого полиаденилированную РНК готовят из клетки, восприимчивой к полипептиду IL-17A/F, а библиотеку кДНК, созданную из этой РНК, разделяют на пулы и используют для трансфицирования клеток COS или других клеток, которые невосприимчивы к полипептиду IL-17A/F. Трансфицированные клетки, выращенные на предметных стеклах, вводят в контакт с меченым полипептидом IL-17A/F. Полипептид IL-17A/F можно метить многими способами, включая йодирование или включение сайта распознавания для сайт-специфической протеинкиназы. После фиксации и инкубации предметные стекла подвергают авторадиографическому анализу. Идентифицируют позитивные пулы, получают подпулы и проводят повторную трансфекцию, применяя процесс интерактивного объединения в подпулы и повторного скрининга, чтобы в конечном итоге получить единственный клон, который кодирует предполагаемый рецептор.

При альтернативном подходе к идентификации рецептора меченый полипептид IL-17A/F можно фотоаффинно связать с клеточной мембраной или с экстрактивными препаратами, которые экспрессируют молекулу рецептора. Поперечно сшитый материал разделяют, используя методику PAGE, и экспонируют на рентгеновской пленке. Меченый комплекс, содержащий рецептор, можно вырезать, разложить на пептидные фрагменты и подвергнуть белковому микросеквенированию. Аминокислотную последовательность, полученную в результате микросеквенирования, используют для конструирования набора вырожденных олигонуклеотидных зондов, которыми можно скринировать библиотеку кДНК с целью идентификации гена, кодирующего предполагаемый рецептор.

В другом скринирующем анализе для выявления антагонистов клетки млекопитающих или их мембранный препарат, экспрессирующий рецептор, инкубируют с меченым полипептидом IL-17A/F в присутствии соединения-кандидата. Затем можно количественно оценить способность соединения усиливать или блокировать это взаимодействие.

Более специфические примеры потенциальных антагонистов включают олигонуклеотид, который связывается с гибридами иммуноглобулина и полипептида IL-17A/F, и, в особенности, антитела, включая (без ограничения) поли- и моноклональные антитела и фрагменты антител, одноцепочечные антитела, антиидиотипические антитела, химерные или гуманизированные версии таких антител или их фрагментов, а также антитела человека и их фрагменты. В альтернативном варианте потенциальный антагонист может представлять собой близкородственный белок, например мутантную форму полипептида IL-17A/F, которая распознает рецептор, но не дает никакого эффекта, следовательно, конкурентно ингибирует действие полипептида IL-17A/F.

Еще одним потенциальным антагонистом полипептида IL-17A/F является антисмысловая конструкция РНК или ДНК, изготовленная с применением антисмысловой технологии, когда, например, антисмысловая молекула РНК или ДНК действует, напрямую блокируя трансляцию мРНК за счет гибридизации с целевой мРНК, то есть предупреждая трансляцию в белок. Антисмысловую технологию можно использовать для управления экспрессией генов через образование тройной спирали или создание антисмысловой ДНК/РНК, причем оба указанных способа основаны на связывании полинуклеотида с ДНК или РНК. Например, 5'-кодирующую часть полинуклеотидной последовательности, которая кодирует указанные здесь зрелые полипептиды IL-17A/F, используют для конструирования олигонуклеотида антисмысловой РНК длиной приблизительно от 10 до 40 пар оснований. Олигонуклеотид ДНК конструируют так, чтобы он был комплементарен участку гена, вовлеченному в транскрипцию (тройная спираль - см. ссылки Lee et al., Nucl. Acids Res., 6:3073 (1979), Cooney et al., Science, 241:456 (1988), Dervan et al., Science, 251:1360 (1991)), посредством этого предупреждая транскрипцию и выработку полипептида IL-17A/F. Антисмысловой олигонуклеотид РНК гибридизуется с мРНК in vivo и блокирует трансляцию молекулы мРНК в полипептид IL-17A/F (antisense - Okano, Neurochem., 56:560 (1991), Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press: Boca Raton, FL, 1988). Описанные выше олигонуклеотиды можно также доставлять в клетки так, чтобы антисмысловая РНК или ДНК могла экспрессироваться in vivo, подавляя выработку полипептида IL-17A/F. Если используют антисмысловую ДНК, то предпочтительны олигодезоксирибонуклеотиды, полученные из сайта инициации трансляции, например, расположенные приблизительно между положениями -10 и +10 относительно нуклеотидной последовательности целевого гена.

Потенциальные антагонисты включают мелкие молекулы, которые связываются с активным сайтом, сайтом связывания рецептора или фактором роста или с другим релевантным сайтом связывания полипептида IL-17A/F, посредством чего они блокируют нормальную биологическую активность полипептида IL-17A/F. Примеры мелких молекул включают, но не ограничиваясь ими, мелкие пептиды или пептидоподобные молекулы, предпочтительно, растворимые пептиды, а также синтетические непептидные соединения (органические и неорганические).

Рибозимы представляют собой ферментативные молекулы РНК, способные катализировать специфическое расщепление РНК. Рибозимы действуют через специфическую по отношению к последовательности гибридизацию с комплементарной целевой РНК, сопровождающуюся эндонуклеолитическим расщеплением. Специфические сайты рибозимного расщепления в потенциально целевой РНК можно идентифицировать при помощи известных методик. Для получения дополнительных подробностей см., например, ссылку Rossi, Current Biology, 4:469-471 (1994) и публикацию PCT № WO 97/33551 (опубликованную 18 сентября 1997 г.).

Молекулы нуклеиновых кислот в форме тройной спирали, используемые для подавления транскрипции, должны быть однонитевыми и состоять из дезоксинуклеотидов. Состав оснований в этих олигонуклеотидах подбирают таким образом, чтобы он способствовал формированию тройной спирали по правилам спаривания оснований Хугстина (Hoogsteen), которые в общем смысле требуют значительных по размерам участков пуринов или пиримидинов на одной из нитей дуплекса. Для получения дополнительных сведений см., например, публикацию PCT № WO 97/33551, выше.

Эти мелкие молекулы можно идентифицировать посредством одного или более анализов скрининга, обсуждавшихся здесь выше, и/или любых других методик скрининга, хорошо известных компетентному специалисту.

Диагностические и терапевтические возможности применения раскрытых здесь молекул могут также основываться на положительных попаданиях функционального анализа, что будет раскрыто и описано ниже.

F. Тканевое распределение

Определяя экспрессию мРНК в различных тканях человека, можно идентифицировать локализацию тканей, экспрессирующих IL-17A/F. Локализация таких генов дает информацию о том, какие ткани с наибольшей вероятностью будут затронуты при стимуляции или ингибировании активности полипептидов IL-17A/F. Локализация гена в специфической ткани также дает возможность получения образца ткани для проведения анализов на блокирование активности, обсуждающихся ниже.

Как отмечалось выше, экспрессию гена в различных тканях можно измерить традиционными способами саузерн-блоттинга, нозерн-блоттинга для количественной оценки транскрипции мРНК (Thomas, Proc. Natl. Acad. Sci. USA, 77:5201-5205 [1980]), дот-блоттинга (анализа ДНК) или гибридизации in situ, используя соответственно меченый зонд на основе раскрытых здесь последовательностей. В альтернативном варианте можно использовать антитела, которые могут распознавать специфические дуплексы, включая дуплексы ДНК, дуплексы РНК и гибридные дуплексы ДНК-РНК или дуплексы ДНК-белок.

В альтернативном варианте экспрессию гена можно измерить иммунологическими способами, например иммуногистохимическим окрашиванием тканевых срезов и анализом культуры клеток или биологических жидкостей с целью прямого количественного определения экспрессии продукта гена. Антитела, полезные для иммуногистохимического окрашивания и/или анализа образцов жидкостей, могут представлять собой либо моноклональные, либо поликлональные антитела и могут быть получены от любого млекопитающего. Удобным образом можно изготовить антитела против природной последовательности полипептида IL-17A/F или против синтетического пептида, основываясь на последовательностях ДНК, кодирующих полипептид IL-17A/F, либо против экзогенной последовательности, слитой с ДНК, кодирующей полипептид IL-17A/F и кодирующей специфический эпитоп антитела. Общие методики генерирования антител, а также специальные протоколы нозерн-блоттинга и гибридизации in situ будут представлены ниже.

G. Исследования связывания антител

Активность полипептидов IL-17A/F можно верифицировать далее, проводя исследования по связыванию антител, в которых тестируется способность анти-IL-17A/F-антител подавлять эффект полипептидов IL-17A/F, соответственно, в клетках тканей. Обычно антитела включают поликлональные, моноклональные, гуманизированные, биспецифические антитела и антитела-гетероконъюгаты, изготовление которых будет описано здесь ниже.

Исследования по связыванию антител можно проводить, применяя любой из известных аналитических методов, например анализы конкурентного связывания, прямые и непрямые сэндвич-анализы и анализы иммунопреципитации. Zola, Monoclonal Antibodies: A Manual of Techniques, p.147-158 (CRC Press, Inc., 1987).

Анализы конкурентного связывания основаны на способности меченого стандарта конкурировать с испытуемым аналитическим образцом, осуществляя связывание с ограниченным количеством антитела. Количество целевого белка в анализируемом образце находится в обратнопропорциональной зависимости от количества стандарта, вступившего в связь с антителами. Чтобы облегчить определение количества стандарта, вступившего в связь, предпочтительно понизить растворимость антител до или после конкуренции с тем расчетом, чтобы стандарт и анализируемый образец, связанный с антителами, было удобно отделить от стандарта и анализируемого образца, оставшихся несвязанными.

Сэндвич-анализы заключаются в применении двух антител, каждое из которых способно связываться с разными иммуногенетическими частями или эпитопами белка, подлежащего выявлению. В сэндвич-анализе испытуемый образец анализируемого вещества связывается с первым антителом, которое иммобилизовано на твердой опоре, после чего второе антитело связывается с анализируемым веществом, формируя нерастворимый трехчастный комплекс. См., например, патент США № 4376110. Второе антитело может иметь собственную метку в виде выявляемого компонента (прямые сэндвич-анализы), или его измерение проводят с использованием противоглобулинового антитела, которое мечено поддающимся выявлению компонентом (непрямой сэндвич-анализ). Например, одним из типов сэндвич-анализа является анализ ELISA, в котором выявляемый компонент представляет собой фермент.

Для исследования иммуногистохимическим способом тканевый образец может быть свежим или замороженным, а также может быть залит парафином и зафиксирован консервантом, например формалином.

H. Анализы на клеточной основе

Для более глубокого проникновения во взаимосвязи между идентифицированными здесь генами и полипептидами, а также в механизмы развития и патогенеза иммунозависимых заболеваний можно использовать клеточные анализы и животные модели иммунозависимых заболеваний.

При другом подходе клетки определенного типа, которые заведомо вовлечены в определенное иммунозависимое заболевание, трансфицируют описанными здесь кДНК, после чего анализируют способность этих кДНК стимулировать или подавлять иммунную функцию. Подходящие клетки можно трансфицировать нужным геном и мониторировать на активность иммунной функции. Затем такие трансфицированные клеточные линии можно применять для тестирования способности поли- или моноклональных антител или композиций антител подавлять или стимулировать иммунную функцию, например модулировать пролиферацию T-клеток или инфильтрацию воспалительных клеток. Далее те клетки, которые были трансфицированы кодирующими последовательностями идентифицированных здесь генов, можно использовать в целях идентификации лекарств-кандидатов для лечения иммунозависимых заболеваний.

В дополнение к этому, первичные культуры, полученные от трансгенных животных (как это описано ниже), можно использовать в рассматриваемых здесь клеточных анализах, хотя в этом отношении предпочтительны стабильные линии. Методики получения непрерывных клеточных линий от трансгенных животных хорошо известны в данной области техники (см., например, ссылку Small et al., Mol. Cell. Biol., 5: 642-648 [1985]).

Одним из приемлемых клеточных анализов является реакция смешанных лимфоцитов (MLR). Current Protocols in Immunology, часть 3.12; под редакцией J. E. Coligan, A. M. Kruisbeek, D. H. Marglies, E. M. Shevach, W. Strober, National Institutes of Health, опубликовано издательством John Wiley & Sons, Inc. В этом анализе оценивают способность испытуемого соединения стимулировать или подавлять пролиферацию активированных T-клеток. Суспензию T-клеток респондеров культивируют с аллогенными стимулирующими клетками, а пролиферацию T-клеток измеряют по поглощению тимидина, меченного тритием. Этот анализ представляет собой общее средство для измерения реактивности T-клеток. Поскольку большинство T-клеток реагируют на IL-2 и вырабатывают IL-2 после активации, различия в реактивности, выявляемые этим анализом, частично отражают различия в выработке IL-2 реагирующими клетками. Результаты MLR можно верифицировать стандартным анализом по выявлению лимфокина (IL-2). Current Protocols in Immunology, выше, 3.15, 6.3.

Пролиферативная реакция T-клеток в анализе MLR может проявляться вследствие прямых митогенных свойств анализируемой молекулы или быть результатом активации, индуцированной внешним антигеном. Дополнительную верификацию стимулирующей активности полипептидов IL-17A/F в отношении T-клеток можно получить посредством анализа с костимуляцией. Для активации T-клеток требуется специфический антигенный сигнал, опосредованный через рецептор T-клеток (TCR), и костимулирующий сигнал, опосредованный через второе взаимодействие связывания с лигандом, например взаимодействие связывания B7 (CD80, CD86)/CD28. Перекрестное сшивание CD28 увеличивает секрецию лимфокина активированными T-клетками. Активация T-клеток имеет как отрицательное, так и положительное управление, которое осуществляется через связывание лигандов, обладающих отрицательным или положительным эффектом. CD28 и CTLA-4 представляют собой родственные гликопротеины суперсемейства Ig, которые связываются с B7. Связывание CD28 с B7 дает положительный костимулирующий эффект в отношении активации T-клеток, и, наоборот, связывание CTLA-4 с B7 дает отрицательный (деактивирующий) эффект в отношении популяции T-клеток. Chambers, C. A. and Allison, J. P., Curr. Opin. Immunol., (1997) 9:396. Schwartz, R. H., Cell (1992) 71:1065; Linsley, P. S. and Ledbetter, J. A., Annu. Rev. Immunol. (1993) 11:191, June, C. H. et al., Immunol. Today (1994) 15:321; Jenkins, M. K., Immunity (1994) 1:405. В анализе с костимуляцией полипептиды IL-17A/F проходят оценку на костимулирующую или ингибиторную активность в отношении T-клеток.

Например, полипептиды IL-17A/F, а также другие соединения, предлагаемые настоящим изобретением, которые являются стимуляторами (костимуляторами) пролиферации T-клеток и агонистами, например агонистические антитела к ним, как это можно определить при помощи MLR и анализов с костимуляцией, полезны при лечении иммунозависимых заболеваний, характеризующихся плохой, субоптимальной или неадекватной иммунной функцией. Эти заболевания лечат, стимулируя пролиферацию и активацию T-клеток (то есть иммунитет, опосредованный T-клетками) и усиливая иммунный ответ у млекопитающего через введение стимулирующего соединения, такого как стимулирующие полипептиды IL-17A/F. Стимулирующий полипептид может представлять собой, например, полипептид IL-17A/F или агонистическое антитело к нему.

Прямое использование стимулирующего соединения в соответствии с изобретением было проверено в экспериментах с гликопротеином 4-1BB, членом семейства рецепторов фактора опухолевого некроза, который связывается с лигандом (4-1BBL), экспрессируемым на примированных T-клетках, давая T-клеткам сигнал к активации и росту. Alderson, M. E. et al., J. Immunol., 24:2219 (1994).

Также было экспериментально апробировано применение агонистического стимулирующего соединения. Активация 4-1BB при обработке агонистическим анти-4-1BB-антителом улучшает радикальное уничтожение опухолей. Hellstrom, I. and Hellstrom, K. E., Crit. Rev. Immunol., 18:1 (1998). Еще одним примером применения стимулирующих соединений в соответствии с изобретением является иммуноадъювантная терапия для лечения опухолей, более подробно описанная ниже.

Стимуляцию иммунитета или усиление иммунного эффекта также можно получить, приводя в действие антагонизм или блокаду активности IL-17A/F, подавление которой было продемонстрировано в анализе MLR. Противостояние ингибиторной активности соединения вызывает конечный стимулирующий эффект. Подходящие антагонистические/блокирующие соединения представляют собой антитела или фрагменты антител, которые распознают и связывают ингибиторный белок, посредством чего блокируют эффективное взаимодействие этого белка с его рецептором и подавляют передачу сигнала через рецептор. Этот эффект был продемонстрирован в экспериментах с применением анти-CTLA-4-антител, которые усиливают пролиферацию T-клеток, предположительно, за счет устранения ингибиторного сигнала, обусловленного связыванием CTLA-4. Walunas, T. L. et al., Immunity, 1:405 (1994).

В альтернативном варианте стимулирующий или усиливающий эффект можно также получить при введении полипептида IL-17A/F, который обладает свойством улучшать проницаемость сосудов. Усиление вакуолярной проницаемости полезно при заболеваниях, проявления которых можно ослабить посредством локальной инфильтрации иммунных клеток (например, моноцитов, эозинофилов, PMN) и воспалительной реакции.

С другой стороны, для того, чтобы подавить иммунный ответ, можно непосредственно использовать полипептиды IL-17A/F, а также другие соединения, предлагаемые изобретением, которые являются прямыми ингибиторами пролиферации/активации T-клеток, секреции лимфокинов и/или проницаемости сосудов. Эти соединения полезны для уменьшения силы иммунного ответа и для лечения иммунозависимых заболеваний, характеризующихся гиперактивным, сверхоптимальным или аутоиммунным ответом. Такое использование соединений, предлагаемых изобретением, было апробировано в описанных выше экспериментах, в которых связывание CTLA-4 с рецептором B7 приводило к деактивации T-клеток. Прямые ингибиторные соединения, рассматриваемые изобретением, действуют аналогичным образом. Можно ожидать, что применение соединения, которое подавляет проницаемость сосудов, будет уменьшать воспаление. Такие возможности применения будут полезны при лечении патологических состояний, связанных с избыточным воспалением.

В альтернативном варианте соединения, например антитела, которые связываются со стимулирующими полипептидами IL-17A/F и блокируют стимулирующий эффект этих молекул, производят конечный ингибиторный эффект, в связи с чем их можно применять для подавления иммунного ответа, опосредованного T-клетками за счет угнетения пролиферации/активации T-клеток и/или секреции лимфокинов. Блокирование стимулирующего эффекта полипептидов подавляет иммунный ответ у млекопитающего. Такая возможность применения была апробирована в экспериментах с применением анти-IL2-антитела. В этих экспериментах антитело связывается с IL2 и блокирует связывание IL2 с его рецептором, посредством чего достигается ингибиторный эффект в отношении T-клеток.

I. Животные модели

Результаты клеточных анализов in vitro можно дополнительно верифицировать, используя животные модели in vivo и анализы на функцию T-клеток. Для того чтобы глубже понять роль идентифицированных здесь генов в развитии и патогенезе иммунозависимых заболеваний, а также аналитически оценить эффективность терапевтических средств-кандидатов, включая антитела и другие антагонисты природных полипептидов, в том числе мелкие молекулы, можно использовать множество хорошо известных животных моделей. Благодаря сущности этих моделей in vivo они имеют прогностическое значение в отношении реакций у больных людей. Животные модели иммунозависимых заболеваний включают использование как нерекомбинантных, так и рекомбинантных (трансгенных) животных. Нерекомбинантные животные модели включают, например, грызунов, например мышиные модели. Такие модели можно создавать, вводя клетки в сингенную мышь с использованием стандартных методик, например подкожной инъекции, инъекции в хвостовую вену, имплантации селезенки, внутрибрюшинной имплантации, имплантации под почечную капсулу и т.д.

Болезнь "трансплантат против хозяина" встречается, когда иммунокомпетентные клетки трансплантируют больным с подавленным иммунитетом или выраженной толерантностью. Донорские клетки распознают антигены хозяина и реагируют на них. Реакция может варьироваться от угрожающего жизни тяжелого воспаления до легких случаев диареи и потери веса. Модели болезни "трансплантат против хозяина" являются средством для оценки реактивности T-клеток против антигенов MHC и второстепенных антигенов трансплантата. Подходящая процедура подробно описана в ссылке Current Protocols in Immunology, выше, часть 4.3.

Животная модель отторжения кожного аллотрансплантата является средством тестирования способности T-клеток опосредовать разрушение ткани in vivo и оценить их количественную роль в отторжении трансплантата. В самых частых и наиболее приемлемых моделях используются кожные трансплантаты на мышиных хвостах. Неоднократные эксперименты показали, что отторжение кожного аллотрансплантата опосредуется T-клетками, хелперными T-клетками и киллерными-эффекторными T-клетками, но не антителами. Auchincloss, H. Jr. and Sachs, D. H., Fundamental Immunology, 2nd ed., W. E. Paul ed., Raven Press, NY, 889-992 (1989). Подходящая процедура подробно описана в ссылке Current Protocols in Immunology, выше, часть 4,4. Другими моделями отторжения трансплантата, которые можно использовать для тестирования соединений, предлагаемых изобретением, являются модели аллогенного трансплантата сердца, описанные в ссылках Tanabe, M. et al., Transplantation, 58:23 (1994) и Tinubu, S. A. et al., J. Immunol., 4330-4338 (1994).

Животные модели гиперчувствительности замедленного типа также служат инструментом для анализа клеточноопосредованной иммунной функции. Реакции гиперчувствительности замедленного типа представляют собой иммунный ответ in vivo, опосредованный T-клетками и характеризующийся воспалением, которое не достигает пика даже после промежутка времени, прошедшего после провокации антигеном. Такие реакции также встречаются при тканеспецифических аутоиммунных заболеваниях, таких как рассеянный склероз (MS) и экспериментальный аутоиммунный энцефаломиелит (EAE, модель MS). Подходящая процедура подробно описана в ссылке Current Protocols in Immunology, выше, часть 4,5.

Термин EAE обозначает аутоиммунное заболевание, опосредованное T-клетками, которое характеризуется T-клеточным и мононуклеарноклеточным воспалением с последующей демиелинизацией аксонов в центральной нервной системе. EAE принято считать адекватной животной моделью MS человека. Bolton, C., Multiple Sclerosis, 1:143 (1995). Были разработаны модели как острой, так и возвратно-ремиттирующей формы заболевания. Соединения, предлагаемые изобретением, можно тестировать на стимулирующую или ингибиторную активность в отношении T-клеток при иммуноопосредованных демиелинизирующих заболеваниях с применением протоколов, описанных в ссылке Current Protocols in Immunology, выше, части 15.1 и 15.2. См. также модели миелиновой болезни, которые построены на пересадке олигодендроцитов или клеток Шванна в центральную нервную систему, как это описано в ссылке Duncan, I. D. et al., Molec. Med. Today, 554-561 (1997).

Контактная гиперчувствительность представляет собой простую гиперчувствительность замедленного типа, выявляемую при анализе клеточноопосредованной иммунной функции in vivo. Эта процедура заключается в том, что кожу подвергают воздействию экзогенных гаптенов, порождающему реакцию гиперчувствительности замедленного типа, которую выявляют и оценивают количественно. Контактная гиперчувствительность содержит начальную фазу сенсибилизации с последующей фазой извлечения. Фаза извлечения встречается тогда, когда T-лимфоциты сталкиваются с таким антигеном, с которым они контактировали ранее. В результате развиваются набухание и воспаление, придающие этой патологии свойства блестящей модели аллергического контактного дерматита. Соответствующая процедура подробно описана в ссылках: Current Protocols in Immunology, Eds. J. E. Cologan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach and W. Strober, John Wiley & Sons, Inc., unit 4.2 (1994), а также Grabbe, S. and Schwarz, T, Immun. Today, 19 (1): 37-44 (1998).

Животной моделью артрита служит артрит, индуцированный коллагеном. Эта модель имеет общие клинические, гистологические и иммунологические свойства с аутоиммунным ревматоидным артритом человека и является приемлемой моделью аутоиммунного артрита человека. Мышиная и крысиная модели характеризуются синовиитом, эрозией хряща и субхондральной кости. Соединения, предлагаемые изобретением, можно проверить на активность против аутоиммунного артрита, применяя протоколы, описанные в ссылке Current Protocols in Immunology, выше, часть 15.5. См. также модель, основанную на применении моноклонального антитела к интегринам CD18 и VLA-4, описанную в ссылке Issekutz, A.C. et al., Immunology, 88:569 (1996).

Была описана модель астмы, в которой индуцированные антигенами гиперреактивность дыхательных путей, легочная эозинофилия и воспаление вызываются сенсибилизацией животного овальбумином с последующей провокацией тем же белком, вводимым в организм животного в виде вдыхаемого аэрозоля. Различные животные модели (на морских свинках, крысах, обезьянах) демонстрируют сходные симптомы с атопической астмой человека при провокации аэрозольными антигенами. Мышиные модели имеют много общих признаков с астмой человека. Соответствующие процедуры для тестирования соединений, предлагаемых изобретением, на активность и эффективность при лечении астмы описаны в статье Wolyniec, W. W. et al., Am. J. Respir. Cell Mol. Biol., 18:777 (1998) и цитируемых в ней ссылках.

В дополнение к этому, соединения, предлагаемые изобретением, можно тестировать на животных моделях заболеваний типа псориаза. Имеющиеся данные позволяют предполагать T-клеточный патогенез псориаза. Соединения, предлагаемые изобретением, можно тестировать на мышиной модели scid/scid, описанной Schon, M. P. et al., Nat. Med., 3:183 (1997), в которой мыши демонстрируют гистопатологические кожные повреждения, напоминающие псориаз. Еще одна подходящая модель представляет собой химеру человек-мышь skin/scid, которая была получена, как это описано в ссылке Nickoloff, B. J. et al., Am. J. Path., 146:580 (1995).

Рекомбинантные (трансгенные) животные модели можно сконструировать генно-инженерными способами, вводя кодирующую часть идентифицированных здесь генов в геном соответствующего животного с использованием стандартных методик для получения трансгенных животных. Животные, которые могут служить мишенями для трансгенных манипуляций, включают, но не ограничиваясь ими, мышей, крыс, кроликов, морских свинок, овец, коз, свиней и приматов (кроме человека), например павианов, шимпанзе и других обезьян. Методики для введения трансгена в таких животных, известные в данной области техники, включают пронуклеарную микроинъекцию (Hoppe and Wanger, патент США № 4873191), перенос генов в зародышевые клеточные линии, опосредованный ретровирусом (см., например, Van der Putten et al., Proc. Natl. Acad. Sci. USA, 82, 6148-615 [1985]), нацеливание на ген в эмбриональных стволовых клетках (Thompson et al., Cell, 56, 313-321 [1989]), эмбриональную электропорацию (Lo, Mol. Cel. Biol., 3, 1803-1814 [1983]), перенос генов, опосредованный спермой (Lavitrano et al., Cell, 57, 717-73 [1989]). Для получения обзорной информации по этому вопросу см., например, патент США № 4736866.

В целях настоящего изобретения по определение "трансгенные животные" подпадают те животные, которые несут трансген только в части своих клеток ("мозаичные животные"). Трансген может быть встроен в геном животного или как одиночный трансген, или в виде конкатемеров, например тандемов типа "голова к голове" или "голова к хвосту". Возможно также селективное введение трансгена в клетку особого типа с применением, например, методики, описанной в ссылке Lasko et al., Proc. Natl. Acad. Sci. USA, 89, 6232-636 (1992).

Экспрессию гена в организме трансгенного животного можно мониторировать на основе стандартных методик. Например, для того, чтобы верифицировать встраивание трансгена, можно применить анализ методом саузерн-блоттинга или амплификацию в PCR. После этого можно проанализировать уровень экспрессии мРНК, пользуясь, например, такими методиками, как гибридизация in situ, нозерн-блоттинг, PCR или иммуногистохимия.

Животное можно дополнительно обследовать на патологические признаки иммунного заболевания, например провести гистологическое исследование для того, чтобы обнаружить инфильтрацию иммунных клеток в специфические ткани. Можно также провести эксперименты по блокированию, в которых трансгенных животных подвергают воздействию соединений, предлагаемых изобретением, чтобы определить степень стимулирования или подавления пролиферации T-клеток этими соединениями. В таких экспериментах подопытному животному вводят блокирующие антитела, связывающиеся с полипептидом IL-17A/F, которые были изготовлены, как это описано выше, после чего определяют их влияние на иммунную функцию.

В альтернативном варианте можно сконструировать "нокаутное" животное, которое имеет ген, кодирующий идентифицированный здесь полипептид, с дефектом или изменением в результате гомологичной рекомбинации между эндогенным геном, кодирующим полипептид, и измененной геномной ДНК, кодирующей тот же полипептид, которая была введена в эмбриональную клетку животного. Например, кДНК, кодирующую специфический полипептид, можно использовать для клонирования геномной ДНК, кодирующей этот полипептид в соответствии с общепризнанными методиками. Часть геномной ДНК, кодирующей специфический полипептид, можно делетировать или заместить другим геном, например геном, кодирующим селектируемый маркер, который можно использовать для мониторинга встраивания в геном. В типичном случае несколько килобаз неизмененной фланкирующей ДНК (как на 5'-, так и на 3'-концах) включают в вектор [см., например., Thomas and Capecchi, Cell, 51:503 (1987) для характеристики гомологичных векторов рекомбинации]. Далее отбирают вектор, введенный в линию эмбриональных стволовых клеток (например, посредством электропорации), и клетки, в которых введенная ДНК гомологично рекомбинирована с эндогенной ДНК [см., например., Li et al., Cell, 69:915 (1992)]. Затем отобранные клетки посредством инъекции вводят в бластоцисту животного (например, мыши или крысы) для формирования агрегированных химер [см., например, Bradley, в Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152]. Затем химерный эмбрион можно имплантировать подходящей ложнобеременной самке животного (суррогатной матери), которая выносит эмбрион до конца беременности, чтобы можно было получить "нокаутное" животное. Потомство, унаследовавшее гомологично рекомбинантную ДНК и несущее ее в своих зародышевых клетках, можно идентифицировать, применяя стандартные методики, и использовать для разведения животных, у которых все клетки организма содержат гомологично рекомбинированную ДНК. Нокаутных животных можно охарактеризовать, например, по их способности противостоять некоторым патологическим состояниям, а также по развитию у них патологических состояний, связанных с отсутствием полипептида.

J. Иммуноадъювантная терапия

В одном из вариантов осуществления изобретения предлагаемые здесь иммуностимулирующие соединения можно применять в рамках иммуноадъювантной терапии для лечения опухолей (раковых). В настоящее время хорошо установлено, что T-клетки распознают специфические антигены опухолей человека. Опухолевые антигены одной из групп, кодируемые семейством генов MAGE, BAGE и GAGE, являются молчащими во всех нормальных тканях взрослых, но экспрессируются в значительном количестве в таких опухолях, как меланомы, опухоли легких, опухоли головы и шеи, а также карциномы мочевого пузыря. DeSmet, C. et al., Proc. Natl. Acad. Sci. USA, 93:7149 (1996). Было показано, что костимуляция T-клеток индуцирует регрессию опухолей и противоопухолевый иммунный ответ как in vitro, так и in vivo. Melero, I. et al., Nature Medicine, 3:682 (1997), Kwon, E. D. et al., Proc. Natl. Acad. Sci. USA, 94: 8099 (1997), Lynch, D. H. et al., Nature Medicine, 3:625 (1997), Finn, O. J. and Lotze, M. T., J. Immunol., 21:114 (1998). Стимулирующие соединения, предлагаемые изобретением, можно вводить в качестве адъювантов, самостоятельно или вместе с регулятором роста, цитотоксическим агентом или химиотерапевтическим агентом для того, чтобы стимулировать пролиферацию/активацию T-клеток и противоопухолевый иммунный ответ на опухолевые антигены. Регулятор роста, цитотоксический или химиотерапевтический агент можно вводить в традиционном количестве, используя общепринятые схемы введения. Иммуностимулирующая активность соединения, предлагаемого изобретением, позволяет снизить дозы регулятора роста цитотоксического или химиотерапевтического агента, благодаря чему можно уменьшить потенциал токсичности этих лекарств для больного.

K. Анализы для скрининга лекарств-кандидатов

Анализы скрининга кандидатов на роль лекарства направлены на выявление соединений, которые связываются или комплексируются с полипептидами, кодируемыми идентифицированными здесь генами или их биологически активными фрагментами, либо иным образом вмешиваются во взаимодействие кодируемых полипептидов с другими клеточными белками. Такие анализы скрининга включают анализы, позволяющие осуществлять высокопроизводительный скрининг химических библиотек, что делает их особенно удобными для идентификации мелкомолекулярных лекарств-кандидатов. Рассматриваемые здесь мелкие молекулы включают синтетические органические или неорганические соединения, в том числе пептиды, предпочтительно, растворимые пептиды, (поли)пептидно-иммуноглобулиновые гибриды, и, особенно, антитела, включая (без ограничения) поли- и моноклональные антитела и фрагменты антител, одноцепочечные антитела, антиидиотипические антитела и химерные или гуманизированные версии таких антител или их фрагментов, а также антитела человека и их фрагменты. Анализы могут быть выполнены во множестве форматов, включая анализы связывания белок-белок, анализы биохимического скрининга, иммуноанализы и клеточные анализы, которые хорошо известны и подробно описаны в данной области техники. Все анализы сходны в том, что они предусматривают обязательный контакт лекарства-кандидата с полипептидом, кодируемым идентифицированной здесь нуклеиновой кислотой, в таких условиях и в течение такого времени, которые позволяют этим двум компонентам прореагировать друг с другом.

В анализах связывания взаимодействие представляет собой такое связывание, в результате которого образуется комплекс, который можно выделить из реакционной смеси или обнаружить в ней. В специфическом варианте осуществления изобретения полипептид, кодируемый идентифицированным здесь геном, или лекарство-кандидат иммобилизуют на твердой фазе, например на титрационном микропланшете, посредством ковалентного или нековалентного присоединения. Нековалентное присоединение обычно осуществляется при покрытии твердой поверхности раствором полипептида с последующим высушиванием. В альтернативном варианте для прикрепления полипептида к твердой поверхности можно использовать иммобилизованное антитело, например моноклональное антитело, специфичное к этому полипептиду. Анализ проводят, добавляя немобилизованный компонент, который может быть снабжен поддающейся выявлению меткой, к иммобилизованному компоненту, например к покрытой поверхности, содержащей фиксированный компонент. По окончании реакции не вступившие в реакцию компоненты удаляют, например, отмыванием, после чего проводят выявление комплексов, зафиксированных на твердой поверхности. Если поддающейся выявлению меткой снабжен компонент, который изначально не был иммобилизован, то выявление метки, иммобилизованной на поверхности, будет свидетельствовать о том, что произошло комплексирование. Если изначально неиммобилизованный компонент не был снабжен меткой, то комплексирование можно выявить, например, применяя меченое антитело, специфически связывающееся с иммобилизованным комплексом.

Если соединение-кандидат взаимодействует, но не связывается с конкретным белком, кодируемым идентифицированным здесь геном, его взаимодействие с этим белком можно проанализировать хорошо известными способами для выявления взаимодействий белок-белок. Такие анализы включают традиционные подходы, например перекрестное сшивание, совместную иммунопреципитацию и совместную очистку при пропускании через градиенты или хроматографическую колонку. В дополнение к этому, взаимодействия типа белок-белок можно мониторировать, применяя основанную на дрожжах генетическую систему, описанную Fields с соавторами [Fields and Song, Nature (London), 340:245-246 [1989]), Chien et al., Proc. Natl. Acad. Sci. USA, 88:9578-9582 [1991)], как это раскрыто в ссылке Chevray and Nathans, Proc. Natl. Acad. Sci. USA, 89:5789-5793 (1991). Многие транскрипционные активаторы, такие как дрожжевой ядерный белок GAL4, состоят из двух физически раздельных модульных доменов, один из которых действует как домен, связывающий ДНК, тогда как другой функционирует в качестве домена, активирующего транскрипцию. Система дрожжевой экспрессии, описанная в указанных выше публикациях (обычно упоминаемая под названием "система двойных гибридов"), имеет преимущество, связанное именно с этой особенностью, то есть использует два гибридных белка, один из которых представляет собой целевой белок, слитый с ДНК-связывающим доменом GAL4, а другой представляет собой белок-кандидат активации, слитый с доменом активации. Экспрессия гена-репортера GAL1-lacZ под контролем GAL4-активированного промотора зависит от восстановления активности GAL4 через взаимодействие белок-белок. Колонии, содержащие взаимодействующие полипептиды, выявляют с хромогенным субстратом для β-галактозидазы. Полный набор (MATCHMAKERTM) для идентификации взаимодействий белок-белок между двумя специфическими белками с применением методики двойных гибридов можно приобрести на коммерческой основе в компании Clontech. Применение этой системы также можно распространить на картирование белковых доменов, вовлеченных в специфические белковые взаимодействия, а также на высокоточное определение аминокислотных остатков, критически важных для этих взаимодействий.

Для того чтобы найти соединения, которые вмешиваются во взаимодействие идентифицированного здесь гена с другими внутри- или внеклеточными компонентами, обычно готовят реакционную смесь, содержащую продукт гена и внутри- или внеклеточный компонент, выдерживая ее в таких условиях и в течение такого времени, которые позволяют осуществиться взаимодействию и связыванию двух продуктов. Для того чтобы проверить способность испытуемого соединения подавлять связывание, реакцию проводят как при наличии этого соединения, так и в его отсутствие. В дополнение к этому, к третьему образцу реакционной смеси можно добавить плацебо в роли фактора положительного контроля. Связывание (образование комплекса) между испытуемым соединением и внутри- или внеклеточным компонентом, присутствующим в смеси, мониторируют так, как это описано выше. Образование комплекса в контрольной реакции (реакциях), но не в реакционной смеси, содержащей испытуемое соединение, указывает на то, что испытуемое соединение препятствует взаимодействию продукта гена и его партнера в реакции.

L. Композиции и способы для лечения иммунозависимых заболеваний

Композиции, полезные для лечения иммунозависимых заболеваний, включают (без ограничения) белки, антитела, мелкие органические молекулы, пептиды, фосфопептиды, антисмысловые и рибозимные молекулы, молекулы с тройной спиралью и т.д., которые способны подавлять или стимулировать иммунную функцию, например пролиферацию/активацию T-клеток, выброс лимфокинов или инфильтрацию иммунными клетками.

Например, антисмысловые молекулы РНК действуют, непосредственно блокируя трансляцию мРНК за счет гибридизации с целевой мРНК, то есть предупреждая белковую трансляцию. Если используют антисмысловую ДНК, то предпочтительны олигодезоксирибонуклеотиды, полученные из сайта инициации трансляции, например расположенные приблизительно между положениями -10 и +10 относительно нуклеотидной последовательности целевого гена.

Рибозимы представляют собой ферментативные молекулы РНК, способные катализировать специфическое расщепление РНК. Рибозимы действуют через специфическую применительно к последовательности гибридизацию с комплементарной целевой РНК, сопровождающуюся эндонуклеолитическим расщеплением. Специфические сайты рибозимного расщепления в потенциально целевой РНК можно идентифицировать при помощи известных методик. Для получения дополнительных подробностей см., например, ссылку Rossi, Current Biology, 4, 469-471 (1994) и публикацию PCT № WO 97/33551 (опубликованную 18 сентября 1997 г.).

Молекулы нуклеиновых кислот в форме тройной спирали, используемые для подавления транскрипции, должны быть однонитевыми и состоять из дезоксинуклеотидов. Состав оснований в этих олигонуклеотидах подбирают таким образом, чтобы он способствовал формированию тройной спирали по правилам спаривания оснований Хугстина (Hoogsteen), которые в общем смысле требуют значительных по размерам участков пуринов или пиримидинов на одной из нитей дуплекса. Для получения дополнительных сведений см., например, публикацию PCT № WO 97/33551, выше.

Эти молекулы можно идентифицировать посредством одного анализа скрининга или любой комбинации таких анализов, обсуждавшихся здесь выше, и/или любых других методик скрининга, хорошо известных компетентному специалисту.

M. Анти-IL-17A/F-антитела

В одном из вариантов осуществления настоящее изобретение предлагает анти-IL-17A/F-антитела, которые могут найти применение в качестве терапевтических и/или диагностических средств. Антитела включают поликлональные, моноклональные, гуманизированные, биспецифические и гетероконъюгатные антитела.

1. Поликлональные антитела

В предпочтительном варианте поликлональные антитела развиваются у животных в результате множественных подкожных (sc) или внутрибрюшинных (ip) инъекций соответствующего антигена и адъюванта. Может оказаться полезным конъюгировать нужный антиген (особенно при использовании синтетических пептидов) с белком, обладающим иммуногенными свойствами для иммунизируемого биологического вида. Например, антиген может быть конъюгирован с гемоцианином моллюска Megathura crenulata (keyhole limpet) (KLH), сывороточным альбумином, тиреоглобулином крупного рогатого скота или соевым ингибитором трипсина при помощи бифункционального или дериватизированного агента, например малеимидобензоил-сульфосукцинимидного эфира (конъюгация через цистеиновые остатки), N-гидроксисукцинимида (через лизиновые остатки), глутарового альдегида, янтарного ангидрида, SOCl2 или R1N=C=NR, где R и R1 представляют собой разные алкильные группы.

Животных иммунизируют против антигена, иммуногенных конъюгатов или их производных, комбинируя, например, 100 мкг или 5 мкг белка или конъюгата (для кроликов или мышей соответственно) с 3 объемами полного адъюванта Фрейнда и вводя раствор внутрикожной инъекцией в нескольких местах. Месяц спустя животным делали бустерные подкожные инъекции в нескольких местах, вводя им от 1/5 до 1/10 первоначального количества пептида или полного конъюгата Фрейнда. От семи до 14 дней позже у животных брали образцы крови для проведения анализа сыворотки на титр антител. Бустерные инъекции проводили до тех пор, пока титр антител не выходил на плато. Конъюгаты также можно получить в рекомбинантной клеточной культуре по типу гибридизации белков. Кроме того, для усиления иммунного ответа вполне подходят агрегирующие агенты, такие как квасцы.

2. Моноклональные антитела

Моноклональные антитела можно получить, применяя способ гибридомы, впервые описанный в ссылке Kohler et al., Nature, 256:495 (1975), или способами рекомбинантной ДНК (патент США № 4816567).

В способе гибридомы мышь или другое пригодное животное-хозяина, например хомяка, иммунизируют, как это описано выше, для извлечения лимфоцитов, которые вырабатывают или способны вырабатывать антитела, специфически связывающиеся с тем белком, который применяют для иммунизации. В альтернативном варианте возможна иммунизация лимфоцитов in vitro. После иммунизации лимфоциты выделяют и затем сливают с клетками миеломной линии, применяя подходящий сливающий агент, например полиэтиленгликоль, для образования клетки гибридомы (Goding, Monoclonal Antibodies: Principles and Practice, p.59-103 (Academic Press, 1986)).

Полученные таким способом клетки гибридомы высевают на подходящую культуральную среду и выращивают, причем такая среда в предпочтительном варианте содержит одно или более веществ, которые подавляют рост или выживание не слитых родительских клеток миеломы (также обозначаемых как партнеры слияния). Например, если в родительских клетках миеломы отсутствует фермент гипоксантингуанинфосфорибозилтрансфераза (HGPRT или HPRT), селективная культуральная среда для гибридомы в типичном варианте будет включать гипоксантин, аминоптерин и тимидин (среда HAT), то есть вещества, предотвращающие рост HGPRT-дефицитных клеток.

Предпочтительными партнерами для слияния из клеток миеломы являются такие клетки, которые эффективно сливаются, поддерживают на высоком уровне стабильную выработку антитела выбранными клетками-продуцентами антитела и чувствительны к селективной среде, которая направляет действие отбора против неслившихся родительских клеток. Предпочтительными линиями клеток миеломы являются линии мышиной миеломы, например полученные из мышиных опухолей MOPC-21 и MPC-11, доступные из Центра распределения клеток Института Солка, Сан-Диего, штат Калифорния, США, а также клетки опухолевой линии SP-2 и их производные, например, клетки X63-Ag8-653, доступные из коллекции культур американского типа, Манассас, штат Вирджиния, США. Было также описано получение моноклональных антител человека из клеточных линий миеломы человека и гетеромиеломы мышь-человек (Kozbor, J. Immunol., 133:3001 (1984); and Brodeur et al., Monoclonal Antibody Production Techniques and Applications, p. 51-63 (Marcel Dekker, Inc., New York, 1987)).

Культуральную среду, в которой выращивают клетки миеломы, анализируют на выработку моноклональных антител, направленных против антигена. Предпочтительно, чтобы специфичность связывания моноклональных антител, вырабатываемых клетками гибридомы, определяли иммунопреципитацией или анализом связывания in vitro, например радиоиммуноанализом (RIA) или твердофазным иммуноферментным анализом (ELISA).

Аффинность связывания для моноклонального антитела можно определить, например, анализом Скэтчарда (Scatchard), описанным в ссылке Munson et al., Anal. Biochem., 107:220 (1980).

После того как клетки гибридомы, продуцирующие антитела с желательной специфичностью, аффинностью и/или активностью, будут идентифицированы, клоны можно субклонировать, применяя процедуру серийных разведений и выращивание по стандартным способам (Goding, Monoclonal Antibodies: Principles and Practice, p.59-103 (Academic Press, 1986)). Подходящие культуральные среды для этой цели включают, например, среды D-MEM или RPMI-1640. В дополнение к этому, клетки гибридомы можно выращивать in vivo как асцитные опухоли у животных, например посредством i.p. инъекции клеток мыши.

Моноклональные антитела, секретируемые субклонами, соответствующим образом отделяют от культуральной среды, асцитной жидкости или сыворотки, применяя традиционные процедуры очистки антител, такие как аффинная хроматография (например, с использованием продуктов protein A или protein G-Sepharose), ионообменная хроматография, гидроксиапатитная хроматография, электрофорез в геле, диализ и т.д.

ДНК, кодирующую моноклональные антитела, достаточно просто можно выделить и секвенировать с применением традиционных процедур (например, используя олигонуклеотидные зонды, которые способны специфически связываться с генами, кодирующими тяжелые и легкие цепи мышиных антител). Предпочтительным источником такой ДНК служат клетки гибридомы. После выделения ДНК ее можно поместить в векторы экспрессии, которыми затем трансфицируют клетки хозяина, например клетки E. coli, клетки COS обезьяны, клетки яичника китайского хомяка (CHO) или клетки миеломы, которые иным образом неспособны продуцировать белок антитела, чтобы инициировать синтез моноклональных антител в рекомбинантных клетках хозяина. Обзорные статьи по рекомбинантной экспрессии в бактериях ДНК, кодирующей антитело, включают следующие ссылки: Skerra et al., Curr. Opinion in Immunol., 5:256-262 (1993) и Plückthun, Immunol. Revs. 130:151-188 (1992).

В дальнейшем варианте осуществления изобретения моноклональные антитела или фрагменты антител можно выделять из фаговых библиотек антител, созданных по методике, описанной McCafferty et al., Nature, 348:552-554 (1990). Clackson et al., Nature, 352:624-628 (1991), а также Marks et al., J. Mol. Biol., 222:581-597 (1991) описывают выделение мышиных антител и антител человека соответственно с применением фаговых библиотек. Более поздние публикации описывают выработку высокоаффинных (в диапазоне нМ) антител человека посредством перестановки цепей (Marks et al., Bio/Technology, 10:779-783 (1992)), а также комбинаторную инфекцию и рекомбинацию in vivo, как стратегию конструирования очень больших фаговых библиотек (Waterhouse et al., Nuc. Acids. Res. 21:2265-2266 (1993)). Таким образом, эти методики являются реальной альтернативой традиционным гибридомным методикам получения и выделения моноклональных антител.

ДНК, кодирующую антитело, можно модифицировать для выработки химерных или гибридных полипептидов антитела, например, замещая последовательности постоянных доменов тяжелой цепи и легкой цепи человека (CH и CL) гомологичными мышиными последовательностями (патент США № 4816567 и ссылка Morrison et al., Proc. Natl Acad. Sci. USA, 81:6851 (1984)), или сливая кодирующую последовательность иммуноглобулина со всей кодирующей последовательностью или с частью кодирующей последовательности неиммуноглобулинового полипептида (гетерологичного полипептида). Неиммуноглобулиновыми полипептидными последовательностями можно заменять постоянные домены антитела или вариабельные домены антигенсвязывающего сайта антитела для того, чтобы создать химерное бивалентное антитело, в котором первый антигенсвязывающий сайт будет специфичен для одного антигена, а второй антигенсвязывающий сайт будет специфичен для другого антигена.

3. Антитела человека и гуманизированные антитела

Анти-IL-17A/F-антитела, предлагаемые изобретением, могут дополнительно включать гуманизированные антитела или антитела человека. Гуманизированные формы нечеловеческих антител, например мышиные антитела, представляют собой химерные иммуноглобулины, цепи иммуноглобулинов или их фрагменты (такие, как Fv, Fab, Fab', F(ab')2, или другие антигенсвязывающие последовательности антител), которые содержат минимальное количество последовательностей, полученных из нечеловеческого иммуноглобулина. Гуманизированные антитела включают иммуноглобулины человека (антитело-реципиент), в которых аминокислотные остатки региона реципиента, определяющего комплементарность (CDR), замещены аминокислотными остатками из CDR другого биологического вида, т.е. не человека (антитело-донор), например мыши, крысы или кролика, придающими последовательности желательную специфичность, аффинность и рабочую производительность. В некоторых случаях аминокислотные остатки каркасного региона Fv иммуноглобулина человека замещены соответствующими остатками, происходящими не от человека. Гуманизированные антитела могут также содержать остатки, которых нет ни в антителе-реципиенте, ни в импортированном CDR или последовательностях каркасного региона. Как правило, гуманизированное антитело содержит, по существу, все или по меньшей мере один, более типично, два вариабельных домена, в которых все или, по существу, все регионы CDR соответствуют таковым в нечеловеческом иммуноглобулине, а все или, по существу, все регионы FR имеют такую же последовательность, как и в иммуноглобулине человека. Оптимальное гуманизированное антитело также содержит по меньшей мере часть постоянного региона (Fc) иммуноглобулина, в типичном варианте иммуноглобулина человека [Jones et al., Nature, 321:522-525 (1986), Riechmann et al., Nature, 332:323-329 (1988), и Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].

Способы получения гуманизированных антител нечеловеческого происхождения хорошо известны в данной области техники. Обычно гуманизированное антитело имеет один или более аминокислотных остатков, которые были введены в него из источника нечеловеческого происхождения. Эти нечеловеческие аминокислотные остатки часто называют "импортными" остатками, которые в типичном случае происходят из "импортного" вариабельного домена. Гуманизацию существенным образом можно провести по методике, разработанной Winter с сотрудниками [Jones et al., Nature, 321:522-525 (1986), Riechmann et al., Nature, 332:323-327 (1988), Verhoeyen et al., Science, 239:1534-1536 (1988)], которая заключается в замещении CDR или последовательностей CDR грызунов соответствующими последовательностями из антитела человека. В соответствии с этим такие "гуманизированные" антитела представляют собой химерные антитела (патент США № 4816567), в которых значительно меньшая часть последовательности, чем интактный вариабельный домен человека, была замещена соответствующей последовательностью от другого биологического вида (не человека). На практике типичные гуманизированные антитела представляют собой антитела человека, в которых некоторые остатки в CDR и, возможно, некоторые остатки в FR замещены остатками из аналогичных сайтов антител грызунов.

Выбор вариабельных доменов человека как легких, так и тяжелых цепей, которые могут быть использованы для изготовления гуманизированных антител, очень важен для того, чтобы, по возможности, ограничить их иммуногенность и реакцию HAMA (выработку противомышиных антител человека) в тех случаях, когда антитело предназначено для лечебного применения на человеке. В соответствии с так называемым методом "оптимального приближения" последовательность вариабельного домена в антителе грызуна скринируют по всей библиотеке известных последовательностей вариабельного домена человека. Идентифицируют ту последовательность V-домена человека, которая ближе всего к последовательности грызуна, и каркасный регион человека (FR) в пределах этой последовательности принимают за основу для гуманизированного антитела (Sims et al., J. Immunol. 151:2296 (1993), Chothia et al., J. Mol. Biol., 196:901 (1987)). Еще один способ подразумевает применение специфического каркасного региона, полученного из консенсусной последовательности всех антител человека особой подгруппы легких и тяжелых цепей. Один и тот же каркасный регион можно использовать для нескольких разных гуманизированных антител (Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285 (1992); Presta et al., J. Immunol. 151:2623 (1993)).

Далее важно, чтобы антитела были гуманизированы с сохранением высокой аффинности связывания с антигеном и других предпочтительных биологических свойств. Для достижения этой цели в соответствии с предпочтительным способом гуманизированные антитела изготовляют в процессе анализа родительской последовательности с различными концептуальными гуманизированными продуктами, используя трехмерные модели родительских и гуманизированных последовательностей. Трехмерные модели иммуноглобулинов широко доступны и хорошо знакомы компетентным специалистам. Доступны также компьютерные программы, которые иллюстрируют и наглядно воспроизводят возможные трехмерные конформационные структуры последовательностей иммуноглобулинов, отобранных в качестве кандидатов. Проверка этих изображений дает возможность проанализировать вероятную роль остатков в функционировании последовательности иммуноглобулина-кандидата, то есть аналитически определить остатки, которые влияют на способность иммуноглобулина-кандидата связываться с соответствующим ему антигеном. Таким образом, можно подобрать остатки FR и так скомбинировать их из реципиентной и импортной последовательности, чтобы получить желательные характеристики антитела, в частности повышенную аффинность к целевому антигену (антигенам). Обычно влияние на связывание антигена напрямую и главным образом определяют аминокислотные остатки гипервариабельного региона.

Предполагаются различные формы гуманизированного анти-IL-17A/F-антитела. Например, гуманизированное антитело может представлять собой фрагмент антитела, такой как Fab, который по выбору конъюгирован с одним или более цитотоксических агентов с той целью, чтобы получить иммуноконъюгат. В альтернативном варианте гуманизированное антитело может представлять собой интактное антитело, такое как интактное антитело IgG1.

В качестве альтернативы гуманизации можно генерировать антитела человека. Например, в настоящее время возможно создавать трансгенных животных (например, мышей), которые способны в результате иммунизации вырабатывать полный репертуар антител человека даже при отсутствии выработки эндогенных иммуноглобулинов. Например, было описано, что гомозиготная делеция гена связующего региона (JH) тяжелой цепи антитела у химерных мышей и мышей, несущих мутацию в зародышевой линии клеток, приводит к полному подавлению эндогенной выработки антител. Перенос гена иммуноглобулина из зародышевой линии человека в зародышевую линию мутантных мышей приведет к выработке антител человека при антигенной провокации. См., например, ссылки Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551 (1993), Jakobovits et al., Nature, 362:255-258 (1993), Bruggemann et al., Year in Immuno. 7:33 (1993), патенты США № 5545806, 5569825, 5591669 (все принадлежат GenPharm), 5545807 и документ WO 97/17852.

В качестве альтернативы можно применить технологию фагового дисплея (McCafferty et al., Nature 348:552-553 [1990]) для продуцирования антител человека и фрагментов антител in vitro из репертуара гена вариабельного (V) домена от иммунизированных доноров. Согласно этой методике гены V-домена антитела клонируют внутри рамки считывания в ген или мажорного, или минорного белка оболочки нитчатого бактериофага, такого как M13 или fd, и демонстрируют как фрагменты функционального антитела на поверхности фаговой частицы. Поскольку нитевидная частица содержит однонитевую копию ДНК фагового генома, выбор, основанный на функциональных свойствах антитела, также приводит к отбору гена, кодирующего антитело, которое проявляет такие свойства. Таким образом, фаг имитирует некоторые из свойств B-клетки. Фаговый дисплей можно осуществить в разных форматах, обзор которых представлен, например, в ссылке Johnson, Kevin S. and Chiswell, David J., Current Opinion in Structural Biology 3:564-571 (1993). Для фагового дисплея можно использовать несколько источников сегментов V-гена. Clackson et al., Nature, 352:624-628 (1991) выделили многообразный массив антител против оксазолона из небольшой случайной комбинаторной библиотеки V-генов, полученных из селезенок иммунизированных мышей. Можно по существу сконструировать репертуар V-генов от неиммунизированных доноров (людей) и выделить многообразный массив антигенов (включая аутоантигены), основываясь на методике, описанной в ссылках Marks et al., J. Mol. Biol. 222:581-597 (1991), или Griffith et al., EMBO J. 12:725-734 (1993). См. также патенты США № 5565332 и 5573905.

Как обсуждалось выше, антитела человека также можно генерировать B-клетками, активированными in vitro (см. патенты США № 5567610 и 5229275).

4. Фрагменты антител

В некоторых обстоятельствах предпочтительнее использовать не целые антитела, а фрагменты антител. Меньший размер фрагментов делает возможным быстрое выведение и может привести к лучшему доступу в солидные опухоли.

Для выработки фрагментов антител были разработаны различные методики. В традиционном варианте эти фрагменты получали посредством протеолитического переваривания интактных антител (см., например, ссылки Morimoto et al., Journal of Biochemical and Biophysical Methods 24:107-117 (1992) и Brennan et al., Science, 229:81 (1985)). Однако в настоящее время эти фрагменты можно получать непосредственно из рекомбинантных клеток-хозяев. Все фрагменты антител типа Fab, Fv и ScFv могут быть экспрессированы и секретированы из E. coli, что позволяет легко получать эти фрагменты в большом количестве. Фрагменты антител можно выделять из фаговых библиотек антител, обсуждавшихся выше. В альтернативном варианте фрагменты Fab'-SH можно напрямую извлекать из E. coli и соединять химически для получения фрагментов F(ab')2 (Carter et al., Bio/Technology 10:163-167 (1992)). В соответствии с другим подходом фрагменты F(ab')2 можно непосредственно выделять из рекомбинантной культуры клеток-хозяев. Фрагменты Fab и F(ab')2 с более продолжительным периодом полувыведения in vivo, содержащие аминокислотные остатки рецепторсвязывающего эпитопа, описаны в патенте США № 5869046. Специалисту-практику будут очевидны другие методики получения фрагментов антител. В других вариантах осуществления изобретения антитело представляет собой одноцепочечный фрагмент Fv (scFv). См. документ WO 93/16185, патент США № 5571894 и патент США № 5587458. Фрагменты Fv и sFv - это единственные разновидности фрагментов с интактными паратопами (сайтами связывания), которые лишены постоянных регионов. Таким образом, они пригодны для редуцированного неспецифического связывания при использовании in vivo. Можно сконструировать гибридные белки sFv, чтобы в результате получить слияние эффекторного белка или с амино-, или с карбокси-концом sFv. См. ссылку Antibody Engineering, ed. Borrebaeck, выше. Фрагмент антитела также может представлять собой "линейное антитело", например, как это описано в патенте США № 5641870. Такие линейные фрагменты антител могут быть моноспецифическими или биспецифическими.

5. Биспецифические антитела

Биспецифические антитела представляют собой антитела, имеющие специфичность связывания по меньшей мере с двумя разными антигенными эпитопами. Типичные биспецифические антитела могут связываться с двумя разными эпитопами белка IL-17A/F, как это описано здесь. Другие антитела подобного типа могут сочетать сайт связывания IL-17A/F с сайтом связывания для другого белка. В альтернативном варианте анти-IL-17A/F-ветвь может сочетаться с ветвью, которая связывается с пусковой молекулой на лейкоците, такой как рецепторная молекула T-клетки (например, CD3), или рецепторы Fc для IgG (FcγR), такие как FcγRI (CD64), FcγRII (CD32) и FcγRIII (CD16), фокусируя и локализуя механизмы клеточной защиты на клетке, экспрессирующей IL-17A/F. Биспецифические антитела можно также применять для локализации цитотоксических агентов на клетках, которые экспрессируют IL-17A/F. Такие антитела обладают ветвью связывания IL-17A/F и ветвью, связывающей цитотоксический агент (например, сапорин, анти-α-интерферон, алкалоиды барвинка, цепь A рицина, метотрексат или гаптен с радиоактивным изотопом). Биспецифические антитела можно изготовить как полноразмерные антитела или как фрагменты антител (например, биспецифические антитела F(ab')2).

Документ WO 96/16673 описывает биспецифическое анти-ErbB2/анти-FcγRIII-антитело, а патент США № 5837234 раскрывает биспецифическое анти-ErbB2/анти-FcγRI-антитело. Биспецифическое анти-ErbB2/Fcα-антитело показано в документе WO 98/02463. Патент США № 5821337 подробно описывает биспецифическое анти-ErbB2/анти-CD3-антитело.

Способы изготовления биспецифических антител известны в данной области техники. Традиционная выработка полноразмерных биспецифических антител основана на одновременной экспрессии двух пар тяжелой цепи и легкой цепи иммуноглобулина, причем две цепи имеют разную специфичность (Millstein et al., Nature 305:537-539 (1983)). Вследствие случайного расхождения тяжелой и легкой цепи иммуноглобулина такие гибридомы (квадромы) продуцируют потенциальную смесь из 10 разных молекул антитела, в которой только одна молекула имеет правильную биспецифическую структуру. Очистка правильной молекулы, которая обычно требует нескольких этапов аффинной хроматографии, довольно обременительна, а выход продукта невелик. Похожие процедуры раскрыты в документе WO 93/08829 и в ссылке Traunecker et al., EMBO J. 10:3655-3659 (1991).

Согласно другому подходу вариабельные домены антитела с желательной специфичностью связывания (сайты связывания антитело-антиген) гибридизируют с последовательностями постоянных доменов иммуноглобулина. Предпочтительно, чтобы слияние происходило с постоянным доменом тяжелой цепи, содержащим по меньшей мере часть регионов талии, CH2 и CH3. Предпочтительно, чтобы первый постоянный регион тяжелой цепи (CH1) содержал сайт, необходимый для связывания легкой цепи, который был бы представлен по меньшей мере в одном из слияний. ДНК, кодирующая слияния тяжелой цепи иммуноглобулина и, если это желательно, легкой цепи иммуноглобулина, вставляется в разные векторы экспрессии, которые одновременно трансфицируются в подходящую клетку-хозяина. Это обеспечивает большую гибкость в подгонке взаимных пропорций трех фрагментов полипептида в тех вариантах осуществления, когда неравное соотношение трех полипептидных цепей, используемое в конструкции, дает оптимальный выход желательного биспецифического антитела. Однако возможно вставлять кодирующие последовательности двух или трех полипептидных цепей в один и тот же вектор экспрессии, если экспрессия по меньшей мере двух полипептидных цепей в равном соотношении приводит к высокому выходу продукта или если это соотношение существенно не влияет на выход желательной комбинации цепей.

В предпочтительном варианте осуществления этого подхода биспецифические антитела состоят из тяжелой цепи гибридного иммуноглобулина с первой связывающей специфичностью в одной ветви и гибридной пары тяжелой и легкой цепи иммуноглобулина (создающей вторую специфичность связывания) в другой ветви. Было обнаружено, что такая асимметричная структура облегчает отделение желательного биспецифического соединения от нежелательной комбинации цепей иммуноглобулина, поскольку присутствие легкой цепи иммуноглобулина только в одной половине биспецифической молекулы создает возможность легкого разделения. Этот подход раскрыт в документе WO 94/04690. Для получения дополнительных сведений по генерированию биспецифических антител см., например, ссылку Suresh et al., Methods in Enzymology 121:210 (1986).

В соответствии с другим подходом, описанным в патенте США № 5731168, можно сконструировать границу раздела между парой молекул антитела, чтобы довести до максимума процентную долю гетеродимеров, которые извлекают из рекомбинантной клеточной культуры. Предпочтительная граница раздела содержит по меньшей мере часть домена CH3. В этом способе одну или более маленьких боковых аминокислотных цепей на границе раздела первой молекулы антитела замещают более крупными боковыми цепями (например, тирозиновыми или триптофановыми). На границе раздела второй молекулы антитела создают компенсаторные "полости" идентичного или сходного размера, замещая большие аминокислотные боковые цепи цепями меньшего размера (например, аланиновыми или треониновыми). Это создает механизм для увеличения выхода гетеродимера по сравнению с другими нежелательными конечными продуктами, например гомодимерами.

Биспецифические антитела включают поперечно сшитые антитела или "гетероконъюгаты". Например, одно из антител в гетероконъюгате может быть соединено с авидином, а другое - с биотином. Например, было предположено, что такие антитела нацеливают клетки иммунной системы на нежелательные клетки (патент США № 4676980) и могут быть использованы при лечении HIV (ВИЧ)-инфекции (документы WO 91/00360, WO 92/200373 и EP 03089). Антитела-гетероконъюгаты можно изготовить, применяя любые традиционные способы поперечного сшивания. Подходящие агенты для поперечного сшивания хорошо известны в данной области техники и раскрыты в патенте США № 4676980 наряду с множеством методик поперечного сшивания.

В литературе также были описаны методики для генерирования биспецифических антител из фрагментов антител. Например, биспецифические антитела можно изготовить, применяя химическое сцепление. В ссылке Brennan et al., Science 229:81 (1985) описана процедура, в которой интактные антитела подвергают протеолитическому расщеплению для генерирования фрагментов F(ab')2. Эти фрагменты редуцируют в присутствии дитиол-комплексообразующего агента, арсенита натрия, чтобы стабилизировать смежные дитиолы и предотвратить образование межмолекулярных дисульфидов. Затем генерированные фрагменты Fab' конвертируют в производные тионитробензоата (TNB). Затем одно из производных Fab'-TNB реконвертируют в Fab'-тиол посредством редукции меркаптоэтаноламином и смешивают с эквимолярным количеством другого производного Fab'-TNB, чтобы получить биспецифическое антитело. Полученные таким способом биспецифические антитела можно использовать в качестве агентов для селективной иммобилизации ферментов.

Новейшие достижения прогресса облегчили прямое извлечение из E. coli фрагментов Fab'-SH, которые можно соединять химически для получения биспецифических антител. В своей статье Shalaby et al., J. Exp. Med. 175: 217-225 (1992) описывают выработку молекулы полностью гуманизированного биспецифического антитела F(ab')2. Каждый фрагмент Fab' был по отдельности секретирован из E. coli и подвергнут прямому химическому соединению in vitro для получения биспецифического антитела. Полученное таким способом антитело было способно связываться с клетками, избыточно экспрессирующими рецептор ErbB2, и с нормальными T-клетками, а также инициировать литическую активность цитотоксических лимфоцитов человека против целевых клеток опухоли молочной железы у человека. Были также описаны различные методики изготовления и выделения фрагментов биспецифических антител непосредственно из культуры рекомбинантных клеток. Например, биспецифические антитела были получены с применением лейциновых застежек. Kostelny et al., J. Immunol. 148(5):1547-1553 (1992). Пептиды с лейциновой застежкой из белков Fos и Jun были сцеплены с частями Fab' двух разных антител посредством слияния генов. Гомодимеры антитела были редуцированы в области талии для получения мономеров и подвергнуты повторному окислению для получения гетеродимеров антитела. Этот способ можно также использовать для выработки гомодимеров антитела. Альтернативный механизм для изготовления фрагментов биспецифических антител предоставляет технология "диател", описанная в ссылке Hollinger et al., Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993). Фрагменты содержат VH, соединенный с VL линкером, который слишком короток для того, чтобы допустить спаривание между двумя доменами в одной и той же цепи. В соответствии с этим домены VH и VL одного фрагмента принудительно спариваются с комплементарными доменами VL и VH другого фрагмента, формируя таким образом два антигенсвязывающих сайта. Кроме того, была описана еще одна стратегия изготовления фрагментов биспецифических антител, основанная на применении одноцепочечных димеров Fv (sFv). См. ссылку Gruber et al., J. Immunol., 152:5368 (1994).

Рассматриваются антитела, имеющие более двух валентностей. Например, можно изготовить триспецифические антитела. Tutt et al., J. Immunol. 147:60 (1991).

6. Антитела-гетероконъюгаты

В сферу настоящего изобретения также входят антитела-гетероконъюгаты. Антитела-гетероконъюгаты состоят из двух ковалентно связанных антител. Например, было предположено, что такие антитела нацеливают клетки иммунной системы на нежелательные клетки (патент США № 4676980) и могут быть использованы при лечении HIV (ВИЧ)-инфекции (документы WO 91/00360, WO 92/200373 и EP 03089). Предполагается, что антитела могут быть изготовлены in vitro с применением известных способов химии синтетических белков, включая способы с применением поперечно сшивающих агентов. Например, могут быть сконструированы иммунотоксины с применением дисульфидной обменной реакции или с образованием тиоэфирной связи. Примеры подходящих реактивов для этой цели включают иминотиолат, метил-4-меркаптобутиримидат и соединения, раскрытые, например, в патенте США № 4676980.

7. Поливалентные антитела

Поливалентное антитело может быть интернализовано (и/или катаболизировано) быстрее, чем бивалентное антитело, посредством клеточной экспрессии антигена, с которым связывается указанное антитело. Антитела, предлагаемые настоящим изобретением, могут представлять собой поливалентные антитела (отличающиеся от антител класса IgM) с тремя или более антигенсвязывающими сайтами (например, тетравалентные антитела), которые можно легко получить посредством рекомбинантной экспрессии нуклеиновой кислоты, кодирующей полипептидные цепи антитела. Поливалентное антитело может содержать домен димеризации, а также три или более антигенсвязывающих сайта. Предпочтительный домен димеризации содержит регион Fc или шарнирный регион (либо целиком состоит из такого региона). Согласно этому сценарию антитело будет содержать регион Fc, а также три или более антигенсвязывающих сайта (аминоконцевых по отношению к региону Fc). Предпочтительное поливалентное антитело в настоящем контексте содержит приблизительно от трех до восьми, но предпочтительнее четыре антигенсвязывающих сайта. Поливалентное антитело содержит по меньшей мере одну полипептидную цепь (предпочтительно, две полипептидные цепи), причем указанная полипептидная цепь (цепи) содержит два или более вариабельных домена. Например, полипептидная цепь (цепи) может содержать конструкцию VD1-(X1)n-VD2-(X2)n-Fc, в которой VD1 означает первый вариабельный домен, VD2 - второй вариабельный домен, Fc - одну полипептидную цепь региона Fc, X1 и X2 представляют аминокислоту или полипептид, а n равно 0 или 1. Например, полипептидная цепь (цепи) может содержать конструкцию: VH-CH1-гибкий линкер-VH-CH1-цепь региона Fc или VH-CH1-VH-CH1-цепь региона Fc. Предпочтительнее, чтобы описанное здесь поливалентное антитело включало по меньшей мере два (но предпочтительнее - четыре) полипептида вариабельного домена легкой цепи. Описанное здесь поливалентное антитело может содержать, например, приблизительно от двух до восьми полипептидов вариабельного домена легкой цепи. Рассматриваемые здесь полипептиды вариабельного домена легкой цепи содержат вариабельный домен легкой цепи, а также, по выбору, могут дополнительно содержать домен CL.

8. Инженерия эффекторной функции

Может оказаться желательным модифицировать предлагаемое изобретением антитело, чтобы изменить его эффекторную функцию, например усилить антигензависимую клеточноопосредованную цитотоксичность (ADCC) и/или комплементзависимую цитотоксичность (CDC) антитела. Этого можно достичь, вводя одно или более аминокислотных замещений в регион Fc антитела. В альтернативном или дополнительном варианте в регион Fc можно ввести цистеиновый остаток (остатки), что позволяет образовываться межцепочечным дисульфидным связям в этом регионе. Полученное таким способом гомодимерное антитело может обладать улучшенной способностью к интернализации и/или повышенными комплементопосредованным уничтожением клеток и антителозависимой клеточной цитотоксичностью (ADCC). См. ссылки Caron et al., J. Exp Med. 176:1191-1195 (1992) и Shopes, B. J. Immunol. 148:2918-2922 (1992). С применением гетеробифункциональных кросс-линкеров можно также изготовить гомодимерные антитела, как это описано в ссылке Wolff et al., Cancer Research 53:2560-2565 (1993). В альтернативном варианте можно инженерно сконструировать антитело, имеющее сдвоенные Fc регионы, то есть улучшенные способности лизиса комплемента и ADCC. См. ссылку Stevenson et al., Anti-Cancer Drug Design 3:219-230 (1989). Для того чтобы увеличить период полувыведения антитела из сыворотки, можно ввести в антитело реутилизационный рецепторсвязывающий эпитоп (особенно фрагмент антитела), как это, например, описано в патенте США № 5739277. При использовании здесь терминологического определения "реутилизационный рецепторсвязывающий эпитоп" относится к эпитопу региона Fc молекулы IgG (например, IgG1, IgG2, IgG3 или IgG4), который отвечает за увеличение периода полувыведения молекулы IgG из сыворотки in vivo.

9. Иммуноконъюгаты

Изобретение также имеет отношение к иммуноконъюгатам, содержащим антитело, конъюгированное с цитотоксическим агентом, таким как химиотерапевтический агент, агент-ингибитор роста, токсин (например, ферментативно активный токсин бактериального, грибкового, растительного или животного происхождения либо его фрагмент) или радиоактивный изотоп (например, радиоконъюгат).

Химиотерапевтические агенты, полезные в генерировании таких иммуноконъюгатов, были описаны выше. Можно использовать ферментативно активные токсины и их фрагменты, включая цепь А дифтерийного токсина, не связывающиеся активные фрагменты дифтерийного токсина, цепь A экзотоксина (Pseudomonas aeruginosa), цепь A рицина, цепь A абрина, цепь A модекцина, альфа-сарцин, белки Aleurites fordii, белки диантина, белки Phytolaca americana (PAPI, PAPII и PAP-S), ингибитор из китайской горькой тыквы (Momordica charantia), курцин, кротин, ингибитор из мыльнянки лекарственной (Sapaonaria officinalis), гелонин, митогеллин, рестриктоцин, феномицин, эномицин и трихотецены. Имеется много доступных радионуклидов для выработки радиоконъюгированных антител. Примеры включают 212Bi, 131I, 131In, 90Y и 186Re. Конъюгаты антитела и цитотоксического агента получают, применяя разнообразные бифункциональные белковые линкеры, такие как N-сукцинимидил-3-(2-пиридилдитиол) пропионат (SPDP), иминотиолан (IT), бифункциональные производные имидоэфиров (например, диметиладипимидат HCL), активные эфиры (например, дисукцинимидилсуберат), альдегиды (например, глутаровый альдегид), бис-азидо-соединения (например, бис-(p-азидобензоил)гександиамин), производные бис-диазония (например, бис-(p-диазонийбензол)этилендиамин), диизоцианаты (например, толуол-2,6-диизоцианат) и бис-активные фтористые соединения (например, 1,5-дифтор-2,4-динитробензол). Например, рициновый иммунотоксин можно изготовить, как это описано в ссылке Vitetta et al., Science, 238: 1098 (1987). Типичным хелатообразующим агентом для конъюгации радионуклида с антителом является меченый 14-углеродом 1-изотиоцианатобензил-3-метилдиэтилен тираминпентауксусная кислота (MX-DTPA). См. документ WO 94/11026.

Здесь также рассматриваются конъюгаты антител с одним или более мелкомолекулярных токсинов, таких как калихеамицин, майтансиноиды, трихотен, CC1065 и производные этих токсинов, обладающие токсической активностью.

Майтансин и майтансиноиды

В одном из предпочтительных вариантов осуществления изобретения предлагаемое здесь анти-IL-17A/F-антитело (полноразмерное или фрагмент) конъюгировано с одной или более молекул майтансиноидов.

Майтансиноиды представляют собой ингибиторы митоза, действие которых основано на подавлении полимеризации тубулина. Майтансин был впервые выделен из восточноафриканского кустарника Maytenus serrata (патент США № 3896111). Позднее было открыто, что некоторые микробы также продуцируют майтансиноиды, в частности майтансинол и эфиры майтансинола C-3 (патент США № 4151042). Синтетически майтансинол, его производные и аналоги раскрыты, например, в патентах США № 4137230, 4248870, 4256746, 4260608, 4265814, 4294757, 4307016, 4308268, 4308269, 4309428, 4313946, 4315929, 4317821, 4322348, 4331598, 4361650, 4364866, 4424219, 4450254, 4362663 и 4371533, раскрытые сведения из которых определенно включены сюда в качестве ссылки.

Конъюгаты майтансиноид-антитело

В попытках улучшить терапевтический индекс лекарств исследователи конъюгировали майтансин и майтансиноиды с антителами, специфически связывающимися с антигенами опухолевых клеток. Иммуноконъюгаты, содержащие майтансиноиды, и их терапевтическое применение раскрыты, например, в патентах США № 5208020, 5416064 и европейском патенте EP 0425235 B1, раскрытые сведения из которых, определенно включены сюда в качестве ссылки. В своей публикации Liu et al., Proc. Natl. Acad. Sci. USA 93:8618-8623 (1996) описали иммуноконъюгаты, содержащие майтансиноид, обозначенный DM1, который был сцеплен с моноклональным антителом C242, направленным против клеток колоректального рака человека. Было обнаружено, что этот конъюгат обладает высокой цитотоксичностью по отношению к культивированным раковым клеткам, а также демонстрирует противоопухолевую активность в анализе на опухолевый рост in vivo. В ссылке Chari et al., Cancer Research 52:127-131 (1992) описаны иммуноконъюгаты, в которых майтансиноид был конъюгирован посредством дисульфидного линкера с мышиным антителом A7, связывающимся с антигеном клеточных линий рака толстой кишки человека, или с другим мышиным моноклональным антителом TA.1, которое связывается с онкогеном HER-2/neu. Цитотоксичность конъюгата TA.1-майтансиноид была протестирована in vitro на клеточной линии рака молочной железы человека SK-BR-3, в которой экспрессируется 3 × 105 поверхностных антигенов HER-2 в расчете на одну клетку. Лекарственный конъюгат достигал степени цитотоксичности, сходной с лекарством, содержавшим свободный майтансиноид, причем цитотоксичность конъюгата можно было повысить, увеличивая число молекул майтансиноида на молекулу антитела. Конъюгат A7-майтансиноид продемонстрировал низкую системную цитотоксичность у мышей.

Конъюгаты майтансиноида с анти-IL-17A/F-антителом к полипептиду интерлейкина (иммуноконъюгаты)

Конъюгаты анти-IL-17A/F-антитела с майтансиноидом могут быть изготовлены посредством химического соединения анти-IL-17A/F-антитела с молекулой майтансиноида, которое существенно не снижает биологическую активность ни антитела, ни молекулы майтансиноида. При среднем содержании в конъюгате 3-4 молекул майтансиноида на молекулу антитела был продемонстрирован эффект усиления цитотоксичности в отношении целевых клеток без отрицательного влияния на функцию или растворимость антитела, хотя можно ожидать, что даже конъюгат одной молекулы токсина с одной молекулой антитела будет иметь большую цитотоксичность, чем применение неконъюгированного антитела. Майтансиноиды хорошо известны в данной области техники, и их можно синтезировать посредством известных методик или выделять из природных источников. Подходящие майтансиноиды раскрыты, например, в патенте США № 5208020, а также в других патентах и непатентных публикациях, ссылки на которые приводились здесь выше. Предпочтительными майтансиноидами являются майтансинол и аналоги майтансинола, модифицированные в ароматическом кольце или в других положениях молекулы майтансинола, в частности эфиры майтансинола.

Существует множество известных в данной области техники соединительных групп для изготовления конъюгатов антитела с майтансиноидом, включая, например, группы, раскрытые в патенте США № 5208020 или в патенте EP 0425235 B1, а также в ссылке Chari et al., Cancer Research 52:127-131 (1992). Соединительные группы включают дисульфидные группы, тиоэфирные группы, кислотолабильные группы, фотолабильные группы, пептидазолабильные группы или эстеразолабильные группы, как это раскрыто в указанных выше патентах, причем предпочтительными являются дисульфидные и тиоэфирные группы.

Конъюгаты антитела и майтансиноида можно получить, применяя разнообразные бифункциональные белковые линкеры, такие как N-сукцинимидил-3-(2-пиридилдитиол) пропионат (SPDP), сукцинимидил-4-(N-малеимидометил) циклогексан-1-карбоксилат, иминотиолан (IT), бифункциональные производные имидоэфиров (например, диметиладипимидат HCL), активные эфиры (например, дисукцинимидилсуберат), альдегиды (например, глутаровый альдегид), бис-азидо-соединения (например, бис-(p-азидобензоил) гександиамин), производные бис-диазония (например, бис-(p-диазонийбензол)-этилендиамин), диизоцианаты (например, толуол-2,6-диизоцианат) и бис-активные фтористые соединения (например, 1,5-дифтор-2,4-динитробензол). Особенно предпочтительные связующие агенты, обеспечивающие дисульфидную связь, включают N-сукцинимидил-3-(2-придилтио) пропионат (SPDP) (Carlsson et al., Biochem. J. 173:723-737 [1978]) и N-сукцинимидил-4-(2-пиридилтио)пентаноат (SPP).

Линкер может быть присоединен к молекуле майтансиноида в разных положениях в зависимости от типа соединения. Например, эфирное соединение может быть сформировано посредством реакции с гидроксильной группой при использовании традиционных методик связывания. Реакция может произойти в положении C-3, имеющем гидроксильную группу, в положении C-14, модифицированном гидроксиметилом, в положении C-15, модифицированном гидроксильной группой, и в положении C-20, имеющем гидроксильную группу. В предпочтительном варианте осуществления связь формируется в положении C-3 майтансинола или аналога майтансинола.

Калихеамицин

Еще один заслуживающий внимания иммуноконъюгат содержит анти-IL-17A/F-антитело, конъюгированное с одной или более молекул калихеамицина. Антибиотики семейства калихеамицина способны производить разрывы двунитевой ДНК в субпикомолярных концентрациях. По вопросам изготовления конъюгатов семейства калихеамицина см. патенты США № 5712374, 5714586, 5739116, 5767285, 5770701, 5770710, 5773001, 5877296 (все выданы компании American Cyanamid). Структурные аналоги калихеамицина, пригодные для применения, включают, но не ограничиваясь ими, γ1I, α2I, α3I, N-ацетил-γ1I, PSAG и θI1 (Hinman et al., Cancer Research 53:3336-3342 (1993), Lode et al., Cancer Research 58:2925-2928 (1998) и вышеуказанные патенты США, выданные компании American Cyanamid). Еще одним противоопухолевым лекарством, которое может быть конъюгировано с антителом, является антифолат QFA. Как калихеамицин, так и QFA имеют внутриклеточное место приложения, но нелегко проходят через плазматическую мембрану. Поэтому поглощение этих агентов клетками через опосредованную антителом интернализацию существенно усиливает их цитотоксические эффекты.

Другие цитотоксические агенты

С анти-IL-17A/F-антителами, предлагаемыми изобретением, могут быть конъюгированы другие противоопухолевые агенты, включая BCNU, стрептозоцин, винкристин и 5-фторурацил, семейство агентов, известных под общим названием комплекса LL-E33288, описанного в патентах США № 5053394, 5770710, а также эсперамицины (патент США № 5877296).

Можно использовать ферментативно активные токсины и их фрагменты, включая цепь А дифтерийного токсина, несвязывающиеся активные фрагменты дифтерийного токсина, цепь A экзотоксина (Pseudomonas aeruginosa), цепь A рицина, цепь A абрина, цепь A модекцина, альфа-сарцин, белки Aleurites fordii, белки диантина, белки Phytolaca americana (PAPI, PAPII и PAP-S), ингибитор из китайской горькой тыквы (Momordica charantia), курцин, кротин, ингибитор из мыльнянки лекарственной (Sapaonaria officinalis), гелонин, митогеллин, рестриктоцин, феномицин, эномицин и трихотецены. См., например, документ WO 93/21232, опубликованный 28 октября 1993 г.

Далее настоящее изобретение рассматривает иммуноконъюгат, образованный между антителом и соединением с нуклеолитической активностью (например, рибонуклеазой или ДНК-эндонуклеазой, такой как дезоксирибонуклеаза, ДНК-аза).

Для избирательного разрушения опухоли антитело может содержать высокорадиоактивный атом. Имеется много доступных радиоактивных изотопов для выработки радиоконъюгированных анти-IL-17A/F-антител. Примеры включают At211, I131, I125, Y90, Re186, Re188, Sm153, Bi212, P32, Pb212 и радиоактивные изотопы Lu. В тех случаях, когда конъюгат используют для диагностики, он может содержать радиоактивный атом для сцинтиграфических исследований, например, tc99m или I123, либо спиновую метку для получения изображений методом ядерного магнитного резонанса (NMR) (эта методика также известна под названием магнитно-резонансная томография [mri]), например, иод-123, иод-131, индий-111, фтор-19, углерод-13, азот-15, кислород-17, гадолиний, марганец или железо.

Радиоактивные или другие метки могут быть инкорпорированы в конъюгат известными способами. Например, можно биосинтезировать или синтезировать меченый пептид методом химического аминокислотного синтеза, применяя подходящие предшественники аминокислот, например фтор-19 вместо водорода. Такие метки, как tc99m или I123, Re186, Re188 и In111 могут быть прикреплены к пептиду через цистеиновый остаток. Иттрий-90 может быть прикреплен через лизиновый остаток. Для инкорпорирования йода-123 можно использовать способ IODOGEN (Fraker et al. (1978) Biochem. Biophys. Res. Commun. 80: 49-57). Другие способы подробно описаны в ссылке "Monoclonal Antibodies in Immunoscintigraphy" (Chatal, CRC Press 1989).

Конъюгаты антитела и цитотоксического агента можно получить, применяя разнообразные бифункциональные белковые линкеры, такие как N-сукцинимидил-3-(2-пиридилдитиол) пропионат (SPDP), сукцинимидил-4-(N-малеимидометил) циклогексан-1-карбоксилат, иминотиолан (IT), бифункциональные производные имидоэфиров (например, диметиладипимидат HCL), активные эфиры (например, дисукцинимидилсуберат), альдегиды (например, глутаровый альдегид), бис-азидо-соединения (например, бис-(p-азидобензоил) гександиамин), производные бис-диазония (например, бис-(p-диазонийбензол)-этилендиамин), диизоцианаты (например, толуол-2,6-диизоцианат) и бис-активные фтористые соединения (например, 1,5-дифтор-2,4-динитробензол). Например, рициновый иммунотоксин можно изготовить так, как это описано в ссылке Vitetta et al., Science 238:1098 (1987). Типичным хелатообразующим агентом для конъюгации радионуклида с антителом является меченый 14-углеродом 1-изотиоцианатобензил-3-метилдиэтилен тираминпентауксусная кислота (MX-DTPA). См. документ WO 94/11026. Линкер может представлять собой "расщепляемый линкер", облегчающий высвобождение цитотоксического лекарства в клетке. Например, можно использовать кислотолабильный линкер, пептидазочувствительный линкер, фотолабильный линкер, диметиловый линкер или дисульфидсодержащий линкер (Chari et al., Cancer Research 52:127-131 (1992), патент США № 5208020).

В альтернативном варианте может быть изготовлен гибридный белок, содержащий анти-IL-17A/F-антитело и цитотоксический агент, например, посредством рекомбинантных методик или пептидного синтеза. Отрезок ДНК может содержать соответствующие регионы, кодирующие две части конъюгата, либо смежные друг с другом, либо разделенные регионом, кодирующим линкерный пептид, который не устраняет желательные свойства конъюгата.

Еще в одном варианте осуществления изобретения антитело может быть конъюгировано с "рецептором" (например, стрептавидином) для использования в предварительном нацеливании на опухоль, причем конъюгат антитело-рецептор вводят больному с последующим удалением несвязанного конъюгата из системы кровообращения при помощи чистящего агента, а затем вводят "лиганд" (например, авидин), который конъюгирован с цитотоксическим агентом (например, радионуклеотидом).

10. Иммунолипосомы

Раскрытые здесь анти-IL-17A/F-антитела можно также ввести в состав иммунолипосом. "Липосома" представляет собой маленький пузырек, состоящий из различных типов липидов, фосфолипидов и/или сурфактанта, который полезен для доставки лекарства в организм млекопитающего. Компоненты липосомы обычно организованы в виде двухслойного образования, напоминающего организацию липидов в биологических мембранах. Липосомы, содержащие антитело, можно изготовить способами, известными в данной области техники, например, как это описано в ссылках Epstein et al., Proc. Natl. Acad. Sci. USA 82:3688 (1985), Hwang et al., Proc. Natl Acad. Sci. USA 77:4030 (1980), а патентах США № 4485045 и 4544545, а также в документе WO 97/38731, опубликованном 23 октября 1997 г. Липосомы с продолжительным периодом циркуляции раскрыты в патенте США № 5013556.

Особенно полезные липосомы можно генерировать способом обращенно-фазового выпаривания с таким составом липидов, который содержит фосфатидилхолин, холестерин и PEG-дериватизированный фосфатидилэтаноламин (PEG-PE). Липосомы формируют продавливанием через фильтры с определенным размером пор, получая липосомы желательного диаметра. Фрагменты Fab' антитела, предлагаемого настоящим изобретением, могут быть конъюгированы с липосомами посредством реакции дисульфидного обмена, как это описано в ссылке Martin et al., J. Biol. Chem. 257:286-288 (1982). По выбору, в состав липосомы может быть включен химиотерапевтический агент. См. ссылку Gabizon et al., J. National Cancer Inst. 81(19):1484 (1989).

N. Олигопептиды, связывающие IL-17A/F

Олигопептиды, связывающие IL-17A/F, предлагаемые настоящим изобретением, представляют собой олигопептиды, которые связываются, предпочтительно, специфически с полипептидом IL-17A/F, как это описано здесь. Олигопептиды, связывающие IL-17A/F, могут быть синтезированы химически с применением известной методологии синтеза олигопептидов или изготовлены и очищены с применением рекомбинантной технологии. Олигопептиды, связывающие IL-17A/F, обычно имеют длину по меньшей мере приблизительно 5 аминокислот, в альтернативных вариантах по меньшей мере приблизительно 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100 аминокислот и более, причем такие олигопептиды способны связываться, предпочтительно, специфически с полипептидом IL-17A/F, как это описано здесь. Олигопептиды, связывающие IL-17A/F, можно идентифицировать без излишнего экспериментирования, применяя хорошо известные методики. В этом отношении следует отметить, что методики скрининга библиотек олигопептидов для выявления олигопептидов, способных специфически связываться с целевым полипептидом, хорошо известны в данной области техники (см., например, патенты США № 5556762, 5750373, 4708871, 4833092, 5223409, 5403484, 5571689, 5663143, публикации PCT № WO 84/03506 и WO 84/03564, ссылки Geysen et al., Proc. Natl. Acad. Sci. U.S.A., 81:3998-4002 (1984); Geysen et al., Proc. Natl. Acad. Sci. U.S.A., 82:178-182 (1985); Geysen et al., in Synthetic Peptides as Antigens, 130-149 (1986); Geysen et al., J. Immunol. Meth., 102:259-274 (1987); Schoofs et al., J. Immunol., 140:611-616 (1988), Cwirla, S. E. et al. (1990) Proc. Natl. Acad. Sci. USA, 87:6378; Lowman, H.B. et al. (1991) Biochemistry, 30:10832; Clackson, T. et al. (1991) Nature, 352: 624; Marks, J. D. et al. (1991), J. Mol. Biol., 222:581; Kang, A.S. et al. (1991) Proc. Natl. Acad. Sci. USA, 88:8363, and Smith, G. P. (1991) Current Opin. Biotechnol., 2:668).

В этом отношении бактериофаговый (фаговый) дисплей представляет собой хорошо известную методику, позволяющую скринировать большие библиотеки олигопептидов для идентификации тех членов этих библиотек, которые способны специфически связываться с целевым полипептидом. Фаговый дисплей представляет собой методику, посредством которой вариантные полипептиды демонстрируются как гибридные белки, соединенные с белком оболочки на поверхности бактериофаговых частиц (Scott, J.K. and Smith, G. P. (1990) Science 249: 386). Возможность полезного применения методики фагового дисплея основана на том факте, что большие библиотеки селективно рандомизированных вариантов белков (или случайным образом клонированных кДНК) могут быть быстро и эффективно отсортированы для выявления таких последовательностей, которые связываются с целевой молекулой на уровне высокой аффинности. Дисплей пептидных (Cwirla, S. E. et al. (1990) Proc. Natl. Acad. Sci. USA, 87:6378) или белковых (Lowman, H.B. et al. (1991) Biochemistry, 30:10832, Clackson, T. et al. (1991) Nature, 352: 624; Marks, J. D. et al. (1991), J. Mol. Biol., 222:581, Kang, A.S. et al. (1991) Proc. Natl. Acad. Sci. USA, 88:8363) библиотек на фагах был использован для скрининга миллионов полипептидов или олигопептидов на выявление среди них тех полипептидов или олигопептидов, которые обладают способностью специфического связывания (Smith, G. P. (1991) Current Opin. Biotechnol., 2:668). Сортировка фаговых библиотек случайных мутантов требует стратегии конструирования и размножения большого число вариантов, процедуры аффинной очистки с применением целевого рецептора, а также средств для оценки результатов усиления связывания. См. патенты США № 5223409, 5403484, 5571689 и 5663143.

Хотя большинство вариантов методики фагового дисплея были связаны с применением нитчатого фага, также известны системы дисплея с лямбдовидным фагом (WO 95/34683, патент США № 5627024), системы дисплея с фагом T4 (Ren, Z-J. et al. (1998) Gene 215:439, Zhu, Z. (1997) CAN 33:534, Jiang, J. et al. (1997) CAN 128:44380, Ren, Z-J. et al. (1997) CAN 127:215644, Ren, Z-J. (1996) Protein Sci. 5:1833, Efimov, V. P. et al. (1995) Virus Genes 10:173) и системы дисплея с фагом T7 (Smith, G. P. and Scott, J.K. (1993) Methods in Enzymology, 217, 228:257, патент США № 5766905).

В последнее время было разработано много усовершенствований и вариаций основной концепции фагового дисплея. Эти усовершенствования направлены на улучшение способности дисплейных систем скринировать библиотеки пептидов на связывание с отобранными целевыми молекулами и демонстрировать функциональные белки с потенциалом скрининга этих белков на желательные свойства. Были разработаны комбинаторные реакционные устройства для реакций фагового дисплея (WO 98/14277), а библиотеки фагового дисплея были использованы для анализа и контроля биомолекулярных взаимодействий (WO 98/20169, WO 98/20159), а также свойств ограниченных спиралевидных пептидов (WO 98/20036). В документе WO 97/35196 описан способ выделения аффинного лиганда, в котором библиотека фагового дисплея контактирует с первым раствором, в котором лиганд связывается с целевой молекулой, и со вторым раствором, в котором аффинный лиганд не связывается с целевой молекулой, что необходимо для селективного выделения связывающих лигандов. В документе WO 97/46251 описан способ биопанорамирования случайной библиотеки фагового дисплея аффинным очищенным антителом с последующим выделением связывающего фага, сопровождающимся процессом микропанорамирования с применением лунок микропланшета для выделения высокоаффинного связывающего фага. Также было описано применение протеина A Staphlylococcus aureus в качестве аффинной метки (Li et al. (1998) Mol Biotech., 9:187). В документе WO 97/47314 описано применение библиотек вычитания субстрата для различения специфичностей ферментов с применением комбинаторной библиотеки, которая может представлять собой библиотеку фагового дисплея. В документе WO 97/09446 описан способ отбора ферментов, пригодных для применения в детергентах при использовании фагового дисплея. Дополнительные способы отбора специфических связывающих белков описаны в патентах США № 5498538, 5432018 и в документе WO 98/15833.

Способы создания библиотек пептидов и скрининга этих библиотек также раскрыты в патентах США № 5723286, 5432018, 5580717, 5427908, 5498530, 5770434, 5734018, 5698426, 5763192 и 5723323.

O. Органические молекулы, связывающие IL-17A/F

Органические молекулы, связывающие IL-17A/F, представляют собой органические молекулы, отличающиеся от определенных здесь олигопептидов или антител, которые способны связываться, предпочтительно, специфически, с полипептидом IL-17A/F, как это описано здесь. Органические молекулы, связывающиеся с IL-17A/F, можно идентифицировать и синтезировать химически, применяя известную методологию (см., например, публикации PCT № WO 00/00823 и WO 00/39585). Органические молекулы, связывающиеся с IL-17A/F, обычно имеют приблизительный размер менее 2000 дальтон, в альтернативных вариантах приблизительный размер менее 1500, 750, 500, 250 или 200 дальтон, причем такие органические молекулы, способные связываться, предпочтительно, специфически с полипептидом IL-17A/F, как это описано здесь, можно идентифицировать без излишнего экспериментирования, применяя хорошо известные методики. В этом отношении следует отметить, что методики скрининга библиотек органических молекул для выявления молекул, способных специфически связываться с целевым полипептидом, хорошо известны в данной области техники (см., например, публикации PCT № WO 00/00823 и WO 00/39585). Органические молекулы, связывающие IL-17A/F, могут представлять собой, например, альдегиды, кетоны, оксимы, гидразоны, семикарбазоны, карбазиды, первичные амины, вторичные амины, третичные амины, N-замещенные гидразины, гидразиды, спирты, эфиры, тиолы, тиоэфиры, дисульфиды, карбоновые кислоты, сложные эфиры, амиды, карбамиды, карбаматы, карбонаты, кеталы, тиокеталы, ацеталы, тиоацеталы, арильные галиды, арильные сульфонаты, алкильные галиды, алкильные сульфонаты, ароматические соединения, гетероциклические соединения, анилины, алкены, алкины, диолы, аминоспирты, оксазолидины, оксазолины, тиазолидины, титазолины, энамины, сульфонамиды, эпоксиды, азиридины, изоцианаты, сульфонилхлориды, диазосоединения, кислые хлориды и т.п.

P. Скрининг на желательные свойства анти-IL-17A/F-антител, олигопептидов, связывающих IL-17A/F, и органических молекул, связывающих IL-17A/F

Методики генерирования антител, олигопептидов и органических молекул, способных связываться с полипептидами IL-17A/F, были описаны выше. Далее можно отбирать антитела, олигопептиды или другие органические молекулы с определенными биологическими характеристиками, которые нужны пользователю.

Ингибирующие эффекты анти-IL-17A/F-антител, олигопептидов или других органических молекул, предлагаемых изобретением, в отношении роста [клеточного] можно оценить способами, известными в данной области техники, например применяя клетки, которые экспрессируют полипептид IL-17A/F, или эндогенно, или после трансфекции с геном IL-17A/F. Например, соответствующие линии опухолевых клеток и клетки, трансфицированные IL-17A/F, можно подвергнуть обработке моноклональным анти-IL-17A/F-антителом, олигопептидом или другой органической молекулой, предлагаемым изобретением, в различных концентрациях в течение нескольких дней (например, 2-7) и окрасить кристаллическим фиолетовым или MTT, либо проанализировать с применением какого-либо иного способа колориметрического анализа. Еще один способ количественной оценки пролиферации заключается в сравнении поглощения 3H-тимидина клетками, обработанными в присутствии или при отсутствии анти-IL-17A/F-антитела, олигопептида, связывающего IL-17A/F, или органической молекулы, связывающей IL-17A/F, которые предложены изобретением. После обработки собирают клетки и при помощи сцинтилляционного счетчика определяют количество радиоактивности, инкорпорированной в ДНК. Соответствующий положительный контроль включает обработку отобранной клеточной линии антителом - ингибитором роста, заведомо подавляющим рост этой клеточной линии. Подавление роста опухолевых клеток in vivo можно определить разными способами, известными в данной области техники. Предпочтительной опухолевой клеткой является такая опухолевая клетка, которая избыточно экспрессирует полипептид IL-17A/F. Предпочтительно, чтобы анти-IL-17A/F-антитело, олигопептид, связывающий IL-17A/F, или органическая молекула, связывающая IL-17A/F, подавляли пролиферацию опухолевых клеток, экспрессирующих IL-17A/F, in vitro или in vivo приблизительно на 25-100% по сравнению с необработанными клетками, более предпочтительно, приблизительно на 30-100% и, еще более предпочтительно, приблизительно на 50-100% или 70-100% (в одном из вариантов осуществления изобретения при концентрации антитела приблизительно от 0,5 до 30 мкг/мл. Подавление роста можно измерить при концентрации антитела в клеточной культуре приблизительно от 0,5 до 30 мкг/мл или приблизительно от 0,5 нМ до 200 нМ, если подавление роста измеряют через 1-10 дней после обработки опухолевых клеток антителом. Антитело проявляет себя как ингибитор роста in vivo, если введение анти-IL-17A/F-антитела в приблизительной дозе от 1 мкг/кг до 100 мг/кг веса тела приводит к снижению размеров опухоли или уменьшению пролиферации опухолевых клеток в сроке приблизительно от 5 дней до 3 месяцев после первого введения антитела, предпочтительнее, приблизительно от 5 до 30 дней.

Для того чтобы выбрать анти-IL-17A/F-антитело, олигопептид, связывающий IL-17A/F, или органическую молекулу, связывающую IL-17A/F, которые способны индуцировать клеточную смерть, можно оценивать по сравнению с контролем утрату целостности мембраны, о чем может свидетельствовать, например, поглощение пропидий-йодида (PI), трипанового синего или 7AAD. Анализ на поглощение PI можно проводить при отсутствии комплемента и эффекторных иммунных клеток. Опухолевые клетки, экспрессирующие полипептид IL-17A/F, инкубируют со средой без добавок или со средой, содержащей соответствующее анти-IL-17A/F-антитело (например, в приблизительной концентрации 10 мкг/мл), олигопептид, связывающий IL-17A/F, или органическую молекулу, связывающую IL-17A/F. Клетки инкубируют на протяжении 3-дневного промежутка времени. После каждой обработки клетки отмывают и переносят аликвотными частями в 12 × 75 пробирок размером 35 мм, закрытых ситом (1 мл на пробирку, 3 пробирки на группу обработки) для удаления комков клеток. Затем в пробирки вводят PI (10 мкг/мл). Образцы можно анализировать, используя проточный цитометр FACSCAN® и компьютерную программу FACSCONVERT® CellQuest (производства компании Becton Dickinson). Можно отбирать те анти-IL-17A/F-антитела, олигопептиды, связывающие IL-17A/F, или органические молекулы, связывающие IL-17A/F, которые способны индуцировать статистически значимый уровень клеточной смерти, определяемый по поглощению PI, обозначая их как анти-антитела-IL-17A/F, олигопептиды, связывающие IL-17A/F, или органические молекулы, связывающие IL-17A/F, индуцирующие клеточную смерть.

Для скрининга на антитела, олигопептиды или другие органические молекулы, которые связываются с эпитопом полипептида IL-17A/F, способным связываться с интересующим исследователя антителом, можно провести стандартный анализ с перекрестным блокированием, который описан в ссылке Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, Ed Harlow and David Lane (1988). Этот анализ можно применять для того, чтобы определить, способны ли испытуемые антитело, олигопептид или другая органическая молекула связываться с тем же сайтом или эпитопом, как и известное анти-IL-17A/F-антитело. Альтернативно или дополнительно можно провести картирование эпитопа способами, известными в данной области техники. Например, для идентификации контактных остатков можно мутагенизировать последовательность антитела посредством аланинового сканирования. Мутантное антитело в первоначальном состоянии тестируют на связывание с поликлональным антителом, чтобы гарантировать его правильное сворачивание. В другом способе можно использовать пептиды, соответствующие разным участкам полипептида IL-17A/F, задействуя их в конкурентном анализе с испытуемыми антителами или с испытуемым антителом и антителом с охарактеризованным или известным эпитопом.

Q. Фармацевтические композиции

Активные молекулы IL-17A/F, предлагаемые изобретением (например, полипептиды IL-17A/F, анти-IL-17A/F-антитела и/или варианты каждого из них), а также другие молекулы, идентифицированные посредством раскрытых выше скринирующих анализов, можно вводить больным в виде фармацевтических композиций для лечения иммунозависимых заболеваний.

Лекарственные составы с активной молекулой IL-17A/F, предпочтительно, с полипептидом или антителом, предлагаемым изобретением, готовят для хранения, смешивая активный молекулярный ингредиент, имеющий желательную степень чистоты с факультативными физиологически приемлемыми носителями, наполнителями или стабилизаторами (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)) в виде лиофилизированных композиций или водных растворов. Приемлемые носители, наполнители или стабилизаторы нетоксичны для реципиентов в применяемых дозах и концентрациях, и к их числу относятся такие буферы, как фосфат, цитрат и другие органические кислоты, антиоксиданты, включая аскорбиновую кислоту и метионин, консерванты (такие, как октадецилдиметилбензилхлорид аммония, хлорид гексония, хлорид бензалкония, хлорид бензетония, фенол, бутиловый или бензиловый спирт, алкилпарабены, такие как метил- или пропилпарабен, катехин, резорцин, циклогексанол, 3-пентанол и m-крезол), полипептиды низкого молекулярного веса (менее приблизительно 10 остатков), белки, такие как сывороточный альбумин, желатин или иммуноглобулины, гидрофильные полимеры, такие как поливинилпирролидон, аминокислоты, такие как глицин, глутамин, аспарагин, гистидин, аргинин или лизин, моносахариды, дисахариды и другие углеводы, включая глюкозу, маннозу и декстрины, хелатообразующие агенты, такие как EDTA, сахара, такие как сахароза, маннит, трегалоза или сорбит, солеобразующие противоионы, такие как натрий, комплексы металлов (например, комплексы Zn-белок) и/или неионные сурфактанты, такие как TWEENTM, PLURONICSTM или полиэтиленгликоль (PEG).

Соединения, идентифицированные посредством раскрытых здесь скринирующих анализов, можно ввести в рецептурные составы аналогичным образом, используя стандартные методики, хорошо известные в данной области техники.

Для доставки молекулы IL-17A/F в клетки можно также использовать липофекции или липосомы. Если используются фрагменты антитела, то предпочтителен наименьший ингибиторный фрагмент, который специфически связывается со связующим доменом целевого белка. Например, основываясь на последовательностях вариабельного региона антитела, можно сконструировать пептидные молекулы, которые сохраняют способность связываться с последовательностью целевого белка. Такие пептиды можно синтезировать химически и/или произвести на основе технологии рекомбинантной ДНК (см., например, ссылку Marasco et al., Proc. Natl. Acad. Sci. USA, 90:7889-7893 [1993]).

Рассматриваемый здесь рецептурный состав может также содержать более одного активного соединения, если это необходимо по специфическим лечебным показаниям, причем предпочтительно, чтобы эти соединения обладали комплементарной активностью и не оказывали отрицательного влияния друг на друга. Альтернативно или дополнительно композиция может содержать цитотоксический агент, цитокин или агент - ингибитор роста. Удобно, чтобы такие молекулы были представлены в комбинации в тех количествах, которые эффективны для достижения намеченной цели.

Активные молекулы IL-17A/F также могут быть заключены в микрокапсулы, изготовленные, например, по методикам коацервации или способом полимеризации на границе фаз, например микрокапсулы из гидроксиметилцеллюлозы или желатина и микрокапсулы из поли-(метилметакрилата), соответственно, в коллоидных системах доставки лекарств (например, в липосомах, альбуминовых микросферах, микроэмульсиях, наночастицах и нанокапсулах) или в макроэмульсиях. Такие методики раскрыты в ссылке Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).

Лекарственные составы, предназначенные для введения in vivo, должны быть стерильными. Это легко достигается посредством фильтрации через стерильные фильтрующие мембраны.

Можно изготовить препараты с замедленным высвобождением молекул IL-17A/F. Подходящие примеры препаратов с замедленным высвобождением включают полупроницаемые матрицы твердых гидрофобных полимеров, содержащие антитело, причем такие матрицы имеют форму профилированных изделий, например пленок или микрокапсул. Примеры матриц с замедленным высвобождением включают сложные полиэфиры, гидрогели (например, поли(2-гидроксиэтил-метакрилат) или поли(виниловый спирт)), полилактиды (патент США № 3773919), сополимеры L-глутаминовой кислоты и γ-этил-L-глутамата, не подверженный разрушению этиленвинилацетат, подверженные разрушению сополимеры молочной и гликолевой кислот, такие как LUPRON DEPOTTM (инъекционные микросферы, состоящие из сополимера молочной кислоты-гликолевой кислоты и лейпролидацетата), а также поли-D-(-)-3-гидроксибутировая кислота. Если такие полимеры, как этиленвинилацетат и молочная кислота-гликолевая кислота, обеспечивают высвобождение молекул на протяжении более чем 100 дней, то некоторые гидрогели высвобождают белки в течение более коротких промежутков времени. Если инкапсулированные антитела остаются в организме длительное время, они могут денатурироваться или агрегироваться в результате контакта с влагой при температуре 37°C, что приводит к потере их биологической активности и возможным изменениям иммуногенности. Необходимо разработать рациональные стратегии для стабилизации таких препаратов в зависимости от вовлеченного механизма. Например, если открыто, что механизм агрегации основан на образовании межмолекулярных S-S связей через тиодисульфидный обмен, то стабилизации можно достичь за счет модификации сульфгидрильных остатков, лиофилизации из кислотных растворов, регулирования содержания влаги, применения подходящих добавок и разработки специфических композиций полимерных матриц.

R. Способы лечения

Ожидается, что полипептиды, антитела и другие активные соединения, предлагаемые настоящим изобретением, могут быть использованы для лечения различных иммунозависимых заболеваний и состояний, таких как заболевания, опосредованные T-клетками, включая заболевания, характеризующиеся инфильтрацией воспалительных клеток в ткани, стимуляцией пролиферации T-клеток, подавлением пролиферации T-клеток, повышением или снижением сосудистой проницаемости либо подавлением этих функций, что, в частности, характерно для аутоиммунных заболеваний.

Типичные заболевания и состояния, которые можно лечить полипептидами, антителами и другими соединениями, предлагаемыми настоящим изобретением, включают, но не ограничиваясь ими, системную красную волчанку, ревматоидный артрит, хронический ювенильный артрит, остеоартрит, спондилоартропатии, системный склероз (склеродермию), идиопатические воспалительные миопатии (дерматомиозит, полимиозит), синдром Шегрена, системный васкулит, саркоидоз, аутоиммунную гемолитическую анемию (иммунную панцитопению, пароксизмальную ночную гемоглобинурию), аутоиммунную тромбоцитопению (идиопатическую тромбоцитопеническую пурпуру, иммуноопосредованную тромбоцитопению), тиреоидит (базедову болезнь, тиреоидит Хасимото, ювенильный лимфоцитарный тиреоидит, атрофический тиреоидит), сахарный диабет, иммуноопосредованное почечное заболевание (гломерулонефрит, тубулоинтерстициальный нефрит), демиелинизирующие заболевания центральной и периферической нервной системы, такие как рассеянный склероз, идиопатическая демиелинизирующая полиневропатия или синдром Гийена-Барре и хроническая воспалительная демиелинизирующая полиневропатия, гепатобилиарные заболевания, такие как инфекционные гепатиты (гепатит A, B, C, D, E и другие негепатотропные вирусы), аутоиммунный хронический активный гепатит, первичный билиарный цирроз, гранулематозный гепатит и склерозирующий холангит, воспалительное заболевание кишечника (язвенный колит: болезнь Крона [Crohn]), глютензависимую энтеропатию (целиакию) и болезнь Уиппла [Whipple], аутоиммунные или иммуноопосредованные кожные заболевания, включая буллезные кожные заболевания, экссудативную многоформную эритему и контактный дерматит, псориаз, аллергические заболевания, такие как астма, аллергический ринит, атопический дерматит, пищевую аллергию и крапивницу, иммунологические заболевания легких, такие как эозинофильная пневмония, идиопатический легочный фиброз и гиперчувствительный пневмонит, заболевания, связанные с трансплантацией, включая отторжение трансплантата и болезнь "трансплантат против хозяина".

При системной красной волчанке центральным медиатором заболевания является выработка аутореактивных антител к собственным белкам/тканям с последующим формированием иммуноопосредованного воспаления. Антитела или напрямую, или косвенно опосредуют повреждение тканей. Хотя и не было показано, что T-лимфоциты непосредственно вовлечены в повреждение тканей, они необходимы для развития аутореактивных антител. Таким образом, генез заболевания зависит от T-лимфоцитов. Клинически выраженному поражению подвергаются многие органы и системы, включая почки, легкие, мышечно-скелетную систему, кожу и слизистые оболочки, глаза, центральную нервную систему, сердечно-сосудистую систему, желудочно-кишечный тракт, костный мозг и кровь.

Ревматоидный артрит (RA) представляет собой хроническое системное аутоиммунное воспалительное заболевание, которое затрагивает, главным образом, синовиальные мембраны многих суставов и в конечном итоге приводит к повреждению суставного хряща. Патогенез этого заболевания зависит от T-лимфоцитов и связан с выработкой ревматоидных факторов, аутоантител, направленных против собственного IgG, с образованием в результате этого иммунных комплексов, которые достигают высокого уровня в суставной жидкости и крови. Присутствие этих комплексов в суставе может индуцировать выраженный инфильтрат лимфоцитов и моноцитов в синовиальную мембрану с ее последующими выраженными изменениями, причем суставное пространство/жидкость инфильтрируют такие же клетки с добавлением многочисленных нейтрофилов. Поражение тканей затрагивает, главным образом, суставы и часто носит симметричный характер. Однако также встречается внесуставное заболевание, проявляющееся в двух главных формах. Одна форма представляет собой развитие внесуставных повреждений наряду с продолжающимся прогрессивным заболеванием суставов и такими типичными повреждениями, как легочный фиброз, васкулит и кожные язвы. Вторая форма внесуставного заболевания - это так называемый синдром Фелти (Felty), который развивается на поздних этапах развития RA, иногда после того, как заболевание суставов становится бессимптомным, и вовлекает такие признаки, как наличие нейтропении, тромбоцитопении и спленомегалии. Эти явления могут сопровождаться васкулитом во многих органах с образованием инфарктов, кожных язв и гангрены. У больных часто развиваются ревматоидные узелки в подкожной ткани, окружающей пораженные суставы, причем на поздней стадии своего существования эти узелки имеют некротические центры, окруженные смешанным инфильтратом воспалительных клеток. Другие возможные проявления RA включают: перикардит, плеврит, коронарный артериит, интерстициальный пневмонит с легочным фиброзом, сухой кератоконъюнктивит и ревматоидные узелки.

Хронический ювенильный артрит представляет собой хроническое идиопатическое воспалительное заболевание, которое часто начинается в возрасте менее 16 лет. Фенотип этого заболевания имеет некоторое сходство с RA, и некоторых больных при наличии положительного ревматоидного фактора классифицируют как страдающих ювенильным ревматоидным артритом. Заболевание подразделяют на три основные категории: олигоартикулярное, полиартикулярное и системное. Артрит может быть тяжелым и в типичной ситуации деструктивным, приводя к анкилозу пораженных суставов и замедлению роста больных. Другие проявления могут включать хронический передний увеит и системный амилоидоз.

Спондилоартропатии представлены группой заболеваний, имеющих некоторые общие клинические признаки и общую ассоциацию с экспрессией продукта гена HLA-B27. Эта группа заболеваний включает: анкилозирующий спондилит, синдром Рейтера (реактивный артрит), артрит, связанный с воспалительным заболеванием кишечника, спондилит, связанный с псориазом, спондилоартропатию с ювенильной манифестацией и недифференцированную спондилоартропатию. Отличительные признаки этих болезней включают сакроилеит со спондилитом или без спондилита, воспалительный асимметричный артрит, ассоциацию с HLA-B27 (серологически определяемым аллелем локуса HLA-B, относящегося к I классу MHC), воспаление глаз и отсутствие антител, ассоциированных с другими ревматоидными заболеваниями. Ключевой клеткой, наиболее вовлеченной в индукцию заболевания, является T-лимфоцит CD8+, клетка, которая нацелена на антиген, представляемый молекулами класса I MHC. T-клетки CD8+ могут реагировать на аллель HLA-B27 I класса MHC так, как будто он является чужеродным пептидом, экспрессируемым молекулами MHC I класса. Была выдвинута гипотеза о том, что эпитоп HLA-B27 может имитировать бактериальный или иной микробный антигенный эпитоп, то есть индуцировать ответ со стороны T-клеток CD8+.

Системный склероз (склеродермия) представляет собой заболевание с неизвестной этиологией. Ведущим признаком этого заболевания является уплотнение кожи, которое, по-видимому, индуцируется активным воспалительным процессом. Склеродермия может быть локализованной или системной, часто сопровождается сосудистыми повреждениями, а ранним и важным явлением в развитии системного склероза является повреждение эндотелиальных клеток в микрососудах, причем сосудистые повреждения могут быть опосредованы иммунной системой. Подразумеваемая иммунологическая основа заболевания заключается в наличии инфильтратов мононуклеарных клеток в кожных повреждениях и наличии у многих больных противоядерных антител. На клеточной поверхности фибробластов в участках кожного повреждения часто наблюдается повышающая регуляция ICAM-1, а это позволяет предположить, что определенную роль в патогенезе заболевания может играть взаимодействие T-клеток с этими клетками. Другие органы, вовлеченные в это заболевание, включают: желудочно-кишечный тракт (атрофия гладкой мускулатуры и фиброз, приводящие к нарушениям перистальтики/подвижности), почки (концентрическая пролиферация субэндотелия в интиме с поражением мелких дугообразных и интерлобулярных артерий, приводящая в результате к снижению кровотока в кортикальном слое почек, сопровождающемуся протеинурией, азотемией и почечной гипертонией, скелетные мышцы (атрофия, интерстициальный фиброз, воспаление), легкие (интерстициальный пневмонит и интерстициальный фиброз), сердце (некроз сократительной полосы, рубцевание/фиброз).

Идиопатические воспалительные миопатии, включая дерматомиозит, полимиозит и некоторые другие нозологические формы, представляют собой заболевания, характеризующиеся хроническим мышечным воспалением неизвестной этиологии, приводящим к мышечной слабости. Повреждение/воспаление мышц часто носит симметричный и прогрессирующий характер. Большинство нозологических форм ассоциировано с антителами. Эти специфические для миозита аутоантитела направлены против компонентов, белков и РНК, вовлеченных в белковый синтез, и подавляют их функцию.

Синдром Шегрена развивается вследствие иммуноопосредованного воспаления с последующей функциональной деструкцией слезных и слюнных желез. Заболевание может быть ассоциировано с воспалительными заболеваниями соединительной ткани или сопровождаться ими. Заболевание сопровождается выработкой аутоантитела против антигенов Ro и La, которые представляют собой мелкие комплексы РНК-белок. Повреждения приводят к сухому кератоконъюнктивиту, ксеростомии (сухости во рту), а также к другим проявлениям или ассоциациям, включая билиарный цирроз, периферическую или сенсорную невропатию и пальпируемую пурпуру (геморрагическую сыпь).

Системный васкулит представляет собой группу заболеваний, при которых основным проявлением патологии является воспаление и повреждение кровеносных сосудов, приводящее к ишемии/некрозу/дегенерации тканей, питаемых пораженными сосудами, и в некоторых случаях итоговая дисфункция конечного органа. Васкулиты также могут встречаться как вторичное повреждение или последствие других воспалительных иммуноопосредованных заболеваний, таких как ревматоидный артрит, системный склероз и т.д., особенно заболеваний, также ассоциированных с образованием иммунных комплексов. Заболевания, входящие в группу первичного системного васкулита, включают: системный некротизирующий васкулит (узелковый полиартериит, аллергический ангиит и гранулематоз, полиангиит, гранулематоз Вегенера [Wegener], лимфоматоидный гранулематоз и гигантоклеточный артериит). Группа смешанных васкулитов включает: слизисто-кожный синдром лимфатических узлов (MLNS или болезнь Кавасаки [Kawasaki]), изолированный васкулит ЦНС, болезнь Бехета [Behet], облитерирующий тромбоангиит (болезнь Бюргера [Buerger]) и кожный некротизирующий венулит. Полагают, что патогенетический механизм большинства перечисленных типов васкулита, главным образом, связан с накоплением комплексов иммуноглобулина в сосудистых стенках и последующей индукцией воспалительного ответа или через ADCC, или через активацию комплемента, или через оба этих звена.

Саркоидоз - заболевание с неизвестной этиологией, которое характеризуется наличием эпителиоидных гранулем почти во всех тканях организма, а наиболее часто в процесс вовлекаются легкие. Патогенез включает персистенцию активированных макрофагов и лимфоидных клеток в очагах заболевания с последующей цепью хронических осложнений в результате выброса продуктов с местной и системной активностью из этих типов клеток.

Аутоиммунная гемолитическая анемия, включая собственно аутоиммунную гемолитическую анемию, иммунную панцитопению и пароксизмальную ночную гемоглобинурию, является результатом выработки антител, которые реагируют с антигенами, экспрессируемыми на поверхности эритроцитов (и в некоторых случаях других клеток крови, включая также тромбоциты), и представляет собой отражение удаления этих клеток, покрытых антителами через лизис, опосредованный комплементом, и/или механизмы, опосредованные ADCC/Fc-рецепторами.

Аутоиммунная тромбоцитопения, включая тромбоцитопеническую пурпуру, и иммуноопосредованная тромбоцитопения в других клинических условиях с разрушением/удалением тромбоцитов развивается в результате прикрепления к тромбоцитам антител или комплемента с их последующим удалением через лизис, опосредованный комплементом, или механизмы, опосредованные ADCC или FC-рецепторами.

Тиреоидиты, включая базедову (Grave) болезнь, тиреоидит Хасимото (Hashimoto), ювенильный лимфоцитарный тиреоидит и атрофический тиреоидит, являются результатом аутоиммунного ответа против антигенов щитовидной железы с выработкой антител, которые реагируют с белками, представленными в щитовидной железе и часто специфическими для нее. Существуют экспериментальные модели, включая модели спонтанного заболевания: крысиные (линии крыс BUF и BB) и куриные (линия кур с ожирением), а также модели индуцируемого заболевания: иммунизация животных либо тиреоглобулином, либо микросомальным антигеном щитовидной железы (тиреоидной пероксидазой).

Сахарный диабет I типа или инсулинозависимый диабет представляет собой аутоиммунное разрушение клеток островков Лангерганса в поджелудочной железе: это разрушение опосредовано аутоантителами и аутореактивными T-клетками. Развитие фенотипа невосприимчивости к инсулину могут также вызывать антитела против инсулина или инсулиновых рецепторов.

Иммуноопосредованные почечные заболевания, включая гломерулонефрит и тубулоинтерстициальный нефрит, являются результатом действия антител или опосредованного T-лимфоцитами повреждения почечной ткани либо прямым образом (в результате выработки аутореактивных антител, или T-клеток против почечных антигенов), либо непрямым образом (в результате накопления в почках антител и/или иммунных комплексов, которые реагируют на другие антигены внепочечного происхождения). Таким образом, другие иммуноопосредованные заболевания, которые приводят к образованию иммунных комплексов, также могут индуцировать иммуноопосредованное почечное заболевание (как непрямое осложнение). Как прямые, так и непрямые иммунные механизмы приводят к воспалительному ответу, который продуцирует/индуцирует развитие повреждений в почечных тканях с конечным эффектом нарушения функции этого органа, а в некоторых случаях с прогрессированием до стадии почечной недостаточности. В патогенез таких повреждений могут быть вовлечены как гуморальные, так и клеточные иммунные механизмы.

Полагают, что демиелинизирующие заболевания центральной и периферической нервной системы, включая рассеянный склероз, идиопатическую демиелинизирующую полиневропатию или синдром Гийена-Барре (Guillain-Barré) и хроническую воспалительную демиелинизирующую полиневропатию, имеют аутоиммунную основу и приводят к демиелинизации нервов в результате повреждения олигодендроцитов или непосредственно миелина. При рассеянном склерозе (MS) имеются данные, которые позволяют предположить зависимость индукции и прогрессирования болезни от T-лимфоцитов. Рассеянный склероз представляет собой демиелинизирующее заболевание, зависимое от T-лимфоцитов, которое имеет или рецидивирующий-ремиттирующий, или хронический прогрессирующий характер течения. Этиология этого заболевания неизвестна, однако вклад в нее могут вносить такие факторы, как вирусные инфекции, генетическая предрасположенность, окружающая среда и аутоиммунитет. Очаги повреждения содержат инфильтраты микроглиальных клеток, преимущественно опосредованные T-лимфоцитами, инфильтраты макрофагов, причем преобладающим типом клеток в очагах повреждения являются T-лимфоциты CD4+. Механизм клеточной гибели олигодендроцитов и последующей демиелинизации неизвестен, но, вероятно, находится под управлением T-лимфоцитов.

Воспалительные и фиброзные заболевания легких, включая эозинофильную пневмонию, идиопатический фиброз легких и гиперчувствительный пневмонит могут вовлекать нарушение регуляции иммуновоспалительного ответа. Подавление такого аномального ответа должно принести терапевтическую пользу.

Аутоиммунные или иммуноопосредованные кожные заболевания, включая буллезные поражения кожи, экссудативную многоформную эритему и контактный дерматит, опосредованы аутоантителами, генез которых зависит от T-лимфоцитов.

Псориаз представляет собой воспалительное заболевание, опосредованное T-лимфоцитами. Очаги повреждения содержат инфильтраты T-лимфоцитов, макрофагов, клеток, перерабатывающих антиген, и некоторых нейтрофилов.

Аллергические заболевания, включая астму, аллергический ринит, атопический дерматит, пищевую аллергию и крапивницу, зависят от T-лимфоцитов. Эти заболевания преимущественно опосредованы воспалением, индуцированным T-лимфоцитами, связаны с IgE-опосредованным воспалением или основаны на обоих указанных механизмах.

Заболевания, связанные с трансплантацией, включая отторжение трансплантата и болезнь "трансплантат против хозяина" (GVHD), зависят от T-лимфоцитов, а подавление функции T-лимфоцитов должно принести улучшающий эффект.

Другими заболеваниями, при которых вмешательство в иммунный и/или воспалительный ответ может принести пользу, являются инфекционные заболевания, включая, но не ограничиваясь ими, вирусные инфекции (включая, но не ограничиваясь ими, СПИД, гепатиты A, B, C, D, E и герпес), бактериальные инфекции, грибковые инфекции, протозойные или паразитарные инфекции (молекулы или их производные/агонисты, способные стимулировать MLR, можно использовать терапевтически для усиления иммунного ответа на инфекционные агенты), иммунодефицитные заболевания (молекулы/производные/агонисты, способные стимулировать MLR, можно использовать терапевтически для усиления иммунного ответа при заболеваниях/состояниях наследственного, приобретенного, инфекционного происхождения (как при ВИЧ-инфекции) или при ятрогенном (то есть в результате химиотерапии) иммунодефиците и неоплазии.

Было продемонстрировано, что у некоторых раковых больных (людей) развиваются антитела и/или ответ со стороны T-лимфоцитов на антигены неопластических клеток. На животных моделях неоплазии также было показано, что усиление иммунного ответа может привести к отторжению или регрессии какого-либо конкретного новообразования. Молекулы, которые усиливают ответ T-лимфоцитов в MLR, можно использовать in vivo для усиления иммунного ответа на неопластический процесс. Молекулы, которые усиливают пролиферативный ответ T-лимфоцитов в MLR (или маленькие молекулы агонисты, или антитела, агонистически взаимодействующие с тем же рецептором), можно использовать как терапевтические средства для лечения рака. Молекулы, которые подавляют лимфоцитарный ответ в MLR, также функционируют in vivo во время неопластического процесса, подавляя иммунный ответ на новообразование, такие молекулы либо могут экспрессироваться опухолевыми клетками как таковыми, либо новообразование может индуцировать их экспрессию в других клетках. Антагонизм таких ингибиторных молекул (либо с антителом, мелкими молекулами антагонистами, либо другими средствами) усиливает иммуноопосредованное отторжение опухоли.

Дополнительно, подавление молекул с провоспалительными свойствами может принести терапевтическую пользу при реперфузионном повреждении, инсульте, инфаркте миокарда, атеросклерозе, остром повреждении легких, геморрагическом шоке, ожоге, сепсисе/септическом шоке, остром тубулярном некрозе, эндометриозе, дегенеративном заболевании суставов и панкреатите. Соединения, предлагаемые настоящим изобретением, например полипептиды или антитела, вводят млекопитающему, предпочтительно, человеку, в соответствии с известными способами, например внутривенно в виде болюсной инъекции или длительного вливания, подкожно, в полость сустава, интрасиновиально, интратекально, перорально, местно или посредством ингаляции (интраназальной, внутрилегочной). Предпочтительным способом введения для полипептидов и антител является внутривенное или ингаляционное введение.

При иммуноадъювантной терапии введение белков, антител или соединений, предлагаемых настоящим изобретением, можно комбинировать с другими схемами лечения, например с введением противораковых средств. Например, больному, которого предполагается лечить иммуноадъювантом предлагаемым изобретением, можно также назначить противораковое средство (химиотерапевтический агент) или лучевую терапию. Приготовление и схемы дозирования таких химиотерапевтических агентов можно проводить в соответствии с инструкциями производителей или определять эмпирически, что входит в компетенцию опытного специалиста-практика. Приготовление и схемы дозирования для такой химиотерапии также описаны в ссылке Chemotherapy Service, Ed., M.C. Perry, Williams & Wilkins, Baltimore, MD (1992). Введение химиотерапевтического агента может предшествовать введению иммуноадъюванта, идти вслед за ним или проводиться одновременно с ним. В дополнение к этому больному можно назначить антиэстрогенное соединение, например тамоксифен или антипрогестерон, например онапристон (см. документ EP 616812), соблюдая известные дозировки для таких лекарственных молекул.

Может оказаться желательным также вводить антитела против других антигенов, ассоциированных с иммунным заболеванием или опухолью, например антитела, которые связываются с CD20, CD11a, CD18, ErbB2, EGFR, ErbB3, ErbB4 или с эндотелиальным сосудистым фактором (VEGF). Альтернативно или дополнительно больному можно одновременно вводить два или более антитела, связывающих один и тот же антиген или два и более разных антигена, которые раскрыты здесь. Иногда также может оказаться полезным вводить больному один или более цитокинов. В одном из вариантов реализации изобретения полипептиды IL-17A/F вводят совместно с таким агентом, как ингибитор роста. Например, ингибитор роста можно вводить после полипептида IL-17A/F. Однако также рассматривается возможность одновременного введения обоих препаратов или введения ингибитора роста первым. Подходящими дозировками для ингибиторов роста являются такие дозировки, которые используются в настоящее время, но можно и снизить дозу вследствие комбинированного действия (синергии) ингибитора роста и полипептида IL-17A/F.

Адекватная доза соединения, предлагаемого изобретением, для лечения или уменьшения тяжести иммунозависимого заболевания будет зависеть от типа заболевания, подлежащего лечению, как это определено выше, от тяжести и характера течения заболевания, от того, вводят ли указанное соединение в лечебных или профилактических целях, от предшествующего лечения, от клинического анамнеза больного, от реакции на указанное соединение, причем выбор дозы основывается на экспертной оценке врача. Соединение можно вводить больному как однократно, так и серийно.

Например, в зависимости от типа и тяжести заболевания в качестве вариантов начальной дозы для введения больному рассматриваются приблизительные дозы от 1 мг/кг до 15 мг/кг (например, 0,1-20 мг/кг) полипептида или антитела, например, для одного или более раздельных введений или для непрерывного вливания. Типичная ежедневная доза может варьироваться в приблизительном диапазоне от 1 мг/кг до 100 мг/кг или более в зависимости от вышеупомянутых факторов. При повторном введении лекарства в течение нескольких дней или более (в зависимости от ситуации) лечение продолжают до тех пор, пока не будет достигнуто желательное подавление симптомов заболевания. Однако могут быть полезными и другие схемы дозирования лекарств. Прогресс, достигнутый в ходе этой терапии, легко поддается мониторированию традиционными методиками и анализами.

S. Изделия

Еще в одном варианте осуществления изобретения предлагается изделие, содержащее материалы (например, молекулу IL-17A/F), полезные для диагностики или лечения описанных выше заболеваний. В состав изделия входят контейнер и инструкция по применению. Подходящие контейнеры включают, например, бутылки, флаконы, шприцы и пробирки. Контейнеры могут быть изготовлены из разных материалов, например из стекла или пластмассы. Контейнер содержит композицию, которая эффективна для диагностики или лечения патологического состояния, и может иметь порт для стерильного доступа (например, в качестве контейнера может быть использован пластиковый пакет для внутривенного раствора с пробкой, которую можно проткнуть иглой для подкожной инъекции). Активный агент в композиции обычно представляет собой полипептид или антитело, предлагаемое изобретением. Этикетка на контейнере или приложенная к нему инструкция указывает, что композиция применима для диагностики или лечения определенного заболевания (патологического состояния). В состав изделия может дополнительно входить второй контейнер, содержащий фармацевтически приемлемый буфер, например забуференный фосфатно-солевой раствор, раствор Рингера и раствор декстрозы. Изделие может дополнительно включать другие материалы, желательные с коммерческой и пользовательской точки зрения, включая другие буферы, разбавители, фильтры, иглы, шприцы и упаковочные вкладыши с инструкциями по применению.

T. Диагностика и прогнозирование иммунозависимого заболевания

Белки клеточной поверхности, в частности белки, которые избыточно экспрессируются при некоторых иммунозависимых заболеваниях, являются блестящими целями для лекарств-кандидатов или для лечения заболевания. Те же белки наряду с секретируемыми белками, которые кодируются генами, усиленно функционирующими при болезненных иммунозависимых состояниях, находят дополнительное применение в диагностике и прогнозировании этих заболеваний. Например, для диагностики или прогнозирования можно использовать антитела, которые направлены против белковых продуктов генов, усиленно функционирующих при рассеянном склерозе, ревматоидном артрите, воспалительном заболевании кишечника или ином иммунозависимом заболевании.

Например, антитела, включая фрагменты антител, можно использовать для качественного или количественного определения экспрессии белков, кодируемых усиленно функционирующими или избыточно экспрессирующими генами ("маркерные генные продукты"). Предпочтительно, чтобы антитело было снабжено поддающейся выявлению, например, флуоресцентной меткой, а связывание можно было мониторировать посредством световой микроскопии, проточной цитометрии, флуорометрии или других методик, известных в данной области техники. Эти методики особенно применимы, если избыточно экспрессирующий ген кодирует белок клеточной поверхности. Такие анализы связывания, по существу, проводят так, как это описано выше.

Выявление антитела, связывающегося с маркерными генными продуктами in situ, можно осуществлять, например, посредством иммунофлуоресценции или иммуноэлектронной микроскопии. С этой целью от больного получают гистологический образец и вводят его в контакт с меченым антителом, предпочтительно, нанося антитело на биологический образец. Эта процедура также позволяет оценить распределение маркерного генного продукта в исследуемой ткани. Компетентному специалисту будет очевидно, что для выявления in situ существует много вполне доступных и самых разнообразных гистологических методик.

Приведенные ниже примеры даны только в иллюстративных целях и не должны рассматриваться как ограничивающие каким-либо образом объем настоящего изобретения.

Все патентные документы и литературные публикации, процитированные в настоящем описании изобретения, включены сюда в качестве ссылок во всей своей полноте.

ПРИМЕРЫ

Все доступные для приобретения реактивы, упоминаемые в примерах, были использованы в соответствии с инструкциями производителей, если специально не указано иное. Источником получения клеток, упоминаемых по инвентарным номерам ATCC в приведенных ниже примерах и во всем описании изобретения, является Коллекция культур американского типа, г. Манассас, штат Вирджиния.

ПРИМЕР 1

Рекомбинантная экспрессия нового цитокина IL-17, идентифицированного как IL-17A/F

Трансфекция почечных клеток человека линии 293 векторами экспрессии кДНК, кодирующей IL-17 и IL-17F

Почечные клетки человека линии 293 были трансфицированы равными количествами плазмид, кодирующих гены IL-17, IL-17C и IL-17F человека, с применением процедуры осаждения фосфатом кальция. Для каждой колбы T-150 со слиянием на уровне 50-80% смешивали по 50 мкг каждой плазмиды для формирования преципитата, наслаиваемого на клетки. Через один день после трансфекции удаляли среду 50:50 F12:DMEM, содержащую 10% FCS, 5 мМ L-глутамина, пенициллин-стрептомицин, замещали ее бессывороточной средой PS24 и продолжали культивирование еще четыре дня. Через четыре дня кондиционированную среду собирали, центрифугировали и стерильно фильтровали перед проведением очистки.

Очистка рекомбинантного IL-17A/F

A. Этап 1 - первоначальное фракционирование:

Два с половиной литра кондиционированной среды с рекомбинантным IL-17A/F от транзиторных культур почечных клеток человека линии 293 концентрировали и диализировали при помощи 20 мМ ацетата натрия, pH 5,0, 1 мМ азида натрия (буфер A) с применением мембраны отсечки 10 килодальтон для доведения объема до 480 миллилитров, затем пропускали через колонку Pharmacia HiLoad S Sepharose 26/10 со скоростью 6 мл/мин. Колонку элюировали линейным градиентом до 100% буфера B (20 мМ ацетата натрия, 1 M NaCl, 1 мМ азида натрия, pH 5,0) со скоростью 1% в минуту при скорости потока 6 мл/мин, собирая фракции по 12 мл. Фракции, собранные из этой колонки, анализировали по методике SDS PAGE. Белки проявляли окрашиванием серебром. Гельсодержащие фракции 25-37 метили маркерами молекулярной массы (фигура 2). Фракции 31 и 32, содержащие белок с видимой молекулярной массой приблизительно 33 kD, соответствуют IL-17A/F.

B. Очистка IL-17A/F:

Четыре мл фракции 32 (фигура 2) подкисляли 0,1% трифторуксусной кислотой, затем пропускали со скоростью 0,5 мл/мин через колонку Vydac C4, уравновешенную 0,1% трифторуксусной кислотой (буфер C) и градиентом, элюированным до 100% буфера D (0,1% трифторуксусной кислоты в 100% ацетонитриле) с тремя ступенями градиента (0-35% D в течение 10 минут, 35-50% D в течение 35 минут, 50-100% D в течение 10 минут). На фигуре 2 показана хроматограмма элюированных белков при измерении на длине волны 214 нм и 280 нм. Ступенчатый градиент ацетонитрила наложен над профилем. Аминокислотный анализ показал, что концентрация белка во фракции 38 составляет 0,536 мг/мл. В этой фракции были проведены анализы гелей, пятен, аминокислотной последовательности и активности.

Фракция 31 и остаточный объем фракции 32 из прогона в колонке HiLoad S Sepharose были объединены, диализированы буфером A в течение восьми часов с применением мембраны отсечки 10 kD и пропущены через фильтр с калибром 0,2 микрон. Полученный материал был загружен в колонку Mono S, уравновешенную буфером A на скорости потока 1 мл/мин, и элюирован трехступенчатым градиентом до 100% буфера B (0-30% B на 10 объемов колонки, 30-75% B на 45 объемов колонки, 75-100% B на 10 объемов колонки) при сборе в объеме 1 мл на фракцию. Фракции 26-43 были проанализированы для определения концентраций белка посредством аминокислотного анализа. Концентрация во фракциях 31, 32 и 33 составила 0,258, 0,359 и 0,291 мг/мл соответственно. Гели, пятна, аминокислотная последовательность, масс-спектрофотометрия и активность были проанализированы, прежде всего, во фракциях 32 и 33. Фракции, генерированные хроматографией, были проанализированы на содержание IL-17 и IL-17F посредством вестерн-блоттинга. Для выявления присутствия либо IL-17, либо IL-17F в образцах использовали один мкг на мл моноклонального антитела, направленного против IL-17 или против IL-17F соответственно.

Масс-спектрометрический анализ IL-17A/F

Аминокислотную последовательность и межцепочечные дисульфидные связи зрелого IL-17A/F определяли масс-спектрометрическим анализом (см. фигуру 4A, где гетеродимерный полипептид IL-17A/F показан с межцепочечными и внутрицепочечными дисульфидными связями). Между полипептидными цепями IL-17F и IL-17 были обнаружены две межцепочечные дисульфидные связи [между остатком 47IL-17F и остатком 129IL-17, а также между остатком 137IL-17F и остатком 33IL-17 соответственно (жирные черные линии на фигуре 4A). В дополнение к этому образуются по две внутрицепочечные дисульфидные связи в каждой из цепей гомодимерного полипептида IL-17 [между остатками 102 и 152 и между остатками 107 и 154], а также IL-17F [между остатками 94 и 144 и между остатками 99 и 146] (тонкие черные линии на фигуре 4A). Аминокислоты пронумерованы по отношению к начальному метионину в каждом из предшественников полипептидной цепи (фигура 4A). Фигура 4B показывает схематические фрагменты пептида IL-17A/F, содержащие дисульфидные связи между цепью IL-17 и цепью IL-17F, которые, как можно ожидать, будут возникать при расщеплении IL-17A/F трипсином [фрагмент #1 дисульфидной связи IL-17A/F обозначен SEQ ID NO:7, а фрагмент #2 дисульфидной связи IL-17A/F обозначен IL-17A/F SEQ ID NO:8 соответственно]. Аминокислоты, содержащиеся в этих фрагментах, показаны и пронумерованы относительно начального метионина в каждой цепочке.

Расчетная приблизительная молекулярная масса тех фрагментов, которые были выявлены при масс-спектрометрии, показана на фигуре 4B как 3410,58 Da и 2420,05 Da [фрагменты дисульфидной связи IL-17A/F #1 и #2 соответственно]. Было проведено картирование пептида с анализом по методу времяпролетной масс-спектрометрии с лазерной ионизацией и десорбцией из жидкой матрицы (MALDI-TOF). Образец, содержавший 55 пмоль IL-17A/F в буфере 400 мМ NaCl, 20 мМ NaOAC (pH 5), расщепляли в течение ночи при 37°C трипсином Promega класса секвенирования. Был проведен анализ по методу времяпролетной масс-спектрометрии с лазерной ионизацией и десорбцией из жидкой матрицы (MALDI-TOF) с отсроченной экстракцией в режиме позитивной ионной рефлексии с применением матрицы 2', 4', 6'-тригидроксиацетофенона. Полученная в результате пептидная карта содержала пики с [M+H]+=2420,12 Da для фрагмента #2 и 3410,60 Da для фрагмента #1, соответствующие пептидам с дисульфидными связями (фигура 4C). Вторая аликвотная часть образца была подвергнута расщеплению при pH 8 после редуцирования дисульфидных связей дитиотериолом и алкилирования сульфгидрильных групп йодацетамидом. Спектр MALDI-TOF этого образца продемонстрировал утрату спорных пиков, подтверждая их отнесения к связанными дисульфидами. Нередуцированный образец был далее охарактеризован по методике жидкостной хроматографии и масс-спектрометрии с ионизацией электрораспылением и ионной ловушкой (LC-ESI-MS) (фигура 4D). Ионные хроматограммы представляют (сверху вниз) тотальную ионную хроматограмму, реконструированную ионную хроматограмму (RIC) дисульфидно связанного фрагмента IL-17A/F #2 [M+2H]2+ и дисульфидно связанного фрагмента IL-17A/F #1 [M+2H]3+. Наблюдались пики, соответствующие обоим гетеродимерам, но не наблюдалось никаких пиков, превышающих фоновый химический шум при ожидаемых массах гомодимерных пептидов, что указывало на отсутствие гомодимеров IL-17 или IL-17F. Затем композиция дисульфидно связанных гетеродимеров была подтверждена тандемной масс-спектрометрией. Диссоциация, индуцированная столкновениями двухзарядного предшественника при m/z 1210,9, соответствовала дисульфидно связанному фрагменту #2 IL-17A/F, а трехзарядный предшественник при m/z 1138,0 соответствует дисульфидно связанному фрагменту #1 IL-17A/F. В соответствующих спектрах наблюдались предсказуемые пики для серий b- и y-ионных фрагментов.

Скрининг фаговой библиотеки на антитела, связывающиеся с IL-17A/F

Для идентификации антител, связывающихся с IL-17A/F, был проведен скрининг фаговой библиотеки синтетических антител Fab. Были идентифицированы тридцать четыре (34) независимых клона, кодирующих отдельные антитела Fab, которые были способны опосредовать связывание с IL-17A/F. Фаговая библиотека последовательностей антител человека была приготовлена и скринирована на антигенспецифические Fab примерно так же, как это описано в ссылке Gerstner, R. B. et al., J. Mol. Biol., 321(5):851-62 (2002). Вкратце, в качестве рабочей платформы для конструирования библиотек Fab с фаговой демонстрацией было использовано гуманизированное моноклональное антитело 4D5, анти-HER2-антитело. Эти конструкции Fab демонстрируются на фаге моновалентно и/или бивалентно посредством слияния с гомодимеризующей лейциновой застежкой. Для того чтобы генерировать разнообразие библиотеки, авторы остановили выбор на рандомизации поверхностно открытых остатков CDR тяжелой цепи, которые также обнаружили свое большое разнообразие в базе данных Kabat по природным последовательностям антител и создают смежный ряд. Кроме того, авторы использовали сайт-специфический мутагенез со специально подобранными вырожденными кодонами для создания аминокислотного разнообразия, имитирующего естественный иммунный репертуар в каждом сайте CDR. Первые два CDR тяжелой цепи, H1 и H2, создавали возможность ограниченного разнообразия с той же длиной, как и герцептин (Herceptin), тогда как H3 предназначен для высокой вырожденности с длиной, варьирующейся в диапазоне от 7 до 19. Все антитела, генерированные из начального выбора библиотеки, имеют идентичную легкую цепь. Полноразмерные IgG или Fab можно генерировать посредством одноэтапного клонирования вариабельного домена тяжелой цепи в векторах, обеспечивающих желательную последовательность специфического для изотипа постоянного региона. Для того чтобы дополнительно улучшить аффинность связующих элементов из библиотеки тяжелой цепи, можно применить второй этап рандомизации для CDR легкой цепи. Аминокислотная последовательность участка вариабельного домена тяжелых цепей, который содержит три (3) CDR [H1-H3] из Fab, способных связываться с IL-17A/F, показана на фигуре 6. Показано выравнивание участка прогнозируемой аминокислотной последовательности 34 клонов Fab, которые кодируют отдельные последовательности тяжелой цепи антитела, способные связываться с IL-17A/F. Три участка CDR тяжелой цепи, обозначенные как CDR-H1, CDR-H2 и CDR-H3, соответственно, затенены. Соответствующие идентификационные номера последовательностей (SEQ ID NO:) для каждого клона таковы:

клон #1 = SEQ ID NO:9; клон #2 = SEQ ID NO:10; клон #3 = SEQ ID NO:11; клон #4 = SEQ ID NO:12; клон #5 = SEQ ID NO:13; клон #6 = SEQ ID NO:14; клон #7 = SEQ ID NO:15; клон #8 = SEQ ID NO:16; клон #9 =SEQ ID NO:17; клон #10 = SEQ ID NO:18; клон #11 = SEQ ID NO:19; клон #12 = SEQ ID NO:20; клон #13 = SEQ ID NO:21; клон #14 = SEQ ID NO:22; клон #15 = SEQ ID NO:23; клон #16 = SEQ ID NO:24; клон #17 = SEQ ID NO:25; клон #18 = SEQ ID NO:26; клон #19 = SEQ ID NO:27; клон #20 =SEQ ID NO:28; клон #21 = SEQ ID NO:29; клон #22 = SEQ ID NO:30; клон #23 = SEQ ID NO:31; клон #24 = SEQ ID NO:32; клон #25 = SEQ ID NO:33; клон #26 = SEQ ID NO:34; клон #27 = SEQ ID NO:35; клон #28 = SEQ ID NO:36; клон #29 = SEQ ID NO:37; клон #30 = SEQ ID NO:38; клон #31 = SEQ ID NO:39; клон #32 = SEQ ID NO:40; клон #33 = SEQ ID NO:41; клон #34 = SEQ ID NO:42 соответственно.

В дополнение к этому, соответствующие кодирующие последовательности ДНК для каждого из тридцати четырех (34) клонов показаны ниже в таблице 7 (от SEQ ID NO:43 до SEQ ID NO:76 соответственно).

Таблица 7
SEQ ID NO:43:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAGTGATTCCGCTATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTGGGATTACTCCTTATAGCGGTTATACTGACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCAAAAGAGGCCCGCGAGGGCTACGACGTCGGCTACGCTATGGACTACTGGGGTCAA
SEQ ID NO:44:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAGTGATTCCTATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTGAAATTTCTCCTCCTGGCGGCGATACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTCTCTTGTGGTGGTGGGACGGGGCTATGGACTACTGGGGTCAA
SEQ ID NO:45:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTAATACTTGGATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTGTTATTACTCCTTATGGCGGTGCTACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCAAGAGAGAGTATGTGGAGTAAGTTCGACTACTGGGGTCAA
SEQ ID NO:46:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAATAGTTCTGCTATACACTGGGTGCGTCAGGCC
CCGGGTAAGGGCCTGGAATGGGTTGGTTATATTACTCCTGATAACGGTGATACTAACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAATAGCTGAGGATACTGCCGTCTATTATTGTGCTCGCGGCCACGGCAACTTCTACGGTACCTGGGCGGCTATGGACTACTGGGGTCAA
SEQ ID NO:47:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAGTGGTTCTGATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTTATATTAATCCTTATGGCGGTTCTACTGACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTGCGTACGAGATGTGGTACGTTATGGACTACTGGGGTCAA
SEQ ID NO:48:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTAATTCCTGGATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGGTGTTATTACTCCTTCTAGCGGTTCTACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTGAGGTCTTCCCCGACATCGGGGACTGCAGCAACGCCTACTGCTACGCTATGGACTACTGGGGTCAA
SEQ ID NO:49:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTAGTACTTATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTTGGATTTCTCCTTATAGCGGTTATACTGACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTGAGGTGGGGTGGGGGGACTCGTACGCTATGGACTACTGGGGTCAA
SEQ ID NO:50:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAGTGGTTCTTGGATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTGGGATTTATCCTTATGACGGTTATACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAA
ATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTGAGGCCGAGGGCCTGTACCAGTCCGGGATCTACGACGCGGGTATGGACTACTGGGGTCAA
SEQ ID NO:51
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTAGTTACTATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTTGGATTTATCCTGCTGACGGTGCTACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTGGGTCCTACTTCGGGGGCTACGATATGGACTACTGGGGTCAA
SEQ ID NO:52:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAATGATTCTGATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGGTATTATTTATCCTTATGACGGTTATACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCAAGAAGCAACCTGGACAACAACTTGTTCGACTACTGGGGTCAA
SEQ ID NO:53
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAATGGTTACTGGATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTGATATTAATCCTAATGGCGGTTCTACTAACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTGCCTACCGGTGCGGCGGGCTCGCCGACTGGGCCGGGGCTATGGACTACTGGGGTCAA
SEQ ID NO:54:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAGTGGTTCTTGGATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTATTATTACTCCTTCTGGCGGTAATACTGACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTGAGGTCTTCGCCGTGTCGACCGCCGGCTACCCCTGGGTTATGGACTACTGGGGTCAA
SEQ ID NO:55:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTGATTCTTGGATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGGTTCTATTACTCCTTATAACGGTAATACTGACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGCAGGGGGGAGTCCGACGAGGCCTACGCCGCGGTTATGGACTACTGGGGTCAA
SEQ ID NO:56:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAGTAGTTCCGATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGGTACTATTAATCCTGCTAGCGGTTCTACTGACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGCGGCGCCAACAGCAGCTTCTACGCGCTCCAGTACGTTATGGACTACTGGGGTCAA
SEQ ID NO:57:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTGATAATTATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGGTTGGATTTCTCCTTATAGCGGTTATACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTGAGACCCTCTTCTACGACAAGGACCAGTACTCCTACGTTATGGACTACTGGGGTCAA
SEQ ID NO:58:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAGTAGTTCTTATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTTGGATTTCTCCTTATAGCGGTTATACTGACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTGAGGGGCTCCTGCGGTGGGGCTACGCTATGGACTACTGGGGTCAA
SEQ ID NO:59:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTGATAATGGGATACACTGGGTGCGTCAGGCC
CCGGGTAAGGGCCTGGAATGGGTTGGTTGGATTACTCCTACTAGCGGTTATACTAACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGCGACGGGGACACCTGGAAGTGGGACGCCCCGTACGTTATGGACTACTGGGGTCAA
SEQ ID NO:60:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTAATACTTATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTTGGATTTCTCCTTATAGCGGTTATACTGACTATGCCGATAGCGTCAAGGACCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGCGAGATCTTGCTGGACTACGGTTCCGCGGGCTACGCTATGGACTACTGGGGTCAA
SEQ ID NO:61:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTAGTACCTGGATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGGTGTTATTACTCCTACTAACGGTTCTACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGCGAGGTGTGGTGGTGGGGCGACGGCCACGGCTACGTTATGGACTACTGGGGTCAA
SEQ ID NO:62:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAGTAGTTCTGCTATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGGTGGGATTACTCCTGCTAGCGGTTATACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGCTCGCCCGGCGGGGTGTTCGTCGACGGCGGGGTTATGGACTACTGGGGTCAA
SEQ ID NO:63:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAATAGTACTGATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGGTAGGATTAATCCTTCTGGCGGTTCTACTAACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAA
ATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTACCAGCGCGTACACCACGTGGGCGGTCGACTGGTTCATCGGCTACGTTATGGACTACTGGGGTCAA
SEQ ID NO:64:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTGGTTACGGGATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTTGGATTTCTCCTTCTAACGGTTATACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTCGCGTCAGCTACTACGTCTACAGGCACGACTGGGTCAGGGGCTACGTTATGGACTACTGGGGTCAA
SEQ ID NO:65:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTGATACCTGGATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGGTGTTATTACTCCTTATGGCGGTTATACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCAAGAGACGGGGGCTTCTTCGATTACTGGGGTCAA
SEQ ID NO:66:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAGTGATTCCTCTATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTTTTATTTATCCTACTAGCGGTTCTACTTACTATGCCAATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCACGTGCCTCGTACGGGGTGAGCAAGTGGACCTTTGACTACTGGGGTCAA
SEQ ID NO:67:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTGGTTACGGGATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTTGGATTTCTCCTTCTAACGGTTATACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCATACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTCGCGTCAGCTACTACGTCTACAGGCACGACTGGGTCAGGGGCTACGTTATGGACTACTGGGGTCAA
SEQ ID NO:68:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTGGTACTTATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTTGGATTTCTCCTTATAGCGGTTATACTAACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCAAGAGAGGCCCGCTCCTCGTTGAGCGCGGACTACGCTATGGACTACTGGGGTCAA
SEQ ID NO:69:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTGATAATTATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTTGGATTTCTCCTTATAGCGGTTATACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTGAGTCCGGCTTCTCCGCGTGCAACACGCGGGCGTACGCTATGGACTACTGGGGTCAA
SEQ ID NO:70:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTGATTCTTGGATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGGTTCTATTACTCCTTATAACGGTAATACTGACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGCAGGGGGGAGTCCGACGAGGCCTACCCCGCGGTTATGGACTACTGGGGTCAA
SEQ ID NO:71:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTAGTACCGCTATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTTGGATTACTCCTTATGACGGTTATACTGACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACTAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTACGTGGTTCACGCTGGCCTCGGCTATGGAACTACTGGGGTCAA
SEQ ID NO:72:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTGGTAATGGGATACACTGGGTGCGTCAGGCC
CCGGGTAAGGGCCTGGAATGGGTTGCTTGGATTTCTCCTACTAACGGTTCTACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTAGGGTCGACTACCAGGTCTACCACGACCGCTTCGAGGAGGGGTACGCTATGGACTACTGGGGTCAA
SEQ ID NO:73:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAATAGTTATTGGATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGGTTGGATTTCTCCTGATAACGGTGCTACTAACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTAAGTTCTGGGGCTGGGACTGGGGGGGTATGGACTACTGGGGTCAA
SEQ ID NO:74:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAGTGATTCTTATATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGGTGATATTACTCCTACTGACGGTTATACTGACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTAACTTGATGTGGTGGGACTCGTCGGCTATGGACTACTGGGGTCAA
SEQ ID NO:75:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAGTGATTCTGGGATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGGTTTTATTTATCCTAATGGCGGTTCTACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTATGTCGTTGATCGGGTTCTCGTACGCTATGGACTACTGGGGTCAA
SEQ ID NO:76:
TTGTCCTGTGCAGCTTCTGGCTTCACCATTAATAGTACCTGGATACACTGGGTGCGTCAGGCCCCGGGTAAGGGCCTGGAATGGGTTGCTTGGATTAATCCTTATAACGGTTCTACTTACTATGCCGATAGCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAA
ATGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCAAGAGACTTGTACGACTACGACATCGGCTTCGACTACTGGGGTCAA

Анализы на клеточной основе - IL-17A/F индуцирует выработку IL-8 и IL-6

Фракции, выделенные на описанном выше этапе очистки Vydac C4 (фигура 3), были проанализированы на способность IL-17A/F индуцировать выработку IL-8. Фракции были протестированы посредством инкубации с клетками TK-10 в течение 24 часов (0,033 микролитра фракции на миллилитр среды для клеточной культуры). Затем собирали кондиционированную среду и в каждой фракции измеряли концентрацию IL-8 и IL-6 методом ELISA. Было обнаружено, что фракция 38 имеет сильную активность. Аминокислотный анализ показал, что концентрация белка во фракции 38 составляет 0,536 мг/мл. В этой фракции были проведены анализы гелей, пятен, аминокислотной последовательности и активности (фигура 3). В альтернативном варианте фракция 31 и остаточный объем фракции 32 из прогона в колонке HiLoad S Sepharose были объединены, диализированы буфером A в течение восьми часов с применением мембраны отсечки 10 kD и пропущены через фильтр с калибром 0,2 микрон. Полученный материал был загружен в колонку Mono S, уравновешенную буфером A на скорости потока 1 мл/мин и элюирован трехступенчатым градиентом до 100% буфера B (0-30% B на 10 объемов колонки, 30-75% B на 45 объемов колонки, 75-100% B на 10 объемов колонки) при сборе в объеме 1 мл на фракцию. Фракции 26-43 были проанализированы для определения концентраций белка посредством аминокислотного анализа. Чистый IL-17A/F был идентифицирован во фракциях 31-33, как единственный белок с очевидной молекулярной массой 30-35 kD. Концентрации во фракциях 31, 32 и 33 составили 0,258, 0,359 и 0,291 мг/мл соответственно. Гели и анализ белковой последовательности показали, что этот материал идентичен IL-17A/F очищенному в колонке C4 (выше). Кривые дозовой зависимости по сравнению индукции IL-8 и IL-6 полипептидами IL-17A/F, IL-17 и IL-17F показаны на фигуре 5. IL-17A/F, IL-17 и IL-17F были инкубированы с клетками TK-10 при номинальных концентрациях в течение 24 часов. Кондиционированную среду из-под TK-10 собирали и анализировали методом IL-8 ELISA и IL-6 ELISA.

Обсуждение

Коэкспрессия мРНК для IL-17 и IL-17F приводит к секреции нового вида белка, который способен связываться с как с определенными антителами, связывающимися с IL-17, так и с определенными антителами, связывающимися с IL-17F. Этот новый вид белка обозначен здесь как интерлейкин-17A/F (IL-17A/F). Этот вид белка не наблюдается в том случае, когда почечные клетки человека способны экспрессировать либо IL-17, либо IL-17F по отдельности. Кондиционированная среда от трансфицированных клеток была подвергнута иммунопреципитации (IP) с использованием антител, которые способны распознавать IL-17 (дорожки 1-5) или IL-17F (дорожки 6-10), как это показано на фигуре 1A и фигуре 1B. Затем иммуноосажденные белки были подвергнуты расщеплению в анализе по методу вестерн-блоттинга и блоттированы антителами к IL-17 (фигура 1A) или к IL-17F (фигура 1B). О выявлении IL-17A/F на дорожке 8 (фигура 1A) и на дорожке 3 (фигура 1B) свидетельствует присутствие IL-17 в димерном комплексе с IL-17F. Молекулярная масса этого белка, определенная в нередуцирующем анализе SDS-PAGE, составляет приблизительно 30-35 kD, что соответствует виду белка, представленному одной молекулой IL-17 и одной молекулой IL-17F, которые соединены ковалентной связью. Существование этой новой разновидности (IL-17A/F) можно также распознать по наличию белка с электрофоретической подвижностью, которая отличается от электрофоретической подвижности молекул IL-17 или IL-17F, экспрессируемых по отдельности. Этот новый вид белка как таковой можно также визуализировать без применения антител, используя другие способы выявления белка, в частности традиционные методики окрашивания белков.

Существование нового вида белка, вырабатываемого посредством коэкспрессии IL-17 и IL-17F, также подтверждено расщеплением секретируемых белков, представленных в кондиционированной питательной среде, по методу обращенно-фазовой хроматографии. Сравнение белковых фракций, наблюдаемых в секретируемых белках, которые производят клетки, одновременно экспрессирующие IL-17 и IL-17F, с клетками, продуцирующими по отдельности либо IL-17, либо IL-17F, показало наличие добавочного вида белка. Этот вид белка, IL-17A/F, был очищен до гомогенности и выделен посредством колоночной хроматографии (фигуры 2 и 3).

Очищенный белок проявлял себя как единичная полоса с молекулярной массой приблизительно 30-35 kD при определении по нередуцирующему методу SDS-PAGE (фигура 3A). Однако при условиях редуцирования анализ обнаруживал две четко различающиеся полосы с очевидной молекулярной массой приблизительно 15-18 kD (не показано). Таким образом, IL-17A/F представляет собой ковалентный димер. Оценка композиции нового белка независимым способом, анализом N-концевой пептидной последовательности, также четко показала, что выделенный IL-17A/F содержит как пептид IL-17, так и пептид IL-17F (фигура 3B). Выявленные пептидные последовательности идентичны последовательности N-концевого участка IL-17 и IL-17F (фигура 3C). Анализ методом вестерн-блоттинга показал, что этот новый вид белка также способен взаимодействовать как с антителом, способным связываться с IL-17, так и с антителом, способным связываться с IL-17F. Каждое из этих наблюдений и не похожая на известные белки молекулярная масса нового выделенного белка позволяют думать о том, что выделенный белок IL-17A/F является новым видом белка с ковалентной ассоциацией IL-17 и IL-17F.

Существование и расположение дисульфидных связей, соединяющих в белке IL-17A/F цепи IL-17 и IL-17F, было дополнительно охарактеризовано исследованием по методу масс-спектрометрии. Расположение дисульфидных связей в молекуле IL-17A/F схематически показано на фигуре 4A. Цепи IL-17 и IL-17F в молекуле IL-17A/F соединены двумя межцепочечными дисульфидными связями. Можно ожидать, что расщепление IL-17A/F трипсином приведет к образованию двух разных пептидных фрагментов, содержащих межцепочечные дисульфидные связи (фрагменты дисульфидной связи IL-17A/F #1 и #2, SEQ ID NO: 7 и 8 соответственно). Эти пептиды показаны схематически (фигура 4B) вместе с соответствующей предсказанной молекулярной массой. Эти пептиды наблюдались в анализе времяпролетной масс-спектрометрии с лазерной ионизацией и десорбцией из жидкой матрицы (MALDI-TOF) (фигура 4C) и в анализе по методике жидкостной хроматографии и масс-спектрометрии с ионизацией электрораспылением и ионной ловушкой (LC-ESI-MS) (фигура 4D). Пики пептидов, соответствующие гомодимерам IL-17 или IL-17F, не определялись, а это указывало на то, что очищенный IL-17A/F состоял из ковалентных гетеродимеров цепей IL-17 и IL-17F, но не содержал поддающегося выявлению уровня гомодимеров ни IL-17, ни IL-17F.

В дополнение к этому, посредством скрининга фановой библиотеки синтетических антител Fab были идентифицированы антитела, связывающиеся с IL-17A/F. Были идентифицированы тридцать четыре (34) независимых клона, кодирующих отдельные антитела Fab, которые способны связываться с IL-17A/F. Аминокислотная последовательность участка вариабельного домена тяжелых цепей, содержащего три (3)CDR [H1-H3] из Fab, связывающегося с IL-17A/F, показана на фигуре 6. Показано выравнивание участка предсказанной аминокислотной последовательности 34 клонов Fab, кодирующих отдельные последовательности тяжелой цепи антитела, которые способны связываться с IL-17A/F. Три участка CDR тяжелой цепи, обозначенные CDR-H1, CDR-H2 и CDR-H3 соответственно, выделены желтым цветом. Соответствующие аминокислотные последовательности для каждого из тридцати четырех (34) клонов обозначены SEQ ID NO: 9-42. В дополнение к этому, соответствующие кодирующие последовательности ДНК для каждого из идентифицированных тридцати четырех (34) клонов показаны ниже в таблице 7 (от SEQ ID NO:43 до SEQ ID NO:76 соответственно). Таким образом, были идентифицированы специфические антитела, избирательно связывающиеся с новым гетеродимерным комплексом IL-17A/F, которые могут быть использованы для модулирования активности этого нового цитокина.

Белок IL-17A/F был проанализирован на способность стимулировать провоспалительный ответ с применением линии почечных клеток человека TK-10 (фигура 5). Эта клеточная линия реагирует как на IL-17, так и на IL-17F выработкой IL-8. Белок IL-17A/F также сильно индуцировал выработку IL-8 в этой клеточной линии (фигура 5A). Интересен тот наблюдавшийся результат, что IL-17A/F имел уникальную мощность, отличавшуюся как от IL-17, так и от IL-17F. Различие активности по сравнению с IL-17 и IL-17F грубо составляло примерно один порядок величины. Существенно более высокая активность IL-17A/F по сравнению с IL-17F в этом анализе позволяет предположить, что IL-17A/F, возможно, содержит критически важный компонент активности цитокина, происходящий из продукта гена IL-17F. Эта уникальная мощность может придать молекуле способность осуществлять особый диапазон действий in vivo. Белок IL-17A/F также индуцировал выработку IL-6 в этой клеточной линии (фигура 5B). В дополнение к этому, вполне вероятно, что IL-17A/F может обладать новыми свойствами, не характерными ни для IL-17, ни для IL-17F, что является результатом его новой гетеродимерной композиции, которая, возможно, изменяет кинетику и утилизацию субъединиц рецептора in vivo, приводя к уникальным биологическим последствиям.

ПРИМЕР 2

Идентификация нового цитокина IL-17, выработанного активированными T-клетками человека

Новый цитокин человека IL-17 (идентифицированный здесь как IL-17A/F человека) описан в этой заявке впервые как белок, вырабатываемый естественным образом в активированных T-лимфоцитах человека. Выделение и активацию T-лимфоцитов человека проводили, а выработку IL-17A/F выявляли и количественно измеряли методом IL-17A/F ELISA, как это продемонстрировано ниже:

Выделение и активация T-клеток человека

Гепаринизированную свежую кровь человека (0,5 мл/50 см3), только что взятую у здорового донора, разбавляли физиологическим раствором 1:1, затем наслаивали на разделительную среду LSM Lymphcyte (производства компании ICN) и центрифугировали в соответствии с инструкциями производителя (ICN). Восстановленные мононуклеарные лимфоциты высевали во флаконы для тканевых культур с полной средой RPMI (RPMI, 10%FCS, 2 мМ L-глутамина, пенициллин/стрептомицин (GIBCO)), на один час при 37°C для истощения запаса моноцитов. Супернатанты культур центрифугировали для получения осадка из остаточных клеток. Затем проводили выделение T-лимфоцитов посредством негативной селекции с применением набора для выделения T-клеток CD4+ (MACS). Для активации выделенных T-лимфоцитов флаконы с тканевой культурой покрывали из расчета 5 мкг/мл на каждый продукт анти-CD3 (BD Bioscience) и анти-CD28 (BD Bioscience) в PBS и выдерживали в течение ночи при 4°C. После удаления покровной среды выделенные T-лимфоциты человека высевали в полную среду RPMI с приблизительной плотностью 2 миллиона клеток на миллилитр среды. Образцы среды собирали в разных точках времени после высева клеток и анализировали на IL-17A/F методом ELISA. Неактивированные контрольные супернатанты собирали из таких же флаконов с клеточной культурой, не покрытой анти-CD3 и анти-CD28.

Измерение выработки IL-17A/F человека в T-клетках человека, активированных анти-CD3/анти-CD28, методом ELISA

Уровень IL-17A/F человека измеряли в анализах по методу ELISA. Мышиное антитело против IL-17 человека разбавляли в покровном буфере (0,05 M буфер из карбоната натрия, pH 9,6) и наносили на 96-луночные титрационные микропланшеты (Nunc) на 12-15 часов при 2-8°C. Все последующие этапы проводили при комнатной температуре. Неспецифическое связывание блокировали, опорожняя лунки и добавляя блокирующий буфер (PBS, 0,5% BSA, 10 ppm Proclin 300). После 1-часовой инкубации лунки отмывали отмывочным буфером (PBS, 0,05% Tween 20, 10 ppm Proclin 300). Затем добавляли эталонные стандарты IL-17A/F и исследуемые образцы, разведенные в аналитическом буфере (PBS, 0,5% BSA, 0,05% Tween 20, 10 ppm Proclin 300). После 2-часовой инкубации лунки отмывали отмывочным буфером. Добавляли мышиное антитело против IL-17F человека, разведенное в аналитическом буфере и проводили инкубацию материала в течение 1 часа. После отмывания добавляли планшеты с отмывочным буфером, стрептавидином-HRP (пероксидазой хрена) (Amersham), разбавленным в аналитическом буфере, и дополнительно инкубировали в течение 1 часа. После отмывания добавляли планшеты с отмывочным буфером, раствором субстрата, TMB (тетраметилбензидин)-пероксидазой (R & D Systems). Развитие окрашивания останавливали, добавляя 2 N серную кислоту. Затем планшеты считывали на считывающем устройстве для титрационных микропланшетов (SLT) при 450 нм с вычитанием пробела на 540 нм. Для генерирования стандартной кривой использовали программу подгонки кривой с четырьмя параметрами, а концентрацию образца выводили посредством интерполяции из линейной части кривой. В качестве контроля в анализ ELISA включали IL-17A и IL-17F, чтобы проиллюстрировать специфичность анализа для IL-17A/F (фигура 12).

Результаты:

Результаты измерений выработки IL-17A/F в анализе ELISA показаны на фигуре 11. Эти исследования демонстрируют выработку нового цитокина IL-17A/F T-лимфоцитами человека, активированными анти-CD3/анти-CD28, в отличие от неактивированных T-клеток человека, в которых выработка IL-17A/F не наблюдалась. Эти результаты впервые показали возможность появления нового цитокина естественным образом, то есть его выработку и высвобождение в ответ на активацию T-лимфоцитов человека. В дополнение к этому была продемонстрирована специфичность анализа ELISA, о чем свидетельствовало наблюдение почти одинакового количества IL-17A/F в трех образцах (#31-#33) при их параллельном анализе. В этом анализе ELISA, специфичном для IL-17A/F, было обнаружено пренебрежимо малое количество IL-17A или IL-17F (фигура 12).

Исследования, описанные здесь в примерах 1 и 2, устанавливают, что IL-17A/F человека явно представляет собой новый цитокин, отличающийся от IL-17 и IL-17F человека как по белковой структуре, так и по анализам активности на клеточной основе. Благодаря использованию очищенного рекомбинантного IL-17A/F человека в качестве стандарта была разработана специфическая методика ELISA для IL-17AF человека (показано на фигуре 11). С помощью этой специфической методики ELISA была выявлена индуцированная экспрессия IL-17A/F человека, а это подтвердило, что IL-17A/F естественным образом вырабатывается активированными T-клетками человека в культуре. Следовательно, IL-17A/F, несомненно, является новым цитокином, определяемым как естественный продукт выделенных активированных T-клеток человека, причем его рекомбинантная форма была охарактеризована по белковой структуре и по анализам на клеточной основе как иная и отличимая от родственных цитокинов.

Этот новый цитокин может действовать, модулируя активность IL-17 in vivo и проявляя себя в качестве конкурентного ингибитора при связывании с сайтами для IL-17 или для других родственных цитокинов. IL-17A/F также может модулировать активность других родственных цитокинов за счет понижающей регуляции сайтов связывания как для себя самого, так и для других родственных цитокинов. IL-17A/F может проявлять активность через внутриклеточные адаптеры или сигнальные молекулы, то есть действует, регулируя собственную сигнальную активность или сигнальную активность других родственных цитокинов. IL-17A/F обладает способностью влиять на спаривание рецепторов и ко-рецепторов, находящихся на поверхности клеток или во внутриклеточном компартменте.

Таким образом, эти исследования выявляют и идентифицируют новый иммуностимулятор (т.е. IL-17A/F), способный помочь иммунной системе отреагировать на специфический антиген, который до этого не проявлял иммунологической активности. По существу новооткрытый иммуностимулятор имеет важные возможности клинического применения. Были идентифицированы и другие известные иммуностимуляторы, в частности IL-12 [см. ссылку Gubler et al. PNAS 88, 4143 (1991)]. В недавно проведенном испытании раковой вакцины исследователи из Чикагского университета и Института генетики (Кембридж, штат Массачусетс) рассчитывали на иммуностимулирующую активность IL-12 при лечении меланомы. [Peterson et al. Journal of Clinical Oncology 21 (12). 2342-48 (2003)]. Они извлекали циркулирующие лейкоциты, несущие один или более маркеров клеток меланомы, выделяли антиген и возвращали их больным. Обычно больные не давали иммунного ответа на собственные антигены человека. Затем больных лечили различными дозами IL-12, иммуностимулятора, способного индуцировать пролиферацию T-клеток, которые были одновременно стимулированы дендровидными клетками. Вследствие иммуностимулирующего эффекта IL-12 лечение давало лучшие результаты по сравнению с предыдущими работами, когда из мононуклеарных клеток периферической крови больных (PBMC) готовили собственные дендровидные клетки, обрабатывали их антигенами, затем культивировали in vitro и возвращали больному для стимуляции противоракового ответа [Thurner et al. J. Exp. Med. 190 (11), 1669-78 (1999)]. Подобным образом этот новый цитокин IL-17A/F или его агонисты могли бы найти практическое применение в качестве иммуностимуляторов. В то же время молекулы, которые подавляют активность IL-17A/F (антагонисты), по-видимому, могут найти полезное практическое применение в тех случаях, когда требуется подавление иммунного ответа, например при аутоиммунных заболеваниях.

Таким образом, лечебными качествами могут обладать антитела к этому новому цитокину, которые либо имитируют иммунологическую активность IL-17A/F (агонистические антитела), либо подавляют ее (антагонистические антитела). Потенциальное лечебное применение могут найти и мелкие молекулы, способные подавлять активность этого нового цитокина.

ПРИМЕР 3

Применение IL-17A/F в качестве зонда гибридизации

Приведенный ниже способ описывает применение нуклеотидной последовательности, кодирующей IL-17A/F, в качестве зонда гибридизации.

ДНК, содержащую кодирующую последовательность полноразмерного или зрелого IL-17A/F, как это раскрыто здесь, используют в качестве зонда для скрининга на гомологичные ДНК (например, такие, которые кодируют встречающиеся в природе варианты IL-17A/F) в библиотеках кДНК или в геномных библиотеках из тканей человека.

Гибридизацию и отмывание фильтров, содержащих ДНК любой из двух указанных библиотек, проводят в следующих условиях высокой строгости. Гибридизацию радиоактивно меченного зонда, полученного из IL-17A/F, с фильтрами проводят в растворе 50% формамида, 5× SSC, 0,1% SDS, 0,1% пирофосфата натрия, 50 мМ фосфата натрия, pH 6,8, 2× раствора Денхардта (Denhardt), и 10% декстрансульфата при 42°C в течение 20 часов. Отмывание фильтров проводят в водном растворе 0,1× SSC и 0,1% SDS при 42°C.

Затем можно идентифицировать ДНК, имеющие желательную идентичность последовательности с ДНК, кодирующей полноразмерную природную последовательность IL-17A/F, применяя стандартные методики, известные в данной области техники.

ПРИМЕР 4

Экспрессия IL-17A/F в E. coli

Этот пример иллюстрирует изготовление негликозилированной формы полипептидов IL-17A/F посредством рекомбинантной экспрессии в E. coli.

Последовательность ДНК, кодирующую полипептид IL-17A/F, сначала амплифицируют, используя специально подобранные праймеры для PCR. Праймеры должны содержать сайты приложения для рестрикционного фермента, которые соответствуют сайтам приложения рестрикционного фермента в выбранном векторе экспрессии. Можно использовать широкий ряд векторов экспрессии. Примером подходящего вектора является pBR322 (полученный из E. coli; см. ссылку Bolivar et al., Gene, 2:95 (1977)), который содержит гены устойчивости к ампициллину и тетрациклину. Вектор расщепляют рестрикционным ферментом и фосфорилируют. Затем последовательности, амплифицированные в PCR, вшивают в вектор. Предпочтительно, чтобы вектор включал генные последовательности, которые кодируют устойчивость к антибиотикам, промотор trp, лидер polyHis (включая первые шесть кодонов STII, последовательность polyHis и сайт расщепления для энтерокиназы), участок, кодирующий полипептид IL-17A/F, терминатор транскрипции лямбда и ген argU.

Затем используют лигирующую смесь для трансформации отобранного штамма E. coli, применяя способы, описанные в ссылке Sambrook et al., см. выше. Трансформанты идентифицируют по их способности расти на чашках LB, после чего проводят отбор колоний, устойчивых к антибиотикам. Плазмидную ДНК можно выделить и подтвердить рестрикционным анализом и секвенированием ДНК.

Отобранные клоны можно выращивать в течение ночи в жидкой культуральной среде, например в бульоне LB с добавками антибиотиков. Ночную культуру впоследствии можно использовать для засева с получением более масштабной культуры. Затем клетки выращивают до желательной оптической плотности, при которой включается промотор экспрессии.

После дополнительного культивирования еще в течение нескольких часов клетки можно собрать центрифугированием. Клеточный осадок, полученный в результате центрифугирования, можно солюбилизировать, применяя разные агенты, известные в данной области техники, а затем солюбилизированный белок IL-17A/F можно очистить в металло-хелатной колонке, соблюдая условия, способствующие плотному связыванию белка.

Полипептиды IL-17A/F могут быть экспрессированы в E. coli в форме, меченой poly-His, с применением следующей процедуры. ДНК, кодирующую полипептид IL-17A/F, сначала амплифицируют, используя специально подобранные праймеры для PCR. Праймеры должны содержать сайты приложения для рестрикционного фермента, которые соответствуют сайтам приложения рестрикционного фермента в выбранном векторе экспрессии, а также другие полезные последовательности, обеспечивающие эффективную и надежную инициацию трансляции, быструю очистку в металло-хелатной колонке и протеолитическое удаление энтерокиназой. Затем амплифицированные в PCR и меченые poly-His последовательности вшивают в вектор экспрессии, который используется для трансформации клетки-хозяина E. coli, полученной на основе штамма 52 (W3110 fuhA(tonA) lon galE rpoHts(htpRts) clpP(lacIq). Трансформанты сначала выращивают в среде LB, содержащей 50 мг/мл карбенициллина при 30°C, с периодическим встряхиванием до достижения O.D.600 порядка 3-5. Затем культуры разбавляют в 50-100 раз средой CRAP (приготовленной посредством смешивания 3,57 г (NH4)2SO4, 0,71 г цитрата натрия·2H2O, 1,07 г KCl, 5,36 г дрожжевого экстракта Difco, 5,36 г Sheffield hycase SF в 500 мл воды, а также 110 мМ MPOS, pH 7,3, 0,55% (вес/объем) глюкозы и 7 мМ MgSO4) и выращивают приблизительно в течение 20-30 часов при 30°C с периодическим встряхиванием. Образцы извлекают для верификации экспрессии посредством анализа SDS-PAGE и основную часть культуры центрифугируют для получения клеточного осадка. Осажденные клетки замораживают до очистки и рефолдинга ("пересворачивания" белков).

Массу E. coli paste из ферментаций от 0,5 до 1 л (6-10 г осадка) ресуспендируют в 10 объемах (вес/объем) буфера, содержащего 7 M гуанидина, 20 мМ Tris, pH 8. Затем добавляют твердый сульфит натрия и тетратионат натрия для получения конечных концентраций 0,1 M и 0,02 M соответственно и полученный раствор перемешивают в течение ночи при 4°C. Этот этап приводит к денатурации белка с блокированием всех цистеиновых остатков посредством сульфитолизации. Раствор центрифугируют со скоростью 40000 оборотов в минуту в ультрацентрифуге Beckman в течение 30 минут. Супернатант разбавляют 3-5 объемами буфера для металло-хелатной колонки (6 M гуанидина, 20 мМ Tris, pH 7,4) и фильтруют для осветления, пропуская через фильтры калибра 0,22 микрон. Осветленный экстракт загружают в металло-хелатную колонку Qiagen Ni-NTA объемом 5 мл, уравновешенную буфером для металло-хелатной колонки. Колонку отмывают дополнительным буфером, содержащим 50 мМ имидазола (Calbiochem, сорт Utrol), pH 7,4. Белок элюируют буфером, содержащим 250 мМ имидазола. Фракции, содержащие нужный белок, объединяют и хранят при 4°C. Концентрацию белка оценивают по поглощению на волне 280 нм с применением расчетного коэффициента экстинкции, основанного на аминокислотной последовательности этого белка.

Белки подвергают рефолдингу (пересворачиванию), медленно разбавляя образец свежеприготовленным буфером для рефолдинга, состоящим из: 20 мМ Tris, pH 8,6, 0,3 M NaCl, 2,5 M мочевины, 5 мМ цистеина, 20 мМ глицина и 1 мМ EDTA. Объем рефолдинга выбирают с таким расчетом, чтобы конечная концентрация белка находилась в диапазоне от 50 до 100 микрограммов на миллилитр. Раствор для рефолдинга осторожно помешивают при 4°C в течение 12-36 часов. Реакцию рефолдинга останавливают, добавляя TFA до конечной концентрации 0,4% (pH приблизительно 3). Перед дополнительной очисткой белка раствор фильтруют через фильтр 0,22 микрон и добавляют ацетонитрил до конечной концентрации 2-10%. Пересвернутый белок хроматографируют в колонке Poros R1/H для обращенно-фазовой хроматографии, применяя мобильный буфер 0,1% TFA с элюцией градиентом ацетонитрила от 10 до 80%. Аликвотные части фракций с поглощением A280 анализировали на полиакриламидных гелях SDS, а фракции, содержащие гомогенный пересвернутый белок, объединяли. Обычно правильно пересвернутые разновидности большинства белков элюируют при минимальных концентрациях ацетонитрила, поскольку эти разновидности наиболее компактны, имея гидрофобные внутренние части, защищенные от взаимодействия с обращенно-фазовым полимером. Агрегированные разновидности обычно элюируют более высокими концентрациями ацетонитрила. В дополнение к отделению неправильно свернутых форм белков от белка нужной формы на этапе обращенно-фазовой хроматографии из образцов удаляется также эндотоксин.

Фракции, содержащие полипептид IL-17A/F, свернутый надлежащим образом, объединяют, после чего удаляют ацетонитрил плавным потоком азота, направленным на раствор. Белки вводят в рецептурный состав, содержащий 20 мМ Hepes, pH 6,8 с 0,14 M хлорида натрия и 4% маннитола, посредством диализа или гель-фильтрации, применяя полимеры G25 Superfine (Pharmacia), уравновешенные в рецептурном буфере и стерильно профильтрованные.

ПРИМЕР 5

Экспрессия IL-17A/F в клетках млекопитающего

Этот пример иллюстрирует изготовление потенциально гликозилированной формы полипептидов IL-17A/F посредством рекомбинантной экспрессии в клетках млекопитающего.

В качестве вектора экспрессии использовали вектор pRK5 (см. документ EP 307247, опубликованный 15 марта 1989 года). По выбору ДНК, кодирующую IL-17A/F, вшивают в pRK5 подобранными рестрикционными ферментами, чтобы сделать возможной вставку ДНК IL-17A/F с применением методов сшивания, как это описано в ссылке Sambrook et al., см. выше. Полученный в результате вектор называется pRK5-IL-17A/F.

В одном из вариантов осуществления изобретения клетками-хозяевами могут быть клетки линии 293. Клетки человека 293 cells (ATCC CCL 1573) выращивают до слияния в чашках для тканевых культур на такой среде как DMEM с добавками телячьей эмбриональной сыворотки и, необязательно, дополнительных питательных компонентов и/или антибиотиков. Приблизительно 10 мкг ДНК pRK5-IL-17A/F смешивают приблизительно с 1 мкг ДНК, кодирующей ген VA RNA [Thimmappaya et al., Cell, 31:543 (1982)], и растворяют в 500 мкл 1 мМ Tris-HCl, 0,1 мМ EDTA, 0,227 M CaCl2. К этой смеси по каплям добавляют 500 мкл 50 мМ HEPES (pH 7,35), 280 мМ NaCl, 1,5 мМ NaPO4 и в течение 10 минут дают образоваться осадку при температуре 25°C. Осадок суспендируют, добавляют к клеткам 293 и дают отстояться приблизительно четыре часа при 37°C. Культуральную среду отсасывают и на 30 секунд добавляют 2 мл 20% глицерина в PBS. Затем клетки 293 отмывают бессывороточной средой, добавляют свежую среду и инкубируют приблизительно 5 дней.

Приблизительно через 24 часа после трансфекции культуральную среду удаляют и заменяют новой культуральной средой (чистой) или культуральной средой, содержащей 200 мКи/мо 35S-цистеина и 200 мКи/мл 35S-метионина. После 12-часовой инкубации собирают кондиционированную питательную среду, концентрируют ее, пропуская через центробежный фильтр, и загружают на 15% SDS-гель. Обрабатываемый гель можно высушить и экспонировать на пленку в течение определенного времени, чтобы выявить присутствие полипептида IL-17A/F. Культуры, содержащие трансфицированные клетки, можно подвергнуть дополнительной инкубации (в бессывороточной среде), после чего среду анализируют определенными методами биоанализа.

В альтернативной методике IL-17A/F можно ввести в клетки 293 кратковременно, применяя способ сульфата декстрана, описанный в ссылке Somparyrac et al., Proc. Natl. Acad. Sci., 12:7575 (1981). Клетки 293 выращивают до максимальной плотности во вращающейся колбе и добавляют 700 мкг ДНК pRK5-IL-17A/F. Клетки из вращающейся колбы прежде всего концентрируют центрифугированием и отмывают в PBS. Осадок ДНК-декстрана инкубируют на клеточном осадке в течение четырех часов. Клетки обрабатывают 20% глицерином в течение 90 секунд, отмывают средой для тканевого культивирования и повторно вносят во вращающуюся колбу, содержащую среду для тканевой культуры, 5 мкг/мл бычьего инсулина и 0,1 мкг/мл бычьего трансферрина. Приблизительно через четыре дня кондиционированную среду центрифугируют и фильтруют для удаления клеток и обломков. Затем образец, содержащий экспрессированный полипептид IL-17A/F, можно концентрировать и очистить любым подходящим способом, например диализом и/или колоночной хроматографией.

Еще в одном варианте осуществления изобретения полипептиды IL-17A/F могут экспрессироваться в клетках CHO. Вектор pRK5-IL-17A/F можно трансфицировать в клетки CHO, применяя известные реактивы, в частности as CaPO4 или DEAE-декстран. Как было описано выше, клеточные культуры можно инкубировать и провести замену среды новой культуральной средой (чистой или содержащей радиоактивную метку, например 35S-метионин). После определения присутствия полипептида IL-17A/F культуральную среду можно заменить бессывороточной средой. Предпочтительно инкубировать культуры приблизительно 6 дней, после чего можно проводить сбор кондиционированной питательной среды. Затем среду, содержащую экспрессированный полипептид IL-17A/F, можно концентрировать и очистить любым выбранным способом.

Меченный эпитопом IL-17A/F может также экспрессироваться в клетках-хозяевах CHO. Полипептид IL-17A/F можно субклонировать из вектора pRK5. Вставка субклона может подвергнуться PCR для слияния в рамке с выбранной эпитопной меткой, например с меткой poly-His в бакуловирусном векторе экспрессии. Вставку IL-17A/F, меченную poly-His, можно затем субклонировать в вектор, управляемый SV40, где содержится селективный маркер, например DHFR для отбора стабильных клонов. Наконец, клетки CHO могут быть трансфицированы (как это описано выше) вектором, управляемым SV40. Для того чтобы верифицировать экспрессию, можно провести мечение, как это описано выше. Затем культуральную среду, содержащую экспрессированный IL-17A/F с меткой poly-His, можно концентрировать и очистить любым выбранным способом, например Ni2+-хелат аффинной хроматографией.

Полипептиды IL-17A/F могут также экспрессироваться в клетках CHO и/или COS посредством процедуры кратковременной экспрессии или в клетках CHO посредством другой процедуры стабильной экспрессии.

Стабильную экспрессию в клетках CHO осуществляют, применяя следующую процедуру. Белки экспрессируются в виде конструкции IgG (иммуноадгезина), когда кодирующие последовательности растворимых форм (например, внеклеточных доменов) соответствующих белков слиты с последовательностью постоянного региона IgG1, содержащей шарнир, домены CH2 и CH2, и/или в виде формы, меченной poly-His.

После амплификации в PCR соответствующие ДНК субклонируют в вектор экспрессии CHO, применяя стандартные методики, как это описано в ссылке Ausubel et al., Current Protocols of Molecular Biology, Unit 3.16, John Wiley and Sons (1997). Секторы экспрессии CHO конструируют таким образом, чтобы они имели совместимые рестрикционные сайты 5' и 3' для представляющей интерес ДНК, чтобы можно было проводить удобную загрузку-разгрузку кДНК. Вектор, задействованный для экспрессии в клетках CHO, описан в ссылке Lucas et al., Nucl. Acids Res., 24:9 (1774-1779 (1996) и использует ранний промотор/энхансер SV40 для управления экспрессией, представляющей интерес кДНК и дигидрофолатредуктазы (DHFR). Экспрессия DHFR делает возможным отбор на стабильное сохранение плазмиды после трансфекции.

Двенадцать микрограммов нужной плазмидной ДНК вводят приблизительно в 10 миллионов клеток CHO, применяя имеющиеся в продаже реактивы Superfect® (Qiagen), Dosper® или Fugene® (Boehringer Mannheim). Клетки выращивают, как это описано в ссылке Lucas et al., см. выше. Приблизительно 3 × 107 клеток замораживают в ампуле для дальнейшего выращивания и выработки (нужных веществ), как это описано ниже.

Ампулы, содержащие плазмидную ДНК, оттаивают, помещая их в водную баню, и перемешивают их содержимое вихревым движением. Содержимое пипетируют в центрифужную пробирку, содержащую 10 мл среды, и центрифугируют на скорости 1000 оборотов в минуту в течение 5 минут. Супернатант отсасывают, а клетки ресуспендируют в 10 мл селективной питательной среды (0,2 мкм фильтрованного PS20 с 5% 0,2 мкм диафильтрованной эмбриональной телячьей сыворотки). Затем аликвотную часть клеток переносят во вращающуюся колбу емкостью 100 мл, содержащую 90 мл селективной питательной среды. Спустя 1-2 дня клетки переносят во вращающуюся колбу емкостью 250 мл, наполненную на 150 мл селективной ростовой средой и инкубируют при 37°C. Спустя еще 2-3 дня вращающиеся колбы емкостью 250 мл, 500 мл и 2000 мл засевают клетками из расчета 3 × 105 клеток на миллилитр. Среду для клеток заменяют свежей средой посредством центрифугирования и ресуспендирования в производительной среде. Хотя можно использовать любую среду, подходящую для клеток CHO, фактически предпочтительно использовать производительную среду, описанную в патенте США № 5122469, выданном 16 июня 1992 г. Вращающуюся колбу для выработки емкостью 3 л засевают из расчета 1,2 × 106 клеток на миллилитр. В 0-й день определяют количество клеток и pH. В 1-й день из вращающейся колбы отбирают образец и начинают барботаж фильтрованным воздухом. Во 2-й день из вращающейся колбы отбирают образец, температуру сдвигают до 33°C и добавляют 30 мл 500 г/л глюкозы и 0,6 мл 10% антивспенивателя (например, 35% эмульсии полидиметилсилоксана 365 медицинского сорта, Dow Corning). Во время выработки по мере необходимости проводят подгонку pH, поддерживая этот показатель на уровне приблизительно 7,2. Через 10 дней или при падении жизнеспособности клеток ниже 70% проводят сбор клеточной культуры центрифугированием и фильтрацией через фильтр 0,22 мкм. Фильтрат либо хранят при 4°C, либо немедленно загружают в колонки для очистки.

Для конструкций с меткой poly-His белки очищают в колонке Ni-NTA (Qiagen). Перед очисткой к кондиционированной среде добавляют имидазол до концентрации 5 мМ. Кондиционированную среду нагнетают в 6 мл колонку Ni-NTA, уравновешенную 20 мМ Hepes, pH 7,4, буфером, содержащим 0,3 M NaCl и 5 мМ имидазола со скоростью потока 4-5 мл/мин при 4°C. После загрузки колонку промывают дополнительным уравновешивающим буфером, элюируя белок уравновешивающим буфером, содержащим 0,25 M имидазола. Затем белок высокой степени очистки обессоливают в буфере для хранения, содержащем 10 мМ Hepes, 0,14 M NaCl и 4% маннита, pH 6,8, с применением 25 мл колонки G25 Superfine (Pharmacia) и хранят при -80°C.

Конструкции иммуноадгезина (Fc-содержащие) очищают от кондиционированной среды следующим образом. Кондиционированную среду нагнетают в 5 мл колонку Protein A (Pharmacia), которая была уравновешена 20 мМ буфера из фосфата натрия, pH 6,8. После загрузки колонку интенсивно промывают уравновешивающим буфером перед тем, как провести элюирование 100 мМ лимонной кислотой, pH 3,5. Элюированный белок немедленно нейтрализуют, собирая фракции по 1 мл в пробирки, содержащие 275 мкл 1 M буфера Tris, pH 9. Затем белок высокой степени очистки обессоливают в буфере для хранения, как это описано выше для белков, меченных poly-His. Гомогенность оценивают анализом в SDS-полиакриламидных гелях и N-концевым аминокислотным секвенированием при расщеплении полипептидов по Эдману.

ПРИМЕР 6

Экспрессия IL-17A/F в дрожжах

Следующий способ описывает рекомбинантную экспрессию полипептидов IL-17A/F в дрожжах.

Прежде всего конструируют дрожжевые векторы экспрессии для внутриклеточной выработки или секреции IL-17A/F из промотора ADH2/GAPDH. ДНК, кодирующую полипептид IL-17A/F и промотор, вставляют в подходящие сайты для рестрикционного фермента в выбранной плазмиде, чтобы управлять внутриклеточной экспрессией полипептида IL-17A/F. Для секреции ДНК, кодирующую IL-17A/F, можно клонировать в выбранную плазмиду вместе с ДНК, кодирующей промотор ADH2/GAPDH, природный сигнальный пептид IL-17A/F, или другой сигнальный пептид млекопитающего, или, например, дрожжевой альфа-фактор, или секреторную последовательность сигнала/лидера инвертазы и линкерные последовательности (если это необходимо) для экспрессии IL-17A/F.

Затем дрожжевые клетки, например клетки дрожжевого штамма AB110, можно трансформировать плазмидами экспрессии, описанными выше, и культивировать в подобранной ферментационной среде. Супернатанты трансформированных дрожжей можно анализировать посредством осаждения 10% трихлоруксусной кислотой и разделения методом SDS-PAGE с последующим окрашиванием гелей кумасси голубым.

Впоследствии можно выделять рекомбинантные полипептиды IL-17A/F, очищать их, удаляя из ферментационной среды дрожжевые клетки центрифугированием, а затем концентрируя среду, применяя подобранные картриджные фильтры. Концентрат, содержащий полипептид IL-17A/F, можно дополнительно очистить, применяя подобранные смолы для колоночной хроматографии.

ПРИМЕР 7

Экспрессия IL-17A/F в клетках насекомого, инфицированных бакуловирусом

Следующий способ описывает рекомбинантную экспрессию полипептидов IL-17A/F в клетках насекомого, инфицированных бакуловирусом.

Последовательность, кодирующую IL-17A/F, гибридизируют выше эпитопной метки, содержащейся в бакуловирусном векторе экспрессии. Такие эпитопные метки включают метки poly-His и иммуноглобулиновые метки (наподобие Fc-регионов IgG). Можно использовать самые разные плазмиды, включая плазмиды, полученные из плазмид, имеющихся в продаже, например pVL1393 (Novagen). Вкратце, последовательность, кодирующую IL-17A/F, или нужную часть кодирующей последовательности IL-17A/F, например последовательность, кодирующую внеклеточный домен трансмембранного белка, или последовательность, кодирующую зрелый белок, если белок является внеклеточным, амплифицируют в PCR с праймерами, комплементарными 5' и 3' регионам. Праймер 5' может инкорпорировать фланкирующие (подобранные) сайты для рестрикционного фермента. Затем продукт расщепляют этими подобранными рестрикционным ферментами и субклонируют в вектор экспрессии.

Рекомбинантный бакуловирус генерируют посредством котрансфекции вышеуказанной плазмиды и вирусной ДНК BaculoGoldTM (Pharmingen) в клетки Spodoptera frugiperda ("Sf9") (ATCC CRL 1711) с применением липофектина (выпускаемого для продажи компанией GIBCO-BRL). Через 4-5 дней инкубации при 28°C проводят сбор высвобожденных вирусов, которые используют для дальнейших амплификаций. Вирусную инфекцию и экспрессию белка осуществляют, как это описано в ссылке O'Reilley et al., Baculovirus expression vectors: A Laboratory Manual, Oxford: Oxford University Press (1994).

Затем экспрессированный IL-17A/F с меткой poly-His можно очистить, например, посредством Ni2+-хелатной аффинной хроматографии, проводимой следующим образом. Из рекомбинантных клеток Sf9, инфицированных вирусом, готовят экстракты, как это описано в ссылке Rupert et al., Nature, 362:175-179 (1993). Вкратце, клетки Sf9 отмывают, ресуспендируют в буфере для ультразвуковой обработки (25 мл Hepes, pH 7,9, 12,5 мМ MgCl2, 0,1 мМ EDTA, 10% глицерина, 0,1% NP-40; 0,4 M KCl) и дважды обрабатывают ультразвуком в течение 20 секунд на льду. Обработанный ультразвуком материал осветляют центрифугированием, а супернатант разбавляют в 50 раз в буфере для загрузки (50 мМ фосфата, 300 мМ NaCl, 10% глицерина, pH 7,8) и фильтруют, пропуская через фильтр 0,45 мкм. Колонку с Ni2+-NTA агарозой (выпускаемую в продажу компанией Qiagen) готовят с объемом ложа 5 мл, промывают 25 мл воды и уравновешивают 25 мл загрузочного буфера. В колонку загружают профильтрованный клеточный экстракт со скоростью 0,5 мл в минуту. Колонку промывают загрузочным буфером до базисного уровня A280 и в этой точке начинают сбор фракций. Далее колонку промывают вторым загрузочным буфером (50 мМ фосфата, 300 мМ NaCl, 10% глицерина, pH 6,0), который элюирует неспецифически связанный белок. После повторного достижения базисного уровня A280 колонку разрабатывают градиентом имидазола от 0 до 500 мМ во втором загрузочном буфере. Фракции собирают в количестве одного мл, анализируют по методике SDS-PAGE с окрашиванием серебром или вестерн-блоттингом с Ni2+-NTA, конъюгированным со щелочной фосфатазой (Qiagen). Фракции, содержащие IL-17A/F с меткой His10, собирают и диализируют загрузочным буфером.

В альтернативном варианте очистку IL-17A/F с меткой IgG (или Fc) можно провести, применяя известные методики хроматографии, включая, например, хроматографию в колонках Protein A или Protein G.

ПРИМЕР 8

Изготовление антител, которые связывают IL-17A/F

Этот пример иллюстрирует изготовление моноклональных антител, которые способны специфически связывать IL-17A/F.

Методики выработки моноклональных антител известны в данной области техники и описаны, например, в ссылке Goding, см. выше. Иммуногены, которые можно использовать, включают очищенные полипептиды IL-17A/F, гибридные белки, содержащие полипептиды IL-17A/F, и клетки, экспрессирующие рекомбинантные полипептиды IL-17A/F на клеточной поверхности. Компетентный специалист может провести выбор иммуногена без излишнего экспериментирования.

Мышей, например, линии BALB/c иммунизируют иммуногеном IL-17A/F, эмульгированным в полном адъюванте Фрейнда, вводя его подкожно или внутрибрюшинно в количестве от 1 до 100 микрограммов. В альтернативном варианте иммуноген эмульгируют в адъюванте MPL-TDM (Ribi Immunochemical Research, Гамильтон, штат Монтана) и вводят инъекцией в подушечки задних лап животных. Затем иммунизированным мышам (через 10-12 дней) делают бустерную инъекцию дополнительной дозой иммуногена, эмульгированного в выбранном адъюванте. Впоследствии в течение нескольких недель животным можно делать дополнительные бустерные иммунизирующие инъекции. Периодически от животных можно получать образцы сыворотки из ретроорбитальной крови для тестирования методом ELISA с целью выявления анти-IL-17A/F-антител.

После выявления приемлемого титра антител животным, "позитивным" по антителам, можно провести заключительную внутривенную инъекцию IL-17A/F. Через три-четыре дня после этого животных умерщвляют и собирают у них клетки селезенки. Затем клетки селезенки сливают (применяя 35% полиэтиленгликоль) с отобранной линией клеток мышиной миеломы, например с клетками P3X63AgU.1, доступными из ATCC (№ CRL 1597). Такое слияние порождает клетки гибридомы, которые затем можно высеять в 96-луночные планшеты для тканевой культуры, содержащие среду HAT (гипоксантин, аминоптерин и тимидин), для подавления пролиферации неслившихся клеток, гибридов миеломы и гибридов клеток селезенки.

Клетки гибридомы скринируют методом ELISA на реактивность против IL-17A/F. Определение "позитивных" клеток гибридомы, секретирующих нужные моноклональные антитела против IL-17A/F, находится в пределах компетенции опытного специалиста.

Позитивные клетки гибридомы можно вводить внутрибрюшинной инъекцией сингенным мышам линии BALB/c для получения асцита, содержащего моноклональные анти-IL-17A/F-антитела. В альтернативном варианте клетки гибридомы можно выращивать во флаконах для тканевой культуры или во вращающихся бутылках. Очистку моноклональных антител, выработанных в асците, можно осуществить, применяя осаждение сульфатом аммония с последующей вытеснительной хроматографией в геле. В альтернативном варианте можно использовать аффинную хроматографию, основанную на связывании антитела с белком A или с белком G.

ПРИМЕР 9

Очистка полипептидов IL-17A/F с применением специфических антител

Нативные или рекомбинантные полипептиды IL-17A/F можно очищать, применяя разнообразные стандартные методики, существующие в области очистки белков. Например, полипептид pro-IL-17A/F, зрелый полипептид IL-17A/F или полипептид pre-IL-17A/F очищают иммуноаффинной хроматографией, применяя антитела, специфичные для представляющего интерес полипептида IL-17A/F. В общем, иммуноаффинную колонку конструируют, ковалентно соединяя анти-IL-17A/F-антитело к полипептиду с активированной хроматографической смолой.

Поликлональные иммуноглобулины готовят из иммунных сывороток, либо осаждая их сульфатом аммония, либо очищая на иммобилизованном белке A (Pharmacia LKB Biotechnology, Пискатауэй, штат Нью-Джерси). Подобным образом моноклональные антитела готовят из мышиной асцитической жидкости, осаждая ее сульфатом аммония или проводя хроматографию на иммобилизованном белке A. Частично очищенный иммуноглобулин ковалентно присоединяют к хроматографической смоле, например, к CnBr-активированной SEPHAROSETM (Pharmacia LKB Biotechnology). Антитело соединяют со смолой, смолу блокируют, а производную смолу отмывают в соответствии с инструкциями производителя.

Такую иммуноаффинную колонку используют для очистки полипептида IL-17A/F, приготавливая фракцию из клеток, содержащих полипептид IL-17A/F в растворимой форме. Такой препарат готовят посредством солюбилизации целых клеток или субклеточной фракции, полученной при дифференциальном центрифугировании с добавлением детергента или другими способами, хорошо известными в данной области техники. В альтернативном варианте растворимый полипептид IL-17A/F, содержащий сигнальную последовательность, можно секретировать в нужном количестве в ту среду, в которой выращивают клетки.

Препарат, содержащий растворимый полипептид IL-17A/F, пропускают через иммуноаффинную колонку, а эту колонку промывают в условиях, обеспечивающих преимущественное поглощение полипептида IL-17A/F (например, с использованием буфера высокой ионной силы или в присутствии детергента). Затем колонку элюируют в условиях, способствующих разрыву связи антитела с полипептидом IL-17A/F (например, используя буфер с низким pH [приблизительно, pH 2-3] или высокую концентрацию хаотропа, такого как мочевина или ион тиоцианата), и собирают полипептид IL-17A/F.

ПРИМЕР 10

Скрининг лекарств

Это изобретение особенно полезно для скрининга соединений при использовании полипептидов IL-17A/F или их связывающих фрагментов в любой из множества методик скрининга лекарств. Полипептид IL-17A/F или его фрагмент, используемый в таком тестировании, может находиться или в свободном состоянии в растворе, или быть фиксированным к твердой опоре, находиться на поверхности клетки или располагаться внутри клетки. Способ скрининга лекарств использует эукариотические или прокариотические клетки-хозяева, которые стабильно трансформированы рекомбинантными нуклеиновыми кислотами, экспрессирующими полипептид IL-17A/F или его фрагмент. Лекарства скринируют на таких трансформированных клетках, применяя анализы на конкурентное связывание. Такие клетки можно использовать в стандартных анализах на связывание или в живой, или в фиксированной форме. Можно оценивать, например, образование комплексов между полипептидом IL-17A/F или его фрагментом и средством, подлежащим тестированию. В альтернативном варианте можно исследовать уменьшение комплексообразования между полипептидом IL-17A/F и его целевой клеткой или целевыми рецепторами, вызванное средством, подлежащим тестированию.

Таким образом, настоящее изобретение предлагает способы скрининга на выявление лекарств или любых других средств, которые могут повлиять на заболевание или расстройство, связанное с полипептидом IL-17A/F. Эти способы включают введение такого средства в контакт с полипептидом IL-17A/F или его фрагментом и анализ (i) на образование комплекса между испытуемым средством и полипептидом IL-17A/F или его фрагментом или (ii) на образование комплекса между полипептидом IL-17A/F или его фрагментом и клеткой способами, хорошо известными в данной области техники. В таких анализах на конкурентное связывание полипептид IL-17A/F или его фрагмент обычно связаны с меткой. После соответствующей инкубации свободный полипептид IL-17A/F или его фрагмент отделяют от аналогов, представленных в связанной форме, причем количество свободной или несвязанной метки является мерилом способности конкретного средства связываться с полипептидом IL-17A/F или препятствовать образованию комплекса полипептида IL-17A/F с клеткой.

Еще одна методика скрининга лекарств основана на высокопроизводительном скрининге, направленном на выявление соединений, обладающих высокой аффинностью связывания с полипептидом, и подробно описана в документе WO 84/03564, опубликованном 13 сентября 1984 г. Вкратце говоря, большое количество разных мелких пептидных тестируемых соединений синтезируют на твердом субстрате, например на пластмассовых штифтах или какой-либо иной поверхности. Применительно к полипептиду IL-17A/F тестируемые пептидные соединения реагируют с полипептидом IL-17A/F и отмываются. Связанный полипептид IL-17A/F определяют способами, хорошо известными в данной области техники. Очищенный полипептид IL-17A/F можно также нанести в виде покрытия на планшеты для применения в вышеупомянутых методиках скрининга лекарств. В дополнение к этому, можно применить не нейтрализующие антитела для захвата пептида и иммобилизации на твердой опоре.

Это изобретение также предполагает применение конкурентных анализов скрининга лекарств, в которых нейтрализующие антитела, способные связывать полипептид IL-17A/F, специфически конкурируют с испытуемым соединением за связывание с полипептидом IL-17A/F или его фрагментом. Таким образом, можно использовать антитела для выявления присутствия любого пептида, имеющего одну или более общих антигенных детерминант с полипептидом IL-17A/F.

ПРИМЕР 11

Конструирование рационального лекарства

Цель конструирования рационального лекарства заключается в получении структурных аналогов вызывающего интерес полипептида (то есть полипептида IL-17A/F) или мелких молекул, с которыми они взаимодействуют, например агонистов, антагонистов или ингибиторов. Любой из этих примеров можно использовать для того, чтобы смоделировать лекарства, представляющие собой более активные и стабильные формы полипептида IL-17A/F, или такие лекарства, которые способны усиливать или препятствовать проявлению функции полипептида IL-17A/F in vivo (c.f., Hodgson, Bio/Technology, 9: 19-21 (1991)).

В одном из подходов трехмерную структуру полипептида IL-17A/F или комплекса полипептида IL-17A/F с ингибитором определяют посредством рентгеноструктурной кристаллографии, компьютерного моделирования или, что более типично, комбинируя оба метода. Для того чтобы выяснить структуру и определить активный сайт (сайты) молекулы, необходимо оценить как форму, так и электрический заряд полипептида IL-17A/F. Несколько реже полезную информацию о структуре полипептида IL-17A/F можно получить посредством моделирования, основанного на структуре гомологичных белков. В обоих случаях имеющую отношение к делу структурную информацию используют для конструирования аналоговых молекул, подобных полипептиду IL-17A/F, или для идентификации эффективных ингибиторов. Полезные примеры конструкций рациональных лекарств могут включать молекулы, которые имеют улучшенную активность или стабильность, как это показано в ссылке Braxton and Wells, Biochemistry, 31:7796-7801 (1992), либо которые действуют как ингибиторы, агонисты или антагонисты природных пептидов, как это показано в ссылке Athauda et al., J. Biochem., 113:742-746 (1993).

Также возможно выделить целеспецифичное антитело, отобранное при помощи функционального анализа, как это описано выше, а затем выяснить его кристаллическую структуру. Такой подход, в принципе, дает фармацевтическую сердцевину, на которой можно основывать конструкции последующих лекарств. Возможно вообще обойти кристаллографию белка, генерируя антиидиотипические антитела (анти-id) к функциональному, фармакологически активному антителу. Можно ожидать, что сайт связывания анти-id как зеркальное отображение зеркального отображения будет аналогом исходного рецептора. Затем антитело типа анти-id можно использовать для идентификации и выделения пептидов из банков химически или биологически выработанных пептидов. Выделенные таким способом пептиды могут играть роль фармацевтической сердцевины.

На основании настоящего изобретения можно рассчитывать на получение достаточного количества полипептида IL-17A/F для проведения таких аналитических исследований, как рентгеноструктурная кристаллография. В дополнение к этому, знание представленной здесь аминокислотной последовательности полипептида IL-17A/F послужит руководством для специалистов, использующих методики компьютерного моделирования вместо рентгеноструктурной кристаллографии или в дополнение к ней.

ПРИМЕР 12

Модели заболеваний in Vivo

Эффекты комбинирования анти-IL-17A- и анти-IL-17F-антител в качестве терапевтического средства для лечения аутоиммунных заболеваний были оценены на мышиных моделях ревматоидного артрита и рассеянного склероза. Протестированные мышиные модели включали мышей, обработанных коллагеном II типа для вызова артрита, индуцированного коллагеном (CIA) (мышиная модель ревматоидного артрита (RA)), или обработанных миелиновым гликопротеином олигодендроцитов (MOG) для вызова экспериментального аллергического энцефаломиелита (EAE) (мышиная модель рассеянного склероза (MS)).

(1) CIA

Мышей линии DBA-1J семи-восьминедельного возраста (Jackson Lab, Бар-Харбор, штат Мэн) иммунизировали 100 мкг бычьего коллагена II типа в 100 мкл полного адъюванта Фрейнда (CFA) в 0-й день (Barck et al., Arthritis & Rheumatism, 50: 3377-3386 (2004)). Коллаген II типа в CFA вводили посредством внутрикожной инъекции (i.d.) в основание хвоста с правой стороны. В 21-й день 100 мкг бычьего коллагена II типа в 100 мкл неполного адъюванта Фрейнда вводили посредством внутрикожной инъекции с левой стороны хвоста. В 45-й день животных распределяли на следующие группы: (1) мышиный IgG2a-изотипический контроль mAb (MuIgG2a) 6 мг/кг в 100 мкл физиологического раствора подкожно (SC) 3 раза в неделю в течение 7 недель (n=40), (2) мышиный TNFRII-Fc (мышиный суррогат Enbrel) (MuTNFII-Fc) 4 мг/кг в 100 мкл физиологического раствора + метотрексат (MTX) 3 мг/кг в 100 мкл физиологического раствора SC 2 раза в неделю в течение 7 недель (n=40) и (3) химерные моноклональные антитела (mAbs) хомяка и мыши анти-IL-17A (MuAnti-IL17) и анти-IL-17F (MuAnti-IL-17F) 6 мг/кг в 100 мкл физиологического раствора SC три раза в неделю в течение семи недель (n=40).

Состояние животных оценивали в баллах два раза в неделю, начиная с 33-го дня, с применением стандартного способа балльной оценки артрита. Балльные оценки варьировались в диапазоне 0-4 на лапку (где 0 означает отсутствие заболевания, а 4 означает эритему и отек, распространяющиеся на всю лапку) при максимально возможной оценке 16 баллов на животное в целом. Животных в группах лечения 1-3 рандомизировали по весу тела и балльной оценке заболевания в 45-й день эксперимента. Три группы лечения были сбалансированы для поддержания равного числа мышей с легкой (средние балльные оценки 0-3, 22-23 мыши на группу лечения), средней (средние балльные оценки 4-8; 11-13 мышей на группу лечения) и тяжелой формой заболевания (средние балльные оценки 9 и выше, 4-6 мышей на группу лечения). Изображения суставов по методу микрокомпьютерной томографии (MicroCT) (Barck et al., Arthritis & Rheumatism, 50: 3377-3386 (2004)) были получены по окончании эксперимента (в 81-й день), и по ним был рассчитан объем кортикальной кости суставов (JCBV).

У мышей DBA-1J, обработанных коллагеном II типа для вызова артрита, индуцированного коллагеном (CIA), комбинация анти-IL-17A- и анти-IL-17F-антител (группа 3) привела к снижению конечной клинической балльной оценки на 81-й день по сравнению с конечной клинической балльной оценкой на 81-й день для мышей, получавших только контрольное лечение IgG2a (группа 1) (p=0,02 (критерий Даннета, Hsu, J.C., Multiple Comparisons Theory and Methods, Chapman and Hall (1996)). Далее у мышей DBA-1J, обработанных коллагеном II типа для вызова артрита, индуцированного коллагеном (CIA), лечение комбинацией анти-IL-17A- и анти-IL-17F-антител защищало животных от костных повреждений, что было оценено по большей величине объема кортикальной кости суставов (JCBV), ~4,5 в группе, получавшей лечение анти-IL-17A-антителами и IL-17F-антителами по сравнению с показателем JCBV ~3,7 у контрольных мышей, получавших лечение мышиным изотипом IgG2a mAb (p<0,001, критерий Даннета).

Способность комбинации антител IL-17A и IL-17F снижать конечную клиническую балльную оценку у мышей с CIA и блокировать костное повреждение у мышей с CIA позволяет предположить, что комбинация IL-17A и IL-17F может оказаться целевым объектом для лечения таких аутоиммунных заболеваний, как ревматоидный артрит.

В сходном эксперименте в исследование было дополнительно введено лечение только анти-IL17A-антителами, то есть добавлена четвертая группа. Результаты показаны на фигурах 19 и 20. В качестве контроля было использовано изотипически сходное антитело амброзии (ragweed-IgG2a) против человека (Genentech, Inc.), обозначенное на фигурах "ragweed". Клиническую балльную оценку для каждой лапки выводили, основываясь на следующих критериях:

0 = отсутствие эритемы и припухлости

1 = эритема и небольшая припухлость, ограниченные средней частью стопы (предплюсневой) или лодыжкой

2 = эритема и небольшая припухлость, распространяющиеся от лодыжки до средней части стопы

3 = эритема и умеренная припухлость, распространяющиеся от лодыжки до плюсневых суставов

4 = эритема и тяжелая припухлость, охватывающие лодыжку, стопу и пальцы

Средняя балльная оценка = сумма баллов по четырем лапкам.

Усредненная суточная клиническая балльная оценка = усреднение средних балльных оценок за день.

Конечная клиническая балльная оценка = средняя балльная оценка в последний день эксперимента.

Полученные данные показывают, что комбинация анти-IL17A- и анти-IL17F-антител более эффективна (на уровне статистической значимости), чем лечение только анти-IL17A-антителом.

(2) EAE

Четыре группы мышей (по 15 животных на группу) были индуцированы миелиновым гликопротеином олигодендроцитов (MOG), как это описано ниже, и, в дополнение к этому, экспериментальные группы после индукции пептидным антигеном MOG35-55 в CFA три раза в неделю получали следующие дозы антител: (1) (группа 1) контроль - мышиный изотип IgG2a mAb (анти-GP120-антитело), 6 мг/кг в 100 мкл физиологического раствора, посредством внутрибрюшинной инъекции (IP), (2) (группа 2) химерное антитело хомяка-мыши анти-IL-17A (MuAnti-IL17) mAb, 6 мг/кг в 100 мкл физиологического раствора, посредством IP, (3) (группа 3) химерное анти-IL-17F-антитело хомяка-мыши (MuAnti-IL-17F) mAb, 6 мг/кг в 100 мкл физиологического раствора, посредством IP, (4) (группа 4) химерное анти-IL-17A-антитело хомяка-мыши (MuAnti-IL17) mAb, 6 мг/кг в 100 мкл физиологического раствора, посредством IP, и химерное анти-IL-17F-антитело хомяка-мыши (MuAnti-IL-17F) mAb, 6 мг/кг в 100 мкл физиологического раствора, посредством IP.

За день до индукции MOG (минус 1-й день) дозы антител, как это описано выше, были введены в качестве первой дозы. В день индукции MOG (0-й день) мышей иммунизировали внутрикожно 200 мкл эмульсии, содержащей 200 мкг пептида MOG35-55 (Liu et al., Nat. Med., 4(1): 78-83 (1998); Suen et al., J. Exp. Med., 186(8): 1233-40 (1997)) в 100 мкл PBS и 100 мкл CFA, который был приготовлен посредством смешения неполного адъюванта Фрейнда (IFA) со штаммом M. tuberculosis H37A (убитым и обезвоженным) до концентрации M. tuberculosis в CFA 2 мг/мл (200 мкг M. tuberculosis на одну мышь). Далее мышам вводили 200 нг коклюшного токсина в 100 мкл PBS посредством IP инъекции.

Во 2-й день мышам дополнительно вводили 200 нг коклюшного токсина в 100 мкл PBS посредством IP инъекции.

Далее до конца исследования мышам вводили дозы антитела, как это описано выше, три раза в неделю.

Состояние мышей оценивали на клинические проявления заболевания, применяя балльный способ оценки рассеянного склероза (описанный ниже), по меньшей мере три раза в неделю, начиная с 1-го дня. Далее, состояние тех мышей, которые достигали 4-й степени заболевания, оценивали ежедневно (если животные с заболеванием 4-й степени не проявляли ослабления его тяжести до 3-й степени или менее в течение 5 дней, то их умерщвляли). Кроме того, в конце исследования оценивали содержание лимфоцитов в головном и спинном мозге животных. Способ балльной оценки рассеянного склероза позволял оценивать заболевание, основываясь на следующей системе градаций. (1) 0-я степень представлена здоровой мышью без явных признаков заболевания, (2) 1-я степень представлена поникшим хвостом (поникший хвост описывается как полная вялость хвоста и отсутствие скручивания на конце хвоста при подхватывании животного) или слабостью задних конечностей (слабость задних конечностей описывается как ватная походка, объективным признаком которой является проваливание задних лапок животного через ячейки проволочной клетки при ходьбе), но не обоими признаками, (3) 2-я степень представлена поникшим хвостом и слабостью задних конечностей, (4) 3-я степень представлена частичным параличом задних конечностей (частичный паралич задних конечностей описывается как неспособность мыши использовать задние конечности для сохранения седалищной позы или ходьбы, но при этом животное еще способно в некоторой степени вытягивать одну или обе конечности), (5) 4-я степень представлена полным параличом задних конечностей (полный паралич задних конечностей описывается как полная утрата движений задних конечностей, когда мышь способна перемещаться только на передних конечностях), и (6) 5-я степень представлена агональным состоянием и смертью от EAE (эвтаназия по гуманным соображениям).

У мышей с экспериментальным аллергическим энцефаломиелитом (EAE), индуцированным миелиновым гликопротеином олигодендроцитов (MOG), комбинация анти-IL-17A- и анти-IL-17F-антител (группа 4) приводила к снижению конечной клинической балльной оценки на 34-й день эксперимента по сравнению с конечной клинической балльной оценкой на 34-й день эксперимента у животных, получавших лечение препаратом gp120 (группа 1) (p<0,01 (критерий Даннета). Лечение только анти-IL-17A-антителом (группа 2) или только анти-IL-17F-антителом (группа 3) было не столь эффективно в снижении клинической балльной оценки, как применение анти-IL-17A- и анти-IL-17F-антител в комбинации. Результаты, полученные на моделях MOA и CIA, позволяют думать о том, что лечение таких аутоиммунных заболеваний, как ревматоидный артрит (RA) и рассеянный склероз (MS), может потребовать блокады обоих метаболических путей (IL-17A и IL-17F) в комбинации.

Способность комбинации антител IL-17A и IL-17F снижать конечную клиническую балльную оценку у мышей с EAE, индуцированным MOG, позволяет предположить, что комбинация IL-17A и IL-17F может оказаться целевым объектом для лечения таких аутоиммунных заболеваний, как рассеянный склероз. Комбинированное лечение, нацеленное на IL-17A и IL-17F, может включать двухспецифичные/перекрестно-реактивные антитела (антитела, распознающие идентичные или сходные эпитопы, представленные как на IL-17A, так и на IL-17F, что основано на гомологии последовательностей или на структурной гомологии, как это описано в примере 15), биспецифичные антитела (антитела, которые были сконструированы для распознавания как IL-17A, так и IL-17F, например одна ветвь антитела распознает IL-17A, а другая ветвь того же антитела распознает IL-17F, либо тяжелая цепь антитела распознает IL-17A, а легкая цепь того же антитела распознает IL-17F), а также антитела IL-17A+IL-17F, введенные в комбинации (два разных антитела, одно из которых распознает IL-17A, а другое распознает IL-17F).

ПРИМЕР 13

Активация T-клеток in vitro

Линию T-хелперных клеток ThIL-17, которая отличается от Th1 и Th2 (см. патентную заявку США № 10/697599, US 2004/0156849, зарегистрированную 29.10.03) и которая вырабатывает IL-17, стимулируют IL-23 (Hunter, et al., Nat. Rev. Immunol., 5:521-531 (2005); Holscher et al., Curr. Opin. Invest. Drugs, 6: 489-495 (2005)), а также другими цитокинами, такими как IL-6 и TNFβ (Veldhoen M et al., Immunity, 24:179-89 (2006)). Для того чтобы определить уровень выработки IL-17A и IL-17F в клетках ThIL-17, T-клетки активировали IL-6 и TGFβ, а уровень IL-17A и IL-17F определяли количественно посредством анализа PCR. Появляющиеся данные о клетках ThIL-17 позволяют предположить, что эта субпопуляция T-клеток способна индуцировать тканевое воспаление и аутоиммунитет, то есть играет важную роль в аутоиммунных заболеваниях (Bettelli et al., Nat Immunol 8:345-350 (2007)).

Необученные T-клетки CD4+CD62L+CD25-CD44hi, очищенные при помощи FACS (чистота >99%), представляющие собой популяцию необученных CD4+ T-клеток, были инкубированы в течение 48 часов на планшете, покрытом αCD3 (анти-CD3-антителом). В раствор, распределенный на группы, добавляли цитокины (включая IL-6, IL-27 и TGFβ) и αCD28 (анти-CD28-антитело), действуя следующим образом: (1) никаких цитокинов, (2) IL-6, (3) IL-27, (4) IL-6+IL-27, (5) IL-6+TGFβ, (6) IL-6+TGFβ+IL-27. Экспрессию IL-23R, IL-17A и IL-17F определяли количественным анализом PCR и нормализовали по отношению к rpl19. Кратность индукции рассчитывали посредством нормализации экспрессии по отношению к экспрессии в клетках, очищенных при помощи FACS перед стимуляцией.

Активация T-клеток in vitro под воздействием IL-6 и TGFβ приводила к увеличению выработки IL-17A (~18000-кратная индукция) и IL-17F (~300000-кратная индукция) (группа 5) по сравнению с активацией без обработки (группа 1), применением только IL-6 (группа 2), только IL-27 (группа 3), IL-6+IL-27 (группа 4) и IL-6+TGFβ+IL-27 (группа 6) (фигура 13).

Результаты, свидетельствующие о том, что IL-6 и TGF-β индуцируют выработку как IL-17A, так и IL-17F, в сочетании с результатами in vivo из примера 12 позволяют предположить, что эффективное лечение аутоиммунных заболеваний, таких как ревматоидный артрит и рассеянный склероз, посредством блокирования функции клеток ThIL-17 может включать ингибирование как IL-17A, так и IL-17F. Комбинированное лечение, нацеленное на IL-17A и IL-17F, может включать двухспецифичные/перекрестно-реактивные антитела (антитела, распознающие идентичные или сходные эпитопы, представленные как на IL-17A, так и на IL-17F, что основано на гомологии последовательностей или на структурной гомологии, как это описано в примере 15), биспецифичные антитела (антитела, которые были сконструированы для распознавания как IL-17A, так и IL-17F, например одна ветвь антитела распознает IL-17A, а другая ветвь того же антитела распознает IL-17F, либо тяжелая цепь антитела распознает IL-17A, а легкая цепь того же антитела распознает IL-17F), а также антитела IL-17A+IL-17F, введенные в комбинации (два разных антитела, одно из которых распознает IL-17A, а другое распознает IL-17F).

ПРИМЕР 14

Идентификация взаимодействий рецепторов и лигандов - обзор скринирующего анализа полипептидов PRO на идентификацию взаимодействий рецепторов и лигандов

В этом анализе различные полипептиды PRO исследуют на способность связываться с набором молекул потенциального рецептора или лиганда с целью идентификации взаимодействий рецепторов и лигандов. Идентификация лиганда для известного рецептора, рецептора для известного лиганда или новой пары рецептор-лиганд полезна во многих случаях, включая, например, нацеливание биоактивных молекул (сцепленных с лигандом или рецептором) на клетку, заведомо экспрессирующую рецептор или лиганд, применение рецептора или лиганда в качестве реактива для выявления присутствия лиганда или рецептора в композиции, где подозревается их содержание, причем такая композиция может включать клетки, подозреваемые на экспрессию лиганда или рецептора, модулирование роста либо другой биологической или иммунологической активности клеток, заведомо экспрессирующих рецептор (лиганд) или реагирующих на них, модулирование иммунного ответа клеток или на клетки, которые экспрессируют рецептор или лиганд, создание возможностей для изготовления агонистов, антагонистов и/или антител, направленных против рецептора или лиганда, которые способны модулировать рост или биологическую или иммунологическую активность клеток, экспрессирующих рецептор или лиганд, а также различные другие показания, которые будут вполне очевидны среднему специалисту.

В общем, анализ проводят следующим образом. Полипептид PRO, предлагаемый настоящим изобретением, подозреваемый на наличие рецептора или лиганда, экспрессируется как гибридный белок, содержащий домен Fc IgG человека (иммуноадгезин). Связывание рецептора с лигандом выявляют по реализации возможности взаимодействия полипептида-иммуноадгезина с клетками (например, клетками Cos), экспрессирующими рецепторы-кандидаты для полипептида PRO, и по визуализации связанного иммуноадгезина с флуоресцентными реактивами, направленными на гибридный домен Fc при микроскопическом исследовании. Клетки, экспрессирующие рецепторы-кандидаты, вырабатывают посредством кратковременной трансфекции (параллельной) определенных подгрупп из библиотеки векторов экспрессии кДНК, кодирующей полипептиды PRO, которые могут функционировать как рецепторные молекулы. Затем клетки инкубируют в течение 1 часа в присутствии иммуноадгезина полипептида PRO, проходящего тестирование на возможное связывание с рецептором. Затем клетки отмывают и фиксируют параформальдегидом. Затем клетки инкубируют с флуоресцентно-конъюгированным антителом, направленным против участка Fc иммуноадгезина полипептида PRO (например, с козьим анти-человеческим-Fc-антителом, конъюгированным с FITC). Затем клетки еще раз отмывают и исследуют под микроскопом. О положительном взаимодействии судят по наличию флуоресцентной метки в клетках, которые были трансфицированы кДНК, кодирующей определенный рецептор для полипептида PRO либо пул рецепторов, а также по отсутствию аналогичной флуоресцентной метки в клетках, приготовленных подобным образом, которые были трансфицированы другой кДНК или пулом кДНК. Если определенный пул векторов экспрессии кДНК считают позитивным в отношении взаимодействия с иммуноадгезином полипептида PRO, то индивидуальные виды кДНК, которые содержат этот пул, тестируют по отдельности (пул "разбивают"), чтобы определить специфическую кДНК, которая кодирует рецептор, способный взаимодействовать с иммуноадгезином полипептида PRO.

Еще в одном варианте осуществления этого анализа меченному эпитопом потенциальному лиганду полипептида PRO (например, с меткой из 8 гистидинов "His") дают возможность взаимодействовать с набором потенциальных рецепторных молекул к полипептиду PRO, которые были экспрессированы как гибриды с доменом Fc IgG человека (иммуноадгезины). После 1-часовой совместной инкубации с меченным полипептидом PRO эпитопом каждый рецептор-кандидат осаждают методом иммунопреципитации с бисером protein A, после чего бисер отмывают. Потенциальное взаимодействие лиганда определяют анализом по методу вестерн-блоттинга иммуноосажденных комплексов с антителом, нацеленным на эпитопную метку. О взаимодействии судят по наблюдению в анализе вестерн-блоттинга с рецептором-кандидатом полосы ожидаемого молекулярного веса, относящейся к белку, меченному эпитопом, при отсутствии такой полосы при исследовании других членов из набора потенциальных рецепторов.

Применение описанных выше анализов позволило идентифицировать следующие взаимодействия рецепторов и лигандов:

(1) PRO1031 (обозначенный здесь как лиганд IL-17B человека) связывается с PRO5801 (обозначенным здесь как рецептор IL-17RH1 человека).

(2) PRO10272 (обозначенный здесь как лиганд IL-17E человека) связывается с PRO5801 (обозначенным здесь как рецептор IL-17RH1 человека).

(3) PRO20110 (обозначенный здесь как лиганд IL-17F человека) связывается с рецептором IL-17 человека (IL-17R) [(Yao et al., Cytokine, 9(11):794-800 (1997); также обозначен здесь как PRO1] и с PRO20040 (обозначенным здесь как рецептор IL-17RH2 человека).

(4) PRO1031 (лиганд IL-17B) и PRO1122 (лиганд IL-17C) не связываются с рецептором IL-17 человека (Li et al., Proc.Natl. Acad. Sci. (USA), 97(2):773-778 (2000)).

ПРИМЕР 15

Связывание рецептора IL-17F, определение структуры IL-17F

A. Способы

(1) Измерения связывания

Кинетику и аффинность связывания IL-17, IL-17E (PRO10272) или IL-17F (PRO20110) с IL-17R или IL-17RH1 (PRO5801) определяли посредством измерений SPR на инструменте Pharmacia BIAcore 1000 (Phamacia Biosensor, Пискатауэй, штат Нью-Джерси). Лиганд или рецептор иммобилизовали на проточной кювете сенсорного чипа CM5 посредством случайного сопряжения с аминогруппами, N-гидроксисукцинимидной химии на основе протоколов, разработанных производителем. Для IL-17R, IL-17RH1 и IL-17F был получен уровень иммобилизации приблизительно 500 резонансных единиц (RU), тогда как уровни иммобилизации IL-17 и IL-17E составили 1200 и 1500 RU соответственно. Для связывания IL-17R с иммобилизованным IL-17 был получен сильный сигнал. Однако, если иммобилизован был IL-17R, для связывания IL-17 был получен лишь слабый сигнал, а это позволяло предположить, что иммобилизация рецептора инактивирует сайт связывания. После блокирования непрореагировавших сайтов этаноламином измерения связывания проводили на скорости потока 25 мкл/мин. Сенсограммы были получены для серий из шести удвоенных растворов белков с серийными разведениями. Была использована максимальная концентрация 1000 или 500 нм белка, а растворы готовили в подвижном буфере (PBS с содержанием 0,05% Tween-20). Поверхность сенсорного чипа восстанавливали между циклами связывания посредством инъекции аликвотной пробы 25 мкл 0,1 M уксусной кислоты, 0,2 M NaCl, pH 3 для элюирования нековалентно связанного белка. Сенсограммы оценивали в соответствии с моделью связывания 1:1 на основе нелинейного регрессионного анализа с использованием программного обеспечения, предоставленного производителем. В независимых экспериментах по измерению конкуренции между вариантами IL-17 за связывание с рецептором фиксированную концентрацию рецептора инкубировали с разными концентрациями белка IL-17 при последующей инъекции этой смеси в проточную кювету с иммобилизованным белком IL-17. Количество связанного рецептора определяли по резонансному сигналу, полученному после завершения фазы ассоциации.

(2) Кристаллография

IL-17F кристаллизовался в виде шестиугольных пластинок в висячих каплях над раствором в лунках, содержавшим 1,0 M сульфата лития, 0,5 M сульфата аммония, 1% этанола и 100 мМ цитрата натрия, pH 5,6, при 19°C. Кристаллы собирали в искусственный маточный раствор, соответствующий раствору в лунках, но без этанола. Перед сбором данных кристаллы погружали в искусственный маточный раствор с 20% глицерина и быстро охлаждали в жидком азоте. Первичные данные собирали на вращающемся анодном генераторе собственной разработки с излучением CuKα, а пространственная группа была охарактеризована как P61 или P6 5 с двумя димерами в асимметричном блоке. Для фазирования кристаллы были дериватизированы посредством отмачивания в течение 6 часов в искусственном маточном растворе с добавлением 2 мМ тимерсола. Набор собственных данных и данные эксперимента с тремя длинами волн Hg MAD (многоволновой аномальной дифракции) собирали на линии пучка 9-2 в Стэнфордской лаборатории синхротронного излучения. Наборы данных были обработаны с применением программ пакета HKL (Otwinowski, Z., and Minor, W., Methods Enzymol. 176:307-326 (1997)). Определение структуры было проведено с применением пакета программ CCP4 (CCP4, Acta Cryst. D50 :760-763 (1994)). Карты Паттерсона указывали на наличие нескольких упорядоченных атомов Hg, расположение которых было определено при помощи программы Rantan. Уточнение фазы было проведено при помощи программы MLPHARE. Исследование DM-модифицированных карт показало, что пространственная группа представляла собой P65, и выявило операторы некристаллографической симметрии (NCS). Каждый промотор связывал одиночный тимеросал в эквивалентном NCS-зависимом сайте.

Начальная структура была встроена в четырехкратную экспериментальную карту, усредненную по NCS и уплощенную растворителем, после чего была детализирована при помощи программ REFMAC_4.0 (CCP4, Acta Cryst. D50 :760-763 (1994)) and Brünger, A. T. (1992), X-PLOR Manual, Version 3.1 (New Haven, Connecticut: Yale University) в модификации Molecular Simulations, Inc. Рефлексии, выделенные для расчета свободной R-величины, были выбраны в программных оболочках с тонкой разрешающей способностью. При позиционной детализации, имитации отжига и уточнении изотропного температурного фактора были использованы целевая функция максимального правдоподобия, общая анизотропная коррекция и коррекция массы раствора в вещественном пространстве. Начальная детализация была проведена по набору удаленных данных 2,65 Δ, но беспорядок вблизи сайтов Hg оказался трудным для модели, поэтому заключительная детализация была выполнена по набору собственных данных 2,85 Δ с применением того же набора свободных R-рефлексий. В конечной модели четыре производных остатка из вектора, остатки с 1 до 8 и остатки 128-133 разупорядочены в промоторах A, B и X, тогда как остатки 1-6 и 130-133 разупорядочены в промоторе Y. В димере XY внутренняя петля (остатки X20-X23 и Y20-Y25) разупорядочена, та же самая петля плохо упорядочена в мономерах AB. График Рамачандрана (Ramachandran) показывает, что 90% всех не-глициновых и не-пролиновых остатков находятся в наиболее благоприятных участках, 9,2% в дополнительных разрешенных участках, 0,7% (3 остатка) в обильно разрешенных участках, но нет никаких остатков в запрещенных участках. Сбор данных и статистика детализации представлены в таблице 8. Координаты для IL-17F были депонированы в банке данных по белкам (Protein Data Bank), но код доступа еще не задан. Для расчетов доступной площади поверхности были использованы программы areaimol и resarea (CCP4, Acta Cryst. D50 :760-763 (1994)). Программы Molscript (Kraulis, P. J., J. Appl. Cryst. 103:1345-1352 (1999)), Raster3D (Merrit, E. A., and Murphy, M. E. P., Acta Cryst. D50 :869-873 (1994)), Insight97 (MSI) и Grasp (Nichols et al., Proteins 11:281-296 (1991)) были использованы для анализа и для отображения структур на фигурах 15, 17 и 18.

(B) Результаты и обсуждение

(1) Рецепторное связывание

Поверхностный плазмон-резонанс (SPR) был использован для определения того, связывается ли IL-17F (PRO20110) с внеклеточными доменами (ECD) любого из двух рецепторов IL-17R (обозначенного PRO1) и IL-17RH1 (PRO5801), заведомо связывающихся с белками IL-17. Однако не наблюдалось связывания ни IL-17R, ни IL-17RH1 (до 1 и 0,5 мкМ соответственно) с иммобилизованным IL-17F. В отличие от этого IL-17R связывался с иммобилизованным IL-17 на уровне умеренной аффинности связывания (см. таблицу 8 ниже), что согласуется с предыдущими сообщениями об аффинности этого взаимодействия (Yao et al., Cytokine 9:794-800 (1997)). Сходным образом IL-17RH1 продемонстрировал высокую аффинность связывания с IL-17E (таблица 7), что согласуется с наблюдаемой мощностью индукции выброса IL-8 из клеток (Lee et al., J. Biol. Chem. 276:1660-1664 (2001)). Кроме того, как и ожидалось, не наблюдали связывания между IL-17RH1 и IL-17, а также между IL-17E и IL-17R (Shi et al., J. Biol. Chem. 275:19167-19176 (2000); Lee et al., J. Biol. Chem. 276:1660-1664 (2001)).

Для того чтобы проверить, не является ли утрата связывания IL-17R или IL-17RH1 с IL-17F результатом активации, связанной с иммобилизацией, связывание IL-17F с рецептором было протестировано в экспериментах с конкуренцией. В этих экспериментах фиксированную концентрацию IL-17R (500 нМ) или IL-17RH1 (31 нМ) инкубировали с варьирующейся концентрацией лиганда, а затем впрыскивали над поверхностью IL-17 или IL-17E. Несмотря на то что IL-17 мог эффективно блокировать связывание IL-17R с иммобилизованным IL-17, не наблюдалось конкуренции с 2 мкМ IL-17F. Кроме того, 1,3 мкМ IL-17F не мог блокировать связывание IL-17RH1 с иммобилизованным IL-17E, хотя связывание полностью подавлялось растворимым IL-17E. Эти результаты указывают на то, что IL-17F не связывается на уровне высокой аффинности с очищенным мономерным ECD, либо IL-17R, либо IL-17RH1. Как показано в ПРИМЕРЕ 14 (фигура 14), было установлено, что лиганд IL-17F связывается с новым рецептором IL-17RH2 (PRO20040).

Хотя установлено, что IL-17F имеет активность, связанную с активностью IL-17, IL-17F не связывается с IL-17R на уровне высокой аффинности in vitro. Однако можно обнаружить усиленное связывание IL-17F с клетками Cos, трансфицированными IL-17R (не показано), а это позволяет предположить, что IL-17F, возможно, способен использовать IL-17R, но только в комбинации с дополнительными, пока не идентифицированными компонентами, образуя высокоаффинный сигнальный комплекс. Похожий механизм был постулирован для IL-17, чтобы объяснить расхождение между аффинностью рецептора и мощностью его биологической активности (Yao et al., Cytokine 9:794-800 (1997)). Представленные здесь результаты позволяют думать о том, что независимо от вовлеченного рецептора (рецепторов) сигналы IL-17F приводят к такой активности на нижерасположенном уровне, которая сходна со стимуляцией IL-17R посредством IL-17.

Таблица 8
Кинетика и аффинность рецепторного связывания с иммобилизованными IL-17 и IL-17E
Иммобилизованный белок Лиганд Kon × 10-5 Koff × 104 Kp
(M-1 с-1) -1) (нМ)
IL-17 IL-17R 0,093 6,7 72
IL-17E IL-17RH1 6,7 7,0 1,1
IL-17RH1 IL-17E 4,3 6,2 1,4

(2) Определение структуры IL-17F

Структуру IL-17F человека выясняли способами многоволновой аномальной дифракции Hg и уточняли по Rfree и Rcryst 28,8% и 23,3% соответственно при разрешении 2,85 Δ (см. таблицу 9 ниже). Стержень промотора IL-17F состоит из двух пар антипараллельных β-нитей: одна пара включает нить 1 (остатки 52-59) и нить 2 (остатки 66-73 и 77-79), а другая пара включает нить 3 (остатки 89-103) и нить 4 (остатки 110-125). Нить 2 прерывается коротким отрезком неправильной β-структуры. Нити 2 и 4 соединены двумя дисульфидными мостиками (Cys 72/Cys 122 и Cys 77/Cys 124). Третий дисульфид (Cys 17/Cys 107) соединяет петлю между нитями 3 и 4 одного промотора с N-концевым удлинением прилежащего промотора, формируя обширные димерные контакты (как обсуждается ниже). Это N-концевое удлинение также содержит β-нить (нить 0, остатки 25-32), которая соединена водородом с нитью 3' на другом промоторе и с маленькой α-спиралью (остатки 43-48). На уровне Asn 53 наблюдалась добавочная электронная плотность, согласующаяся с ожидаемым гликозилированием этого остатка по результатам анализа последовательности и определения параметров очищенного белка.

Эта структура показывает, что IL-17F является дальним гомологом семейства белков цистинового узла (McDonald, N. Q., and Hendrickson, W. A., Cell 73:421-424 (1993)), получившего свое название по необычной стыкуемости цистина (фигура 15). Цистиновый узел характеризуется двумя наборами парных β-нитей (нити 1 и 2, а также нити 3 и 4), которые соединены дисульфидными связями между нитями 2 и 4 (фигура 15A, вставка). Третий дисульфидный мостик проходит через этот макроцикл, соединяя нити 1 и 3. В отличие от этого IL-17F содержит только две из трех отличительных цистиновых связи, которыми и обусловлено название этого семейства. В молекуле IL-17F дисульфидные связи Cys 72/Cys 122 и Cys 77/Cys 124 формируют макроцикл типичного цистинового узла. Третий дисульфид, который мог бы сформировать "узел", проходя через этот макроцикл, отсутствует, а вместо этого остатки 50 и 89, которые расположены в том же трехмерном пространстве, что и третий дисульфид в белках с цистиновым узлом, представлены в молекуле IL-17F серинами. Наряду с тем, что Ser 50 находится в той же конформации, что и соответствующий цистеин в узловом белке, Ser 89 организован иначе. Заслуживает внимания, что серины в этих положениях законсервированы во всех членах семейства IL-17 (см. фигуру 16) несмотря на тот факт, что структура предполагает возможную аккомодацию третьего дисульфида.

Таблица 9
Кристаллографическая статистика
Сбор данных и фазирование MAD
Естественный Пик Hg Перегиб Hg Удаленный Hg
Пространственная группа P65
Константы одиночной ячейки (Δ) a=126,4, b=89,9 a=126,8, b=90,0
Длина волны (Δ) 0,979 1,0067 1,0087 1,127
Разрешение (Δ) 2,85 2,8 2,8 2,65
I/Isig 7,7 11,4 11,2 9,1
Полнота (%) 100 (100) 98,9 (91,3) 98,8 (90,2) 99,9 (99,9)
Rsymb 8,8 (54,1) 5,8 (34,4) 5,9 (35,9) 6,4 (43,1)
Измеренные отраженияс 141778 228788 228553 266735
Уникальные отраженияс 19294 40450 40459 46851
Мощность фазирования центрическаяd - 1,4 1,6 1,3
Мощность фазирования ацентрическаяd - 4,3 3,2 4,3
Rcullis ацентрическийd - 0,76 0,7 0,8
Детализация
Resolution (Δ) 30-2,85
# Отражений 19246
Re 0,233
Rfree 0,288
# атомов белков 3716
# атомов углеводов 84
3 воды 21
Rmsd связи (Δ) 0,12
Rmsd связанные Bs 4,5
Rmsd углы (°) 1,7
a Цифры в скобках относятся к оболочке максимального разрешения
b Rsym = 3*I-<I*/1I.<I> - средняя интенсивность связанных с симметрией наблюдений уникального отражения.
C Отражения Bijvoet учитываются отдельно в статистике Hg
d Статистические показатели фазирования даны для отражений с F>2σ
e R=3*Fo-Fc*/3Fo

(3) Димеризация

IL-17F димеризуется параллельным образом, подобно фактору роста нервов (NGF) и другим нейтрофинам (McDonald et al., Nature 354:411-414 (1991)). Однако поверхность раздела димера необычно велика, закрывая в целом 6800 Δ2 (или ~3400 Δ2 на мономер) по сравнению с 3400 Δ2 в целом (~1700 Δ2 на мономер) для NGF (код PDB - 1WWW; Weismann et al., Nature 401:184-188 (1999)). Примерно одна треть поверхности раздела формируется посредством взаимодействий между 3-й и 4-й нитями мономера с теми же нитями другого мономера, подобно поверхности раздела димера, наблюдаемой у нейтрофилов. Уникальной особенностью IL-17F является огромное количество площади поверхности, закрытое взаимодействиями, вовлекающими N-концевое удлинение (остатки 8-48) каждого промотора, тянущееся поперек канонической границы раздела димера и уложенное напротив разных частей другого промотора.

Общую каркасную структуру димера IL-17F можно образно представить в виде предмета одежды (женской), в котором листки 1/2 и 1'/2' образуют рукава, дисульфиды цистинового узла вычерчивают воротник, а листки 3/4 и 3'/4' наряду с N-концевым удлинением формируют корсаж, который заканчивается двумя трехнитевыми листками (включая нити 4/3/0' и 0/3'/4'), образующими юбку внизу (фигура 15B, размеры dimensions 65 Δ × 25 Δ × 30 Δ). Впечатляющим признаком на поверхности молекулы является необыкновенно большая полость (18 Δ × 10 Δ × 10 Δ в глубину), расположенная на поверхности раздела димера и, по существу дела, соответствующая карману в одежде. Основание полости формируется остатками в нитях 3 и 3' (Gln 95, Glu 96, Thr 97 и Leu 98 из обеих цепей), а также 4 и 4' (Lys 115', Val 118 и Val 120'). Остатки в N-концевой линии выстилают одну сторону полости (остатки Arg 37, Val 38, Met 40), тогда как другую сторону полости выстилают остатки из нити 1 (Tyr 54), нити 2 (Val 68, Glu 66) и из изгиба между этими нитями (Tyr 63 и Pro 64). Пептидная связь между Tyr 63 и Pro 64 находится в необычной цис-конформации. Поскольку этот пролин законсервирован во всех последовательностях IL-17 и всегда ассоциирован с большим гидрофобным остатком (см. фигуру 16), маловероятно, чтобы эта пептидная связь находилась в цис-конформации во всех членах семейства IL-17. Ртутьсодержащее соединение, тимеросал, которое было использовано для фазирования структуры, образует связь на нижнем конце этой полости (в ориентации, показанной на фигуре 17), занимая 30% пространства.

Обсуждавшиеся выше структурные признаки демонстрируют, что гомолог IL-17 (IL-17F) является членом суперсемейства белков цистинового узла и димеризуется сходным образом с членами подсемейства NGF. Белки IL-17 имеют пренебрежимо малое сходство последовательности с другими членами суперсемейства. Например, основанное на структуре выравнивание последовательности IL-17F с NGF отражает идентичность только по десяти остаткам, включая четыре цистеина, законсервированных в мотиве цистинового узла (не показано). Ограниченная консервация типична для суперсемейства белков цистинового узла (McDonald, N. Q., and Hendrickson, W. A., Cell 73:421-424 (1993)).

По структуре IL-17F можно сделать обобщенный вывод о других членах семейства IL-17. Изгиб цистинового узла, включая расположение β-листков и дисульфидную связь макроцикла, должен быть сохранен во всех гомологах IL-17 (фигура 16). В частности, IL-17 настолько похож на IL-17F, имея почти 50% идентичность последовательности, что можно предсказать, в каких участках молекулы IL-17 и IL-17F будут иметь общие признаки на поверхности, а в каких участках они будут различаться. Фигура 17 показывает молекулярную поверхность IL-17F, окрашенную в соответствии с идентичностью последовательности с IL-17. Единственные законсервированные участки на поверхности IL-17F находятся на плоской грани каждого промотора (фигура 17B) и в области, расположенной "выше" полости (фигура 17A). Законсервированная область на грани промотора может представлять консервативные признаки, необходимые либо для поддержания структуры, либо для потенциального распознавания обычных партнеров связывания. Таким образом, можно ожидать, что большая полость на поверхности IL-17F также будет представлена в структуре IL-17, но может состоять как из консервативных, так и из вариабельных остатков.

В противоположность этому последовательности IL-17B, IL-17C и IL-17E значительно отличаются от IL-17F и IL-17, особенно по числу и расположению вспомогательных цистиновых связей, а также по длине и последовательности N-концевого удлинения. Несмотря на это расхождение можно сделать несколько предсказаний о дисульфидной связности и о том влиянии, которое она будет оказывать на N-концевое удлинение у других членов семейства. Например, IL-17B секретируется как нековалентный димер как клетками CHO, так и клетками насекомых (Shi et al., J. Biol. Chem. 275:19167-19176 (2000)), указывая на то, что все восемь цистеиновых остатков спарены в пределах одной цепи димера (данные не показаны). Один из двух добавочных цистеинов в молекуле IL-17B (Cys 103) расположен между двумя цистеинами в нити 2, которые участвуют в макроцикле, в то время как второй добавочный цистеин, в свою очередь, расположен между нитями 3 и 4 (фигура 16 и фигура 15). Основываясь на том допущении, что изгиб цистинового узла законсервирован во всех гомологах IL-17, логично предположить, что добавочный цистеин (Cys 103) в нити 2 IL-17B будет расположен слишком далеко, чтобы вступить в связь с любым из цистеинов в петле нитей 3/4. Следовательно, Cys 103 в молекуле IL-17B должен образовывать дисульфидную связь с Cys 64 в N-концевом удлинении, предоставляя возможность двум цистеинам в петле нитей 3/4 связываться друг с другом. Для того чтобы эти взаимодействия действительно могли осуществиться, N-концевое удлинение в молекуле IL-17B должно находиться совершенно в другой конформации, чем в IL-17F. Данный вывод вполне обоснован, поскольку последовательность в этой части структуры не консервативна в пределах семейства, образует очень небольшую регулярную вторичную структуру и уложена, главным образом, по периферии молекулы. Основываясь на этом анализе, можно ожидать, что IL-17C и IL-17E, которые обладают добавочным цистеином в нити 2, возможно, также имеют N-концевые отделы в существенно иных конформациях, чем IL-17F и IL-17. Этот анализ позволяет подразделить семейство на два класса, основываясь на характере дисульфидных связей N-концевых отделов.

Впечатляющим признаком структуры IL-17F является необыкновенно большая полость, образованная остатками на поверхности раздела димера (фигура 18), что наводит на мысль о регионе, который способен связывать еще одну молекулу. Полость (две на димер) состоит из комбинации остатков, которые или строго законсервированы, или всегда обладают сходным химическим характером (Tyr 54, Tyr 63, Pro 64, Val 120), а также других остатков, которые крайне вариабельны среди членов семейства IL-17 (Arg 37, Val 38, Met 40, Ala 95), создавая потенциал для проявления специфичности в межмолекулярных взаимодействиях. Полость не имеет резко выраженного свойства электростатической поверхности - вместо этого она образована комбинацией гидрофобных, полярных и заряженных остатков (см. фигуры 17A и 18A). Основываясь на анализе последовательности, можно ожидать существование аналогичной полости у других членов семейства IL-17, однако, учитывая, вероятно, иную конформацию N-концевого удлинения, специфические характеристики полости у белков IL-17B, IL-17C и IL-17E могут существенно отличаться.

NGF связывает свой высокоаффинный рецептор, TrkA, в положении, аналогичном расположению полостей в IL-17F. Фигура 18B и фигура 18C показывают IL-17F и NGF в той же ориентации, которая высвечивает расположение полостей и сайты связывания TrkA (предположительно, используемые всеми комплексами нейтрофин/Trk: Weismann et al., Nature 401:184-188 (1999)). Известные структуры нейтрофиновых гомодимеров (NGF, NT3, NT4) также имеют выемку на своей поверхности в этом положении, но она имеет намного меньшие размеры и более умеренна, чем полость в IL-17F (McDonald et al., Nature 354:411-414 (1991)); Butte et al., Biochemistry 37:16846-16852 (1998); Robinson et al., Protein Sci. 8:2589-2597 (1999)). Членами семейства Trk являются рецепторные тирозинкиназы, которые взаимодействуют с нейтрофинами через их проксимальный мембранный внеклеточный Ig-подобный домен. Хотя не следует ожидать, что структура IL-17R или IL-17RH1 содержит Ig-подобный изгиб, белки IL-17 и нейтрофины, по-видимому, используют сходные участки на своей поверхности для связывания с соответствующими рецепторами.

Нейтрофины не только связывают специфические рецепторы Trk, но также способны одновременно связывать p75NTR, второй рецептор, общий для всех нейтрофинов. p75NTR связывает свои нейтрофиновые лиганды через богатый цистином внеклеточный домен, который, как ожидается, напоминает структуры рецептора 1 фактора опухолевого некроза (TNFR1) или рецептора смерти 5 (Banner et al., Cell 73:431-445 (1993); Hymowitz et al., Mol. Cell 4:563-571 (1999); Mongkolsapaya et al., Nat. Struc. Biol. 6:1048-1053 (1999)). Модель взаимодействия NGF:p75NTR была предложена на основе данных мутагенеза (Weismann, C., and de Vos, A. M., Cell. Mol. Life Sci. 58:1-12 (2001)) и предполагает, что петли на любом из двух концов димера лиганда, а также на плоской поверхности каждого промотора взаимодействуют с p75NTR. Последовательности IL-17R и IL-17RH1 не похожи на p75NTR и, по-видимому, неспособны принимать TNFR1-подобный изгиб. Однако, принимая во внимание сходство в изгибах IL-17 и нейтрофина, разумно рассмотреть возможность наличия второго рецепторного компонента в IL-17s, аналогичного системе нейтрофина.

Кроме того, было также высказано предположение о том, что белковая структура späztle воспринимает нейтрофиновый изгиб (Mizuguchi et al., TIBS 23:239-242 (1998)), а также было продемонстрировано генетически (хотя не в экспериментах по прямому связыванию), что она является рецептором для рецептора Toll у дрозофилы (Morisato et al., Cell 76:677-688 (1994)). Поскольку IL-17 передает сигнал через NF-κB в метаболическом пути, сходном с таковым, используемым рецепторами IL-1 и Toll, которые имеют общий изгиб для внутриклеточного домена, хотя их внеклеточные домены существенно различаются, резонно ожидать, что или внутриклеточные, или внеклеточные домены рецепторов IL-17, включая другие, еще не известные компоненты сигнального комплекса, могут структурно напоминать части этих рецепторов. Однако независимо от структуры рецептора способ взаимодействия между лигандами IL-17 и рецепторами с наибольшей вероятностью затрагивает глубокие полости, расположенные на сторонах структуры димера IL-17.

1. Способ лечения иммуноопосредованного заболевания у нуждающегося в этом млекопитающего, предусматривающий введение млекопитающему терапевтически эффективного количества одного или более антагонистов, способных ингибировать как IL-17A (SEQ ID NO:3), так и IL-17F (SEQ ID NO:4) в полипептиде IL-17A/F.

2. Способ по п.1, в котором млекопитающим является человек.

3. Способ лечения иммуноопосредованного заболевания у нуждающегося в этом млекопитающего, предусматривающий введение млекопитающему терапевтически эффективного количества антагониста IL-17A и антагониста IL-17F.

4. Способ по п.3, в котором указанный антагонист IL-17A представляет собой антитело, которое специфически связывается с IL-17A (SEQ ID NO:3) или с его фрагментом.

5. Способ по п.3, в котором указанный антагонист IL-17F представляет собой антитело, которое специфически связывается с IL-17F (SEQ ID NO:4) или с его фрагментом.

6. Способ по п.3, в котором указанный антагонист IL-17A представляет собой антитело, которое специфически связывается с IL-17A (SEQ ID NO:3) или с его фрагментом, а указанный антагонист IL-17F представляет собой антитело, которое специфически связывается с IL-17F (SEQ ID NO:4) или с его фрагментом.

7. Способ по п.2, в котором указанный антагонист представляет собой антитело, специфически связывающееся как с IL-17A (SEQ ID NO:3), так и с IL-17F (SEQ ID NO:4) в полипептиде IL-17A/F или в его фрагменте.

8. Способ по п.7, в котором указанное антитело представляет собой перекрестно реагирующее антитело, которое распознает идентичные или сходные эпитопы, представленные как в IL-17A (SEQ ID NO:3), так и в IL-17F (SEQ ID NO:4).

9. Способ по п.7, в котором указанное антитело представляет собой биспецифическое антитело, имеющее специфичность в отношении как IL-17 А, так и IL-17F или их фрагментов.

10. Способ по любому из пп.3-9, в котором указанное антитело представляет собой моноклональное антитело или его фрагмент.

11. Способ по п.10, в котором указанное моноклональное антитело или фрагмент антитела являются химерными, гуманизированными или человеческими.

12. Способ по п.11, в котором иммуноопосредованное заболевание представляет собой системную красную волчанку, ревматоидный артрит, остеоартрит, ювенильный хронический артрит, спондилоартропатию, системную склеродермию, идиопатическую воспалительную миопатию, синдром Шегрена, системный васкулит, саркоидоз, аутоиммунную гемолитическую анемию, аутоиммунную тромбоцитопению, тиреоидит, сахарный диабет, иммуноопосредованное почечное заболевание, демиелинизирующее заболевание центральной или периферической нервной системы, идиопатическую демиелинизирующую полинейропатию, синдром Гийена-Барре, хроническую воспалительную демиелинизирующую полинейропатию, гепатобилиарное заболевание, инфекционный или аутоиммунный хронический активный гепатит, первичный билиарный цирроз, гранулематозный гепатит, склерозирующий холангит, воспалительное заболевание кишечника, целиакию, болезнь Уипла, аутоиммунное или иммуноопосредованное кожное заболевание, буллезное кожное заболевание, экссудативную многоформную эритему, контактный дерматит, псориаз, аллергическое заболевание, астму, аллергический ринит, атопический дерматит, пищевую аллергию, крапивницу, иммунологическое заболевание легких, эозинофильную пневмонию, идиопатический легочный фиброз, гиперчувствительный пневмонит, заболевание, ассоциированное с трансплантацией, отторжение трансплантата или болезнь "трансплантат против хозяина".

13. Способ по п.12, в котором указанное иммуноопосредованное заболевание представляет собой рассеянный склероз (MS) или ревматоидный артрит (RA).

14. Способ лечения иммуноопосредованного заболевания у нуждающегося в этом млекопитающего, который заключается в одновременном нацеливании на IL-17A и IL-17F у указанного млекопитающего, причем указанный способ заключается во введении указанному млекопитающему терапевтически эффективного количества перекрестно реагирующего антитела или фрагмента указанного антитела, а указанное антитело распознает идентичные или сходные эпитопы как на IL-17A, полипептиде, имеющем аминокислотную последовательность SEQ ID NO:3, так и на IL-17F, полипептиде, имеющем аминокислотную последовательность SEQ ID NO:4.

15. Способ по п.14, в котором иммуноопосредованное заболевание представляет собой системную красную волчанку, ревматоидный артрит, остеоартрит, ювенильный хронический артрит, спондилоартропатию, системную склеродермию, идиопатическую воспалительную миопатию, синдром Шегрена, системный васкулит, саркоидоз, аутоиммунную гемолитическую анемию, аутоиммунную тромбоцитопению, тиреоидит, сахарный диабет, иммуноопосредованное почечное заболевание, демиелинизирующее заболевание центральной и периферической нервной системы, идиопатическую демиелинизирующую полинейропатию, синдром Гийена-Барре, хроническую воспалительную демиелинизирующую полинейропатию, гепатобилиарное заболевание, инфекционный или аутоиммунный хронический активный гепатит, первичный билиарный цирроз, гранулематозный гепатит, склерозирующий холангит, воспалительное заболевание кишечника, целиакию, болезнь Уипла, аутоиммунное или иммуноопосредованное кожное заболевание, буллезное кожное заболевание, экссудативную многоформную эритему, контактный дерматит, псориаз, аллергическое заболевание, астму, аллергический ринит, атопический дерматит, пищевую аллергию, крапивницу, иммунологическое заболевание легких, эозинофильную пневмонию, идиопатический легочный фиброз, гиперчувствительный пневмонит, заболевание, связанное с трансплантацией, отторжение трансплантата или болезнь "трансплантат против хозяина".

16. Способ по п.15, в котором иммуноопосредованное заболевание представляет собой рассеянный склероз (MS) или ревматоидный артрит (RA).

17. Способ лечения иммуноопосредованного заболевания у нуждающегося в этом млекопитающего, заключающийся в одновременном нацеливании на IL-17A и IL-17F у указанного млекопитающего, причем указанный способ заключается во введении указанному млекопитающему терапевтически эффективного количества биспецифического антитела, где указанное антитело состоит из двух плечей, одно из которых специфически распознает IL-17A, а другое специфически распознает IL-17F.

18. Способ по п.17, в котором иммуноопосредованное заболевание представляет собой системную красную волчанку, ревматоидный артрит, остеоартрит, ювенильный хронический артрит, спондилоартропатию, системную склеродермию, идиопатическую воспалительную миопатию, синдром Шегрена, системный васкулит, саркоидоз, аутоиммунную гемолитическую анемию, аутоиммунную тромбоцитопению, тиреоидит, сахарный диабет, иммуноопосредованное почечное заболевание, демиелинизирующее заболевание центральной и периферической нервной системы, идиопатическую демиелинизирующую полинейропатию, синдром Гийена-Барре, хроническую воспалительную демиелинизирующую полинейропатию, гепатобилиарное заболевание, инфекционный или аутоиммунный хронический активный гепатит, первичный билиарный цирроз, гранулематозный гепатит, склерозирующий холангит, воспалительное заболевание кишечника, целиакию, болезнь Уипла, аутоиммунное или иммуноопосредованное кожное заболевание, буллезное кожное заболевание, экссудативную многоформную эритему, контактный дерматит, псориаз, аллергическое заболевание, астму, аллергический ринит, атопический дерматит, пищевую аллергию, крапивницу, иммунологическое заболевание легких, эозинофильную пневмонию, идиопатический легочный фиброз, гиперчувствительный пневмонит, заболевание, связанное с трансплантацией, отторжение трансплантата или болезнь "трансплантат против хозяина".

19. Способ по п.18, в котором иммуноопосредованное заболевание представляет собой рассеянный склероз (MS) или ревматоидный артрит (RA).

20. Способ лечения иммуноопосредованного заболевания у нуждающегося в этом млекопитающего, заключающийся в одновременном нацеливании на IL-17A и IL-17F у указанного млекопитающего, причем указанный способ предусматривает введение указанному млекопитающему терапевтически эффективного количества биспецифического антитела, при этом указанное антитело состоит из тяжелой цепи, которая распознает IL-17 А, и легкой цепи, которая распознает IL-17F.

21. Способ по п.20, в котором иммуноопосредованное заболевание представляет собой системную красную волчанку, ревматоидный артрит, остеоартрит, ювенильный хронический артрит, спондилоартропатию, системную склеродермию, идиопатическую воспалительную миопатию, синдром Шегрена, системный васкулит, саркоидоз, аутоиммунную гемолитическую анемию, аутоиммунную тромбоцитопению, тиреоидит, сахарный диабет, иммуноопосредованное почечное заболевание, демиелинизирующее заболевание центральной и периферической нервной системы, идиопатическую демиелинизирующую полинейропатию, синдром Гийена-Барре, хроническую воспалительную демиелинизирующую полинейропатию, гепатобилиарное заболевание, инфекционный или аутоиммунный хронический активный гепатит, первичный билиарный цирроз, гранулематозный гепатит, склерозирующий холангит, воспалительное заболевание кишечника, целиакию, болезнь Уипла, аутоиммунное или иммуноопосредованное кожное заболевание, буллезное кожное заболевание, экссудативную многоформную эритему, контактный дерматит, псориаз, аллергическое заболевание, астму, аллергический ринит, атопический дерматит, пищевую аллергию, крапивницу, иммунологическое заболевание легких, эозинофильную пневмонию, идиопатический легочный фиброз, гиперчувствительный пневмонит, заболевание, связанное с трансплантацией, отторжение трансплантата или болезнь "трансплантат против хозяина".

22. Способ по п.21, в котором иммуноопосредованное заболевание представляет собой рассеянный склероз (MS) или ревматоидный артрит (RA).

23. Способ лечения иммуноопосредованного заболевания у нуждающегося в этом млекопитающего, заключающийся в одновременном нацеливании на IL-17A и IL-17F у указанного млекопитающего, причем указанный способ предусматривает введение указанному млекопитающему терапевтически эффективного количества биспецифического антитела, при этом указанное антитело состоит из тяжелой цепи, которая распознает IL-17F, и легкой цепи, которая распознает IL-17A.

24. Способ по п.23, в котором иммуноопосредованное заболевание представляет собой системную красную волчанку, ревматоидный артрит, остеоартрит, ювенильный хронический артрит, спондилоартропатию, системную склеродермию, идиопатическую воспалительную миопатию, синдром Шегрена, системный васкулит, саркоидоз, аутоиммунную гемолитическую анемию, аутоиммунную тромбоцитопению, тиреоидит, сахарный диабет, иммуноопосредованное почечное заболевание, демиелинизирующее заболевание центральной и периферической нервной системы, идиопатическую демиелинизирующую полинейропатию, синдром Гийена-Барре, хроническую воспалительную демиелинизирующую полинейропатию, гепатобилиарное заболевание, инфекционный или аутоиммунный хронический активный гепатит, первичный билиарный цирроз, гранулематозный гепатит, склерозирующий холангит, воспалительное заболевание кишечника, целиакию, болезнь Уипла, аутоиммунное или иммуноопосредованное кожное заболевание, буллезное кожное заболевание, экссудативную многоформную эритему, контактный дерматит, псориаз, аллергическое заболевание, астму, аллергический ринит, атопический дерматит, пищевую аллергию, крапивницу, иммунологическое заболевание легких, эозинофильную пневмонию, идиопатический легочный фиброз, гиперчувствительный пневмонит, заболевание, связанное с трансплантацией, отторжение трансплантата или болезнь "трансплантат против хозяина".

25. Способ по п.24, в котором иммуноопосредованное заболевание представляет собой рассеянный склероз (MS) или ревматоидный артрит (RA).



 

Похожие патенты:

Изобретение относится к фармацевтической композиции для локального введения на поверхность барьера эпителиальной ткани, содержащей scFv-антитела, которые специфически связывают выбранные антигены и могут быть получены способом, предусматривающим (i) отбор из пула растворимых и стабильных каркасов антител растворимого и стабильного каркаса, соответствующего наилучшим образом каркасу антитела не человека против антигена с определенной связывающей специфичностью, (ii) либо обеспечение указанного растворимого и стабильного каркаса CDR, которые связываются специфически с указанным антигеном, либо мутирование этого каркаса указанного антитела не человека в направлении последовательности указанного растворимого и стабильного каркаса, для генерирования scFv-антител, (iii) тестирование генерированного антитела на растворимость и стабильность, и тестирование генерированного антитела на связывание антигена, и (iv) отбор scFv-антитела, которое является стабильным, растворимым и специфически связывается с этим антигеном.

Изобретение относится к биотехнологии и представляет собой антитела, которые специфически связываются с IL-13. .

Изобретение относится к биотехнологии и представляет собой антитела, которые избирательно нейтрализуют биоактивность по крайней мере двух подтипов белка интерферона-альфа ("IFN ") в отношении подтипов белка А, 2, В2, С, F, G, H2, I, J1, К, 4а, 4b и WA, и не нейтрализуют по крайней мере одну биоактивность белка IFN подтипа D.

Изобретение относится к биотехнологии и представляет собой антитела, которые специфически связывают сайт II онкостатина М человека (hOSM) и ингибируют взаимодействие между hOSM и gp130.

Изобретение относится к области медицины и касается гуманизированного антитела против остеопонтина человека. .

Изобретение относится к иммунологии и биотехнологии. .

Изобретение относится к биотехнологии и представляет собой фармацевтическую композицию для лечения эпителиальной опухоли у человека, где указанная фармацевтическая композиция содержит биспецифическое одноцепочечное антитело, обладающее первым связывающим доменом, специфически связывающимся с CD3 человека, и вторым связывающим доменом, специфически связывающимся с СЕА человека.

Изобретение относится к биотехнологии и представляет собой IL-17-связывающее антитело или его активный фрагмент. .

Изобретение относится к области биотехнологии, конкретно к модификациям молекулы IL-7, и может быть использовано в медицине. .

Изобретение относится к новым вариантам пептидов ИЛ-21, где аминокислоты делегированы и/или заменены в области, состоящей из аминокислот 83-96, а также их применению для изготовления лекарственного средства для лечения рака.

Изобретение относится к области молекулярной фармакологии, в частности к пептиду, являющемуся частью последовательности интерлейкина-15 (IL-15), который может ингибировать биологическую активность указанной молекулы.

Изобретение относится к области биотехнологии, конкретно к получению модифицированного антагониста рецептора мутеина IL-4 (IL-4RA), и может быть использовано для лечения заболеваний дыхательных путей, таких как астма, эмфизема или хронический бронхит.

Изобретение относится к области биотехнологии, в частности к генной инженерии, и может быть использовано в медикобиологической промышленности для получения активных препаратов интерлейкина-29 (IL-29).

Изобретение относится к биотехнологии. .
Изобретение относится к биохимии, конкретнее к биологически активным пептидам, обладающим стресспротекторной активностью, которые могут найти применение в медицине и фармакологии.

Изобретение относится к области биотехнологии, конкретно к получению новых пептидов, и может быть использовано в лечении и профилактике цитокинзависимых нарушений.

Изобретение относится к биологии, медицине и раскрывает повышение экспрессии кардиотрофина (СТ-1) в процессе регенерации печени, которая совпадает с максимальной пролиферацией гепатоцитов.

Изобретение относится к области биотехнологии, конкретно к модификациям молекулы IL-7, и может быть использовано в медицине. .
Наверх