Соединения, связывающиеся с bir доменом iap



Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap
Соединения, связывающиеся с bir доменом iap

 


Владельцы патента RU 2446170:

ЭГЕРА ТЕРАПЬЮТИКС ИНК. (CA)

В настоящем изобретении раскрываются соединения Формулы I и содержащие их фармацевтические композиции, предназначенные для модуляции функции IAP посредством предотвращения связывания BIR-связывающего белка с BIR доменом IAP и для лечения пролиферативных заболеваний, таких как рак. Также раскрывается соединение Формулы I, меченное детектируемой меткой или аффинной меткой, которое может использоваться в качестве зонда для идентификации соединений, которые связываются с BIR доменом IAP. 12 н. и 21 з.п. ф-лы, 4 табл., 1 пр.

 

Настоящее изобретение относится к связанным мостиковой связью соединениям, которые связываются с BIR доменами IAP и которые являются полезными для лечения пролиферативных расстройств и расстройств с нарушенной регуляцией апоптоза, таких как рак.

Апоптоз, или программированная клеточная гибель, типично возникает при нормальном развитии и сохранении здоровых тканей в многоклеточных организмах. Это сложный процесс, который приводит к удалению поврежденных, заболевших клеток или клеток с чрезмерным развитием в отсутствие признаков воспаления или некроза.

Известно, что в организме дерегуляция характерных для апоптоза путей происходит, в частности, при раке и лимфопролиферативных синдромах, а также при аутоиммунных расстройствах, таких как рассеянный склероз, при нейродегенеративных заболеваниях и воспалении. Также были описаны изменения в апоптическом ответе хозяина в процессе развития или сохранения вирусных и бактериальных инфекций.

Каспазы представляют собой семейство протеолитических ферментов из класса цистеинпротеаз, которые, как известно, инициируют и осуществляют апоптоз. В нормальных клетках каспазы присутствуют в качестве неактивных зимогенов, которые каталитически активируются после внешних сигналов, например сигналов от управляемой лигандом активации рецептора апоптоза (Death Receptor), таких как цитокины или иммунологические агенты, или путем высвобождения митохондриальных факторов, таких как цитохром C, после генотоксического, хемотоксического или индуцированного радиацией повреждения клеток. Ингибиторы белков апоптоза (IAPs) составляют семейство белков, которые способны к связыванию с каспазами и их ингибированию, таким образом подавляя клеточный апоптоз. Из-за их центральной роли в регуляции каспазной активности IAP способны ингибировать программированную клеточную гибель в результате действия различных пусковых механизмов, которые включают потерю гомеостатических или эндогенных механизмов контроля клеточного роста, а также химиотерапевтические лекарственные средства и облучение.

IAP содержат от одного до трех гомологичных структурных доменов, известных как повторные домены бакуловирусных IAP (BIR). Они также могут содержать домен “цинкового пальца” RING-типа на C-конце с возможностью индукции убихитинилирования IAP-связывающих молекул через его E3 лигазную функцию. Человеческие IAP, XIAP, HIAP1 (также обозначаемые как (cIAP2)) и HIAP2 (cIAP1), каждый, содержат три BIR домена и “цинковый палец” RING-типа по карбокси-концу. Другой IAP, NAIP, содержит три BIR домена (BIR1, BIR2 и BIR3), но RING домен отсутствует, в то время как Livin, TsIAP и MLIAP содержат один BIR домен и RING домен. X хромосомасвязанный ингибитор апоптоза (XIAP) является примером IAP, который может ингибировать каспазу-инициатор, известную как каспаза-9, и эффекторные каспазы, Каспазу-3 и Каспазу-7, путем непосредственного связывания. XIAP также может индуцировать удаление каспазы через убихитинилирование - опосредованный протеасомный путь через E3 лигазную активность домена “цинкового пальца” RING-типа. Кроме того, BIR3 домен XIAP связывается с каспазой-9 и ингибирует ее. Линкер-BIR2 домен XIAP ингибирует активность каспазы-3 и каспазы-7. BIR домены также связывают с взаимодействиями IAPs с фактором, ассоциированным с рецептором к фактору некроза опухоли (TRAFs)-1 и -2, и с TAB1, в качестве адапторных белков, осуществляющих передачу сигнала выживания через активацию NFkB. Таким образом, IAP выполняют функции непосредственного тормоза каскада апоптоза, предотвращая действие или ингибируя активные каспазы и перенаправляя клеточную передачу сигнала в режим провыживания. Развитие исследований рака привело к новой парадигме в биологии рака, где неоплазию можно рассматривать как неспособность раковых клеток к осуществлению нормальных путей апоптоза. Нормальные клетки принимают постоянную обратную связь от их окружения через различные внутриклеточные и внеклеточные факторы и "совершают самоубийство", будучи извлеченными из этого контекста. Такая индукция апоптоза достигается путем активации каспазного каскада. Однако раковые клетки приобретают способность преодолевать или обходить такую регуляцию апоптоза и продолжают аномальную пролиферацию. Большинство методов лечения рака индуцируют, по меньшей мере, частичный апоптический ответ в раковых мишеневых клетках, приводя к ремиссии или инициации регрессии опухоли. Однако во многих случаях оставшиеся клетки, которые являются резистентными к апоптозу, способны к невосприятию терапии с продолжением процесса онкогенного/генетического изменения, приводя к возникновению высоко лекарственно-резистентного метастатического заболевания, которое противостоит возможности эффективного лечения заболевания. Более того, большинство методов лечения рака, включая радиационную терапию и традиционную химиотерапию для индукции апоптоза в раковых клетках, вызывают дополнительное повреждение клеток из-за отсутствия специфичности индукции апоптоза исключительно в раковых клетках. Необходимость улучшения специфичности/активности проапоптических средств, используемых для лечения рака, а также и других пролиферативных расстройств, является важной, поскольку это дает преимущества снижения побочных эффектов, связанных с введением таких средств. Поэтому выявление новых средств для индукции апоптоза в раковых клетках является чрезвычайно желательным в медицине, и решение этой проблемы открывает возможность абсолютно новых методов лечения рака.

Растущий объем данных показывает, что раковые клетки могут избегать апоптоза путем замедленной сверхэкспрессии одного или нескольких членов семейства белков IAP, как это документально подтверждено во многих образцах биопсии первичной опухоли, а также в большинстве установленных раковых клеточных линий. Эпидемиологические исследования продемонстрировали, что сверхэкспрессия различных IAP ассоциируется с плохим клиническим прогнозом и выживанием. Для XIAP это показано в таких разных типах рака, как лейкоз и рак яичников. Сверхэкспрессия HIAP1 и HIAP2, являющаяся результатом частой хромосомной амплификации области 11q21-q23, которая заключает в себе оба белка, наблюдалась в различных злокачественных опухолях, включая медуллобластомы, почечно-клеточные карциномы, глиобластомы и желудочные карциномы. Негативно-регуляторные молекулы (X)IAP, такие как XAF, оказались супрессорами опухоли, которые очень часто утрачиваются при клиническом раке. Так, благодаря их способности к подавлению активации и действия истинных медиаторов апоптоза, каспаз, IAP могут непосредственно способствовать развитию опухоли и резистентности к фармацевтическому вмешательству. Индукция апоптоза в раковых клетках при использовании активных малых молекул, которые связываются со специфическими доменами IAP, является объектом настоящего изобретения.

Авторы настоящего изобретения и др. продемонстрировали критическую важность отдельных BIR доменов для влияния на антиапоптическую функцию IAPs. Было сделано предположение, что антагонисты IAPs, которые могут связываться с отдельными BIR доменами, могут разрушать антиапоптическую функцию IAPs. Действительно, отдельные BIR служат в качестве критических сайтов связывания для N-концевых Ser-Gly-Val-Asp, Ser-Gly-Pro-lle и Ala-Thr-Pro-lle остатков Каспаз 3, 7, и 9 соответственно, и такое связывание является крайне необходимым для функци IAP по ингибированию каспаз. Связывание N-концевых AxPy тетра-пептидных остатков с XIAP приводит к высвобождению активных каспаз 3, 7 и 9. В случае других IAP, таких как C-IAP1 и C-IAP2, функции BIR, когда они связаны с лигандом, по-видимому, заключаются в том, чтобы направить активацию убихитинлигазной RING функции IAPs на связанную мишень, или сами отдельные IAP, вызывая протеосомальные потери. В любом случае малые молекулы-антагонисты IAP должны быть отличными проапоптическими средствами с потенциальным их применением для лечения рака, различных пролиферативных расстройств и воспаления.

Митохондральный белок млекопитающих, а именно Второй Митохондральный Активатор Каспазы (SMAC), который антагонизирует функцию IAP, связывается преимущественно с BIR 3 или 2 сайтами в соответствующих IAPs через AxPy амино-концевой тетрапептид. Четыре индуцирующих гибель белка дрозофилы, Reaper, HID, Grim и Sickle, которые атагонизируют способность IAPs дрозофилы ингибировать каспазы, также связываются с BIR доменами аналогичных IAPs дрозофилы через короткий AxPy амино-концевой тетрапептид, последовательность, которая вставляется в BIR-связывающий “карман” и прерывает IAP-каспазные взаимодействия.

Общая топология отдельных BIR доменов является высококонсервативной среди IAPs человека и среди отдельных BIR доменов человеческих IAPs, при этом каждый BIR представляет собой полипептидный домен типа “цинкового пальца”, замыкаемый в координированный Zn атом тремя цистеинами и гистидиновым остатком. Рентгеноструктурный анализ XIAP BIR2 и BIR3 показал критический связывающий “карман” для AxPy мотива на поверхности каждого BIR домена. Есть изменения во вставочных аминокислотных последовательностях, которые образуют связывающий “карман” и углубление в обоих BIR2 и BIR3. Подобным образом, авторами настоящего изобретения были описаны гомологичные домены в BIRs других IAP, cIAP1 и cIAP2. Это открывает возможность получения различных классов природных и синтетических связывающих соединений, которые будут обладать разной специфичностью и сродством связывания в отношении каждого из BIR доменов для каждого из IAP. Различение пути, по которому такие соединения будут влиять на биологическую функцию IAPs в раковых клетках по сравнению с нормальными клетками, является главной новой задачей в открытии новых механизмов и средств лечения рака и других пролиферативных расстройств, где наблюдается нарушенная регуляция функции IAP. Авторы настоящего изобретения обнаружили, что некоторые классы BIR-связывающих соединений могут связываться с BIR-доменами IAP с неожиданной селективностью и активностью, приводя к явным терапевтическим преимуществам для некоторых структурных классов, что потенциально происходит либо в результате утраты функции IAP, либо утраты клеточного IAP белка, либо и того, и другого.

Был описан ряд пептидных AxPy-подобных и гетероциклических модифицированных AxPy пептидных соединений, которые активируют клеточную каспазу 3 путем согласно сообщаемым сведениям связывания с XIAP BIR3. Последние обзоры см. в Elmore et al., Annual Reports in Medicinal Chemistry, 40 (2006) 245-262; Sun et al., Bioorg. Med. Chem. Let. 15 (2005) 793-797; Oost et al., J. Med. Chem., 2004, 47(18), 4417-4426; Park et al., Bioorg. Med. Chem. Lett. 15 (2005) 771-775; Franklin et al., Biochemistry, Vol. 42, №27, 2003, 8223-8231; Kip et al., Biochemistry 2002, 41, 7344-7349; Wu et al., Chemistry и Biology, Vol., 759-767 (2003); Glover et al., Analytical Biochemistry, 320 (2003) 157-169; Опубликованной патентной заявке США № 20020177557; Опубликованной патентной заявке США № 20040180828; Опубликованной патентной заявке США № US2006/0025347A1; Опубликованной патентной заявке США № US2005/0197403A1; и Опубликованной патентной заявке США № US2006/0194741 A1.

Было показано, что указанные выше соединения прицельно действуют на выделенный BIR3 домен XIAP через замещение флуоресцентно-меченного зонда, и оказалось, что они индуцируют апоптическое событие в определенном ряде раковых клеточных линий с активностью в низких микромолярных-наномолярных пределах. Эти соединения показали низкую in-vivo активность, вероятно, из-за ограниченной биодоступности, и поэтому они могут иметь ограниченное терапевтическое применение.

Таким образом, BIR домены IAP представляют привлекательную мишень для открытия и разработки новых терапевтических средств, особенно для лечения пролиферативных расстройств, таких как рак.

Краткое описание изобретения

Авторами настоящего изобретения ранее был раскрыт ряд соединений, которые связываются с BIR звеньями IAPs и индуцируют апоптоз в различных раковых клеточных линиях (опубликованная патентная заявка США № 20060264379). В настоящей заявке раскрывается, что связывание двух связывающихся с BIR единиц с предпочтением в отношении сайта, ориентации и химической природы связи обеспечивает новые и обладающие явным преимуществом классы соединений с 1000-кратным увеличением активности против различных раковых клеточных линий по сравнению с соответствующими BIR-связывающими соединениями, которые не связаны мостиковой связью. Эти соединения демонстрируют необходимую активность, стабильность и фармацевтические свойства для лечения различных типов рака человека. Преимущество дает то, что химическую природу мостиковой группы можно выбирать, чтобы вызвать трансляцию высокой внутренней клеточной активности до уровня активности микрограмм/кг при ингибировании и/или супрессии IAPs в опухолевых образцах. Более того, описанные соединения обладают фармацевтически приемлемой стабильностью в целом ряде тканей и жидкостей млекопитающих и обладают фармацевтическими свойствами, которые обеспечивают адекватную растворимость и биодоступность при использовании различных путей введения, подходящих для клинического использования. Такое введение обеспечивает устойчивый in vivo эффект у млекопитающих, как было измерено в нормальных и опухолевых тканях.

В одном варинте воплощения настоящего изобретения обеспечивается изомер, энантиомер, диастереоизомер или таутомер соединения, представленного Формулой I:

где:

n имеет значение 0 или 1;

m имеет значение 0, 1 или 2;

Y представляет собой NH, O или S;

W представляет собой

или

где X представляет собой C1-C3 алкил, который образует часть кольцевой системы, где указанная кольцевая система является необязательно замещенной одним или несколькими заместителями R11; или X является частью 5-, 6- или 7-членной гетероциклической кольцевой системы, необязательно включающей один, два или три гетероатома, выбранных из O, N или S, где указанная кольцевая система является необязательно замещенной одним или несколькими R11; или X представляет собой -C(O)-; и G представляет собой 5-, 6- или 7-членную кольцевую систему, необязательно включающую один или несколько гетероатомов, выбранных из O, N или S, где указанная кольцевая система является необязательно замещенной одним или несколькими R11; и

W1 представляет собой

или

где R300, R400, R500, R500a, X1, G1 имеют значения, определенные для R3, R4, R5, X и G соответственно; или

W и W1 независимо выбран из или ,

где R3, R4 имеют значения, определенные для R300, R400 соответственно;

B представляет собой

Q и Q1 независимо выбраны из

1) -CH2-,

2) -CH2CH2-,

3) -CH(C1-C6 алкил)-,

4) -CH(C3-C7 циклоалкил)-,

5) -C3-C7 циклоалкил-,

6) -CH(C1-C6 алкил-C3-C7 циклоалкил)-; или

7) -C(O) -;

A и A1 независимо выбраны из

1) NR6 или

2) NR600;

BG представляет собой

1) -Y1-L-Y100-; или

2) -L-; или

BG представляет собой -Y1-L1-Z-L100-Y100-, где L1 и L100 имеют одинаковые значения или L1 и L100 являются отличными друг от друга;

Y1 и Y100 независимо выбраны из

1) -C(O)-,

2) -S(O)2- или

3) -C(O)N(R8)-;

L, L1 и L100 выбраны из групп:

1) -C1-C12 алкил-,

2) -C2-C12 алкенил-,

3) -C2-C12 алкинил-,

4) -C3-C7 циклоалкил-,

5) -C3-C7 циклоалкенил-,

5) -арил-,

6) -бифенил-,

7) -гетероарил-,

8) -гетероциклил-,

9) -C1-C6 алкил-(C2-C6 алкенил)-C1-C6 алкил-,

10) -C1-C6 алкил-(C2-C4 алкинил)-C1-C6 алкил,

11) -C1-C6 алкил-(C3-C7 циклоалкил)-C1-C6 алкил,

12) -C1-C6 алкил-арил-C1-C6 алкил,

13) -C1-C6 алкил-бифенил-C1-C6 алкил,

14) -C1-C6 алкил-гетероарил-C1-C6 алкил,

15) -C1-C6 алкил-гетероциклил-C1-C6 алкил или

16) -C1-C6 алкил-O-C1-C6 алкил; или

L, L1 и L100 выбраны из групп:

1) - N(R8)C(O)N(R8)- или

2) -C1-C6 алкил-Z-C1-C6 алкил-;

где алкил, алкенил, алкинил, циклоалкиенил и циклоалкил необязательно замещены одним или несколькими заместителями R7; и арил, гетероарил, бифенил и гетероциклил необязательно замещены одним или несколькими заместителями R11;

Z выбран из групп:

1) -N(R8)CON(R8)-,

2) -N(R8)C(O)-арил-C(O)N(R8)-,

3) -N(R8)C(O)-гетероарил-C(O)N(R8)-,

4) -C(O)-,

5) -S(O)2-,

6) -N(R8)C(O)-,

7) -C(O)N(R8)-,

8) -OC(O)N(R8)-,

9) -S(O)2N(R8)-,

10) -N(R8)-C1-C12-алкил-N(R8)-,

11) -N(R8)-C(O)C(O)-N(R8)-,

12) -N(R8)-C(O)-C1-C12-алкил-C(O)-N(R8)-,

13) -N(R8)-C(O)-арил-C(O)-N(R8)-,

14) -N(R8)-C(O)-арил-O-арил-C(O)-N(R8)-,

15) -N(R8)-C(О)-гетероарил-C(О)-N(R8)-,

16) -N(R8)-C(O)-бифенил-C(O)-N(R8)-,

17) -N(R8)-S(O)2-C1-C12-алкил-S(O)2-N(R8)-,

18) -N(R8)-S(O)2-арил-S(O)2-N(R8)-,

19) -N(R8)-S(O)2-гетероарил-S(O)2-N(R8)-,

20) -N(R8)-S(O)2-бифенил-S(O)2-N(R8)-,

21) -N(R8)-C1-C12-алкил-N(R8)-,

22) -N(R8)-арил-N(R8)-,

23) -N(R8)-гетероарил-N(R8)- или

24) -N(R8)-бифенил-N(R8)-;

где алкил и циклоалкил необязательно замещены одним или несколькими заместителями R7, и арил, гетероарил и гетероциклил необязательно замещены одним или несколькими заместителями R11;

R1 и R100 независимо выбраны из

1) H или

2) C1-C6 алкила, необязательно замещенного одним или несколькими заместителями R7;

R2, R3, R4, R5, R5a, R200, R300, R400, R500 и R500а, каждый независимо, представляют собой H или C1-C6 алкил, необязательно замещенный одним или несколькими заместителями R7;

R6 и R600, каждый независимо, представляют собой

1) H,

2) галогеналкил,

3) ←C1-C6 алкил,

4) ←C2-C6 алкенил,

5) ←C2-C4 алкинил,

6) ←C3-C7 циклоалкил,

7) ←C3-C7 циклоалкенил,

8) ←арил,

9) ←гетероарил,

10) ←гетероциклил,

11) ←гетеробициклил,

12) ←C(O)(O)n-R12,

13) ←C(=Y)NR9R10 или

14) ←S(O)2-R12, где алкил, алкенил, алкинил, циклоалкил, циклоалкенил необязательно замещены одним или несколькими заместителями R7; и где арил, гетероарил, гетероциклил и гетеробициклил необязательно замещены одним или несколькими заместителями R11;

R7 представляет собой

1) галоген,

2) NO2,

3) CN,

4) галогеналкил,

5) C1-C6 алкил,

6) C2-C6 алкенил,

7) C2-C4 алкинил,

8) C3-C7 циклоалкил,

9) C3-C7 циклоалкенил,

10) арил,

11) гетероарил,

12) гетероциклил,

13) гетеробициклил,

14) OR8,

15) S(O)mR8,

16) NR9R10,

17) NR9S(O)2R12,

18) COR8,

19) C(O)OR8,

20) CONR9R10,

21) S(O)2NR9R10,

22) OC(O)R8,

23) OC(O)Y-R12,

24) SC(O)R8 или

25) NC(Y)R9R10, где арил, гетероарил, гетероциклил и гетеробициклил необязательно замещены одним или несколькими заместителями R11;

R8 представляет собой

1) H,

2) галогеналкил,

3) C1-C6 алкил,

4) C2-C6 алкенил,

5) C2-C4 алкинил,

6) C3-C7 циклоалкил,

7) C3-C7 циклоалкенил,

8) арил,

9) гетероарил,

10) гетероциклил,

11) гетеробициклил,

12) R9R10NC(=Y) или

13) C1-C6 алкил-C2-C4 алкенил или

14) C1-C6 алкил-C2-C4 алкинил, где алкил, алкенил, алкинил, циклоалкил, циклоалкенил необязательно замещены одним или несколькими заместителями R7; и где арил, гетероарил, гетероциклил и гетеробициклил необязательно замещены одним или несколькими заместителями R11;

R9 и R10, каждый независимо, представляют собой

1) H,

2) галогеналкил,

3) C1-C6 алкил,

4) C2-C6 алкенил,

5) C2-C4 алкинил,

6) C3-C7 циклоалкил,

7) C3-C7 циклоалкенил,

8) арил,

9) гетероарил,

10) гетероциклил,

11) гетеробициклил,

12) C(O)R12,

13) C(O)Y-R12 или

14) S(O)2- R12,

где алкил, алкенил, алкинил, циклоалкил, циклоалкенил необязательно замещены одним или несколькими заместителями R7 и где арил, гетероарил, гетероциклил и гетеробициклил необязательно замещены одним или несколькими заместителями R11;

или R9 и R10 вместе с атомом азота, с которым они связаны, образуют пяти-, шести- или семичленное гетероциклическое кольцо, необязательно замещенное одним или несколькими заместителями R7;

R11 представляет собой

1) галоген,

2) NO2,

3) CN,

4) B(OR13)(OR14),

5) C1-C6 алкил,

6) C2-C6 алкенил,

7) C2-C4 алкинил,

8) C3-C7 циклоалкил,

9) C3-C7 циклоалкенил,

10) галогеналкил,

11) ОR8,

12) NR9R10,

13) SR8,

14) COR8,

15) C(O)OR8,

16) S(O)mR8,

17) CONR9R10,

18) S(O)2NR9R10,

19) арил,

20) гетероарил,

21) гетероциклил или

22) гетеробициклил, где алкил, алкенил, алкинил, циклоалкил и циклоалкенил необязательно замещены одним или несколькими заместителями R7;

R12 представляет собой

1) галогеналкил,

2) C1-C6 алкил,

3) C2-C6 алкенил,

4) C2-C4 алкинил,

5) C3-C7 циклоалкил,

6) C3-C7 циклоалкенил,

7) арил,

8) гетероарил,

9) гетероциклил или

10) гетеробициклил,

где алкил, алкенил, алкинил, циклоалкил, циклоалкенил необязательно замещены одним или несколькими заместителями R7 и где арил, гетероарил, гетероциклил и гетеробициклил необязательно замещены одним или несколькими заместителями R11;

R13 и R14, каждый независимо, представляют собой

1) H или

2) C1-C6 алкил; или

R13 и R14 объединены с образованием кольцевой системы;

или его пролекарство, или фармацевтически приемлемая соль, или меченное детектируемой меткой или его аффинной меткой.

В другом аспекте настоящего изобретения обеспечивается промежуточное соединение, представленное Формулой 1-v:

где PG3, R1, R2, R3, R4, R5, R5a, X и R6 имеют значения, определенные в настоящей заявке.

В другом аспекте настоящего изобретения обеспечивается промежуточное соединение, представленное Формулой 5-i:

где PG3, R1, R2, R3, R4, R5, R, X1 и R6 имеют значения, определенные в настоящей заявке.

В другом аспекте настоящего изобретения обеспечивается промежуточное соединение, представленное Формулой 6-iv:

где R3, R300, R4, R400, R5, R5a, R500, R500a, X, X1 и L имеют значения, определенные в настоящей заявке.

В другом аспекте настоящего изобретения обеспечивается способ получения соединений, представленных Формулой 2-i, описанных в настоящей заявке, где указанный способ включает: a) смешивание двух промежуточных соединений, представленных Формулой 1-v:

и LG-C(O)-L-C(O)-LG в растворителе в присутствии основания; и

b) удаление защитной группы PG3 с получением соединения Формулы 2-i:

где PG3, R1, R100, R2, R200, R3, R300, R4, R400, R5, R5a, R500, R500а, X, X1 и L имеют значения, определенные в настоящей заявке.

В другом аспекте настоящего изобретения обеспечивается способ получения соединений, представленных Формулой 3-i, описанных в настоящей заявке, где указанный способ включает: a) смешивание двух промежуточных соединений, представленных Формулой 1-v:

и LG-S(O)2-L-S(O)2-LG в растворителе в присутствии основания; и

b) удаление защитной группы PG3 с получением соединения Формулы 3-i:

где PG3, R1, R100, R2, R200, R3, R300, R4, R400, R5, R5a, R500, R500a, X, X1 и L имеют значения, определенные в настоящей заявке.

В другом аспекте настоящего изобретения обеспечивается способ получения соединений, представленных Формулой 4-i, описанных в настоящей заявке, где указанный способ включает: a) смешивание двух промежуточных соединений, представленных Формулой 1-v:

и LG-L-LG в растворителе в присутствии основания; и

b) удаление защитной группы PG3 с получением соединения Формулы 4-i:

где PG3, R1, R100, R2, R200, R3, R300, R4, R400, R5, R5a, R500, R500а, X, X1 и L имеют значения, определенные в настоящей заявке.

В другом аспекте настоящего изобретения обеспечивается способ получения соединений, представленных Формулой 5-ii, описанных в настоящей заявке, где указанный способ включает: a) смешивание двух промежуточных соединений, представленных Формулой 5-i:

и LG-L-LG в растворителе в присутствии основания; и

b) удаление защитной группы PG3 с получением соединения Формулы 5-ii:

где PG3, R1, R100, R2, R200, R3, R300, R4, R400, R5, R5a, R500, R500a, R6, R600, R8, R800, X, X1 и L имеют значения, определенные в настоящей заявке.

В другом аспекте настоящего изобретения обеспечивается способ получения соединений, представленных Формулой 6-v, описанных в настоящей заявке, где указанный способ включает: a) смешивание двух промежуточных соединений, представленных Формулой 6-iv:

и в растворителе с агентом сочетания; и

b) удаление защитной группы PG3 с получением соединения Формулы 6-v:

где PG3, R1, R100, R2, R200, R3, R300, R4, R400, R5, R5a, R500, R500a, R6, R600, R8, R800 X, X1 и L имеют значения, определенные в настоящей заявке.

В другом аспекте настоящего изобретения обеспечивается промежуточное соединение, представленное Формулой I-ia:

где PG4, R1, R2, R3, R4, R5, R5a, X, Q и R6 имеют значения, определенные в настоящей заявке.

В другом аспекте настоящего изобретения обеспечивается промежуточное соединение, представленное Формулой I-iia:

где PG4, PG400, R1, R100, R2, R200, R3, R300, R4, R400, R5, R5a, R500, R500a, A, A1, Q, Q1, X, X1 и BG имеют значения, определенные в настоящей заявке.

В другом аспекте настоящего изобретения обеспечивается способ получения соединений, представленных Формулой I, определенных выше, где указанный способ включает:

a) связывание мостиковой связью двух промежуточных соединений, представленных Формулой I-ia:

где PG4, R1, R2, R3, R4, R5, R5a, X, Q и R6 имеют значения, определенные в настоящей заявке, в растворителе с получением промежуточного соединения, представленного Формулой I-iia:

где PG4, PG400, R1, R100, R2, R200, R3, R300, R4, R400, R5, R5a, R500, R500a, A, A1, Q, Q1, X, X1 и BG имеют значения, определенные в настоящей заявке, и

b) удаление защитных групп PG4 и PG400 с получением соединений Формулы 1.

В другом аспекте настоящего изобретения обеспечивается промежуточное соединение, представленное Формулой I-ib:

где PG4, R1, R2, R3, R4, R5, R5a, X, Q и R6 имеют значения, определенные в настоящей заявке.

В другом аспекте настоящего изобретения обеспечивается промежуточное соединение, представленное Формулой I-iib:

где PG4, PG400, R1, R100, R2, R200, R3, R300, R4, R400, R5, R5a, R500, R500а, A, A1, Q, Q1, X, X1 и BG имеют значения, определенные в настоящей заявке.

В другом аспекте настоящего изобретения обеспечивается способ получения соединений, представленных Формулой I, определенной выше, где указанный способ включает:

a) связывание мостиковой связью двух промежуточных соединений, представленных Формулой I-ib:

где PG4, R1, R2, R3, R4, R5, R5a, X, Q и R6 имеют значения, определенные в настоящей заявке, в растворителе с получением промежуточного соединения, представленного Формулой I-iib:

где PG4, PG400, R1, R100, R2, R200, R3, R300, R4, R400, R5, R5a, R500, R500a, A, A1, Q, Q1, X, X1 и BG имеют значения, определенные в настоящей заявке, и

b) удаление защитных групп PG4 и PG400 с получением соединений Формулы 1.

В другом аспекте настоящего изобретения обеспечивается способ получения фармацевтически приемлемой соли соединения Формулы I путем обработки соединения Формулы I 1-2 эквивалентами фармацевтически приемлемой кислоты, определенной в настоящей заявке.

В другом аспекте настоящего изобретения обеспечивается фармацевтическая композиция, включающая соединение, описанное выше, в смеси с фармацевтически приемлемым носителем, разбавителем или эксципиентом.

В другом аспекте настоящего изобретения обеспечивается фармацевтическая композиция, адаптированная для введения в качестве средства для лечения пролиферативного расстройства у субъекта, включающая терапевтически эффективное количество соединения, описанного выше.

В другом аспекте настоящего изобретения обеспечивается фармацевтическая композиция, включающая соединение Формулы I в сочетании с одним или несколькими агонистами рецептора апоптоза, например агонистом TRAIL рецептора.

В другом аспекте настоящего изобретения обеспечивается фармацевтическая композиция, включающая соединение Формулы I в сочетании с любым терапевтическим средством, которое усиливает ответ одного или нескольких агонистов рецептора апоптоза, например цитотоксических цитокинов, таких как интерфероны.

В другом аспекте настоящего изобретения обеспечивается способ получения фармацевтической композиции, который включает: смешивание соединения, описанного выше, с фармацевтически приемлемым носителем, разбавителем или эксципиентом.

В другом аспекте настоящего изобретения обеспечивается способ oблегчения состояния заболевания, характеризующегося недостаточным апоптозом, при этом способ включает: введение субъекту, нуждающемуся в этом, терапевтически эффективного количества фармацевтической композиции, описанной выше, для лечения состояния заболевания.

В другом аспекте настоящего изобретения обеспечивается способ модуляции функции IAP, при этом указанный способ включает: контактирование клетки с соединением по настоящему изобретению для предотвращения связывания BIR-связывающего белка с BIR доменом IAP, модулируя, таким образом, функцию IAP.

В другом аспекте настоящего изобретения обеспечивается способ лечения пролиферативного заболевания, при этом указанный способ включает: введение субъекту, нуждающемуся в этом, терапевтически эффективного количества фармацевтической композиции, описанной выше, для лечения пролиферативного заболевания.

В другом аспекте настоящего изобретения обеспечивается способ лечения рака, при этом указанный способ включает: введение субъекту, нуждающемуся в этом, терапевтически эффективного количества фармацевтической композиции, описанной выше, для лечения рака.

В другом аспекте настоящего изобретения обеспечивается способ лечения рака, при этом указанный способ включает: введение субъекту, нуждающемуся в этом, терапевтически эффективного количества фармацевтической композиции, описанной выше, в сочетании с или последовательно со средством, выбранным из следующих:

a) модулятор рецептора эстрогена,

b) модулятор рецептора андрогена,

c) модулятор ретиноидного рецептора,

d) цитотоксическое средство,

e) антипролиферативное средство,

f) ингибитор пренил-протеинтрансферазы,

g) ингибитор HMG-CoA редуктазы,

h) ингибитор ВИЧ протеазы,

i) ингибитор обратной транскриптазы,

k) ингибитор ангиогенеза,

l) агонист PPAR-.γ,

m) агонист PPAR-.δ.,

n) ингибитор характерной полилекарственной резистентности,

o) противорвотное средство,

p) средство, полезное для лечения анемии,

q) средства, полезные для лечения нейтропении,

r) средство для повышения иммунитета,

s) ингибитор протеасомы,

t) ингибитор HDAC,

u) ингибитор хемотрипсинподобной активности в протеасоме или

v) ингибиторы Е3 лигазы,

w) модулятор иммунной системы, такой как, но не ограничивающийся этим, интерферон-альфа, Bacillus Calmette-Guerin (BCG) и ионизирующее излучение (UVB), который может индуцировать выделение цитокинов, таких как интерлейкины, TNF, или индуцировать выделение лигандов рецепторов апоптоза, таких как TRAIL;

x) модулятор TRAIL рецепторов апоптоза и агонисты TRAIL, такие как гуманизированные антитела HGS-ETR1 и HGS-ETR2;

или в сочетании, или последовательно с радиационной терапией для лечения рака.

В другом аспекте настоящего изобретения обеспечивается способ лечения или профилактики пролиферативного расстройства у субъекта, при этом указанный способ включает: введение субъекту терапевтически эффективного количества композиции, описанной выше.

В другом аспекте настоящего изобретения способ дополнительно включает введение субъекту терапевтически эффективного количества химиотерапевтического средства до, одновременно или после введения композиции.

В следующем аспекте способ дополнительно включает введение субъекту терапевтически эффективного количества агониста рецептора апоптоза до, одновременно или после введения композиции. Агонист рецептора апоптоза представляет собой TRAIL, или агонист рецептора апоптоза представляет собой антитело к TRAIL. Агонист рецептора апоптоза типично вводят в количестве, которое обеспечивает синергический эффект.

В следующем аспекте обеспечивается применение соединения, описанного выше, для получения лекарственного средства для лечения или профилактики состояния заболевания, характеризующегося недостаточным апоптозом.

В следующем аспекте обеспечивается применение соединения, описанного выше, для получения лекарственного средства для лечения или профилактики пролиферативного расстройства.

В следующем аспекте обеспечивается применение соединения, описанного выше, в сочетании со средством для получения лекарственного средства для лечения или профилактики пролиферативного расстройства, где указанное средство выбрано из следующих:

a) модулятор рецептора эстрогена,

b) модулятор рецептора андрогена,

c) модулятор ретиноидного рецептора,

d) цитотоксическое средство,

e) антипролиферативное средство,

f) ингибитор пренил-протеинтрансферазы,

g) ингибитор HMG-CoA редуктазы,

h) ингибитор ВИЧ протеазы,

i) ингибитор обратной транскриптазы,

k) ингибитор ангиогенеза,

l) агонист PPAR-.γ,

m) агонист PPAR-.δ.,

n) ингибитор характерной полилекарственной резистентности,

o) противорвотное средство,

p) средство, полезное для лечения анемии,

q) средства, полезные для лечения нейтропении,

r) средство для повышения иммунитета,

s) ингибитор протеасомы,

t) ингибитор HDAC,

u) ингибитор хемотрипсинподобной активности в протеасоме или

v) ингибиторы Е3 лигазы,

w) модулятор иммунной системы, такой как, но не ограничивающийся этим, интерферон-альфа, Bacillus Calmette-Guerin (BCG) и ионизирующее излучение (UVB), который может индуцировать выделение цитокинов, таких как интерлейкины, TNF, или индуцировать выделение лигандов рецепторов апоптоза, таких как TRAIL;

x) модулятор TRAIL рецепторов апоптоза и агонисты TRAIL, такие как гуманизированные антитела HGS-ETR1 и HGS-ETR2;

или в сочетании или последовательно с радиационной терапией.

В следующем аспекте обеспечивается применение соединения, описанного выше, в сочетании с агонистом рецептора апоптоза для получения лекарственного средства для лечения или профилактики пролиферативного расстройства у субъекта.

В следующем аспекте обеспечивается фармацевтическая композиция, включающая соединение, описанное выше, в смеси с фармацевтически приемлемым носителем, разбавителем или эксципиентом, для лечения или профилактики состояния заболевания, характеризующегося недостаточным апоптозом.

В следующем аспекте обеспечивается фармацевтическая композиция, включающая соединение, описанное выше, в сочетании с любым соединением, которое повышает уровень в кровотоке одного или нескольких агонистов рецептора апоптоза, для профилактики или лечения пролиферативного расстройства.

В следующем аспекте обеспечивается способ получения фармацевтической композиции, при этом указанный способ включает: смешивание соединения, описанного выше, с фармацевтически приемлемым носителем, разбавителем или эксципиентом.

В другом аспекте настоящего изобретения обеспечивается зонд, при этом указанный зонд представляет собой соединение Формулы I, представленной выше, где указанное соединение является меченным детектируемой меткой или аффинной меткой.

В другом аспекте настоящего изобретения обеспечивается способ идентификации соединений, которые связываются с BIR доменом IAP, где такой анализ включает:

a) контактирование BIR домена IAP с зондом с образованием комплекса зонд:BIR домен, при этом указанный зонд является замещаемым испытываемым соединением;

b) измерение сигнала от зонда для установления контрольного уровня;

c) инкубацию комплекса зонд:BIR домен с испытываемым соединением;

d) измерение сигнала от зонда;

e) сравнение сигнала со стадии d) с контрольным уровнем, при этом модуляция сигнала является показателем того, что испытываемое соединение связывается с BIR доменом, где зонд представляет собой соединение Формулы I, меченное детектируемой меткой или аффинной меткой.

В другом аспекте настоящего изобретения обеспечивается способ детекции потери функции или супрессии IAPs in vivo, при этом указанный способ включает: a) введение субъекту терапевтически эффективного количества фармацевтической композиции, определенной выше; b) выделение образца ткани субъекта; и c) детекцию потери функции или супрессии IAPs в образце.

Подробное описание изобретения

Во многих типах раковых и других заболеваний активацию IAPs в клетках, индуцированную генетическими дефектами или в ответ на химиотерапевтические средства, соотносили с повышенной резистентностью к апоптозу. Интересно, что полученные авторами настоящего изобретения результаты показывают, что раковые клетки, в которых уровни IAP понижены, являются более чувствительными к химиотерапевтическим средствам или TRAIL-индуцированному апоптозу. В настоящем изобретении описываются соединения, которые могут непосредственно связываться с различными IAP, антагонизировать их функции и, более того, вызывать даун-регуляцию некоторых IAP белков в клетках, сенсибилизируя их, таким образом, к апоптозу. Такие молекулы, которые, индуцируя продолжительную потерю IAP из клеток, являются вовлеченными в патогенез или развитие заболевания, будут полезными в качестве терапевтических средств, либо взятые отдельно, либо в синергической комбинации с другими индукторами апоптоза. Ожидается, что такое сочетание эффектов будет обеспечивать клинические преимущества соединений по настоящему изобретению в том, что касается преодоления резистентности к терапии. Также должно дать преимущество применение раскрываемых в настоящей заявке соединений в комбинированной терапии с другими средствами.

В одном аспекте настоящего изобретения соединения по настоящему изобретению также могут быть представлены следующей Формулой II, где M1 и M2 представляют собой независимые BIR связывающие домены.

В одной подгруппе Формулы II, M1 имеет такое же значение, как M2, и пунктирная линия означает линию симметрии. В другой подгруппе M1 является отличным от M2.

В одной подгруппе соединения Формулы II являются асимметричными вокруг пунктирной линии. В другой подгруппе заместители в M1 и M2 являются одинаковыми. В другой подгруппе заместители в M1 и M2 являются отличными друг от друга.

Специалистам в данной области должно быть понятно, что, когда M1 и M2 являются одинаковыми, заместители R1, R1a, R2, R3, R4, R5, R5a, R6, R7, R8, R9, R10, R11, R12, R13, R14, n, m, Y1, Q и X в M1 имеют такое же значение, как соответственно R100, R100a, R200, R300, R400, R500, R600, R700, R800, R900, R1000, R1100, R1300, R1400, n, m, Y100, Q1 и X1 заместители в M2. Когда M1 и M2 являются отличными друг от друга, по меньшей мере, один из указанных выше заместителей имеет другое значение в любом из M1 или M2.

Альтернативно, заместители в M1 могут быть определены как R1, R1a, R2, R3, R4, R5, R5a, R6, R7, R8, R9, R10, R11, R12, R13, R14, n, m, Y1, Q и X, а заместители в M2 могут быть определены как R100, R100a, R200, R300, R400, R500, R600, R700, R800, R900, R1000, R1100, R1300, R1400, n, m, Y100, Q1 и X1 соответственно. В случае когда M1 и M2 являются одинаковыми, заместители R1, R1a, R2, R3, R4, R5, R5a, R6, R7, R8, R9, R10, R11, R12, R13, R14, n, m, Y1, Q и X в M1 имеют такие же значения, как соответственно R100, R100a, R200, R300, R400, R500, R600, R700, R800, R900, R1000, R1100, R1300, R1400, n, m, Y100, Q1 и X1 в M2. В случае когда M1 и M2 являются отличными друг от друга, по меньшей мере, один из указанных выше заместителей имеет другое значение.

Соединения по настоящему изобретению являются полезными в качестве соединений, связывающихся с BIR доменом в IAP млекопитающих, и представлены Формулой I.

W и W1:

В одной подгруппе соединений Формулы I W представляет собой и W1 представляет собой , где R300, R400, R500, R500a, X1 имеют значения, определенные для R3, R4, R5, R5a и X соответственно.

В альтернативной подгруппе соединений Формулы II W представляет собой и W1 представляет собой , где R500, R500a, X1, G1 имеют значения, определенные для R5, Ra, X и G соответственно.

В альтернативной подгруппе соединений Формулы I, W представляет собой и W1 представляет собой , где R500, R500a, G1 имеют значения, определенные для R5, R5a и G соответственно.

В другой альтернативной подгруппе соединений Формулы I W представляет собой и W1 представляет собой , где R3, R4 имеют значения, определенные для R300, R400 соответственно.

Любое и каждое индивидуальное определение W и W1, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением R1, R1a, R2, R100, R100a, R2, R200, B.

В:

В одном примере соединений Формулы I B представляет собой

где A, A1, Q, Q1 и BG имеют значения, определенные в настоящей заявке.

Любое и каждое индивидуальное определение B, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением R1, R1a, R2, R100, R100a, R2, R200, W и W1, раскрытым в настоящей заявке.

Q и Q1:

В одной подгруппе соединений Формулы I Q и Q1 оба представляют собой -CH2-.

В альтернативной подгруппе соединений Формулы II Q и Q1 оба представляют собой -C(O)-.

Любое и каждое индивидуальное определение Q и Q1, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением R1, R1a, R2, R100, R100a, R200, W и W1, раскрытым в настоящей заявке.

A и A1:

В одной подгруппе соединений Формулы I A и A1 независимо выбраны из

1) NR6 или

2) NR600;

где R6 и R600 имеют значения, определенные в настоящей заявке.

Любое и каждое индивидуальное определение A и A1, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением R1, R1a, R2, R100, R100a, R200, W и W1, раскрытым в настоящей заявке.

BG:

В одной подгруппе соединений Формулы I BG представляет собой -Y1-L-Y100-.

В альтернативной подгруппе соединений Формулы I BG представляет собой -L-.

В другой альтернативной подгруппе BG представляет собой -Y1-L1-Z-L100-Y100-, где L1 и L100 имеют одинаковые значения или L1 и L100 являются отличными друг от друга.

Любое и каждое индивидуальное определение BG, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением R1, R1a, R2, R100, R100a, R200, W и W1, раскрытым в настоящей заявке.

Ядро:

Следовательно, в одной подгруппе соединения по настоящему изобретению включают соединения Формулы 1A.

где R1, R1a, R2, R2, R3, R4, R5, R5a, X, X1, A, A1, BG, R100, R100a, R200, R300, R400, R500 и R500a имеют значения, определенные в настоящей заявке.

В одной подгруппе соединения по настоящему изобретению включают соединения Формулы 1A1:

где R1, R1a, R2, R2, R3, R4, R5, R5a, Q, Q1, A, A1, BG, X, X1, R100, R100a, R200, R300, R400, R500 и R500a имеют значения, определенные в настоящей заявке.

В другой подгруппе соединения по настоящему изобретению включают соединения Формулы 1A2:

где R1, R1a, R2, R2, R3, R4, R5, R5a, Q, Q1, A, A1, BG, X, X1, R100, R100a, R200, R300, R400, R500 и R500a имеют значения, определенные в настоящей заявке.

В другой подгруппе соединения по настоящему изобретению включают соединения Формулы 1A3:

где R1, R1a, R2, R2, R3, R4, R5, R5a, Q, Q1, BG, X, X1, R100, R100a, R200, R300, R400, R500, R500a, R6 и R600 имеют значения, определенные в настоящей заявке.

В другой подгруппе соединения по настоящему изобретению включают соединения Формулы 1A4:

где R1, R1a, R2, R2, R3, R4, R5, R5a, Q, Q1, L, X, X1, R100, R100a, R200, R300, R400, R500, R500a, R6 и R600 имеют значения, определенные в настоящей заявке.

В другой подгруппе соединения по настоящему изобретению включают соединения Формулы 1A5:

где R1, R1a, R2, R2, R3, R4, R5, R5a, Q, Q1, L, X, X1, R100, R100a, R200, R300, R400, R500, R500a, R6 и R600 имеют значения, определенные в настоящей заявке.

В другой подгруппе соединения по настоящему изобретению включают соединения Формулы 1A6:

где R1, R1a, R2, R2, R3, R4, R5, R, Q, Q1, X, X1, L, R100, R100a, R200, R300, R400, R500, R500a, R6 и R600 имеют значения, определенные в настоящей заявке.

В альтернативной подгруппе соединения по настоящему изобретению включают соединения Формулы 1B:

где R1, R1a, R2, R200, R5, R5a, G, G1, Q, Q1, X, X1, A, A1, R100, R100a, R200, R500 и R500a имеют значения, определенные в настоящей заявке.

В другой подгруппе соединения по настоящему изобретению включают соединения Формулы 1B1 :

где R1, R1a, R2, R200, R5, R5a, G, G1, Q, Q1, BG, X, X1, A, A1, R100, R100a, R200, R500 и R500a имеют значения, определенные в настоящей заявке.

В другой подгруппе соединения по настоящему изобретению включают соединения Формулы 1B2:

где R1, R1a, R2, R200, R5, R5a, G, G1, L, Q1 Q1, X, X1, A, A1, R100, R100a, R200, R500 и R500a имеют значения, определенные в настоящей заявке.

В другой альтернативной подгруппе соединения по настоящему изобретению включают соединения Формулы 1C:

где R1, R1a, R2, R200, R5, R5a, G, G1, BG, Q, Q1, X, X1, A, A1, R100, R100a, R200, R500 и R500a имеют значения, определенные в настоящей заявке.

В другой альтернативной подгруппе соединения по настоящему изобретению включают соединения Формулы 1D:

где R1, R1a, R2, R2, R5, R5a, BG, G, G1, Q, Q1, A, A1, R100, R100a, R200, R500, R500a, R6 и R600 имеют значения, определенные в настоящей заявке.

Y1 и Y100:

В одной подгруппе Y1 и Y100 оба представляют собой -C(O)-.

В другой подгруппе Y1 и Y100 оба представляют собой -S(O)2-.

В другой подгруппе Y1 и Y100 оба представляют собой -C(O)N(R8)-, где R8 имеет значение, определенное в настоящей заявке.

Любое и каждое индивидуальное определение Y1 и Y100, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением Z, R1, R1a, R2, R3, R4, R5, R5a, R6, R7, R8, R9, R10, R11, R12, R13, R14, n, m, Q, X, R100, R100a, R200, R300, R400, R500, R600, R700, R800, R900, R1000, R1100, R1300, R1400, n, m, Y100, Q1 и X1, представленным в настоящей заявке.

L, L1 и L100:

В одной подгруппе L, L1 и L100 выбраны из следующих групп:

1) -C1-C12 алкил-,

2) -C3-C7 циклоалкил-,

3) -арил-,

4) -бифенил-,

5) -гетероарил-,

6) -гетероциклил-,

7) -C1-C6 алкил-(C3-C7 циклоалкил)-C1-C6 алкил,

8) -C1-C6 алкил-арил-C1-C6 алкил,

9) -C1-C6 алкил-бифенил-C1-C6 алкил,

10) -C1-C6 алкил-гетероарил-C1-C6 алкил,

11) -C1-C6 алкил гетероциклил-C1-C6 алкил или

12) -C1-C6 алкил-O-C1-C6 алкил,

где алкил и циклоалкил необязательно замещены одним или несколькими заместителями R7 и арил, гетероарил, бифенил и гетероциклил необязательно замещены одним или несколькими заместителями R11.

В другой подгруппе L, L1 и L100 представляют собой - N(R8)C(O)N(R8)-, где R8 имеет значение, определенное в настоящей заявке.

В другой подгруппе L, L1 и L100 представляют собой -C1-C6 алкил-Z-C1-C6 алкил-; где алкил необязательно замещен одним или несколькими заместителями R7 и Z имеет значение, определенное в настоящей заявке.

Любое и каждое индивидуальное определение L, L1, L100, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением Z, R1, R1a, R2, R3, R4, R5, R5a, R6, R7, R8, R9, R10, R11, R12, R13, R14, n, m, Y, Q, X, R100, R100a, R200, R300, R400, R500, R600, R700, R800, R900, R1000, R1100, R1300, R1400, n, m, Y100, Q1 и X1, представленным в настоящей заявке.

Z:

В одной подгруппе Z выбран из следующих групп:

1) -N(R8)CON(R8)-,

2) -N(R8)C(O)-арил-C(O)N(R8)-,

3) -N(R8)C(O)-гетероарил-C(O)N(R8)-,

4) -C(O)-,

5) -N(R8)-C1-C12-алкил-N(R8)-,

6) -N(R8)-C(O)C(O)-N(R8)-,

7) -N(R8)-C(O)-C1-C12-алкил-C(O)-N(R8)-,

8) -N(R8)-C(O)-арил-C(O)-N(R8)-,

9) -N(R8)-C(O)-арил-O-арил-C(O)-N(R8)-,

10) -N(R8)-C(O)-гетероарил-C(O)-N(R8)-,

11) -N(R8)-C(O)-бифенил-C(O)-N(R8)-,

12) -N(R8)-S(O)2-C1-C12-алкил-S(O)2-N(R8)-,

13) -N(R8)-S(O)2-арил-S(O)2-N(R8)-,

14) -N(R8)-S(O)2-гетероарил-S(O)2-N(R8)- или

15) -N(R8)-S(O)2-бифенил-S(O)2-N(R8)-,

где алкил и циклоалкил необязательно замещены одним или несколькими заместителями R7 и арил, гетероарил и гетероциклил необязательно замещены одним или несколькими заместителями R11 и где R8 имеет значение, определенное в настоящей заявке.

Любое и каждое индивидуальное определение Z, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением L, L1, L100, R1, R1a, R2, R3, R4, R5, R5a, R6, R7, R8, R9, R10, R11, R12, R13, R14, n, m, Y, Q, X, R100, R100a, R200, R300, R400, R500, R600, R700, R800, R900, R1000, R1100, R1300, R1400, n, m, Y100, Q1 и X1, представленным в настоящей заявке.

R1, R1a, R100 и R100а:

В одной подгруппе соединений Формулы I R1, R1a, R100 и R100а независимо выбраны из H или CH3.

Любое и каждое индивидуальное определение R1, R1a, R100, R100a, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением L, L1, L100, R2, R3, R4, R5, R5a, R6, R7, R8, R9, R10, R11, R12, R13, R14, n, m, Y, Q, X, R200, R300, R400, R500, R600, R700, R800, R900, R1000, R1100, R1300, R1400, n, m, Y100, Q1 и X1, представленным в настоящей заявке.

R2 и R200:

В одной подгруппе соединений Формулы I оба, R2 и R200, демонстрируют (S)-стереохимию.

Любое и каждое индивидуальное определение R2 и R200, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением L, L1, L100, R1, R1a, R3, R4, R5, R5a, R6, R7, R8, R9, R10, R11, R12, R13, R14, n, m, Y1, Q, X, R100, R100a, R300, R400, R500, R600, R700, R800, R900, R1000, R1100, R1300, R1400, n, m, Y100, Q1 и X1, представленным в настоящей заявке.

R3 и R300:

В одной подгруппе соединений Формулы I R3 и R300 независимо выбраны из

1) H или

2) C1-C6 алкила, необязательно замещенного заместителем R7; и где R7 имеет значение, определенное в настоящей заявке.

Типичные примеры R3 и R300 включают H, (S)-метил, (S)-этил, (S)-трет-бутил, (S)-циклогексилметил, (S)-2-фенилэтил и бензил (S)-бутилкарбамат.

Любое и каждое индивидуальное определение R3 и R300, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением L, L1, L100, R1, R1a, R2, R4, R5, R5a, R6, R7, R8, R9, R10, R11, R12, R13, R14, n, m, Y, Q, X, R100, R100a, R200, R400, R500, R600, R700, R800, R900, R1000, R1100, R1300, R1400, n, m, Y100, Q1 и X1, представленным в настоящей заявке.

R6 и R600:

В одной подгруппе соединений Формулы I R6 и R600, каждый независимо, представляют собой

1) H,

2) ←C1-C6 алкил,

3) ←арил или

4)

где алкил необязательно замещен одним или несколькими заместителями R7 и где арил необязательно замещен одним или несколькими заместителями R11.

Типичные примеры R6 и R600 включают:

Любое и каждое индивидуальное определение R6 и R600, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением L1 L1, L100, R1, R1a, R2, R3, R4, R5, R5a, R7, R8, R9, R10, R11, R12, R13, R14, n, m, Y, Q, X, R100, R100a, R200, R300, R400, R500, R700, R800, R900, R1000, R1100, R1300, R1400, n, m, Y100, Q1 и X1, представленным в настоящей заявке.

R7:

В одной подгруппе соединений Формулы I R7 представляет собой

1) C3-C7 циклоалкил,

2) арил,

3) гетероарил или

4) NHC(O)OCH2фенил,

где арил и гетероарил необязательно замещены одним или несколькими заместителями R11 и где R9 и R10 имеют значения, определенные в настоящей заявке.

Любое и каждое индивидуальное определение R7, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением L, L1, L100, R1, R1a, R2, R3, R4, R5, R5a, R6, R8, R9, R10, R11, R12, R13, R14, n, m, Y, Q, X, R100, R100a, R200, R300, R400, R500, R600, R700, R800, R900, R1000, R1100, R1300, R1400, n, m, Y100, Q1 и X1, представленным в настоящей заявке.

R8:

В одной подгруппе R8 выбран из

1) H,

2) галогеналкила,

3) C1-C6 алкила,

4) C3-C7 циклоалкила,

5) арила,

6) гетероарила,

7) гетероциклила или

8) гетеробициклила,

где алкил, циклоалкил необязательно замещены одним или несколькими заместителями R7 и где арил, гетероарил, гетероциклил и гетеробициклил необязательно замещены одним или несколькими заместителями R11.

Любое и каждое индивидуальное определение R8, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением L, L1, L100, R1, R1a, R2, R3, R4, R5, R5a, R6, R7, R9, R10, R11, R12, R13, R14, n, m, Y, Q, X, R100, R100a, R200, R300, R400, R500, R600, R700, R800, R900, R1000, R1100, R1300, R1400, n, m, Y100, Q1 и X1, представленным в настоящей заявке.

R11:

В одной подгруппе соединений Формулы I R11 представляет собой

1) галоген,

2) CF3,

3) OH,

4) OMe,

5) арил или

6) гетероарил.

Примеры R11 включают F, Cl, Br, OH, OMe, CF3, фенил и тетразол.

Любое и каждое индивидуальное определение R11, раскрытое в настоящей заявке, может быть объединено с любым и каждым индивидуальным определением L, L1, L100, R1, R1a, R2, R3, R4, R5, R5a, R6, R7, R8, R9, R10, R12, R13, R14, n, m, Y, Q, X, R100, R100a, R200, R300, R400, R500, R600, R700, R800, R900, R1000, R1100, R1300, R1400, n, m, Y100, Q1 и X1, представленным в настоящей заявке.

В соответствии с другими примерами настоящего изобретения W и W1, каждый, может быть определен как:

или

где R3, R300, R4 и R400 имеют значение, определенное выше.

Одна подгруппа соединений по настоящему изобретению включает соединения, в которых W и W1 определены как:

В одном примере настоящего изобретения W и W1, каждый, может быть определен как:

или

где R3, R300, R4 и R400 имеют значение, определенное выше.

Более конкретно, одна подгруппа соединений по настоящему изобретению включает соединения, в которых W и W1 определены как:

В другом аспекте настоящего изобретения W и W1, каждый, может быть определен как β-поворотный миметик, такой как:

где G, G1, X, X1, R5, R5a, R500 и R500a имеют значения, определенные выше.

Более конкретно, примеры β-поворотных миметиков, таким образом, могут быть охарактеризованы следующими бициклическими и трициклическими кольцевыми системами:

Обзор синтеза бициклических и трициклических кольцевых систем, способных действовать как β-поворотные миметики, и способы синтеза для их получения можно найти в следующей обзорной статье: Cluzeau J.; Lubell W. D. Biopolymers-Peptide Synthesis, 2005, 80, 98, и указанных в ней ссылках, включенной во всей ее полноте.

Если какая-либо переменная, такая как R3, R4 и т.п., встречается более одного раза в какой-либо составляющей структуре, определение такой переменной в каждом случае является не зависимым от каких-либо других случаев присутствия такой переменной. Если заместитель сам является замещенным одним или несколькими заместителями, должно быть понятно, что такие один или несколько заместителей могут быть присоединены по одному и тому же атому углерода или по разным атомам углерода. Комбинации заместителей и переменных, определенных в настоящей заявке, допустимы только в том случае, если они образуют химически стабильные соединения.

Специалистам в данной области должно быть понятно, что картины замещения и заместители в соединениях по настоящему изобретению могут быть выбраны для получения соединений, которые являются химически стабильными и которые можно легко синтезировать с применением химии, описанной в примерах, и химических приемов, хорошо известных из уровня техники, с использованием легко доступных исходных веществ.

Должно быть понятно, что многие заместители или группы, описанные в настоящей заявке, содержат эквиваленты функциональных групп, и это означает, что такая группа или заместитель могут быть замещены другой группой или заместителем, которые имеют аналогичные электронные характеристики, характеристики гибридизации и связывания.

Определения

Если не указано иное, применимы следующие определения.

Формы единственного числа, на которые указывают артикли "a", "an" и "the", включают соответствующие формы множественного числа, если только из контекста явно не следует иное.

Как он использован в настоящей заявке, термин "включающий" означает, что перечисленные элементы, следующие после слова "включающий", являются необходимыми или обязательными, но что другие элементы являются необязательными и могут присутствовать или отсутствовать.

Как он использован в настоящей заявке, термин "состоящий из" означает включающий и ограничивающийся тем, что следует после фразы "состоящий из". Так, фраза "состоящий из" указывает, что перечисленные элементы являются необходимыми или обязательными и что не могут присутствовать какие-либо другие элементы.

Как он использован в настоящей заявке, термин "алкил" предусматривает включение как разветвленных, так и линейных насыщенных алифатических углеводородных групп, содержащих указанное количество атомов углерода, например C1-C6, как в C1-C6-алкиле, определен как включающий группы, содержащие 1, 2, 3, 4, 5 или 6 атомов углерода в линейном или разветвленном расположении, и C1-C4, как в C1-C4 алкиле, определен как включающий группы, содержащие 1, 2, 3 или 4 атомов углерода в линейном или разветвленном расположении, и C1-C3, как в C1-C3 алкиле, определен как включающий группы, содержащие 1, 2 или 3 атомов углерода в линейном или разветвленном расположении, и C1-C12, как в C1-C12 алкиле, определен как включающий группы, содержащие 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 и 12 атомов углерода в линейном или разветвленном расположении. Примеры алкила, определенного выше, включают, но не ограничиваются этим, метил, этил, н-пропил, изопропил, н-бутил, трет-бутил, изобутил, пентил и гексил.

Как он использован в настоящей заявке, термин "алкенил" означает ненасыщенные линейные или разветвленные углеводородные группы, содержащие указанное количество атомов углерода, и в которых, по меньшей мере, два из этих атомов углерода связаны друг с другом двойной связью, и имеющие либо E, либо Z стереохимию, и их сочетания. Например, C2-C6, как в C2-C6 алкениле, определен как включающий группы, содержащие 2, 3, 4, 5 или 6 атомов углерода в линейном или разветвленном расположении, где, по меньшей мере, два из этих атомов углерода связаны вместе двойной связью. Примеры C2-C6 алкенила включают этенил (винил), 1-пропенил, 2-пропенил, 1-бутенил и т.п.

Как он использован в настоящей заявке, термин "алкинил" означает ненасыщенные, линейные углеводородные группы, содержащие указанное количество атомов углерода и в которых, по меньшей мере, два атома углерода связаны вместе тройной связью. Например C2-C4, как в C2-C4 алкиниле, определен как включающий группы, содержащие 2, 3 или 4 атомов углерода в цепи, где, по меньшей мере, два из этих атомов углерода связаны вместе тройной связью.

Как он использован в настоящей заявке, термин "циклоалкил" означает моноциклическую насыщенную алифатическую углеводородную группу, содержащую указанное количество атомов углерода, например C3-C7, как в C3-C7 циклоалкиле, определен как включающий группы, содержащие 3, 4, 5, 6 или 7 атомов углерода в моноциклическом расположении. Примеры C3-C7 циклоалкила, определенного выше, включают, но не ограничиваются этим, циклопропил, циклобутил, циклопентил, циклогексил и циклогептил.

Как он использован в настоящей заявке, термин "циклоалкенил" означает моноциклическую насыщенную алифатическую углеводородную группу, содержащую указанное количество атомов углерода, например C3-C7, как в C3-C7 циклоалкениле, определен как включающий группы, содержащие 3, 4, 5, 6 или 7 атомов углерода в моноциклическом расположении. Примеры C3-C7 циклоалкенила, определенного выше, включают, но не ограничиваются этим, циклопентенил и циклогексенил.

Как он использован в настоящей заявке, термин "гало" или "галоген" означает фтор, хлор, бром или иод.

Как он использован в настоящей заявке, термин "галогеналкил" означает алкил, определенный выше, в котором каждый атом водорода может быть последовательно замещен атомом галогена. Примеры галогеналкилов включают, но не ограничиваются этим, CH2F, CHF2 и CF3.

Как он использован в настоящей заявке, термин "арил", либо отдельно, либо в сочетании с другим радикалом, означает карбоциклическую ароматическую моноциклическую группу, содержащую 6 атомов углерода, которая, кроме того, может быть конденсированной со второй 5- или 6-членной карбоциклической группой, которая может быть ароматической, насыщенной или ненасыщенной. Арил включает, но не ограничивается этим, фенил, инданил, 1-нафтил, 2-нафтил и тетрагидронафтил. Конденсированые арилы могут быть связаны с другой группой либо в подходящем положении в циклоалкильном кольце, либо в ароматическом кольце. Например:

Стрелки, выведенные из кольцевой системы, показывают, что связь может быть присоединена по любому из подходящих кольцевых атомов.

Как он использован в настоящей заявке, термин "гетероарил" означает моноциклическую или бициклическую кольцевую систему, включающую вплоть до десяти атомов, где, по меньшей мере, одно кольцо является ароматическим, и содержащую от 1 до 4 гетероатомов, выбранных из группы, состоящей из O, N и S. Гетероарильный заместитель может быть присоединен либо через кольцевой атом углерода, либо один из гетероатомов. Примеры гетероарильных групп включают, но не ограничиваются этим, тиенильные, бензимидазолильные, бензо[b]тиенильные, фурильные, бензофуранильные, пиранильные, изобензофуранильные, хроменильные, ксантенильные, 2H-пирролильные, пирролильные, имидазолильные, пиразолильные, пиридильные, пиразинильные, пиримидинильные, пиридазинильные, индолизинильные, изоиндолильные, 3H-индолильные, индолильные, индазолильные, пуринильные, 4H-хинолизинильные, изохинолильные, хинолильные, фталазинильные, нафтиридинильные, хиноксалинильные, хиназолинильные, циннолинильные, птеридинильные, изотиазолильные, изохроманильные, хроманильные, изоксазолильные, фуразанильные, индолинильные, изоиндолинильные, тиазолo[4,5-b]-пиридиновые и флуоресцеиновые производные, такие как: или

Как он использован в настоящей заявке, термин "гетероцикл", "гетероциклический" или "гетероциклил" означает 5-, 6- или 7-членную неароматическую кольцевую систему, содержащую от 1 до 4 гетероатомов, выбранных из группы, состоящей из O, N и S. Примеры гетероциклов включают, но не ограничиваются этим, пирролидинильные, тетрагидрофуранильные, пиперидильные, пирролинильные, пиперазинильные, имидазолидинильные, морфолинильные, имидазолинильные, пиразолидинильные, пиразолинильные и биотинильные производные. Как он использован в настоящей заявке, термин "гетеробицикл", либо отдельно, либо в сочетании с другим радикалом, означает гетероцикл, определенный выше, конденсированный с другим циклом, который может представлять собой гетероцикл, арил или любой другой цикл, определенный в настоящей заявке. Примеры таких гетеробициклов включают, но не ограничиваются этим, кумарин, бензо[d][1,3]диоксол, 2,3-дигидробензо[b][1,4]диоксин и 3,4-дигидро-2H-бензо[b][1,4]диозепин.

Как он использован в настоящей заявке, термин "детектируемая метка" означает группу, которая может быть связана с соединением по настоящему изобретению с получением зонда или с BIR доменом IAP таким образом, чтобы при связывании зонда с BIR доменом метка делала возможным либо непосредственное, либо опосредованное распознавание зонда, обеспечивая его детекцию, измерение и количественное определение. Как он использован в настоящей заявке, термин "аффинная метка" означает лиганд или группу, которая связывается либо с соединением по настоящему изобретению, либо с BIR доменом IAP, позволяя экстрагировать из раствора другое соединение, с которым связан указанный лиганд или группа.

Как он использован в настоящей заявке, термин "зонд" означает соединение Формулы I, которое является меченным либо детектируемой меткой, либо аффинной меткой и которое способно к связыванию либо ковалентно, либо нековалентно с BIR доменом IAP. Когда, например, зонд связан нековалентно, он может замещаться испытываемым соединением. Когда, например, зонд связан ковалентно, его можно использовать для образования поперечно-связанных аддуктов, которые могут количественно определяться и ингибироваться испытываемым соединением.

Как он использован в настоящей заявке, термин "необязательно замещенный одним или несколькими заместителями" или его эквивалентный термин "необязательно замещенный, по меньшей мере, одним заместителем" означает, что описанное далее событие или обстоятельства могут иметь место или нет и что описание включает случаи, когда событие или обстоятельство имеет место, и случаи их отсутствия. Это определение предполагает от нуля до пяти заместителей.

Если заместители как таковые являются несовместимыми со способами синтеза по настоящему изобретению, заместитель можно защитить подходящей защитной группой (PG), которая является стойкой к реакционным условиям, используемым в этих способах. Защитную группу можно удалить в подходящий момент в последовательности реакций способа с получением желаемого промежуточного соединения или целевого соединения. Подходящие защитные группы и способы защиты различных заместителей и удаления защитных групп, в которых используют такие подходящие защитные группы, хорошо известны специалистам в данной области; их примеры можно найти в T. Greene and P. Wuts, Protecting Groups in Chemical Synthesis (3rd ed.), John Wiley & Sons, NY (1999), который включен в настоящую заявку посредством ссылки во всей полноте. Примеры защитных групп, используемых в настоящем изобретении, включают, но не ограничиваются этим Alloc, Fmoc, Bn, Boc, CBz и COCF3. В некоторых случаях заместитель может быть специально выбран так, чтобы он был реакционноспособным в реакционных условиях, используемых в способах по настоящему изобретению. В таких обстоятельствах реакционные условия преобразуют выбранный заместитель в другой заместитель, который либо является полезным в промежуточном соединении в способах по настоящему изобретению, либо является желательным заместителем в целевом соединении.

Аббревиатуры для α-аминокислот, используемых в настоящем изобретении, представляют собой следующие:

Аминокислота Аббревиатура
α-Аминомасляная кислота Abu
Аланин Ala
Аргинин Arg
Аспарагиновая кислота Asp
Аспарагин Asn
Цистеин Cys
Глутаминовая кислота Glu
Глутамин Gln
Глицин Gly
Изолейцин Ile
Гистидин His
Лейцин Leu
Лизин Lys
Метионин Met
Фенилаланин Phe
Пролин Pro
Серин Ser
Треонин Thr
Триптофан Trp
Тирозин Tyr
Валин Val

Как он использован в настоящей заявке, термин "остаток", когда это относится к α-аминокислотам, означает радикал, происходящий из соответствующей α-аминокислоты путем удаления гидроксила карбоксигруппы и одного водорода α-аминогруппы. Например, термины Gln, Ala, Gly, Ile, Arg, Asp, Phe, Ser, Leu, Cys, Asn и Tyr представляют остатки L-глутамин, L-аланин, глицин, L-изолейцин, L-аргинин, L-аспарагиновая кислота, L-фенилаланин, L-серин, L-лейцин, L-цистеин, L-аспарагин и L-тирозин соответственно.

Как он использован в настоящей заявке, термин "субъект" означает человека и млекопитающих, отличных от человека, таких как приматы, кошки, собаки, свиньи, коровы, овцы, козы, лошади, кролики, крысы, мыши и т.п.

Как он использован в настоящей заявке, термин "пролекарство" означает соединение, которое может быть преобразовано в физиологических условиях или путем сольволиза в биологически активное соединение по настоящему изобретению. Так, термин "пролекарство" относится к предшественнику соединения по настоящему изобретению, который является фармацевтически приемлемым. Пролекарство может быть неактивным или демонстрировать ограниченную активность при введении субъекту, нуждающемуся в этом, но оно преобразуется in vivo в активное соединение по настоящему изобретению. Типично пролекарства преобразуются in vivo с образованием соединения по настоящему изобретению, например посредством гидролиза в крови или других органах путем ферментативного процессинга. Пролекарственное соединение часто демонстрирует преимущества растворимости, совместимости с тканями или замедленного высвобождения у субъекта (см., Bundgard, H., Design of Prodrugs (1985), p. 7-9, 21-24 (Elsevier, Amsterdam). Определение пролекарства включает любые ковалентно связанные носители, которые высвобождают активное соединение по настоящему изобретению in vivo, когда такое пролекарство вводят субъекту. Пролекарства соединения по настоящему изобретению можно получить путем модификации функциональных групп, присутствующих в соединении по настоящему изобретению, так, чтобы такие модификации расщеплялись либо путем рутинной манипуляции, либо in vivo до исходного соединения по настоящему изобретению.

Как он использован в настоящей заявке, термин "фармацевтически приемлемый носитель, разбавитель или эксципиент" означает, без ограничения, любой адъювант, носитель, эксципиент, агент скольжения, подсластитель, разбавитель, консервант, краситель/окрашивающее вещество, интенсификатор вкуса и аромата, поверхностно-активное вещество, смачивающее вещество, диспергирующее вещество, суспендирующее вещество, стабилизатор, агент изотоничности, растворитель, эмульгатор или инкапсулирующее вещество, такое как липосома, циклодекстрины, инкапсулирующие полимерные системы доставки или полиэтиленгликолевая матрица, которое является приемлемым для использования субъектом, предпочтительно человеком.

Как он использован в настоящей заявке, термин "фармацевтически приемлемая соль" означает как кислотно-, так и основно-аддитивные соли.

Как он использован в настоящей заявке, термин "фармацевтически приемлемая кислотно-аддитивная соль" означает такие соли, которые сохраняют биологическую эффективность и свойства свободных оснований, которые не являются с биологической или другой точки зрения нежелательными и которые образованы с неорганическими кислотами, такими как хлористоводородная кислота, бромистоводородная кислота, серная кислота, азотная кислота, фосфорная кислота и т.п., и органическими кислотами, такими как уксусная кислота, трифторуксусная кислота, пропионовая кислота, гликолевая кислота, пирувиновая кислота, щавелевая кислота, малеиновая кислота, малоновая кислота, янтарная кислота, фумаровая кислота, винная кислота, лимонная кислота, бензойная кислота, коричная кислота, миндальная кислота, метансульфоновая кислота, этансульфоновая кислота, п-толуолсульфоновая кислота, салициловая кислота и т.п.

Как он использован в настоящей заявке, термин "фармацевтически приемлемая основно-аддитивная соль" означает такие соли, которые сохраняют биологическую эффективность и свойства свободных кислот, которые не являются с биологической или другой точки зрения нежелательными. Такие соли получают путем добавления неорганического основания или органического основания к свободной кислоте. Соли, полученные из неорганических оснований, включают, но не ограничиваются этим, соли натрия, калия, лития, аммония, кальция, магния, железа, цинка, меди, марганца, алюминия и т.п. Соли, полученные из органических оснований, включают, но не ограничиваются этим, соли первичных, вторичных и третичных аминов, замещенных аминов, включая природные замещенные амины, циклических аминов и основных ионообменных смол, таких как изопропиламин, триметиламин, диэтиламин, триэтиламин, трипропиламин, этаноламин, 2-диметиламиноэтанол, 2-диэтиламиноэтанол, дициклогексиламин, лизин, аргинин, гистидин, кафеин, прокаин, гидрабамин, холин, бетаин, этилендиамин, глюкозамин, метилглюкамин, теобромин, пурины, пиперазин, пиперидин, N-этилпиперидин, полиаминовые смолы и т.п.

Как он использован в настоящей заявке, термин "связывание с BIR доменом" означает действие соединения по настоящему изобретению на BIR домен IAP, которое блокирует или уменьшает связывание IAPs с BIR-связывающими белками или участвует в вытеснении BIR-связывающих белков из IAP. Примеры BIR-связывающих белков включают, но не ограничиваются этим, каспазы и выделенные из митохондрий BIR-связывающие белки, такие как Smac, Оmi/WTR2A и т.п.

Как он использован в настоящей заявке, термин "недостаточный апоптоз" означает состояние, где заболевание вызвано или протекает из-за того, что клетки, вредные для субъекта, не были подвержены апоптозу. Он включает, но не ограничивается этим, раковые клетки, которые выживают у субъекта без лечения, раковые клетки, которые выживают у субъекта в процессе или после антиракового лечения, или иммунные клетки, действие которых является вредным для субъекта, и включает нейтрофилы, моноциты и аутореактивные T-клетки.

Как он использован в настоящей заявке, термин "терапевтически эффективное количество" означает количество соединения Формулы I, которое при введении субъекту является достаточным для обеспечения лечения состояния заболевания, связанного с недостаточным апоптозом. Количество соединения Формулы I может варьировать в зависимости от соединения, состояния и его тяжести и возраста субъекта, которого лечат, но это количество может определить специалист в данной области рутинным способом на основании его собственных знаний и настоящего раскрытия.

Как он использован в настоящей заявке, термин "лечить" или "лечение" означает лечение состояния заболевания, связанного с недостаточным апоптозом, как раскрывается в настоящей заявке, у субъекта и включает: (i) профилактику возникновения у субъекта заболевания или состояния, связанного с недостаточным апоптозом, в частности, когда такое млекопитающее предрасположено к этому заболеванию или состоянию, но оно еще не диагностировано у этого млекопитающего; (ii) ингибирование заболевания или состояния, связанного с недостаточным апоптозом, т.е. остановку его развития; или (iii) облегчение заболевания или состояния, связанного с недостаточным апоптозом, т.е. обеспечение регрессии такого состояния.

Как он использован в настоящей заявке, термин "лечение рака" означает введение фармацевтической композиции по настоящему изобретению субъекту, предпочтительно человеку, пораженному раком, чтобы вызвать облегчение рака путем уничтожения, ингибирования роста или ингибирования метастазов раковых клеток.

Как он использован в настоящей заявке, термин "профилактика заболевания" означает в случае рака введение после хирургической операции, после химиотерапии или после радиотерапии фармацевтической композиции по настоящему изобретению субъекту, предпочтительно человеку, пораженному раком, для предотвращения возобновления роста опухоли путем уничтожения, ингибирования роста или ингибирования метастазов оставшихся раковых клеток. Также в это определение включена профилактика продолжительного состояния, которое приводит к таким заболеваниям, как астма, MS и т.п.

Как он использован в настоящей заявке, термин "апоптоз" или "программированная гибель клеток" означает регулируемый процесс клеточной гибели, где умирающая клетка демонстрирует ряд четко определяемых биохимических показателей, которые включают образование пузырьков в клеточной мембране, сморщивание клеточной сомы, конденсацию хроматина и разрушение структуры ДНК (ступенчатость), а также любую каспаза-опосредованную клеточную гибель.

Как они использованы в настоящей заявке, термины "BIR домен" или "BIR" используются взаимозаменяемо повсеместно в настоящей заявке и означают домен, который характеризуется несколькими инвариантными аминокислотными остатками, включающие консервативные цистеины и один консервативный гистидиновый остаток в последовательности Cys-(Xaa1)2Cys-(Xaa1)16His-(Xaa1)6-8CyS. Типично аминокислотная последовательность консенсусной последовательности представляет собой: Xaa1-Xaa1-Xaa1-Arg-Leu-Xaa1-Thr-Phe-Xaa1-Xaa1-Trp-Pro-Xaa2-Xaa1-Xaa1-Xaa2-Xaa2-Xaa1-Xaa1-Xaa1-Xaa1-Leu-Ala-Xaa1-Ala-Gly-Phe-Tyr-Tyr-Xaa1-Gly-Xaa1-Xaa1-Asp-Xaa1-Val-Xaa1-Cys-Phe-Xaa1-Cys-Xaa1-Xaa1-Xaa1-Xaal-Xaal-Xaal-Trp-Xaal-Xaal-Xaal-Asp-Xaal-Xaal-Xaal-Xaal-Xaal-His-Xaa-1-Xaa1-Xaa1-Xaa1-Pro-Xaa1-Cys-Xaa1-Phe-Val, где Xaa1 представляет собой любую аминокислоту и Xaa2 представляет собой любую аминокислоту или отсутствует. Предпочтительно последовательность является, по существу, идентичной одной из последовательностей BIR домена, представленных в настоящей заявке для XIAP, HIAP1 или HIAP2.

Остатки BIR домена указаны ниже (см. Genome Biology (2001) 1-10):

Как он использован в настоящей заявке, термин “цинковый палец RING-типа” или "RZF" означает домен, имеющий аминокислотную последовательность консенсусной последовательности: Glu-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1-Xaa-1-Xaa2-Xaa1-Xaa1-Xaa1-Cys-Lys-Xaa3-Cys-Met-Xaa1-Xaa1-Xaa1-Xaa1-Xaa1- Xaa3-X-aal-Phe-Xaal-Pro-Cys-Gly-His-Xaal-Xaal-Xaal-Cys-Xaal-Xaal-Cys-Ala-Xaa1-Xaa-1-Xaa1-Xaa1-Xaa1-Cys-Pro-Xaa1-Cys, где Xaa1 представляет собой любую аминокислоту, Xaa2 представляет собой Glu или Asp и Xaa3 представляет собой Val или Ile.

Как он использован в настоящей заявке, термин "IAP" означает полипептид или белок или его фрагмент, кодируемый геном IAP. Примеры IAP включают, но не ограничиваются этим, человеческий или мышиный NAIP (Birc 1), HIAP-1 (cIAP2, Birc 3), HIAP-2 (cIAP1, Birc 2), XIAP (Birc 4), survivin (Birc 5), livin (ML-IAP, Birc 7), ILP-2 (Birc 8) и Apollon/BRUCE (Birc 6) (см., например, патенты США № 6107041; 6133437; 6156535; 6541457; 6656704; 6689562; Deveraux and Reed, Genes Dev. 13, 239-252, 1999; Kasof and Gomes, J. Biol. Chem., 276, 3238-3246, 2001; Vucic et al., Curr. Biol. 10, 1359-1366, 2000; Ashab et al. FEBS Lett., 495, 56-60, 2001, содержание которых включено в настоящую заявку посредством ссылки).

Как он использован в настоящей заявке, термин "ген IAP" означает ген, кодирующий полипептид, содержащий, по меньшей мере, один BIR домен, и который способен модулировать (ингибировать или усиливать) апоптоз в клетке или ткани. Ген IAP представляет собой ген, имеющий около 50% или больше идентичность нуклеотидной последовательности с, по меньшей мере, одним из человеческого или мышиного NAIP (Birc 1), HIAP-1 (cIAP2, Birc 3), HIAP-2 (cIAP1, Birc 2), XIAP (Birc 4), survivin (Birc 5), livin (ML- IAP, Birc 7), ILP-2 (Birc 8) и Apollon/BRUCE (Birc 6). Область последовательности, по которой определяют идентичность, представляет собой область, кодирующую, по меньшей мере, один BIR домен и домен “цинкового пальца” RING-типа. Гены IAP млекопитающих включают нуклеотидные последовательности, выделенные из любого источника-млекопитающего.

Как он использован в настоящей заявке, термин "ИК50" означает количество, концентрацию или дозу конкретного соединения по настоящему изобретению, при которой достигается 50% ингибирование максимального ответа, такого как смещение максимального связывания с флуоресцентным зондом в анализе, в котором измеряют такой ответ.

Как он использован в настоящей заявке, термин "EC50" означает количество, концентрацию или дозу конкретного соединения по настоящему изобретению, при которой достигается 50% ингибирование клеточного выживания.

Как он использован в настоящей заявке, термин "модулировать" или "модулирование" означает лечение, профилактику, супрессию, усиление или индукцию функции или состояния с использованием соединения по настоящему изобретению. Например, соединения по настоящему изобретению могут модулировать функцию IAP у субъекта, таким образом усиливая апоптоз путем существенного уменьшения или, по существу, устранения взаимодействия активированных апоптических белков, таких как каспаза-3, 7 и 9, с BIR доменами IAP млекопитающих или путем индукции потери XIAP белков в клетке.

Как он использован в настоящей заявке, термин "усиление апоптоза" означает увеличение числа клеток, где имеет место апоптоз в данной клеточной популяции либо in vitro, либо in vivo. Примеры клеточных популяций включают, но не ограничиваются этим, раковые клетки яичника, раковые клетки толстой кишки, раковые клетки молочной железы, раковые клетки легкого, раковые клетки поджелудочной железы или T-клетки и т.п. Должно быть понятно, что степень усиления апоптоза, обеспечиваемая апоптоз-усиливающим соединением по настоящему изобретению в каком-либо определенном анализе, будет варьировать, но специалисты в данной области могут определить статистически значимое изменение уровня апоптоза, идентифицируя соединение, которое усиливает апоптоз, в противном случае ограничиваемый IAP. Предпочтительно "усиление апоптоза" означает, что увеличение количества клеток, претерпевающих апоптоз, составляет, по меньшей мере, 25%, более предпочтительно увеличение составляет 50% и наиболее предпочтительно увеличение, по меньшей мере, в два раза. Предпочтительно отслеживаемый образец представляет собой образец клетки, которая обычно претерпевает недостаточный апоптоз (т.е. раковые клетки). Способы детекции изменений уровня апоптоза (т.е. усиление или снижение) описаны в примерах и включают способы количественного определения фрагментации ДНК, способы количественного определения транслокации фосфатоилсерина из цитоплазматической к внеклеточной стороне мембраны, определение активации каспаз и способы количественного определения выделения цитохрома C и фактора ингибирования апоптоза в цитоплазму митохондриями.

Как он использован в настоящей заявке, термин "пролиферативное заболевание" или "пролиферативное расстройство" означает заболевание, которое вызвано (или приводит к этому) аномально высокими уровнями клеточного деления, аномально низкими уровнями апоптоза или и тем, и другим. Например, рак, такой как лимфома, лейкоз, меланома, рак яичников, рак молочной железы, рак поджелудочной железы и рак легкого, и аутоиммунные расстройства - все являются примерами пролиферативных заболеваний.

Соединения по настоящему изобретению или их фармацевтически приемлемые соли могут содержать один или несколько асимметрических центров, хиральных осей и хиральных плоскостей, и, таким образом, возможно образование энантиомеров, диастереомеров и других стереоизомерных форм, которые могут быть определены с точки зрения абсолютной стереохимии, например, как (R)- или (S)- или как (D)- или (L)- для аминокислот. Настоящее изобретение предусматривает включение всех таких возможных изомеров, а также их рацемических и оптически чистых форм. Оптически активные (+) и (-), (R)- и (S)- или (D)- и (L)-изомеры можно получить с использованием хиральных синтонов или хиральных реагентов или при помощи разделения с использованием традиционных способов, таких как обращенно-фазовая ВЭЖХ. Можно получить рацемические смеси и затем разделить их на индивидуальные оптические изомеры или эти оптические изомеры можно получить путем хирального синтеза. Энантиомеры можно разделить способами, известными специалистам в данной области, например путем образования диастереоизомерных солей, которые затем можно разделить при помощи кристаллизации, газожидкостной или жидкостной хроматографии, селективного взаимодействия одного энантиомера с энантиомер-специфическим реагентом. Специалистам в данной области также должно быть понятно, что, когда желаемый энантиомер преобразуют в другую химическую структурную единицу методом разделения, в этом случае потребуется дополнительная стадия для образования желаемой энантиомерной формы. Альтернативно, конкретные энантиомеры можно синтезировать путем асимметрического синтеза с использованием оптически активных реагентов, субстратов, катализаторов или растворителей или путем преобразования одного энантиомера в другой методом асимметрического преобразования.

Некоторые соединения по настоящему изобретению могут существовать в цвиттер-ионной форме, и настоящее изобретение включает цвиттер-ионные формы таких соединений и их смеси.

Применения

Соединения по настоящему изобретению являются полезными в качестве соединений, связывающихся с BIR доменом IAP, и как таковые соединения, композиции и способ по настоящему изобретению включают применение для клеток или субъектов, пораженных или имеющих предрасположение к развитию конкретного болезненного состояния, которое характеризуется недостаточным апоптозом. Так, соединения, композиции и способы по настоящему изобретению используют для лечения клеточно-пролиферативных заболеваний/расстройств, которые включают, но не ограничиваются этим, i) рак, ii) аутоиммунное заболевание, iii) воспалительные расстройства, iv) пролиферацию, индуцированную после медицинских процедур, включающих, но не ограничивающихся этим, хирургическую операцию, ангиопластику и т.п.

Соединения по настоящему изобретению также могут быть полезными в качестве противоязвенных средств. Даун-регуляция TRAIL (TNF-альфа-связанный апоптоз-индуцирующий лиганд) системы в контексте инфекции H. pylori может ограничивать усиленный апоптоз эпителиальных клеток желудка и разрушение ткани и поэтому может позволить H. pylori сохранять свою нишу, таким образом, соединения по настоящему изобретению могут быть полезными для лечения бактериальной инфекции и/или рецидивирующей инфекции, которая может развиваться в результате даун-регуляции TRAIL системы (см. Nou et al. J. Infectious Diseases (2005) 571-8).

Соединения по настоящему изобретению также могут быть полезными для лечения первичного варикоза. Данные говорят о том (см. Ducass et al. Eur. J. Vase. Endovac. Surg (2005) 316-323), что пораженные первичным варикозом вены ассоциируются с ингибированием программированной клеточной гибели, где имеет место дефект в характерном апоптическом пути. Так, BIR домен-связывающие соединения по настоящему изобретению могут быть полезными для лечения этой патологии.

Соединения по настоящему изобретению также могут быть полезными для лечения заболеваний, в которых имеет место дефект программированной клеточной гибели или апоптического механизма (TRAIL, FAS, апоптосома), таких как рассеянный склероз, астма, атеросклероз, воспаление, аутоиммунная реакция и т.п.

Лечение включает введение субъекту, нуждающемуся в этом, соединения по настоящему изобретению, или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей фармацевтический носитель и терапевтически эффективное количество соединения по настоящему изобретению или его фармацевтически приемлемой соли. В частности, соединения, композиции и способы по настоящему изобретению являются полезными для лечения рака, включающего солидные опухоли, такие как карциномы кожи, молочной железы, головного мозга, легкого, мужских половых желез и т.п. Типы рака, которые можно лечить при помощи соединений, композиций и способов по настоящему изобретению, включают, но не ограничиваются этим, следующие:

Ткань Пример
Надпочечники нейробластома
Кость остеогенная саркома (остеосаркома), фибросаркома, злокачественная фиброзная гистиоцитома, хондросаркома, саркома Эвинга, злокачественная лимфома (ретикуло-клеточная саркома), множественная миелома, злокачественная гигантоклеточная хордома, остеохронфрома (костно-хрящевые экзостозы), доброкачественная хондрома, хондробластома, хондромиксофиброма, остеоидная остеома и гигантоклеточные опухоли
Сердце саркома (ангиосаркома, фибросаркома, рабдомиосаркома, липосаркома), миксома, рабдомиома, фиброма, липома и тератома
Желудочно-кишечный тракт пищевод (сквамозно-клеточная карцинома, аденокарцинома, лейомиосаркома, лимфома), желудок (карцинома, лимфома, лейомиосаркома), поджелудочная железа (дуктальная аденокарцинома, инсулинома, глюкагонома, гастринома, карциноидные опухоли, випома), тонкий кишечник (аденокарцинома, лимфома, карциноидные опухоли, саркома Капоши, лейомиома, гемангиома, липома, нейрофиброма, фиброма), толстый кишечник (аденокарцинома, тубулярная аденома, ворсинчатая аденома, гамартома, лейомиома)
Мочеполовые пути почка (аденокарцинома, опухоль Вильмса (нефробластома), лимфома, лейкоз), мочевой пузырь и уретра (сквамозно-клеточная карцинома, транзиторно-клеточная карцинома, аденокарцинома), предстательная железа (аденокарцинома, саркома), яички (семинома, тератома, эмбриональная карцинома, тератокарцинома, хориокарцинома, саркома, интерстициально-клеточная карцинома, фиброма, фиброаденома, аденоматоидные опухоли, липома)
Гинекология матка (эндометриальная карцинома), шейка матки (цервикальная карцинома, предопухолевая цервикальная дисплазия), яичники (карцинома яичников (серозная цистаденокарцинома, муцинозная цистаденокарцинома, неклассифицированная карцинома), гранулоза-текально-клеточные опухоли, Sertoli-Leydig-клеточные опухоли, дисгерминома, злокачественная тератома), вульва (сквамозно-клеточная карцинома, интраэпителиальная карцинома, аденокарцинома, фибросаркома, меланома), влагалище (паренхиматозно-клеточная карцинома, сквамозно-клеточная карцинома, ботриоидная саркома (эмбриональная рабдомиосаркома). Фаллопиевы трубы (карцинома)
Гематология кровь (миелоидный лейкоз (острый и хронический), острый лимфобластный лейкоз, хронический лимфоцитарный лейкоз, миелопролиферативные заболевания, множественная миелома, миелодиспластический синдром), болезнь Ходжкина, не-Ходжкинская лимфома (злокачественная лимфома)
Печень гепатома (гепатоцеллюлярная карцинома), холангиокарцинома, гепатобластома, ангиосаркома, гепатоцеллюлярная аденома, гемангиома
Легкие бронхогенная карцинома (сквамозно-клеточная, недифференцированная мелкоклеточная, недифференцированная крупноклеточная, аденокарцинома), альвеолярная (бронхиолярная) карцинома, бронхиальная аденома, саркома, лимфома, хондроматозная гамартома, мезотелиома
Нервная система череп (остеома, гемангиома, гранулема, ксантома, деформирующий остоз), мозговые оболочки (менингиома, менингиосаркома, глиоматоз), головной мозг (астроцитома, медулобластома, глиома, эпендимома, герминома (пинеалома), мультиформная глиобластома, олигодендроглиома, шваннома, ретинобластома, врожденные опухоли), нейрофиброма спинного мозга, менингиома, глиома, саркома)
Кожа злокачественная меланома, базально-клеточная карцинома, сквамозно-клеточная карцинома, саркома Капоши, невоидные опухоли, липома, ангиома, дерматофиброма, келоиды

Соединения по настоящему изобретению, или их фармацевтически приемлемые соли, или их пролекарства можно вводить в чистой форме или в подходящей фармацевтической композиции, и это можно осуществить любым способом, принятым в галено-фармацевтической практике.

Фармацевтические композиции по настоящему изобретению можно получить путем смешивания соединения по настоящему изобретению с подходящим фармацевтически приемлемым носителем, разбавителем или эксципиентом, и их можно формулировать в препараты в твердой, полутвердой, жидкой или газообразной формах, такие как таблетки, капсулы, порошки, гранулы, мази, растворы, суппозитории, препараты для инъекций, препараты для ингаляций, гели, микросферы и аэрозоли. Типичные пути введения таких фармацевтических композиций включают, без ограничения, пероральный, местный, чрескожный, введение путем ингаляции, парентеральный (подкожные инъекции, внутривенные, внутримышечные, интрастермальные инъекции или путем инфузии), сублингвальный, глазной, ректальный, вагинальный и интраназальный. Фармацевтические композиции по настоящему изобретению формулируют таким образом, чтобы обеспечить биодоступность активных ингредиентов, содержащихся в них, при введении композиции субъекту. Композиции для введения субъекту или пациенту имеют форму одной или более дозируемых единиц, где, например, таблетка может представлять собой одну дозируемую единицу, а контейнер с соединением по настоящему изобретению в форме аэрозоля может содержать множество дозируемых единиц. Практические способы получения таких лекарственных форм известны или дожны быть очевидны специалистам в данной области; например, см. Remington's Pharmaceutical Sciences, 18th Ed., (Mack Publishing Company, Easton, Pa., 1990). Композиция для введения в любом случае должна содержать терапевтически эффективное количество соединения по настоящему изобретению или его фармацевтически приемлемой соли для лечения состояния заболевания, описанного выше.

Фармацевтическая композиция по настоящему изобретению может быть в твердой или жидкой форме. В одном аспекте носитель (носители) представляет собой мелкие частицы, таким образом, композиции имеют форму, например, таблеток или порошка. Носитель (носители) может быть жидким, тогда композиции представляют собой, например, пероральный сироп, жидкость для инъекций или аэрозоль, который является полезным, например, для введения путем ингаляции.

Для перорального введения фармацевтическая композиция предпочтительно находится либо в твердой, либо в жидкой форме, где полутвердая, полужидкая формы, суспензия и гель включены в формы, рассматриваемые в настоящей заявке как либо твердая, либо жидкая.

В качестве твердой композиции для перорального введения фармацевтическую композицию можно формулировать с получением порошка, гранул, прессованных таблеток, пилюль, капсул, жевательной резинки, облатки или подобной формы. Такая твердая композиция типично содержит один или несколько инертных разбавителей или носителей, представляющих собой пищевые вещества. Кроме того, может присутствовать одно или несколько из следующих веществ: связующие, такие как карбоксиметилцеллюлоза, этилцеллюлоза, микрокристаллическая целлюлоза, трагакантовая камедь или желатин; эксципиенты, такие как крахмал, лактоза или декстрины, разрыхлители, такие как альгиновая кислота, альгинат натрия, Primogel, кукурузный крахмал и т.п.; смазывающие вещества, такие как стеарат магния или Sterotex; агенты скольжения, такие как коллоидный диоксид кремния; подсластители, такие как сахароза или сахарин; отдушка, такая как перечная мята, метилсалицилат или апельсиновая отдушка; и краситель.

Когда фармацевтическая композиция имеет форму капсулы, например желатиновой капсулы, она может содержать помимо веществ указанного выше типа жидкий носитель, такой как полиэтиленгликоль или масло, такое как соевое или растительное масло.

Фармацевтическая композиция может быть в форме жидкости, например эликсир, сироп, раствор, эмульсия или суспензия. Жидкость может представлять собой жидкость для перорального введения или для доставки путем инъекции, в качестве двух примеров. Когда предполагается пероральное введение, предпочтительная композиция содержит помимо соединений по настоящему изобретению одно или несколько веществ, выбранных их подсластителя, консервантов, красителя/окрашивающего вещества и интенсификатора вкуса и аромата. В композицию, предназначенную для введения путем инъекции, может быть включено одно или несколько веществ, выбранных их поверхностно-активного вещества, консерванта, смачивающего вещества, диспергирующего вещества, суспендирующего вещества, буфера, стабилизатора и агента изотоничности.

Жидкие фармацевтические композиции по настоящему изобретению независимо от того, находятся ли они в форме растворов, суспензий или в другой подобной форме, могут включать один или несколько из следующих адъювантов: стерильные разбавители, такие как вода для инъекций, солевой раствор, предпочтительно физиологический солевой раствор, раствор Рингера, изототнический раствор хлорида натрия, нелетучие масла, такие как синтетические моно- или диглицериды, которые могут служить в качестве растворителя или среды для суспендирования, полиэтиленгликоли, глицерин, пропиленгликоль или другие растворители; антибактериальные вещества, такие как бензиловый спирт или метилпарабен; антиоксиданты, такие как аскорбиновая кислота или бисульфит натрия; агенты хелатообразования, такие как этилендиаминтетрауксусная кислота; буферы, такие как ацетаты, цитраты или фосфаты, и вещества для регулирования изотоничности, такие как хлорид натрия или декстроза. Солюбилизирующие вещества могут включать циклодекстрины, такие как гидроксипропил-бета-циклодекстрин. Парентеральный препарат может быть заключен в ампулы, одноразовые шприцы или мультидозовые флаконы из стекла или пластика. Фармацевтическая композиция для инъекций предпочтительно является стерильной.

Жидкая фармацевтическая композиция по настоящему изобретению, используемая либо для парентерального, либо для перорального введения, должна содержать такое количество соединения по настоящему изобретению, чтобы можно было получить подходящую дозу. Типично это количество составляет, по меньшей мере, 0,01% соединения по настоящему изобретению в композиции. Когда композиция предназначена для перорального введения, это количество может варьировать в пределах от 0,1 до около 70% в расчете на массу композиции. Для парентерального применения композиции и препараты по настоящему изобретению получают таким образом, чтобы парентеральная стандартная доза содержала от 0,01 до 1% мас. соединения по настоящему изобретению.

Фармацевтическую композицию по настоящему изобретению можно использовать для местного введения, в этом случае является подходящим, когда носитель может включать раствор, эмульсию, мазь или гелевую основу. Основа, например, может включать одно или несколько из следующих веществ: вазелин, ланолин, полиэтиленгликоли, пчелиный воск, минеральное масло, разбавители, такие как вода и спирт, и эмульгаторы и стабилизаторы. В фармацевтической композиции для местного введения могут присутствовать загустители. Если композиция предназначена для чрескожного введения, она может включать чрескожный пластырь или устройство для ионофореза. Композиции для местного введения могут иметь концентрацию соединения по настоящему изобретению от около 0,1 до около 10% мас./об. (масса на единицу объема).

Фармацевтическую композицию по настоящему изобретению можно использовать для ректального введения для лечения, например, рака толстой кишки в форме, например, суппозитория, который будет плавиться в прямой кишке и высвобождать лекарственное средство. Композиция для ректального введения может содержать масляную основу в качестве подходящего нераздражающего эксципиента. Такие основы включают, без ограничения, ланолин, масло какао и полиэтиленгликоль.

Фармацевтическая композиция по настоящему изобретению может включать различные вещества, которые модифицируют физическую форму твердой или жидкой лекарственной формы. Например, композиция может включать вещества, которые образуют покрытие в виде оболочки вокруг активных ингредиентов. Вещества, которые образуют покрывающую оболочку, типично являются инертными, и их можно выбрать, например, из сахара, шеллака и других веществ, используемых для энтеросолюбильных покрытий. Альтернативно, активные ингредиенты могут быть заключены в желатиновую капсулу.

Фармацевтическая композиция по настоящему изобретению в твердой или жидкой форме может включать вещество, которое связывается с соединением по настоящему изобретению и таким образом способствует доставке соединения. Подходящие вещества, которые могут действовать таким образом, включают, но не ограничиваются этим, моноклональное или поликлональное антитело, белок или липосому.

Фармацевтическая композиция по настоящему изобретению может состоять из унифицированных доз, которые можно вводить в виде аэрозоля. Термин аэрозоль означает различные системы от имеющих коллоидную природу до систем, состоящих из находящихся под давлением упаковок. Доставка может осуществляться при помощи сжиженного или находящегося под давлением газа или при помощи подходящей системы нагнетания, которая дозирует активные ингредиенты. Доставку аэрозолей соединений по настоящему изобретению можно осуществлять в однофазной, бифазной или трехфазной системах для доставки активного ингредиента (ингредиентов). Доставка аэрозоля включает необходимый контейнер, активаторы, клапаны, субконтейнеры и т.п., которые вместе могут составлять набор. Специалист в данной области без излишнего экспериментирования может определить предпочтительные аэрозоли.

Фармацевтические композиции по настоящему изобретению можно получить в соответствии с методиками, хорошо известными в области в фармацевтики. Например, фармацевтическую композицию, предназначенную для введения путем инъекции, можно получить смешиванием соединения по настоящему изобретению со стерильной, дистиллированной водой с получением раствора. Можно добавить поверхностно-активное вещество, способствующее образованию гомогенного раствора или суспензии. Поверхностно-активные вещества представляют собой соединения, которые нековалентно взаимодействуют с соединением по настоящему изобретению, способствуя растворению или гомогенному суспендированию соединения в водной системе доставки.

Соединения по настоящему изобретению или их фармацевтически приемлемые соли вводят в терапевтически эффективном количестве, которое варьирует в зависимости от различных факторов, включающих активность конкретного используемого соединения; метаболическую стабильность и продолжительность действия соединения; возраст, массу тела, общее состояние здоровья, пол и режим питания пациента; способ и время введения; скорость выведения лекарственного средства из организма; комбинирование лекарственных средств; тяжесть конкретного расстройства или состояния; и конкретного субъекта, принимающего лечение. Как правило, терапевтически эффективная суточная доза может составлять от около 0,1 мг до около 40 мг/кг массы тела в день или два раза в день соединения по настоящему изобретению или его фармацевтически приемлемой соли.

Комбинированная терапия

Соединения по настоящему изобретению или их фармацевтически приемлемые соли также можно вводить одновременно с, до или после введения одного или нескольких терапевтических средств, описанных ниже. Так, комбинированная терапия может включать введение одной фармацевтической дозы композиции, которая содержит соединение по настоящему изобретению и одно или несколько дополнительных средств, указанных ниже, а также введение соединения по настоящему изобретению и каждого из дополнительных средств в его собственной отдельной дозируемой фармацевтической композиции. Например, соединение по настоящему изобретению и другое терапевтическое средство можно вводить пациенту либо вместе в одной пероральной дозируемой композиции, такой как таблетка или капсула, или каждое средство вводить в отдельной пероральной дозируемой композиции или через внутривенную инъекцию. Когда используют отдельные дозируемые композиции, соединения по настоящему изобретению и одно или несколько дополнительных средств можно вводить, по существу, в одно и то же время, т.е. одновременно, или раздельно с определенными интервалами во времени, т.е. последовательно; должно быть понятно, что комбинированная терапия включает все такие схемы введения.

Таким образом, настоящее изобретение также охватывает применение соединений по настоящему изобретению в сочетании с радиационной терапией или с одним или несколькими дополнительными средствами, такими как описанные в заявке WO 03/099211 (PCT/US03/15861), которая включена в настоящую заявку посредством ссылки.

Примеры таких дополнительных терапевтических средств включают, но не ограничиваются этим, следующие:

a) модулятор рецептора эстрогена,

b) модулятор рецептора андрогена,

c) модулятор ретиноидного рецептора,

d) цитотоксическое средство,

e) антипролиферативное средство,

f) ингибитор пренил-протеинтрансферазы,

g) ингибитор HMG-CoA редуктазы,

h) ингибитор ВИЧ протеазы,

i) ингибитор обратной транскриптазы,

k) ингибитор ангиогенеза,

l) агонист PPAR-.γ,

m) агонист PPAR-.δ.,

n) ингибитор характерной полилекарственной резистентности,

o) противорвотное средство,

p) средство, полезное для лечения анемии,

q) средства, полезные для лечения нейтропении,

r) средство для повышения иммунитета,

s) ингибитор протеасомы, такой как Velcade и MG132 (7-Leu-Leu-альдегид) (см. He at al. в Oncogene (2004) 23, 2554-2558);

t) ингибитор HDAC, такой как бутират натрия, фенил бутират, гидроаминокислоты, циклинтетрапептид и т.п. (см. Rosato et al. Molecular Cancer Therapeutics 2003, 1273- 1284);

u) ингибитор хемотрипсинподобной активности в протеасоме; и

v) ингибиторы Е3 лигазы.

Более конкретно, соединения по настоящему изобретению также можно использовать в сочетании с одним или несколькими химиотерапевтическими средствами, которое разрывает или стабилизирует микротрубочки, является особенно эффективным для лечения рака и других новообразований. Разрывающие микротрубочки средства (например, алкалоиды барвинка) и стабилизирующие микротрубочки средства (например, таксаны) описаны более подробно ниже.

Алкалоиды барвинка и родственные соединения

Алкалоиды барвинка, которые можно использовать в сочетании с нуклеоосновными олигомерами по настоящему изобретению для лечения рака и других новообразований, включают винкристин, винбластин, виндесин, винфлунин, винорелбин и ангидровинбластин.

Доластатины представляют собой олигопептиды, которые преимущественно осуществляют вмешательство в тубулин на связывающем домене алкалоида барвинка. Эти соединения также можно использовать в сочетании с соединениями по настоящему изобретению для лечения рака и других новообразований. Доластатины включают доластатин-10 (NCS 376128), доластатин-15, ILX651, TZT-1027, симплостатин 1, симплостатин 3 и LU 103793 (цемадотин).

Криптофицины (например, криптофицин 1 и криптофицин 52 (LY355703)) связывают тубулин в связывающем домене алкалоида барвинка и индуцируют блокирование G2/M и апоптоз. Каждое из этих соединений можно использовать в сочетании с соединениями по настоящему изобретению для лечения рака и других новообразований.

Другие разрывающие микротрубочки соединения, которые можно использовать в сочетании с соединениями по настоящему изобретению для лечения рака и других новообразований, описаны в патентах США № 6458765; 6433187; 6323315; 6258841; 6143721; 6127377; 6103698; 6023626; 5985837; 5965537; 5955423; 5952298; 5939527; 5886025; 5831002; 5741892; 5665860; 5654399; 5635483; 5599902; 5530097; 5521284; 5504191; 4879278 и 4816444 и опубликованных патентных заявках США № 2003/0153505 A1; 2003/0083263 A1 и 2003/0055002 A1, каждый из которых включен в настоящую заявку посредством ссылки.

Таксаны и другие стабилизирующие микротрубочки соединения

Таксаны, такие как паклитаксел, доцетаксел, RPR 109881 A, SB-T-1213, SB-T-1250, SB-T-101187, BMS-275183, BRT 216, DJ-927, MAC-321, IDN5109 и IDN5390, можно использовать в сочетании с соединениями по настоящему изобретению для лечения рака и других новообразований. Таксановые аналоги (например, BMS-184476, BMS-188797) и функционально родственные не-таксаны (например, эпотилоны (например, эпотилон A, эпотилон B (EPO906), дезоксиэпотилон B и эпотилон B лактам (BMS-247550)), элеутеробин, дискодермолид, 2-эпи-дискодермолид, 2-дез-метилдискодермолид, 5-гидроксиметилдискодермолид, 19-дез- аминокарбонилдискодермолид, 9(13)-циклодискодермолид и лаулималид) также можно использовать в способах и композициях по настоящему изобретению.

Другие стабилизирующие микротрубочки соединения, которые можно использовать в сочетании с соединениями по настоящему изобретению для лечения рака и других новообразований, описаны в патентах США № 6624317; 6610736; 6605599; 6589968; 6583290; 6576658; 6515017; 6531497; 6500858; 6498257; 6495594; 6489314; 6458976; 6441186; 6441025; 6414015; 6387927; 6380395; 6380394; 6362217; 6359140; 6306893; 6302838; 6300355; 6291690; 6291684; 6268381; 6262107; 6262094; 6147234; 6136808; 6 127406; 6 100411; 6096909; 6025385; 6011056; 5965718; 5955489; 5919815; 5912263; 5840750; 5821263; 5767297; 5728725; 5721268; 5719177; 5714513; 5587489; 5473057; 5407674; 5250722; 5010099 и 4939168 и опубликованных патентных заявках США № 2003/0186965 A1; 2003/0176710 A1; 2003/0176473 A1; 2003/0144523 A1; 2003/0134883 A1; 2003/0087888 A1; 2003/0060623 A1; 2003/0045711 A1; 2003/0023082 A1; 2002/0198256 A1; 2002/0193361 A1; 2002/0188014 A1; 2002/0165257 A1; 2002/0156110 A1; 2002/0128471 A1; 2002/0045609 A1; 2002/0022651 A1; 2002/0016356 A1; 2002/0002292 A1, каждый из которых включен в настоящую заявку посредством ссылки.

Другие химиотерапевтические средства, которые можно вводить с соединением по настоящему изобретению, перечислены в Таблице ниже:

Другие средства
SR-27897 (ингибитор CCK A, Sanofi-Synthelabo) BCX-1777 (ингибитор PNP, BioCryst) токладесин (циклический АМР агонист, Ribapharm) ранпримаза (стимулятор рибонуклеазы, Alfacell) алвоцидиб (ингибитор CDK, Aventis) галарубицин (ингибитор синтеза РНК, Dong-А) CV-247 (ингибитор COX-2, Ivy Medical) тирапазамин (восстановитель, SRI International) P54 (ингибитор COX-2, Phytopharm) N-ацетилцистеин (восстановитель, Zambon) CapCell™ (стимулятор CYP450, Bavarian Nordic) R-флурбипрофен (ингибитор NF-kappaB, Encore) GCS-100 (антагонист gal3, GlycoGenesys) 3CPA (ингибитор NF-kappaB, Active Biotech) G17DT иммуноген (ингибитор гастрина, Aphton) сеокальцитол (агонист рецептора витамина D, Leo) эфапроксирал (окислитель, Allos Therapeutics) 131-I-TM-601 (антагонист ДНК, TransMolecular) PI-88 (ингибитор гепараназы, Progen) Эфлорнитин (ингибитор ODC, ILEX Oncology) тесмилифен (антагонист гистамина, YM BioSciences) минодроновая кислота (ингибитор остеокластов, Yamanouchi) гистамин (агонист рецептора Н2, Maxim) индисулам (стимулятор p53, Eisai) тиазофурин (ингибитор IMPDH, Ribapharm) аплидин (ингибитор РРТ, PharmaMar) циленгитид (антагонист интегрина, Merck KGaA) ритуксимаб (CD20 антитело, Genentech) SR-31747 (антагонист IL-1, Sanofi-Synthelabo) гемтузумаб (CD33 антитело, Wyeth Ayerst) CCI-779 (ингибитор киназы mTOR, Wyeth) PG2 (усилитель гематопоэза, Pharmagenesis) эксисулинд (ингибитор PDE V, Cell Pathways) ImmunolTM (полоскание для полости рта на основе триклозана, Endo) CP-461 (ингибитор PDE V, Cell Pathways) триацетилуридин (уридиновое пролекарство, Wellstat) AG-2037 (ингибитор GART, Pfizer) SN-4071 (средство против саркомы, Signature BioScience) WX-UK1 (ингибитор активации плазминогена, Wilex) TransMID-107.TM. (иммунотоксин, KS Biomedix) PBI-1402 (стимулятор PMN, ProMetic LifeSciences) PCK-3145 (промотор апоптоза, Procyon) бортезомиб (ингибитор протеасомы, Millennium) доранидазол (промотор апоптоза, Pola) SRL-172 (стимулятор Т-клеток, SR Pharma) CHS-828 (цитотоксическое средство, Leo) TLK-286 (ингибитор глутатион S трансферазы, Telik) транс-ретиноевая кислота (дифференциатор, NIH) PT-100 (агонист фактора роста, Point Therapeutics) MX6 (промотор апоптоза, MAXIA) мидостаурин (ингибитор PKC, Novartis) апомин (промотор апоптоза, ILEX Oncology) бриостатин-1 (стимулятор PKC, GPC Biotech) уроцидин (промотор апоптоза, Bioniche) CDA-II (промотор апоптоза, Everlife) Ro-31-7453 (промотор апоптоза, LaRoche) SDX-101 (промотор апоптоза, Salmedix) бросталлицин (промотор апоптоза, Pharmacia) цефлатонин (промотор апоптоза, ChemGenex)

Дополнительные комбинации также могут включать средства, которые снижают токсичность указанных выше средств, такую как гепатотоксичность, нейрональную токсичность, нефротоксичность и т.п.

Более того, на основании полученных авторами настоящего изобретения in vitro результатов можно предположить, что соединения по настоящему изобретению могут хорошо работать с TRAIL. В одном примере совместное введение одного из соединений Формулы I по настоящему изобретению с агонистом рецептора апоптоза, таким как TRAIL, таким как малая молекула или антитело, которое имитирует TRAIL, может дать преимущество, обеспечивая синергический эффект с повышением активности в 2-3 раза. Более того, соединения по настоящему изобретению можно использовать в сочетании с любыми соединениями, которые вызывают повышения уровней циркуляции TRAIL.

Скрининговые анализы

Соединения по настоящему изобретению также можно использовать в методе отбора других соединений, которые связываются с BIR доменом IAP. В общем, для использования соединения по настоящему изобретению в способе идентификации соединений, которые связываются с BIR доменом IAP, IAP связывают с носителем и к анализируемому образцу добавляют соединение по настоящему изобретению. Альтернативно, соединение по настоящему изобретению можно связать с носителем и добавить IAP.

Существует множество способов определения связывания соединения по настоящему изобретению с BIR доменом. В одном способе соединение по настоящему изобретению, например, может быть флуоресцентно или радиоактивно меченным, и связывание определяют непосредственно. Например, это можно осуществить путем присоединения IAP к твердому носителю, добавления детектируемо меченного соединения по настоящему изобретению, вымывания избыточного количества реагента и определения, является ли количество детектируемой метки таким, которое присутствует на твердом носителе. Можно использовать различные стадии блокировки и промывки, которые известны специалистам в данной области.

В некоторых случаях только один из компонентов является меченным. Например, конкретные остатки в BIR домене могут быть меченными. Альтернативно, более чем один компонент могут быть меченными различными метками; например, с использованием I125 для BIR домена и флуоресцентной метки для зонда.

Соединения по настоящему изобретению также можно использовать в качестве конкурентов для отбора методом скрининга дополнительных лекарственных средств-кандидатов или соединений для испытаний. Как они использованы в настоящей заявке, термины "лекарственное средство-кандидат" или "соединения для испытаний" используются взаимозаменяемо и означают любую молекулу, например белок, олигопептид, малую органическую молекулу, полисахарид, полинуклеотид и т.п., для испытания на биоактивность. Соединения могут обладать способностью непосредственно или опосредованно изменять биологическую активность IAP.

Лекарственные средства-кандидаты могут включать различные химические классы, хотя типично они представляют собой малые органические молекулы, имеющие молекулярную массу более чем 100 и менее чем около 2500 дальтон. Средства-кандидаты типично включают функциональные группы, необходимые для сутруктурного взаимодействия с белками, например водородного связывания и липофильного связывания, и типично включают, по меньшей мере, группу амина, карбонила, гидроксила, простого эфира или карбоксила. Лекарственные средства-кандидаты часто включают циклические углеродные или гетероциклические структуры и/или ароматические или полиароматические структуры, замещенные одной или несколькими функциональными группами.

Лекарственные средства-кандидаты могут быть получены из любого количества источников, включающих библиотеки синтетических или природных соединений. Например, доступны различные средства для произвольного и прямого синтеза широкого ряда органических соединений и биомолекул, включающие экспрессию рандомизированных олигонуклеотидов. Альтернативно, библиотеки природных соединений в форме бактериальных, грибковых, растительных и животных экстрактов являются доступными или могут быть легко получены. Кроме того, природные или синтетически полученные библиотеки и соединения можно легко модифицировать традиционными химическими, физическими и биохимическими средствами.

Конкурентные скрининговые анализы можно осуществить путем сочетания BIR домена IAP и зонда с образованием комплекса зонд:BIR домен в первом образце с последующим добавлением испытываемого соединения из второго образца. В этом анализе определяют связывание испытываемого соединения, и изменение или разница в связывании между двумя образцами показывают присутствие испытываемого соединения, способного к связыванию с BIR доменом и потенциальной модуляции активности IAP.

В одном случае связывание испытываемого соединения определяют, используя анализы конкурентного связывания. В этом варианте воплощения зонд метят аффинной меткой, такой как биотин. В некоторых обстоятельствах может иметь место конкурентное связывание между испытываемым соединением и зондом, где зонд вытесняет средство-кандидат.

В одном случае испытываемое соединение может быть меченным. Либо испытываемое соединение, либо соединение по настоящему изобретению, или оба добавляют сначала к BIR домену IAP в течение времени, достаточного для обеспечения связывания с образованием комплекса.

Для образования комплекса зонд:BIR домен типично требуется инкубация при температуре в пределах от 4ºC и 40ºC в течение времени от 10 минут до около 1 часа, что делает возможным осуществление высокопроизводительного скрининга. Любое избыточное количество реагентов обычно удаляют или вымывают. Затем добавляют испытываемое соединение и отслеживают присутствие или отсутствие меченного компонента, что является показателем связывания с BIR доменом.

В одном случае сначала добавляют зонд, а затем испытываемое соединение. Вытеснение зонда является показателем того, что испытываемое соединение связывается с BIR доменом и, таким образом, способно к связыванию и потенциальной модуляции активности IAP. Любой компонент может быть меченным. Например, присутствие зонда в промывочном растворе указывает на вытеснение зонда испытываемым соединением. Альтернативно, если испытываемое соединение является меченным, присутствие зонда на носителе указывает на его вытеснение.

В одном случае сначала можно добавить испытываемое соединение, с инкубацией и промывкой, с последующим добавлением зонда. Отсутствие связывания с зондом может указывать на то, что испытываемое соединение связывается с BIR доменом с высокой аффиностью. Так, если зонд детектируют на носителе, в сочетании с отсутствием связывания испытываемого соединения это может указывать на то, что испытываемое соединение способно к связыванию с BIR доменом.

Модуляцию испытывают путем скрининга на способность испытываемого соединения модулировать активность IAP, и этот метод включает объединение испытываемого соединения с BIR доменом IAP, как описано выше, и определение изменения биологической активности IAP. Поэтому в этом случае испытываемое соединение должно связываться с BIR доменом (хотя это может и не быть необходимым), а также изменять его биологическую активность, описанную в настоящей заявке.

В анализах можно использовать положительные контроли и отрицательные контроли. Все контрольные и испытываемые образцы анализируют несколько раз для получения статистически значимых результатов. После инкубации все образцы промывают для удаления из них неспецифически связанных веществ и определяют количество связанного зонда. Например, когда используют радиометку, образцы считывают в сцинтилляционном счетчике для определения количества связанного соединения.

Типично сигналы, которые детектируют в этом анализе, могут включать флуоресценцию, передачу энергии резонанса, разделенную по времени флуоресценцию, радиоактивность, поляризацию флуоресценции, плазменный резонанс или хемилюминесценцию и т.п. в зависимости от природы метки. Детектируемые метки, полезные для осуществления скрининговых анализов в настоящем изобретении, включают флуоресцентную метку, такую как Флуоресцеин, Орегон зеленый, дансил, родамин, тетраметилродамин, техас красный, Eu3+; хемилюминесцентную метку, такую как люцифераза; колориметрические метки; ферментативные маркеры; или радиоизотопы, такие как тритий, I125 и т.п.

В настоящей заявке раскрывается применение двух флуоресцентно меченных BIR-связывающих соединений, которые могут выполнять роль зондов в анализе поляризации флуоресценции, описанном ниже.

Аффинные метки, которые могут быть полезными для осуществления скрининговых анализов по настоящему изобретению, включают биотин, полигистидин и т.п.

Синтез и методика

Общие способы синтеза соединений по настоящему изобретению представлены ниже и раскрываются только в целях иллюстрации, и их не следует рассматривать как ограничение способов получения соединений любыми другими способами. Специалистам в данной области должно быть понятно, что доступно большое количество способов для получения соединений по настоящему изобретению.

Общие процедуры

Схемы 1, 2, 3, 4, 5 и 6 иллюстрируют общие процедуры синтеза для получения соединений по настоящему изобретению.

Схема 1 иллюстрирует общие процедуры для получения промежуточных соединений общей Формулы 1-v. Промежуточное соединение 1-ii получали путем последовательности процедур восстановительного аминирования. Так, соединение общей Формулы 1-i обрабатывали амином R6NH2 с последующим восстановлением при помощи подходящего гидрида с получением промежуточного соединения 1-ii. Защита соединения 1-ii защитной группой PG5 с последующим удалением защитной группы PG1 дает промежуточное соединение 1-iii. PG2(H)N(R3)CHCO2H подвергают связыванию с 1-iii с использованием аминокислотных связующих веществ с последующим удалением защитной группы PG2, что дает промежуточное соединение 1-iv. Подобным образом, PG3(R1)N(R2)CHCO2H подвергают связыванию с 1-iv с использованием аминокислотных связующих веществ с последующим удалением защитной группы PG5, что дает промежуточное соединение 1-v.

Схема 2 иллюстрирует общие процедуры получения бис-амидных соединенных мостиковой связью соединений по настоящему изобретению. Обработка промежуточного соединения 1-v 0,5 эквивалентами LG-C(O)-L-C(O)-LG и удаление защитной группы PG3 дает соединение 2-i.

Схема 3 иллюстрирует общие процедуры получения бис-сульфонильных соединенных мостиковой связью соединений по настоящему изобретению. Обработка промежуточного соединения 1-v 0,5 эквивалентами LG-S(O)2-L-S(O)2-LG и удаление защитной группы PG3 дает соединение 3-i.

Схема 4 иллюстрирует общие процедуры получения алкильных соединенных мостиковой связью соединений по настоящему изобретению. Обработка промежуточного соединения 1-v 0,5 эквивалентами LG-L-LG и удаление защитной группы PG3 дает соединение 4-i.

Схема 5 иллюстрирует использование функционализированных аминокислот в качестве образующих мостиковую связь групп.

PG4(H)N(R8)CHCO2H подвергают связыванию с 1-v с использованием аминокислотных связующих веществ с последующим удалением защитной группы PG4, что дает промежуточное соединение 4-i. Обработка 4-i при помощи LG-Z-LG с последующим удалением защитной группы PG3 дает соединение 5-ii.

Подобные стратегии соединения мостиковой связью можно использовать для получения соединений Формулы I из промежуточных соединений I-ia и I-ib.

Схема 6 иллюстрирует общие процедуры получения соединенных мостиковой связью соединений общей Формулы 6-v. Промежуточное соединение 6-i получают с использованием последовательности процедур восстановительного аминирования. Бис-альдегид обрабатывают амином R6NH2 с последующим восстановлением с использованием подходящего гидрида с получением промежуточного соединения 6-i. Соединение общей Формулы 6-ii подвергают связыванию с соединением 6-i с использованием аминокислотных связующих веществ с последующим удалением защитной группы PG1, что дает промежуточное соединение 6-iii. PG2(H)N(R3)CHCO2H подвергают связыванию с соединением 6-iii с использованием аминокислотных связующих веществ с последующим удалением защитной группы PG2, что дает промежуточное соединение 6-iv. Подобным образом, PG3(R1)N(R2)CHCO2H подвергают связыванию с соединением 6-iv с использованием аминокислотных связующих веществ с последующим удалением защитной группы PG5, что дает соединение 6-v.

Представленные выше схемы также применимы в случаях, где R3 и R4 объединены с образованием гетероциклической кольцевой системы и R1, R2, W, R5, R5a, X, L и т.п. имеют значения, определенные в настоящей заявке. LG представляет собой удаляемую группу, такую как, например, Cl, Br, I, OTs или OMs.

ПРИМЕРЫ

В настоящем описании используются следующие аббревиатуры:

Boc: трет-бутоксикарбонил;

CBz: бензилоксикарбонил;

DCM: дихлорметан, CH2Cl2;

DIPEA: диизопропилэтиламин;

DMAP: 4-(диметиламино)пиридин;

DMF: N,N-диметилформамид;

DTT: дитиотреитол;

EDC: гидрохлорид 3-(диметиламинопропил)-3-этилкарбодиимида;

EDTA: этилендиаминтетрауксусная кислота;

Fmoc: N-(9-флуоренилметоксикарбонил);

HBTU: гексафторфосфат O-(бензотриазол-1-ил)-N,N,N',N'-тетраметилурония;

HCl: хлористоводородная кислота;

HOAc: уксусная кислота;

HOBt: 1-гидроксибензотриазол;

ВЭЖХ: высокоэффективная жидкостная хроматография;

ЖХМС: жидкостная хроматография - масс-спектрометрия;

MeOH: метанол;

MgSO4: сульфат магния;

MS: масс-спектр;

Ms: метансульфонил;

NaHCO3: гидрокарбонат натрия;

Pd/C: палладий на углероде;

TEA: триэтиламин;

TFA: трифторуксусная кислота;

ТГФ: тетрагидрофуран;

TMEDA: N,N,N,N-тетраметилэтилендиамин;

Ts: пара-толуолсульфонил.

Способы синтеза

Получение репрезентативных примеров:

Получение промежуточного соединения 7-7 проиллюстрировано на схеме 7. Преобразование промежуточного соединения 7-7 в соединения 1, 13, 20 и 23 в общем виде представлено на схемах 8, 9, 10 и 11.

Соединение 7-7 получали способом, аналогичным описанному в находящейся в совместном владении патентной заявке США № 11/434166. Восстановительное аминирование Boc-пролиналя с использованием фенетиламина и Na(AcO)3BH давало промежуточное соединение 7-1, которое затем подвергали ацилированию с использованием бензилхлорформиата и удаляли защитную группу Boc с использованием 4 н. раствора HCl в 1,4-диоксане с получением промежуточного соединения 7-3·HCl. Активация карбоксильной группы Boc-L-Tle-Gly-OH путем обработки амидными связующими веществами HBTU, HOBt и DIPEA в ДМФА растворителе с последующим добавлением 7-3·Cl давали промежуточное соединение 7-4. Удаление защитной группы Boc с использованием 4 н. раствора HCl в 1,4-диоксане давала 7-5·ΗCl. Активация карбоксильной группы Boc-NMe-Ala-OH путем обработки амидными связующими веществами HBTU, HOBt и DIPEA в ДМФА растворителе с последующим добавлением 7-5·HCl давали промежуточное соединение 7-6. Удаление защитной группы Cbz с использованием Pd/C в атмосфере водорода в MeOH давало соединение 7-7.

Обработка раствора соединения 7-7 терефталоилхлоридом и TEA в ТГФ давала промежуточное соединение 8-1. Удаление защитной группы Boc у промежуточного соединения 8-1 с использованием 4 н. раствора HCl в 1,4-диоксане давало соединение 1 в форме его бис-гидрохлоридной соли.

Обработка раствора соединения 7-7 4,4'-бифенилдисульфонилхлоридом и TEA в ТГФ давала промежуточное соединение 9-1. Удаление защитной группы Вос у промежуточного соединения 9-1 с использованием 4 н. раствора HCl в 1,4-диоксане давало соединение 13 в форме его бис-гидрохлоридной соли.

Обработка раствора соединения 7-7 1,4-фенилендиизоцианатом в CH2Cl2 давала промежуточное соединение 10-1. Удаление защитной группы Вос у промежуточного соединения 9-1 с использованием 50% TFA в DCM давало соединение 20 в форме его бис-TFA соли.

Обработка раствора соединения 7-7 α,α'-дибром-п-ксилолом и TEA в ДМФА давала промежуточное соединение 11-1. Удаление защитной группы Вос у промежуточного соединения 11-1 с использованием 4 н. раствора HCl в 1,4-диоксане давало соединение 23 в форме его бис-гидрохлоридной соли.

Получение промежуточного соединения 12-2 проиллюстрировано на схеме 12. Преобразование промежуточного соединения 12-2 в соединения 35, 87 и 104 в общем виде представлено на схемах 13, 14 и 15.

Активация карбоксильной группы Cbz-Gly-OH путем обработки амидными связующими веществами HBTU и DIPEA в ДМФА растворителе с последующим добавлением соединения 7-7 давали промежуточное соединение 12-1. Удаление защитной группы Cbz с использованием Pd/C в атмосфере водорода в MeOH давало промежуточное соединение 12-2.

Обработка раствора соединения 12-2 терефталоилхлоридом и TEA в CH2Cl2 давала промежуточное соединение 13-1. Удаление защитной группы Вос у промежуточного соединения 13-1 с использованием 4 н. раствора HCl в 1,4-диоксане давало соединение 91 в форме его бис-гидрохлоридной соли.

Обработка раствора соединения 12-2 2,6-нафталиндисульфонилхлоридом и TEA в CH2Cl2 давала промежуточное соединение 14-1. Удаление защитной группы Вос у промежуточного соединения 14-1 с использованием 4 н. раствора HCl в 1,4-диоксане давало соединение 87 в форме его бис-гидрохлоридной соли.

Обработка раствора соединения 12-2 1,4-фенилендиизоцианатом в ДМФА давала промежуточное соединение 15-1. Удаление защитной группы Вос у промежуточного соединения 15-1 с использованием 50% TFA в CH2Cl2 давало соединение 104 в форме его бис-TFA соли.

Получение соединения 94 проиллюстрировано на схеме 16. Восстановительное аминирование 4,4'-бифенилдикарбоксальдегида с использованием фенетиламина и Na(AcO)3BH давало промежуточное соединение 16-2. Активация карбоксильной группы пролина путем обработки амидными связующими веществами HBTU, HOBt и DIPEA в ДМФА растворителе с последующим добавлением соединения 16-2 давали промежуточное соединение 16-3. Удаление защитной группы Boc у соединения 16-3 с использованием 4 н. раствора HCl в 1,4-диоксане давало соединения 16-4·2HCl. Активация карбоксильной группы Boc-L-Tle-OH путем обработки амидными связующими веществами HBTU, HOBt и DIPEA в ДМФА растворителе с последующим добавлением соединения 16-4·HCl давали промежуточное соединение 16-5. Удаление защитной группы Boc с использованием 4 н. раствора HCl в 1,4-диоксане давало соединение 16-6·2HCl. Активация карбоксильной группы Boc-N-Me-Ala-OH путем обработки амидными связующими веществами EDC, HOBt и DIPEA в CH2Cl2 растворителе с последующим добавлением 16-6·2HCl давали промежуточное соединение 16-7. Удаление защитной группы Boc с использованием 4 н. раствора HCl в 1,4-диоксане давало соединение 94·2HCl.

Способы получения

Промежуточное соединение 7-1

К раствору N-(трет-бутоксикарбонил)-L-пролиналя (10,0 г, 50,2 ммоль) в метиленхлориде (150 мл) добавляли фенетиламин (6,52 мл, 50,2 ммоль). После перемешивания в течение 1 часа при комнатной температуре добавляли триацетоксиборогидрид натрия (21,0 г, 100,3 ммоль) и метанол (50 мл) и реакционную смесь перемешивали при комнатной температуре в течение ночи. Добавляли насыщенный водный раствор NaHCO3 и этилацетат, органический слой отделяли, промывали насыщенным солевым раствором, сушили над безводным MgSO4, фильтровали и концентрировали в вакууме. Очистка хроматографией на силикагеле, элюируя смесью 95:5 до 50:50 гексан/EtOAc, давала промежуточное соединение 7-1 в виде бесцветного масла. MS (m/z) M+1=305,4

Промежуточное соединение 7-2

К раствору соединения 7-1 (8,10 г, 26,6 ммоль) в метиленхлориде (80 мл), охлажденному до 0ºC последовательно добавляли TEA (7,4 мл, 53,3 ммоль), бензилхлорформиат (4,10 мл, 29,3 ммоль) и реакционную смесь перемешивали в течение 3 часов при комнатной температуре. Добавляли водный раствор NaHCO3 и этилацетат, органический слой отделяли, промывали насыщенным солевым раствором, сушили над MgSO4 и концентрировали в вакууме. Очистка хроматографией на силикагеле с градиентным элюированием 95:5 → 50:50 смесью гексан/EtOAc давала промежуточное соединение 7-2 в виде бесцветного масла.

Промежуточное соединение 7-3·HCl

4 н. раствор HCl в 1,4 диоксане (20 мл) добавляли к промежуточному соединению 7-2 (11,5 г, 26,2 ммоль) и раствор перемешивали в течение 2 часов при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток растирали в порошок с диэтиловым эфиром с получением промежуточного соединения 7-3·HCl в виде белого твердого вещества. MS (m/z) M+1=339,2

Промежуточное соединение 7-4

К раствору Boc-L-Tle-OH (5,70 г, 24,5 ммоль) в ДМФА, охлажденному до 0ºC последовательно добавляли DIPEA (16,9 мл, 94,3 ммоль), HOBt (3,3 г, 24,5 ммоль) и HBTU (9,30 г, 24,5 ммоль). После перемешивания в течение 10 минут добавляли промежуточное соединение 7-3·HCl (7,04 г, 18,8 ммоль) и реакционную смесь перемешивали в течение ночи при комнатной температуре. Добавляли воду и этилацетат, органический слой отделяли, промывали 10% раствором лимонной кислоты, водным раствором NaHCO3 и насыщенным солевым раствором, сушили над безводным MgSO4, фильтровали и концентрировали в вакууме. Очистка хроматографией на силикагеле с градиентным элюированием 95:5 → 50:50 смесью гексан/EtOAc давала промежуточное соединение 7-4 в виде бесцветного масла.

Промежуточное соединение 7-5·HCl

4 н. раствор HCl в 1,4-диоксане (20 мл) добавляли к промежуточному соединению 7-4 (8,30 г, 15,0 ммоль) и раствор перемешивали в течение 2 часов при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток растирали в порошок с диэтиловым эфиром с получением промежуточного соединения 7-5·HCl в виде белого твердого вещества. MS (m/z) M+1=452,2.

Промежуточное соединение 7-6

К раствору Boc-N-Me-Ala-OH (4,20 г, 20,7 ммоль) в ДМФА, охлажденному до 0ºC, последовательно добавляли DIPEA (14,3 мл, 79,8 ммоль), HOBt (2,8 г, 20,7 ммоль) и HBTU (7,90 г, 20,7 ммоль). После перемешивания в течение 10 минут добавляли промежуточное соединение 7-5·ΗCl (7,76 г, 15,9 ммоль) и реакционную смесь перемешивали в течение ночи при комнатной температуре. Добавляли воду и этилацетат, органический слой отделяли, промывали 10% раствором лимонной кислоты, водным раствором NaHCO3 и насыщенным солевым раствором, сушили над безводным MgSO4, фильтровали и концентрировали в вакууме. Очистка хроматографией на силикагеле с градиентным элюированием 95:5 → 50:50 смесью гексан/ТГФ давала промежуточное соединение 7-6 в виде бесцветного масла.

Промежуточное соединение 7-7

К раствору промежуточного соединения 7-6 (3,00 г, 4,7 ммоль) в безводном MeOH (100 мл) при перемешивании в атмосфере N2 добавляли 10% Pd/C (200 мг). Реакционную смесь продували H2 и перемешивали в течение 1 часа. Реакционную смесь затем фильтровали через целит и фильтрат концентрировали в вакууме. Очистка хроматографией на силикагеле с градиентным элюированием 95:5 → 50:50 смесью гексан/ТГФ давала промежуточное соединение 7-7 в виде бесцветного масла. MS (m/z) M+1=503,4.

Промежуточное соединение 8-1

К раствору промежуточного соединения 7-7 (250 мг, 0,49 ммоль) в ТГФ, охлажденному до 0ºC, последовательно добавляли TEA (134 мкл, 0,96 ммоль) и терефталоилхлорид (49,7 мг, 0,24 ммоль) и реакционную смесь перемешивали в течение 2 часов при комнатной температуре. Добавляли воду и этилацетат, органический слой отделяли, промывали 10% раствором лимонной кислоты, водным раствором NaHCO3 и насыщенным солевым раствором, сушили над безводным MgSO4, фильтровали и концентрировали в вакууме. Очистка хроматографией на силикагеле с градиентным элюированием 95:5 → 50:50 смесью гексан/ТГФ давала промежуточное соединение 8-1 в виде белого твердого вещества.

Соединение 1·2ΗCl

4 н. раствор HCl в 1,4-диоксане (3 мл) добавляли к промежуточному соединению 8-1 (120 мг, 0,10 ммоль) и раствор перемешивали в течение 2 часов при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток растирали в порошок с диэтиловым эфиром с получением соединения 1·2ΗCl в виде белого твердого вещества.

Промежуточное соединение 9-1

К раствору промежуточного соединения 7-7 (1,22 г, 2,42 ммоль) в ТГФ, охлажденному до 0ºC последовательно добавляли TEA (1,35 мл, 9,70 ммоль) и 4,4'-бифенилдисульфонилхлорид (425 мг, 1,21 ммоль) и реакционную смесь перемешивали в течение 2 часов при комнатной температуре. Добавляли воду и этилацетат, органический слой отделяли, промывали 10% раствором лимонной кислоты, водным раствором NaHCO3 и насыщенным солевым раствором, сушили над безводным MgSO4, фильтровали и концентрировали в вакууме. Очистка хроматографией на силикагеле с градиентным элюированием 95:5 → 50:50 смесью гексан/ТГФ давала промежуточное соединение 9-1 в виде белого твердого вещества.

Соединение 13·2ΗCl

4 н. раствор HCl в 1,4-диоксане (5 мл) добавляли к промежуточному соединению 9-1 (450 мг, 0,35 ммоль) и раствор перемешивали в течение 2 часов при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток растирали в порошок с диэтиловым эфиром с получением соединения 13·2ΗClв виде белого твердого вещества.

Промежуточное соединение 10-1

К раствору промежуточного соединения 7-7 (180 мг, 0,36 ммоль) в CH2Cl2 добавляли 1,4-фенилендиизоцианат (25 мг, 0,16 ммоль) и реакционную смесь перемешивали в течение ночи при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток очищали хроматографией на силикагеле с градиентным элюированием 95:5 → 50:50 смесью гексан/ТГФ с получением промежуточного соединения 10-1 в виде белого твердого вещества.

Соединение 20·2TFA

Промежуточное соединение 10-1 (175 мг, 0,15 ммоль) растворяли в смеси CH2Cl2 (3,0 мл) и TFA (3,0 мл). Раствор перемешивали в течение 3 часов при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток растирали в порошок с диэтиловым эфиром с получением соединения 20·2TFA в виде белого твердого вещества.

Промежуточное соединение 11-1

К раствору промежуточного соединения 7-7 (210 мг, 0,42 ммоль) в ДМФА последовательно добавляли DIPEA (435 мкл, 2,50 ммоль) и α,α'-дибром-п-ксилол (49 мг, 0,18 ммоль) и реакционную смесь перемешивали в течение 2 часов при комнатной температуре. Добавляли воду и этилацетат, органический слой отделяли, промывали 10% раствором лимонной кислоты, водным раствором NaHCO3 и насыщенным солевым раствором, сушили над безводным MgSO4, фильтровали и концентрировали в вакууме. Очистка хроматографией на силикагеле с градиентным элюированием 95:5 → 30:70 смесью гексан/ТГФ давала промежуточное соединение 11-1 в виде белого твердого вещества.

Соединение 23·2ΗCl

4 н. раствор HCl в 1,4-диоксане (2 мл) добавляли к промежуточному соединению 11-1 (33 мг, 0,03 ммоль) и раствор перемешивали в течение 2 часов при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток растирали в порошок с диэтиловым эфиром с получением соединения 23·2ΗCl в виде белого твердого вещества.

Промежуточное соединение 12-1

К раствору Cbz-Gly-OH (4,16 г, 19,9 ммоль) в ДМФА, охлажденному до 0ºC, последовательно добавляли DIPEA (14,0 мл, 80,4 ммоль) и HBTU (7,01 г, 18,5 ммоль). После перемешивания в течение 5 минут добавляли промежуточное соединение 7-7 (8,11 г, 16,1 ммоль) и реакционную смесь перемешивали в течение ночи при комнатной температуре. Добавляли воду и этилацетат, органический слой отделяли, промывали 10% раствором лимонной кислоты, водным раствором NaHCО3 и насыщенным солевым раствором, сушили над безводным MgSO4, фильтровали и концентрировали в вакууме. Очистка хроматографией на силикагеле с градиентным элюированием 95:5 → 50:50 смесью гексан/ТГФ давала промежуточное соединение 12-1 в виде белого твердого вещества.

Промежуточное соединение 12-2

К раствору промежуточного соединения 12-1 (4,21 г, 6,07 ммоль) в безводном MeOH (120 мл) при перемешивании в атмосфере N2 добавляли 10% Pd/C (500 мг). Реакционную смесь продували H2 и перемешивали в течение 6 часов. Реакционную смесь затем фильтровали через целит и фильтраты концентрировали в вакууме с получением промежуточного соединения 12-2 в виде белого твердого вещества. MS (m/z) M+1=560,4

Промежуточное соединение 13-1

К раствору промежуточного соединения 12-2 (200 мг, 0,36 ммоль) в DCM, охлажденному до 0ºC, последовательно добавляли TEA (100 мкл, 0,71 ммоль) и терефталоилхлорид (36 мг, 0,18 ммоль) и реакционную смесь перемешивали в течение 6 часов при комнатной температуре. Добавляли воду и этилацетат, органический слой отделяли, промывали 10% раствором лимонной кислоты, водным раствором NaHCO3 и насыщенным солевым раствором, сушили над безводным MgSO4, фильтровали и концентрировали в вакууме. Очистка хроматографией на силикагеле с градиентным элюированием 95:5 → 50:50 смесью гексан/ТГФ давала промежуточное соединение 13-1 в виде белого твердого вещества.

Соединение 35·2ΗCl

4 н. раствор HCl в 1,4-диоксане (3,0 мл) добавляли к промежуточному соединению 13-1 (195 мг, 0,18 ммоль) и раствор перемешивали в течение 2 часов при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток растирали в порошок с диэтиловым эфиром с получением соединения 35·2ΗCl в виде белого твердого вещества.

Промежуточное соединение 14-1

К раствору промежуточного соединения 12-2 (245 мг, 0,44 ммоль) в DCM, охлажденному до 0ºC, последовательно добавляли TEA (130 мкл, 0,93 ммоль), 2,6-нафталиндисульфонилхлорид (66 мг, 0,20 ммоль) и реакционную смесь перемешивали в течение ночи при комнатной температуре. Добавляли воду и этилацетат, органический слой отделяли, промывали 10% раствором лимонной кислоты, водным раствором NaHCO3 и насыщенным солевым раствором, сушили над безводным MgSO4, фильтровали и концентрировали в вакууме. Очистка хроматографией на силикагеле с градиентным элюированием 95:5 → 50:50 смесью гексан/ТГФ давала промежуточное соединение 14-1 в виде белого твердого вещества.

Соединение 87·2ΗCl

4 н. раствор HCl в 1,4-диоксане (5,0 мл) добавляли к промежуточному соединению 14-1 (160 мг, 0,11 ммоль) и раствор перемешивали в течение 2 часов при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток растирали в порошок с диэтиловым эфиром с получением соединения 87·2ΗCl в виде белого твердого вещества.

Промежуточное соединение 15-1

К раствору промежуточного соединения 12-2 (142 мг, 0,25 ммоль) в ТГФ добавляли 1,4-фенилендиизоцианат (41 мг, 0,25 ммоль) и реакционную смесь перемешивали при комнатной температуре в течение 3 часов. Летучие вещества удаляли при пониженном давлении и остаток очищали хроматографией на силикагеле с градиентным элюированием 95:5 → 50:50 смесью гексан/ТГФ с получением промежуточного соединения 15-1 в виде белого твердого вещества.

Соединение 104·2TFA

Промежуточное соединение 15-1 (96 мг, 0,07 ммоль) растворяли в смеси CH2Cl2 (1,0 мл) и TFA (1,0 мл). Раствор перемешивали в течение 1 часа при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток растирали в порошок с диэтиловым эфиром с получением соединения 104·2TFA в виде белого твердого вещества.

Промежуточное соединение 16-2

К раствору 4,4'-бифенилдикарбоксальдегида (1,50 г, 7,13 ммоль) в метиленхлориде (25 мл) добавляли фенетиламин (1,72 г, 14,3 ммоль). После перемешивания в течение 1 часа при комнатной температуре добавляли триацетоксиборогидрид натрия (4,53 г, 21,4 ммоль) и метанол (25 мл) и реакционную смесь перемешивали при комнатной температуре в течение ночи. Добавляли насыщенный водный раствор NaHCO3 и этилацетат, органический слой отделяли, промывали насыщенным солевым раствором, сушили над безводным MgSO4, фильтровали и концентрировали в вакууме. Очистка хроматографией на силикагеле, элюируя смесью 95:5 → 50:50 гексан/EtOAc, давала промежуточное соединение 16-2 в виде желтого твердого вещества.

Промежуточное соединение 16-3

К раствору Boc-Pro-OH (3,64 г, 16,1 ммоль) в ДМФА, охлажденному до 0ºC, последовательно добавляли DIPEA (11,06 мл, 61,8 ммоль), HOBt (2,50 г, 18,5 ммоль) и HBTU (7,03 г, 18,5 ммоль). После перемешивания в течение 10 минут добавляли промежуточное соединение 16-2 (2,60 г, 6,18 ммоль) и реакционную смесь перемешивали в течение 3 дней при комнатной температуре. Добавляли воду и этилацетат, органический слой отделяли, промывали 10% раствором лимонной кислоты, водным раствором NaHCO3 и насыщенным солевым раствором, сушили над безводным MgSO4, фильтровали и концентрировали в вакууме. Очистка хроматографией на силикагеле с градиентным элюированием 95:5 → 50:50 смесью гексан/EtOAc давала промежуточное соединение 16-3 в виде белого твердого вещества.

Промежуточное соединение 16-4·2ΗCl

4 н. раствор HCl в 1,4 диоксане (10 мл) добавляли к промежуточному соединению 16-3 (3,10 г, 3,80 ммоль) и раствор перемешивали в течение 2 часов при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток растирали в порошок с диэтиловым эфиром с получением промежуточного соединения 16-4·2ΗCl в виде белого твердого вещества.

Промежуточное соединение 16-5

К раствору Boc-L-Tle-OH (2,18 г, 9,45 ммоль) в ДМФА, охлажденному до 0ºC, последовательно добавляли DIPEA (6,50 мл, 36,3 ммоль), HOBt (1,47 г, 10,89 ммоль) и HBTU (4,12 г, 10,89 ммоль). После перемешивания в течение 10 минут добавляли промежуточное соединение 16-4·2ΗCl (2,50 г, 3,63 ммоль) и реакционную смесь перемешивали в течение ночи при комнатной температуре. Добавляли воду и этилацетат, органический слой отделяли, промывали 10% раствором лимонной кислоты, водным раствором NaHCO3 и насыщенным солевым раствором, сушили над безводным MgSO4, фильтровали и концентрировали в вакууме. Очистка хроматографией на силикагеле с градиентным элюированием 95:5 → 50:50 смесью гексан/EtOAc давала промежуточное соединение 16-5 в виде белого твердого вещества.

Промежуточное соединение 16-6·2ΗCl

4 н. раствор HCl в 1,4 диоксане (5 мл) добавляли к промежуточному соединению 16-5 (1,60 г, 1,54 ммоль) и раствор перемешивали в течение 2 часов при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток растирали в порошок с диэтиловым эфиром с получением промежуточного соединения 16-6·2ΗCl в виде белого твердого вещества.

Промежуточное соединение 16-7

К раствору Boc-N-Me-Ala-OH (404 мг, 1,99 ммоль) в CH2Cl2, охлажденному до 0ºC, последовательно добавляли DIPEA (1,36 мл, 7,60 ммоль), HOBt (308 мг, 2,28 ммоль) и EDC (437 мг, 2,28 ммоль). После перемешивания в течение 10 минут добавляли промежуточное соединение 16-6·2ΗCl (700 мг, 0,76 ммоль) и реакционную смесь перемешивали в течение ночи при комнатной температуре. Добавляли воду и этилацетат, органический слой отделяли, промывали 10% раствором лимонной кислоты, водным раствором NaHCO3 и насыщенным солевым раствором, сушили над безводным MgSO4, фильтровали и концентрировали в вакууме. Очистка хроматографией на силикагеле с градиентным элюированием 95:5 → 50:50 смесью гексан/ТГФ давала промежуточное соединение 16-7 в виде белого твердого вещества.

Соединение 94·2ΗCl

4 н. раствор HCl в 1,4-диоксане (3 мл) добавляли к промежуточному соединению 16-7 (243 г, 0,20 ммоль) и раствор перемешивали в течение 2 часов при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток растирали в порошок с диэтиловым эфиром с получением соединения 94·2ΗCl в виде белого твердого вещества.

Соединение 94·2ΗCl

4 н. раствор HCl в 1,4-диоксане (3 мл) добавляли к промежуточному соединению 16-7 (243 г, 0,20 ммоль) и раствор перемешивали в течение 2 часов при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток растирали в порошок с диэтиловым эфиром с получением соединения 94·2ΗCl в виде белого твердого вещества.

Соединение 49

Осуществляли связывание соединений 49-1 и 49-2 с использованием HOBt, HBTU и DIPEA в ДМФА растворителе с использованием способа, аналогичного описанному для преобразования соединения 7-5- в 7-6, с получением промежуточного соединения 49-3. Осуществляли удаление защиты в промежуточном соединении 9-3 с использованием 4 н. раствора HCl в 1,4-диоксане с получением соединения 49·2ΗCl. MS (m/z) (M+2)/2=519,0.

Соединение 106 - Зонд P2:

Стадия a)

Промежуточное соединение 49-3 и 5% Pd/C (10% мас.) суспендировали в MeOH и помещали в атмосферу водорода (1 атм). После перемешивания в течение 16 часов раствор фильтровали через целит и концентрировали при пониженном давлении с получением промежуточного соединения 106-1.

Стадия b)

К раствору соединения 106-1 (100 мг, 0,09 ммоль) в безводном дихлорметане (5 мл) при перемешивании в атмосфере N2 добавляли флуоресцеинизотиоцианат (35 мг, 0,09 ммоль) и триэтиламин (20 мкл). Реакционную смесь затем перемешивали в течение 2 часов при комнатной температуре. Добавляли этилацетат и промывали два раза 10% раствором лимонной кислоты, органический слой отделяли, промывали насыщенным солевым раствором, сушили над безводным MgSO4, фильтровали и концентрировали в вакууме с получением промежуточного соединения 106-2 в виде желтого твердого вещества. MS (m/z) (M+2)/2=746,6.

Стадия c)

Дихлорметан (3 мл) и TFA (3 мл) добавляли к соединению 106-2 (60 мг, 0,04 ммоль) и раствор перемешивали в течение 40 минут при комнатной температуре. Летучие вещества удаляли при пониженном давлении и остаток растирали в порошок с диэтиловым эфиром. Очистка обращенно-фазовой хроматографией с градиентным элюированием смесью вода/ацетонитрил давала ожидаемое соединение 106·2TFA в виде желтого твердого вещества. MS (m/z) M+1=1291,6.

Репрезентативные соединения по настоящему изобретению были получены в соответствии с описанными выше процедурами и проиллюстрированы в Таблице 1.

Репрезентативные соединения по настоящему изобретению, которые можно получить с использованием простых модификаций описанных выше процедур, проиллюстрированы в Таблице 2:

X может быть выбран из CH2, CF2, O или S;

и n может иметь значение 1, 2 или 3;

и BG может быть выбран из групп, включающих:

и R3/300 имеют значения, определенные в настоящей заявке

и R6/600 независимо выбран из H, алкила или:

Репрезентативные соединения по настоящему изобретению, которые можно получить с использованием простых модификаций описанных выше процедур, проиллюстрированы ниже:

Где R4, R5, R5a, R6, R400, R500, R500а, R600, X, X100 и BG имеют значения, определенные в настоящей заявке;

и R3 и R300 независимо выбраны из следующих: -CHOR7, -C(CH3)OR7 или -CH2CH2OR7; где R7 определен как -C(O)R8 и R8 представляет собой алкил, арил или гетероарил, где алкил может быть дополнительно замещен группой R7 и арил и гетероарил может быть дополнительно замещен группой R11.

Анализы

Молекулярные конструкции для экспрессии

GST-XIAP BIR3RING: XIAP кодирующую последовательность из аминокислот 246-497 клонировали в PGEX2T1 через BamH1 и AVA I. Плазмиду трансформировали в DH5α E. coli для использования в экспрессии и очистке белка.

GST-HIAP2(cIAP-1)BIR 3:HIAP2 кодирующую последовательность из аминокислот 251-363 клонировали в PGex4T3 через BamH1 и Xhol. Плазмиду трансформировали в DH5α E. coli для использования в экспрессии и очистке белка.

GST-H IAP1(cIAP-2)BIR 3:HIAP1 кодирующую последовательность из аминокислот 236-349 клонировали в PGex4T3 через BamH1 и Xhol. Плазмиду трансформировали в DH5α E. coli для использования в экспрессии и очистке белка.

GST- линкер BIR 2 BIR3Ring: XIAP кодирующую последовательность из аминокислот 93-497 клонировали в PGex4T1 через BamH1 и Xhol. Аминокислоты 93-497 амплифицировали из полноразмерной XIAP в pGex4t3 с использованием праймеров: TTAATAGGATCCATCAACGGCTTTTATC и GCTGCATGTGTGTCAGAGG, используя стандартные условия ПЦР. ПЦР фрагмент TA клонировали в pCR-2,1 (Invitrogen). Линкер BIR 2 BIR 3Ring субклонировали в pGex4T1 посредством расщепления при помощи BamHI/Xhol. Плазмиду трансформировали в DH5α E. coli для использования в экспрессии и очистке белка.

Полноразмерную XIAP человека, AEG плазмида номер 23. XIAP кодирующую последовательность из аминокислот 1-497 клонировали в GST вектор гибридизации, PGEX4T1, через сайты рестрикции BamH1 и Xho I. Плазмиду трансформировали в DH5α E. coli для использования в экспрессии и очистке белка.

GST-XIAP линкер BIR 2:XIAP линкер BIR 2 кодирующую последовательность из аминокислот 93-497 клонировали в pGex4T3 через BamHI и Xhol. Плазмиду трансформировали в DH5α E. coli для использования в экспрессии и очистке белка.

Синтез флуоресцентного зонда для FP анализа

Флуоресценный пептидный зонд Fmoc-Ala-Val-Pro-Phe-Tyr(t-Bu)-Leu-Pro-Gly(t-Bu)-Gly-OH получали с использованием стандартной Fmoc химии на 2-хлортритилхлоридной смоле (Int. J. Pept. Prot. Res. 38:555-561, 1991). Отщепление от смолы осуществляли с использованием 20% уксусной кислоты в дихлорметане (DCM), при этом боковая цепь все еще оставалась блокированной. C-концевую защищенную карбоновую кислоту связывали с 4'-(аминометил)флуоресцеином (Molecular Probes, A-1351; Eugene, Oreg.) с использованием избыточного количества диизопропилкарбодиимида (DIC) в диметилформамиде (ДМФА) при комнатной температуре и очищали хроматографией на силикагеле (10% метанола в DCM). N-концевую защитную группу Fmoc удаляли с использованием пиперидина (20%) в ДМФА и очищали хроматографией на силикагеле (20% метанола в DCM, 0,5% HOAc). В конце трет-бутильные защитные группы боковой цепи удаляли с использованием 95% раствора трифторуксусной кислоты, содержащего 2,5% воды и 2,5% триизопропилсилана. Полученный пептид показал единственный пик согласно данным ВЭЖХ (чистота >95%).

Флуоресцентные зонды можно получить с использованием мономерных связывающих BIR звеньев или связанных мостиковой связью BIR-связывающих соединений по настоящему изобретению с использованием химических приемов, описанных в настоящей заявке, с получением зондов, представляющих собой соединение 106.

Зонд P2:

Экспрессия и очистка рекомбинантных белков

A. Экспрессия рекомбинантных белков

Глутатион S-трансфераза(GST)-меченные белки экспрессировали в Escherichia coli штаммах DH5-альфа. Для экспрессии полноразмерного XIAP отдельные или комбинации XIAP- BIR доменов, cIAP-1, cIAP-2 и Livin трансформированных бактерий культивировали в течение ночи при 37ºC в среде Luria Broth (LB), дополненной 50 мкг/мл ампициллина. Культуру после культивирования в течение ночи затем 25-кратно разбавляли в свежей дополненной ампициллином среде LB и бактерии выращивали до A600=0,6, затем индуцировали при помощи 1 мМ изопропил-D-1-тиогалактопиранозида в течение 3 часов. После индукции клетки центрифугировали при 5000 об/мин в течение 10 минут и среду удаляли. Каждый осадок после центрифугирования, полученный из 1 литра культуры, к которому было добавлено 10 мл буфера для лизиса (50 мМ Tris-HCl, 200 мМ NaCl, 1 мМ DTT, 1 мМ PMSF, 2 мг/мл лизозима, 100 мкг/мл)), инкубировали при 4ºC при осторожном встряхивании. После 20 минут инкубации клеточную суспензию выдерживали при -80ºC в течение ночи или до тех пор, пока не потребуется.

B. Очистка рекомбинантных белков

Для очистки рекомбинантных белков IPTG-индуцированный клеточный лизат оттаивали в вихревой воронке и затем разрывали при помощи мгновенного замораживания в жидком азоте два раза, подвергая перемешиванию с завихрением после каждого оттаивания. Клетки подвергали дальнейшему разрыву, пропуская экстракт четыре раза через устройство для разрыва клеток Bio-Neb (Glas-col) с установленным давлением газообразного азота 100 ф/дюйм2 (7,0 кг/см2). Из экстракта удаляли взвешенные примеси при помощи центрифугирования при 4ºC при 15000 об/мин в роторном устройстве SS-34 Beckman в течение 30 минут. Полученный супернатант затем смешивали с 2 мл глутатион-сефарозных шариков (Pharmacia) на 500 мл клеточной культуры (на 1000 мл культуры для полноразмерного XIAP) в течение 1 часа при 4ºC. Затем шарики промывали 3 раза 1× Tris-забуференным физиологическим раствором (TBS) для удаления несвязанных белков. Оставшиеся белки элюировали при помощи 2 промывок по 2 мл 50 мМ Tris pH 8,0, содержащего 10 мМ восстановленного глутатиона. Элюированные белки собирали и осаждали при помощи 604 г/литр сульфата аммония и полученный осадок после центрифугирования снова суспендировали в подходящем буфере. Анализ SDS-PAGE показал, что очищенные белки имели чистоту >90%. Для определения концентрации белка в очищенных белках использовали метод Bradford.

Белки с His-tag (гистидиновый таг) экспрессировали в клетках E. coli штамм AD494 с использованием конструкции pet28ACPP32. Растворимую белковую фракции получали, как описано выше. Для очистки белка супернатант очищали при помощи аффинной хроматографии с использованием хелатирующего агента-сефарозы (Pharmacia) с загрузкой NiSO4 в соответствии с инструкциями изготовителя. Чистота элюированного белка составила >90%, как было определено при помощи анализа SDS-PAGE. Для определения концентрации белка в очищенных белках использовали метод Bradford.

Анализ связывания

Конкурентный анализ на основе поляризации флуоресценции

Для всех анализов флуоресценцию и поляризацию флуоресценции определяли с использованием устройства Tecan Polarion с фильтром возбуждения, установленным на 485 нм и фильтром эмиссии, установленным на 535 нм. Для каждого анализа концентрацию целевого белка сначала устанавливали путем титрования выбранного белка для получения линейного сигнала доза-ответ и инкубировали отдельно в присутствии флуоресцентного зонда. После установления таких условий активность соединений (ИК50) и селективность определяли в присутствии фиксированного определенного количества целевого белка и флуоресцентного зонда и 10-точечного серийного разведения выбранных соединений. Для каждой кривой ИК50 анализы осуществляли следующим образом: 25 мкл/лунка разбавленного соединения в 50 мМ MES буфера pH 6,5 добавляли в черный 96 луночный планшет, затем добавляли 25 мкл/лунка бычьего сывороточного альбумина (BSA) при 0,5 мг/мл в 50 мМ MES pH 6,5. Автофлуоресценцию для каждого соединения сначала определяли путем осуществления считывания только раствора соединения/BSA. Затем добавляли 25 мкл флуоресцеинового зонда, разведенного в 50 мМ MES, содержащем 0,05 мг/мл BSA, и осуществляли считывание для определения гашения сигнала флуоресцеина. В конце добавляли 25 мкл/лунка целевого или контрольного белка (GST-BIRs), разведенного в подходящей концентрации в 50 мМ MES, содержащем 0,05 мг/мл BSA, и определяли поляризацию флуоресценции.

Определение ИК 50 и констант ингибирования

Для каждого анализа строили график единиц относительной поляризации флуоресценции против конечных концентраций соединения и ИК50 рассчитывали с использованием программы Grad pad prism и/или Cambridge soft. Значение ki выводили из рассчитанного значения ИК50, как описано выше, и в соответствии с уравнением, описанным в Nikolovska-Coleska, Z. (2004) Anal Biochem 332, 261-273.

Было показано, что выбранное соединение по настоящему изобретению связывается с BIR3 доменом c-IAP1, с-IAP2 и XIAP и с линкер-BIR2-BIR3-RING XIAP при значениях ki<1 мкМ.

Анализ де-репрессии Каспазы-3 с использованием полноразмерного XIAP, линкер BIR2 или Линкер-BIR2-BIR3-RING

Для определения относительной активности выбранного соединения против XIAP-Bir2 был осуществлен in vitro анализ, где каспазу-3 ингибировали при помощи GST гибридных белков XIAP линкер-Bir2, XIAP Линкер Bir2-Bir3-RING или полноразмерного XIAP. Каспазу 3 (0,125 мкл) и 12,25-34,25 нМ (конечная концентрация) GST-XIAP гибридного белка (GST-Bir2, GST-Bir2Bir3RING или полноразмерный XIAP) коинкубировали с серийными разведениями соединения (200 мкМ - 5 пМ). Активность каспазы 3 измеряли путем наложения сверху 25 мкл раствора 0,4 мМ DEVD-AMC. Конечный реакционный объем составил 100 мкл. Все разведения осуществляли в каспазном буфере (50 мМ Hepes pH 7,4, 100 мМ NaCl, 10% сахарозы, 1 мМ EDTA, 10 мМ DTT, 0,1% CHAPS (Stennicke, H. R. and Salvesen, G.S. (1997). Biochemical characteristics of caspase-3, -6, -7 and -8. J. Biol. Chem. 272, 25719-25723).

Флуоресцентный AMC, высвобожденный в результате гидролиза субстрата каспазой-3, измеряли в спектрофотометре TECAN при возбуждении при 360 нм и эмиссии при 444 нм после 15 минут инкубации при комнатной температуре. Значения ИК50 рассчитывали на одно- или двухсайтовой конкурентной модели с использованием GraphPad v4,0, используя график значений флуоресценции после 15 минут инкубации против log10 концентрации соединения.

Бесклеточный анализ

Анализ де-репрессии Каспазы-3 с использованием клеточных экстрактов (апоптосома)

100 мкг S100 экстракта клеток 293 и от 0,25 мкМ до 20 мкМ гибридного белка GST-XIAP (XIAP-Bir3RING, XIAP-Bir2Bir3RING или полноразмерный XIAP) коинкубировали с серийными разведениями соединения (40 мкM - 50 пM). Каспазы, присутствующие в экстрактах, активировали путем добавления 1 мМ dATP, 0,1 мМ ALLN, 133 мкг Цитохрома C (конечные концентрации) и инкубации при 37ºC в течение 25 минут. Для всех реакций и разведений использовали S100 буфер (50 мМ Pipes pH 7,0, 50 мМ KCl, 0,5 мМ EGTA pH 8,0, 2 мМ MgCl2, дополненный 1/1000 разведениями 2 мг/мл Цитогализина B, 2 мг/мл Химостатина, Лейпептина, Пепстатина, Антипаина, 0,1 M PMSF, 1M DTT). Конечный реакционный объем составил 30 мкл. Активность каспазы 3 измеряли путем наложения сверху 30 мкл раствора 0,4 мМ DEVD-AMC. Высвобожденный AMC в результате расщепления измеряли в спектрофотометре TECAN при возбуждении при 360 нм и эмиссии при 444 нм с использованием кинетического цикла 1 час с осуществлением считываний через каждые 5 минут. Активность каспазы рассчитывали как V0 AMC флуоресценции/сек. Дерепрессию каспазы при помощи соединений по настоящему изобретению сравнивали с полностью активированным экстрактом, репрессированным присутствием гибридного белка XIAP.

Клеточная культура и анализы клеточной гибели

A. Клеточная культура

Раковые клетки MDA-MD-231 (молочная железа), SKOV-3 (яичник) и H460 (легкое) культивировали в среде RPMI 1640, дополненной 10% FBS и 100 единиц/мл Пенициллина и Стрептомицина.

B. Анализы

Анализы выживания осуществляли на следующих трансформированных раковых клеточных линиях человека: MDA-MB-231, SKOV-3, H460, PC3, HCT-116 и SW480 клетки. Клетки высевали в 96-луночные планшеты при соответствующей плотности 5000 и 2000 клеток на лунку и инкубировали при 37ºC в присутствии 5% CO2 в течение 24 часов. Выбранные соединения разводили в среде при различных концентрациях в пределах от 0,00001 мкМ до 100 мкМ. Разведенные соединения добавляли к культуральной среде. Для клеток MDA-MB-231 SKOV3, H460, PC3, HCT-116 и SW480 соединения добавляли либо отдельно, либо в присутствии 1-3 нг/мл TRAIL. Через 48-72 часов выживание клеток оценивали при помощи анализов с использованием MTS. Раствор [3-(4,5-диметилтиазол-2-ил)-5-(3-карбоксиметоксифенил)-2-(4-сульфофенил)-2H-тетразолия, внутренняя соль; MTS] добавляли на клетки в течение от 1 до 4 часов. После инкубации количество преобразованного MTS определяли с использованием спектрофотометра Tecan, установленного на 570 нм.

Клетки MDA-MB-231 и SKOV-3 обрабатывали выбранными соединениями по настоящему изобретению, и было обнаружено, что значения EC50 ниже 200 нМ.

Анализ жизнеспособности с использованием MTT

За один день до обработки соединением от 2000 до 4000 клеток на лунку высевали в обработанные культурой ткани чашки для культивирования в 96-луночном формате с 100 мкл среды и инкубировали при 37ºC, 5% CO2. В день обработки соединением соединения разводили в клеточной культуральной среде до рабочей исходной концентрации 2×. Затем в каждую лунку добавляли 100 мкл разведенного соединения. Обработанный планшет инкубировали в течение 72 часов при 37ºC, 5% CO2. После инкубации жизнеспособность клеток оценивали следующим образом: 20 мкл реагента MTT (5 мг/мл) добавляли в каждую лунку на клеточную пластинку. Планшет инкубировали в течение 2 часов при 37ºC в присутствии 5% CO2. Супернатант затем удаляли из планшета и добавляли 100 мкл изопропанола. Оптическую плотность измеряли в спектрофотометре TECAN при 570 нм. Процент жизнеспособности выражали в процентах от сигнала, полученного с необработанными клетками.

В Таблице 7 представлены некоторые SAR соединений, представленных в Таблице 1 выше. Как таковые соединения продемонстрировали значения EC50 против MDA-MB-231 и SKOV-3 клеток <1 мкМ, при этом многие соединения продемонстрировали значения EC50<50 нМ.

A - EC50 <10 нМ

B - EC50 10-25 нМ

C - EC50 >25 нМ

Кроме того, обработка клеток при помощи 10 нМ соединений 31 и 35 усиливала эффективность TRAIL на колоректальных клетках HCT116 и клетках яичника A2780S примерно в 2 раза соответственно.

Анализ апоптоза: определение активности каспазы-3 из культивированных клеток.

За день до обработки 10000 клеток на лунку высевали в белый обработанный культурой ткани 96-луночный планшет с 100 мкл среды. В день обработки соединением соединения разводили в клеточной культуральной среде до рабочей исходной концентрации 2× и добавляли в каждую лунку 100 мкл разведенного соединения, планшет инкубировали в течение 5 часов при 37ºC в присутствии 5% CO2. После инкубации планшет промывали два раза холодным буфером - Tris-забуферeнным физиологическим раствором (200 мкл, TBS). Клетки лизировали при помощи 50 мкл буфера для анализа каспазы (20 мМ), Tris-HCl pH 7,4, 0,1% NP-40, 0,1% Chaps, 1 мМ DTT, 0,1 мМ EDTA, 0,1 мМ PMSF, 2 мг/мл Химостатина, Лейпептина, Пепстатина, Антипаина), затем инкубировали при 4ºC при встряхивании в течение 30 минут. Буфер для анализа каспазы (45 мкл) и Ac-DEVD-AMC (5 мкл, 1 мг/мл) добавляли в каждую лунку и планшет встряхивали и инкубировали в течение 16 часов при 37ºC. Количество высвобожденного AMC измеряли в спектрофотометре TECAN с фильтром возбуждения и фильтром эмиссии, установленными на 360 нм и 444 нм. Процент активности Каспазы-3 выражали в сравнении с сигналом, полученным с необработанными клетками.

Клеточная биохимия:

A. Определение XIAP, C-IAP1, C-IAP2, PARP, Каспазы-3 и Каспазы-9

Определение экспрессируемого клетками XIAP и PARP осуществляли при помощи вестерн-блоттинга. Клетки высевали при плотности 300000 клеток/лунка в 60-мм лунки (6-луночный планшет). На следующий день клетки обрабатывали выбранным соединением в указанной концентрации. Через 24 часа клетки, трипсинизированные клетки, осаждали центрифугированием при 1800 об/мин при 4ºC. Полученный осадок после центрифугирования промывали два раза холодным TBS. Конечный промытый осадок клеток лизировали при помощи 250 мкл лизисного буфера (NP-40, глицерин, 1% коктейль ингибитора протеазы (Sigma)), помещали в температурные условия 4ºC на 25 мин при осторожном встряхивании. Клеточный экстракт центрифугировали при 4ºC в течение 10 минут при 10000 об/мин. И супернатант и осадок после центрифугирования хранили для анализа методом вестерн-блоттинга, как описано ниже. Определяли количество белка в супернатанте и около 50 мкг белка фракционировали на 10% SDS-PAGE. Осадки после центрифугирования промывали лизисным буфером и ресуспендировали в 50 мкл буфера Lamelli 1×, кипятили и фракционировали на SDS-PAGE. После электрофореза каждый гель был электроперенесен на нитроцеллюлозную мембрану при 0,6A на 2 часа. Мембранные неспецифические участки блокировали в течение 1 часа при помощи 5% сепарированного молока в TBST (TBS, содержащий 0,1% (об./об.) Tween-20) при комнатной температуре. Для иммунодетекции белка мембраны инкубировали в течение ночи с первичными антителами против различных IAP или каспаза-3 или каспаза-9 первичные антитела инкубировали при 4ºC при встряхивании при следующих разведениях:

после инкубации в течение ночи мембраны промывали три раза по 15 мин в TBST, затем инкубировали в течение 1 часа при комнатной температуре в присутствии вторичного антитела, связанного с HRP-ферментом (Chemicon) и разбавленного при 1/5000. После инкубации каждую мембрану промывали три раза при помощи TBST и иммунореактивные полосы определяли путем добавления люминисцентного субстрата (набор ECL, Amersham) и улавливали сигнал на X-RAY пленке для разного времени экспонирования. Было показано, что активные соединения индуцируют расщепление PARP и индуцируют потерю C-IAP1 и C-IAP2 из клеток.

Более конкретно, C-IAP1 уровни снижались в HCT116 клетках после обработки в течение ночи соединениями 45, 100, 31, 59, 44, 40, 67, 91.

Модель полого волокна

In vivo модель полого волокна использовали для демонстрации in vivo эффективности выбранных соединений против выбранных клеточных линий в качестве терапии с использованием одного средства или в сочетании с выбранными цитотоксическими средствами. В день 1 выбранные клеточные линии культивировали и волокно заполняли при плотности клеток около 40000 клетки/волокно. В день операции (день 4) три волокна имплантировали подкожно 28-35 самцам мышей Nu/Nu CD-1. В день 5 мышам начинали вводить ежедневные инъекции подкожным путем контрольного носителя или носителя, содержащего выбранное соединение в подходящей концентрации, и/или инъекцию цитотоксического средства интраперитонеальным путем. После 4 последовательных дней обработки животных умерщвляли, каждое волокно удаляли и метаболическую жизнеспособность оставшихся клеток определяли при помощи MTT анализа. Эффективность соединения определяли как разницу между животным, которого обрабатывали носителем, и животным, которого обрабатывали только соединением или соединением, вводимым в сочетании с цитотоксическим средством.

Соединение 31 и соединение 56 вызывали 70% снижение MTT сигнала в волокнах от обработанных мышей по сравнению с волокнами от обработанных носителем контрольных мышей.

In vivo комбинированная противораковая терапия с таксотером

Самкам бестимусных мышей CD-1 с мутацией nude (примерно 20-25 г) подкожно вводили 5×106 H460 клеток в правый бок. Животных распределяли на равные группы в зависимости от размера опухоли и лекарственную терапию начинали, когда опухоли достигали размера ~30-50 мм3. Животных, у которых не было опухоли или которых считали выходящими за рамки исследования из-за слишком больших размеров опухоли, в этот момент удаляли из испытания. Оставшимся животным вводили таксотер (или эквивалентный объем носителя) при 30 мг/кг, интраперитонеально, 2 раза с интервалом через неделю. Соединение вводили два раз в день (при 10 мг/кг, подкожно, с интервалами примерно 6 часов), начиная во время введения таксотера и продолжая ежедневно в течение эксперимента. Размер опухоли измеряли три раза в неделю. Оценку здоровья осуществляли во время доставки соединения.

Исследование ксенттрансплантата клеточной линии SKOV-3 рака яичников человека

Самкам бестимусных мышей CD-1 с мутацией nude (примерно 20-25 г) подкожно вводили 1×106 клетки SKOV-3 опухоли яичника человека в 50% матригеле, в правый бок. В день 55, когда опухоли достигали размера примерно 100 мм3, начинали обработку соединением по схеме обработки 5/2 в течение периода эксперимента. Размер опухоли измеряли при помощи цифровых циркулей и рассчитывали как V=(a×b2)/2, где a представляет собой длину и b представляет собой ширину.

Исследование ксенттрансплантата клеточной линии MDA-MB-231 рака молочной железы человека

Самкам бестимусных мышей CD-1 с мутацией nude (примерно 20-25 г) подкожно вводили 1×106 клетки MDA-MB-231 опухоли молочной железы человека в правый бок. В день 71, когда опухоли достигали размера примерно 90 мм3, начинали обработку соединением по схеме обработки 5/2 в течение периода эксперимента. Размер опухоли измеряли при помощи цифровых циркулей и рассчитывали как V=(a×b2)/2, где a представляет собой длину и b представляет собой ширину.

Фармакокинетические исследования

Выбранные соединения растворяются в водной среде, и их можно вводить при различных дозах с использованием разных путей введения, включающих внутривенную болюсную инъекцию, внутривенную инфузию, пероральное введение и подкожную инъекцию.

Соединения по настоящему изобретению демонстрируют приемлемые фармакокинетические профили при введении различными клинически релевантными путями.

Обсуждение

Не желая быть связанными теорией, авторы настоящего изобретения считают, что соединения по настоящему изобретению связываются в BIR доменах XIAP и предотвращают взаимодействие активированных каспаз с XIAP и вызывают потерю белка XIAP в клетках. В частности, представленные данные подтверждают, что соединения по настоящему изобретению могут существенно снижать или существенным образом устранять взаимодействие XIAP с активной каспазой-9 и с активной каспазой-3. Поскольку каспаза-7 также может связываться с BIR2 сайтом XIAP, возможно, что соединения также препятствуют связыванию активированной каспазы-7 с XIAP. Другие данные также показывают, что соединения по настоящему изобретению индуцируют потерю cIAP-1 и -2 в клетках в течение 1-5 часов после добавления соединения. Таким образом, возможный механизм во многих раковых клетках является таким, что соединения по настоящему изобретению связываются с cIAPs и через убихитинопосредованную деградацию индуцируют потерю их функции и способствуют апоптозу целевых клеток или стимулируют его. Обобщая вышесказанное, соединения по настоящему изобретению через непосредственный контакт в IAPs ингибируют функцию IAP в клетках, способствуют апоптозу клеток или стимулируют его и в некоторых клетках обеспечивают синергическую активность индукторов апоптоза.

Все ссылки на литературу, патенты, опубликованные патентные заявки, приведенные в настоящей заявке, включены в настоящую заявку посредством ссылки во всей их полноте.

Хотя были описаны конкретные варианты воплощения, специалистам в данной области должно быть понятно, что возможны изменения, не нарушающие суть настоящего изобретения, которая определяется исключительно в соответствии с представленной ниже формулой изобретения.

1. Соединение формулы I

где n имеет значение 0 или 1;
m имеет значение 0, 1 или 2;
Y представляет собой О;
W представляет собой
или
где X представляет собой С13 алкил, который образует часть кольцевой системы, и G представляет собой 5-, 6- или 7-членную кольцевую систему; и
W1 представляет собой
или
где X1 и G1 имеют значения, определенные для X и G соответственно; или
В представляет собой

Q и Q1 независимо представляют собой
1) -СН2- или
2) -С(О)-;
А и А1 независимо представляют собой
1) NR6 или
2) NR600;
BG представляет собой
1) -Y1-L-Y100-;
2) -L- или
3) -Y1-L1-Z-L100-Y100-, где L1 и L100 имеют одинаковые значения или
4)
Y1 и Y100 независимо представляют собой
1) -С(О)-,
2) -S(O)2- или
3) -C(O)N(R8)-;
L, L1 и L100 представляют собой
1) -С112алкил-
2) -арил-,
3) -бифенил-,
4) -тиенил-,
5) -C16алкил-арил-С16алкил или
6) -С16 алкил-О-С16 алкил;
Z представляет собой
1) -N(R8)CON(R8)-,
2) -N(R8)C(O)-арил-C(O)N(R8)-,
3) -С(O)-,
4) -N(R8)-C(O)C(O)-N(R8)-,
5) -N(R8)-С(О)-С112-алкил-С(О)-N(R8)-,
6) -N(R8)-C(O)-гетероарил-C(O)-N(R8)-,
7) -N(R8)-С(О)-бифенил-С(О)-N(R8)-,
8) -N(R8)-S(O)2-арил-S(O)2N(R8)- или
9) -N(R8)-S(О)2-бифенил-S(О)2-N(R8)-,
R1 и R100 независимо представляют собой
1) Н или
2) С16 алкил;
Rla и R100a представляют собой Н;
R2, R3, R200 и R300 каждый независимо представляет собой Н или С16алкил, необязательно замещенный одним или несколькими заместителями R7;
R4 R5 R5a R400 R500 и R500a представляют собой Н;
R6 и R600 каждый независимо представляет собой
1) Н,
2) С16алкил,
3) арил или
4) C(O)(O)n-R12,
где алкил является необязательно замещенным одним или несколькими заместителями R7;
R7 представляет собой
1) С16алкил,
2) С37циклоалкил,
3) арил,
4) гетероарил,
5) тиенил,
6) тетразолил или
7) NR9R10,
где арил или тетразолил необязательно замещены одним или несколькими заместителями R11;
R8 представляет собой
1) Н или
2) С16алкил,
R9 и R10 каждый независимо представляет собой
1) Н или
2) C(O)Y-R12,
R11 представляет собой
1) галоген,
2) галогеналкил,
3) OR8,
4) арил или
6) тетразолил,
R12 представляет собой
1) С16 алкил, необязательно замещенный одним или несколькими заместителями R7;
где арил представляет собой карбоциклическую ароматическую моноциклическую группу, содержащую 6 атомов углерода, которая может быть конденсированной со второй 5- или 6-членной карбоциклической группой, которая может быть ароматической, насыщенной или ненасыщенной, и арил присоединен в положении на карбоциклической ароматической моноциклической группе, содержащей 6 атомов углерода, или необязательно на второй 5- или 6-членной карбоциклической группе, которая может быть ароматической, насыщенной или ненасыщенной, или его фармацевтически приемлемая соль.

2. Соединение по п.1, в котором W представляет собой

и W1 представляет собой

3. Соединение по п.1, в котором W представляет собой

и W1 представляет собой

4. Соединение по п.1, в котором Q и Q1 оба представляют собой -СН2-.

5. Соединение по п.1, в котором BG представляет собой -Y1-L-Y100-.

6. Соединение по п.1, в котором L представляет собой нафтил или бифенил.

7. Соединение по п.1, представляющее собой соединение
формулы 1А1

формулы 1А2

формулы 1А4

формулы 1А5

или
формулы 1А6

8. Соединение по п.1, в котором Y1 и Y100 оба представляют собой -С(О)-.

9. Соединение по п.1, в котором R1 и R100 представляют собой СН3.

10. Соединение по п.1, в котором соединение демонстрирует (S)-стереохимию при R2 и R200.

11. Соединение по п.1, в котором R3 и R300 представляют собой Н, (S)- метил, (S)-этил, (S)-трет-бутил, (S)-циклогексилметил, (S)-2-фенилэтил или бензил (S)-бутилкарбамат.

12. Соединение по п.1, в котором R6 и R600 каждый независимо представляет собой
1) Н,
2) С16алкил, необязательно замещенный арилом, или
3) арил.

13. Соединение по п.1, в котором R6 и R600 представляют собой
Н, -СН(СН3)2, -СН2СН2С(СН3)3,







и

14. Соединение по п.1, в котором R11 представляет собой F, Cl, Br, ОН, ОМе, CF3, фенил или тетразол.

15. Соединение по п.1, представленное формулой

где BG представляет собой




и
и R6 и R600 независимо выбраны из Н, алкила или



16. Соединение по п.1, выбранное из группы, состоящей из

Соедин. № Структура
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
44
45
46
47
48
49
50
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
71
72
73
74
75
76
77
78
79
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
105

и его фармацевтически приемлемые соли.

17. Промежуточное соединение, представленное формулой 1-v:

формулой 5-i:

формулой 6-iv:

формулой I-ia:

формулой I-iia:

или его соли, где
PG3, PG4 и PG400 означают защитные группы, независимо выбранные из Alloc, Fmoc, Bn, Boc, CBz и COCF3;
X, X1 каждый означает С13алкил, который образует часть кольцевой системы;
G означает 5-, 6- или 7-членную кольцевую систему;
Q и Q1 независимо представляют собой
1) -СН- или
2) -С(О)-;
А и А1 независимо представляют собой
1) NR6 или
2) NR600;
BG представляет собой
1) -Y1-L-Y100-;
2) -L-;
3) -Y1-L1-Z-L100-Y100-, где L1 и L100 равны, или
4)
Y1 и Y100 независимо представляют собой
l) -c(O)-,
2) -S(O)2- или
3) -C(O)N(R8)-;
L, L1 и L100 представляют собой
1) -C112алкил-
2) -арил-,
3) -бифенил-,
4) -тиенил-
5)-С16алкил-арил-С16алкил или
6) -C16алкил-О-С16алкил;
Z представляет собой
1) -N(R8)CON(R8)-,
2) -N(R8)C(O)-арил-C(O)N(R8)-,
3) -С(О),
4) -N(R8)-C(O)C(O)-N(R8)-,
5) -N(R8)-C(O)-C1-C12-алкил-C(O)-N(R8)-,
6) -N(R8)-C(O)-гетероарил-C(O)-N(R8)-,
7) -N(R8)-С(О)-бифенил-С(О)-N(R8)-,
8) -N(R8)-S(O)2-арил-S(O)2-N(R8)- или
9) -N(R8)-S(O)2-бифенил-S(O)2-N(R8)-;
R1 и R100 независимо представляют собой
1) Н или
2) С16алкил;
R2, R3, R200 и R300 каждый независимо представляет собой Н или С16алкил, необязательно замещенный одним или несколькими заместителями R7;
R4, R5, R5a, R400, R500 и R5OOa представляют собой Н;
R6 и R600 каждый независимо представляет собой
1) Н,
2) С16алкил,
3) арил или
4) C(O)(O)n-R12,
где алкил является необязательно замещенным одним или несколькими заместителями R7;
R7 представляет собой
1) С16алкил,
2) С37циклоалкил,
3) арил,
4) гетероарил,
5) тиенил,
6) тетразолил или
7) NR9R10,
где арил, или тетразолил необязательно замещены одним или несколькими заместителями R11;
R8 представляет собой
1) Н или
2) С16алкил,
R9 и R10 каждый независимо представляет собой
1) Н или
2) C(O)Y-R12,
R11 представляет собой
1) галоген,
2) галогеналкил,
3) OR8,
4) арил или
5) тетразолил,
R12 представляет собой С16алкил, необязательно замещенный одним или несколькими заместителями R7;
где арил представляет собой карбоциклическую ароматическую моноциклическую группу, содержащую 6 атомов углерода, которая может быть конденсированной со второй 5- или 6-членной карбоциклической группой, которая может быть ароматической, насыщенной или ненасыщенной, и арил присоединен в положении на карбоциклической ароматической моноциклической группе, содержащей 6 атомов углерода, или необязательно на второй 5- или 6-членной карбоциклической группе, которая может быть ароматической, насыщенной или ненасыщенной.

18. Способ получения соединения формулы 2i, где указанный способ включает:
а) смешивание двух промежуточных соединений, представленных формулой 1-v

и LG-C(O)-L-C(O)-LG в растворителе в присутствии основания и
b) удаление защитной группы PG3 с получением соединения формулы 2-i

или его соли,
где PG3 представляет собой защитную группу, выбранную из Alloc, Fmoc, Bn, Boc, CBz и COCF3,
LG является уходящей группой, выбранной из Cl, Br, I, OTs или OMs;
каждый из X и X1 представляет собой С13алкил, который образует часть кольцевой системы;
L представляет собой
1) -С112алкил-;
2) арил;
3) бифенил;
4) тиенил;
5) -С16алкил-арил-С16 алкил или
6) -C16алкил-О-С16алкил;
R1 и R100 независимо представляют собой
1) Н или
2) С16алкил;
R2, R3, R200 и R300 каждый независимо представляет собой Н или С16алкил, необязательно замещенный одним или несколькими заместителями R7;
R4, R5, R5a, R400, R500 и R500a представляют собой Н;
R6 и R600 каждый независимо представляет собой
1) Н,
2) С16алкил,
3) арил или
4) C(O)(O)n-R12,
где алкил является необязательно замещенным одним или несколькими заместителями R7;
R7 представляет собой
1) C16алкил,
2) С37циклоалкил,
3) арил,
4) гетероарил,
5) тиенил,
6) тетразолил или
7) NR9R10,
где арил или тетразолил необязательно замещены одним или несколькими заместителями R11;
R8 представляет собой
1) Н или
2) С16 алкил,
R9 и R10 каждый независимо представляет собой
1) Н или
2) C(O)Y-R12,
R11 представляет собой
1) галоген,
2) галогеналкил,
3) OR8,
4) арил или
5) тетразолил,
R12 представляет собой С16алкил, необязательно замещенный одним или несколькими заместителями R7;
где арил представляет собой карбоциклическую ароматическую моноциклическую группу, содержащую 6 атомов углерода, которая может быть конденсированной со второй 5- или 6-членной карбоциклической группой, которая может быть ароматической, насыщенной или ненасыщенной, и арил присоединен в положении на карбоциклической ароматической моноциклической группе, содержащей 6 атомов углерода, или необязательно на второй 5- или 6-членной карбоциклической группе, которая может быть ароматической, насыщенной или ненасыщенной.

19. Способ получения фармацевтически приемлемой соли соединения формулы (I) по любому одному из пп.1-16 путем обработки соединения формулы I 1-2 эквивалентами фармацевтически приемлемой кислоты.

20. Фармацевтическая композиция для лечения или профилактики пролиферативного расстройства или болезненного состояния, характеризующегося недостаточным апоптозом, содержащая терапевтически эффективное количество соединения по любому из пп.1-16, и фармацевтически приемлемый носитель, разбавитель или эксципиент.

21. Фармацевтическая композиция по п.20, дополнительно включающая одно или несколько соединений формулы I в сочетании с одним или несколькими агонистами рецептора гибели.

22. Фармацевтическая композиция по п.21, где агонистом рецептора гибели является TRAIL-рецептор.

23. Фармацевтическая композиция по п.20, дополнительно включающая терапевтическое средство, которое усиливает ответ одного или нескольких агонистов рецептора гибели.

24. Соединение по любому из пп.1-16 для лечения или предотвращения пролиферативного расстройства или болезненного состояния, характеризующегося недостаточным апоптозом.

25. Применение соединения по любому из пп.1-16 для получения лекарственного средства для лечения или профилактики пролиферативного расстройства или болезненного состояния, характеризующегося недостаточным апоптозом.

26. Применение соединения по любому из пп.1-16 в сочетании с агонистом рецептора гибели для лечения или профилактики пролиферативного расстройства или болезненного состояния, характеризующегося недостаточным апоптозом.

27. Применение по п.26, где агонистом рецептора гибели является TRAL- или TRAIL-рецептор антитела.

28. Зонд, представляющий собой соединение по любому из пп.1-16 и меченное детектируемой меткой или аффинной меткой, выбранной из группы, включающей флуоресцеин, орегон зеленый, дансил, родамин, тетраметилродамин, техас красный, Eu3+; люциферазу, тритий, I125, биотин и полигистидин.

29. Зонд по п.28, имеющий следующую формулу:

30. Способ идентификации соединений, которые связываются с BIR доменом IAP, где такой анализ включает:
a) контактирование BIR-домена IAP с зондом по п.28 с образованием комплекса зонд - BIR-домен, при этом указанный зонд является замещаемым испытуемым соединением;
b) измерение сигнала от зонда для установления контрольного уровня;
c) инкубацию комплекса зонд: BIR-домен с испытуемым соединением;
d) измерение сигнала от зонда;
e) сравнение сигнала со стадии d) с контрольным уровнем, при этом модуляция сигнала является показателем того, что испытуемое соединение связывается с BIR-доменом.

31. Соединение, выбранное из группы, состоящей из







или его фармацевтически приемлемые соли.

32. Способ получения соединения формулы 5ii, где способ включает
а) смешивание двух промежуточных соединений, представленных формулой 5-i:

и LG-L-LG в растворителе в присутствии основания и
b) удаление защитной группы PG3 с получением соединения формулы I, представленного формулой 5-ii:

или его соли,
где PG3 представляет собой защитную группу, выбранную из Alloc, Fmoc, Bn, Boc, CBz и COCF3,
LG является уходящей группой, выбранной из Cl, Br, I, OTs или OMs;
X и X1 каждый представляет собой С13алкил, который образует часть кольцевой системы;
Z представляет собой
1) -N(R8)CON(R8)-,
2) -N(R8)С(О)-арил-С(О)N(R8)-,
3) -С(О)-,
4) -N(R8)-C(O)C(O)-N(R8)-,
5) -N(R8)-С(О)-С112-алкил-С(О)-N(R8)-,
6) -N(R8)-С(О)-гетероарил-С(О)-N(R8)-,
7) -N(R8)-С(О)-бифенил-С(О)-N(R8)-,
8) -N(R8)-S(O)2-арил-S(O)2-N(R8)- или
9) -N(R8)-S(О)2-бифенил-S(О)2-N(R8)-,
R1 и R100 независимо представляют собой
1) Н или
2) С16алкил;
R2, R3, R200 и R300 каждый независимо представляет собой Н или С16алкил, необязательно замещенный одним или несколькими заместителями R7;
R4, R5, R5a, R400, R500 и R500a представляют собой Н;
R6 и R600 каждый независимо представляет собой
1) Н,
2) С16алкил,
3) арил или
4) C(O)(O)n-R12,
где алкил является необязательно замещенным одним или несколькими заместителями R7;
R7 представляет собой
1) С16алкил,
2) С37циклоалкил,
3) арил,
4) гетероарил,
5) тиенил,
6) тетразолил или
7) NR9R10,
где арил, или тетразолил необязательно замещены одним или несколькими заместителями R11;
R8 представляет собой
1) Н или
2) C16алкил,
R9 и R10 каждый независимо представляет собой
1) Н или
2) C(O)Y-R12,
R11 представляет собой
1) галоген,
2) галогеналкил,
3) OR8,
4) арил или
5) тетразолил,
R12 представляет собой С16алкил, необязательно замещенный одним или несколькими заместителями R7;
где арил представляет собой карбоциклическую ароматическую моноциклическую группу, содержащую 6 атомов углерода, которая может быть конденсированной со второй 5- или 6-членной карбоциклической группой, которая может быть ароматической, насыщенной или ненасыщенной, и арил присоединен в положении на карбоциклической ароматической моноциклической группе, содержащей 6 атомов углерода, или необязательно на второй 5- или 6-членной карбоциклической группе, которая может быть ароматической, насыщенной или ненасыщенной.

33. Способ получения соединения формулы 6v, где способ включает:
а) смешивание двух промежуточных соединений, представленных формулой 6-iv:

и
в растворителе с агентом сочетания, и b) удаление защитной группы PG3 с получением соединения формулы 6-v:

где PG3 представляет собой защитную группу, выбранную из Alloc, Fmoc, Bn, Boc, CBz и COCF3,
каждый из X и X1 представляет собой С13алкил, который образует часть кольцевой системы;
L представляет собой
1) -C112алкил-;
2) арил;
3) бифенил;
4) тиенил;
5) -С16алкил-арил-С16алкил или
6) -С16алкил-О-С16алкил;
R1 и R100 независимо представляют собой
1) Н или
2) C16алкил;
R2, R3, R200 и R300 каждый независимо представляет собой Н или С16алкил, необязательно замещенный одним или несколькими заместителями R7;
R4, R5, R5a, R400, R500 и R500a представляют собой Н;
R6 и R600 каждый независимо представляет собой
1) Н,
2) C16алкил,
3) арил или
4) C(O)(O)n-R12,
где алкил является необязательно замещенным одним или несколькими заместителями R7;
R7 представляет собой
1) С16алкил,
2) С37циклоалкил,
3) арил,
4) гетероарил,
5) тиенил,
6) тетразолил или
7) NR9R10,
где арил или тетразолил необязательно замещены одним или несколькими заместителями R11;
R8 представляет собой
1) Н или
2) C16алкил,
R9 и R10 каждый независимо представляет собой
1) Н или
2) C(O)Y-R12,
R11 представляет собой
1) галоген,
2) галогеналкил,
3) OR8,
4) арил или
5) тетразолил,
R12 представляет собой С16алкил, необязательно замещенный одним или несколькими заместителями R7;
где арил представляет собой карбоциклическую ароматическую моноциклическую группу, содержащую 6 атомов углерода, которая может быть конденсированной со второй 5- или 6-членной карбоциклической группой, которая может быть ароматической, насыщенной или ненасыщенной, и арил присоединен в положении на карбоциклической ароматической моноциклической группе, содержащей 6 атомов углерода, или необязательно на второй 5- или 6-членной карбоциклической группе, которая может быть ароматической, насыщенной или ненасыщенной.



 

Похожие патенты:

Изобретение относится к области фармацевтической химии, а именно к химии пептидов и более конкретно к новому способу получения нонапептидэтиламида формулы и промежуточным соединениям для его получения.

Изобретение относится к области пептидной и фармацевтической химии, конкретно к способу получения защищенного метилового эфира O-трет-бутил-N-(N -трет-бутоксикарбонил-L-лизил)-L-треонина.

Изобретение относится к новым соединениям формулы (IVa), которые ингибируют связывание белка Smac с ингибитором белков апоптоза (IAP).1н.и 3 з.п. .

Изобретение относится к соединениям, обладающим агонистической или антагонистической активностью нейротрофинов NGF и BDNF и представляющим собой мономерные или димерные замещенные дипептиды, которые являются аналогами экспонированных наружу участков петель 1 или 4 этих нейротрофинов, близких к бета-изгибам этих петель или совпадающих с ними.

Изобретение относится к соединениям, обладающим агонистической или антагонистической активностью нейротрофинов NGF и BDNF и представляющим собой мономерные или димерные замещенные дипептиды, которые являются аналогами экспонированных наружу участков петель 1 или 4 этих нейротрофинов, близких к бета-изгибам этих петель или совпадающих с ними.

Изобретение относится к липодипептиду, представляющему собой 1-гексадецил-5-(1-пиренбутил)-N-(L-орнитил)-L-глутамат бисхлорид, который проявляет способность доставлять нуклеиновые кислоты в клетки и содержит в своей структуре стабильную флуоресцентную метку в виде пирена.

Изобретение относится к новому средству, снижающему влечение к алкоголю, представляющему собой гидроксизамещенные флаваноиды общей формулы 1, где R1, R2, R3, и R5 независимо друг от друга представляют собой атом водорода или необязательно замещенный гидроксил; R4 представляет собой атом водорода, гидроксил, необязательно замещенный моносахарид, за исключением -D-глюкопиранозила и -L-рамнопиранозила(6-дезокси- -L-маннопиранозила), необязательно замещенный дисахарид; R6 представляет собой атом водорода или метил.

Изобретение относится к полиморфу 2-[4-(3-хинолин-6-илметил-3Н-[1,2,3]триазоло[4,5-b]пиразин-5-ил)пиразол-1-ил]этанола, в частности к новой кристаллической фосфатной соли 2-[4-(3-хинолин-6-илметил-3Н-[1,2,3]триазоло[4,5-b]пиразин-5-ил)пиразол-1-ил]этанола.
Изобретение относится к медицине, онкологии, и может быть использовано для органосохраняющего лечения больных начальной формы рака вульвы. .

Изобретение относится к лекарственному средству, способу лечения или профилактики системного мастоцитоза. .

Изобретение относится к комбинированной терапии, при которой анти-IL-4R-антитело или фрагмент антитела вводят в комбинации со вторым терапевтическим средством. .

Изобретение относится к новому химическому соединению, а именно к N-этилпиперазиламиду бетулоновой кислоты формулы (I): которое может быть использовано в медицине в качестве лекарственного средства, обладающего противоопухолевым действием.

Изобретение относится к соединению формулы I в которой: Х8 представляет собой N, а X 5 и X6 представляют собой СН; R7 представляет собой фенил или C5-6-гетероарильную группу, необязательно замещенную одной или несколькими группами, выбранными из галогена, гидроксигруппы, нитрогруппы, цианогруппы, карбоксигруппы и тиола, или фенила, или метоксигруппы, -С(=O)СН3, -С(=O)ОСН3, -С(=O)ОСН2СН3, -С(=O)ОС(СН 3)3, -C(=O)NH2, -С(=O)NHCH3 , -C(=O)N(CH3)2, -С(=O)NHCH2 CH3, -С(=O)N(СН2СН3)2 , -NH2, -NHCH3, -N(СН3) 2, -NHCH(СН3)2, -N(СН2 СН3)2 или C1-4-алкила, необязательно замещенного гидроксигруппой; RN3 и RN4, вместе с атомом азота, к которому они присоединены, образуют гетероциклическое кольцо, выбранное из морфолинового, тиоморфолинового, пиперидинильного, пиперазинильного, гомопиперазинильного и пирролидинильного кольца, необязательно замещенного на атоме углерода одной или двумя C1-4-алкильными группами; R2 представляет собой NRN5RN6, где RN5 и R N6, вместе с атомом азота, к которому они присоединены, образуют гетероциклическое кольцо, выбранное из морфолинового, тиоморфолинового, пиперидинильного, пиперазинильного, гомопиперазинильного и пирролидинильного кольца, необязательно замещенного на атоме углерода одной или двумя C1-4-алкильными группами; или его фармацевтически приемлемая соль, и где "С5-6 -гетероарил" означает гетероарильную группу, выбранную из фурана, тиофена, пиррола, имидазола, пиразола, триазола, оксазола, изоксазола, тиазола, изотиазола, оксадиазола, тетразола, оксатриазола, изоксазина, пиридина, пиридазина, пиримидина, пиразина и триазина; и где "С3-5-гетероциклил", как здесь используется, относится к одновалентной структуре, получаемой путем удаления атома водорода из кольцевого атома гетероциклического соединения, где эта структура содержит 5 или 6 кольцевых атомов, из которых от 1 до 4 являются кольцевыми гетероатомами, выбранными из кислорода, азота и серы; и при условии, что когда R2 представляет собой незамещенную морфолиновую группу, RN3 и R N4 вместе с атомом азота, к которому они присоединены, образуют незамещенную морфолиновую группу, R7 не представляет собой незамещенный фенил, и когда R2 представляет собой незамещенный пиперидинил, RN3 и RN4 вместе с атомом азота, к которому они присоединены, образуют незамещенный пиперидинил, R7 не представляет собой незамещенный фенил.

Изобретение относится к новым соединениям формулы (I), где для лечения заболевания, которое связано с ингибированием активности протеинкиназы, особенно опухолевого заболевания, в частности лейкемии, способу лечения такого заболевания и способу получения соединений.
Изобретение относится к медицине и касается пероральной фармацевтической композиции для лечения воспалительных заболеваний желудочно-кишечного тракта, включающей альгинат натрия, функциональную добавку и воду.
Наверх