Рекомбинантная вакцина против вируса африканской катаральной лихорадки

Группа изобретений относится к области медицины и касается рекомбинантной вакцины против вируса африканской катаральной лихорадки. Сущность изобретений включает варианты иммуногенной композиции для индуцирования иммунного ответа против Orbivirus, более специфично вируса синего языка (BTV), у животного, восприимчивого к инфекции, вызванной BTV. Композиция может включать фармацевтически или ветеринарно приемлемое связующее вещество или наполнитель и вектор. Вектор может содержать гетерологичную молекулу(ы) нуклеиновой кислоты, экспрессирующую in vivo в организме животного BTV антиген, иммуноген или их эпитоп белков VP2 и VP5. Композиция может содержать адъювант, такой как карбомер. Изобретение также включает способ индуцирования иммунологического или защитного ответа и набор. Преимущество изобретений заключается в усилении иммунного ответа. 5 н. и 24 з.п. ф-лы, 19 пр., 8 табл., 21 ил.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к векторам, содержащим, по меньшей мере, один полинуклеотид рода Orbivirus семейства Reoviridae, более специфично, вируса африканской катаральной лихорадки, называемого вирус синего языка (BTV), или, по меньшей мере, одну молекулу нуклеиновой кислоты, кодирующую, по меньшей мере, один BTV антиген, иммуноген или эпитоп, напр., in vivo и in vitro экспрессирующим векторам, которые могут содержать и экспрессировать, по меньшей мере, один полинуклеотид BTV, или in vivo и in vitro экспрессирующим векторам, которые могут содержать и экспрессировать, по меньшей мере, один BTV антиген, иммуноген или эпитоп, а также к иммуногенным композициям и вакцинам против заболевания синий язык; например, таким композициям или вакцинам, которые могут содержать один или более векторов и/или один или более продуктов экспрессии векторов. Изобретение также относится к способам применения векторов, композиций и вакцин, включая иммунизацию и вакцинацию против этого вируса, экспрессирующего продукты экспрессии полинуклеотида(ов), используя продукты экспрессии в анализах или для получения антител, пригодных в анализах, а также к способам приготовления полинуклеотида(ов), векторов, композиций, вакцин, анализов, inter alia.

Предшествующий уровень техники

Африканская катаральная лихорадка или заболевание синий язык (ВТ) представляет антропонозное инфекционное вирусное заболевание жвачных животных. Крупный рогатый скот и козы могут с легкостью заражаться вызывающим заболевание вирусом BTV, но без обширного сосудистого поражения, и, следовательно, эти виды обычно не в состоянии показывать выраженные клинические симптомы. Наоборот, заболевание у овец характеризуется катаральным воспалением слизистых оболочек рта, носа и кардиального отдела желудка и воспалением венчиков копыт и пластинки копыт. Наблюдается отслаивание эпителия и, в конечном счете, некроз слизистой оболочки щеки; вздутые и воспаленные язык и рот могут окрашиваться в синий цвет, из-за чего эта болезнь получила свое название (Spreull 1905). Уровень смертности овец насчитывает 1-30%.

BTV представляет собой прототипный вирус рода Orbivirus (семейство Reoviridae) и имеет, по меньшей мере, 24 различных серотипов (Wilson and Mecham 2000). Различные штаммы BTV идентифицированы во всем мире во всех тропических и температурных зонах. BTV инфекция происходит до 45°N в Европе, до 50°N в Азии и Северной Америке и до 35° в Южной. BTV не является контагиозным среди жвачных животных, таким образом распространение BTV зависит от присутствия членистоногих векторных видов coides sp. (biting midges), с различными векторными вилами, находящимися в различных частях мира. Последние данные полагают, что генетический дрейф и эффект основателя обеспечивают разнообразие отдельных генных сегментов полевых штаммов BTV (Bonneau, Mullens et al. 2001). Показано, что BTV серопозитивные животные резистентны к повторному инфицированию гомологичным серотипом BTV.

BTV инфицирование у жвачных является транзиторным, тогда как инфицирование вектором насекомых Culicoides - персистентным. Продолжительность виремии зависит от животных видов и штамма BTV. Было отмечено, что виремия может быть транзиторной у овец и может длиться до 41 дня у BTV-инфицированных индивидуумов, до 42 дней у коз и до 100 дней у крупного рогатого скота. Поскольку BTV инфекция крупного рогатого скота часто приводит к длительной, но не персистентной, виремии, крупный рогатый скот служит как резервуар, из которого вирус может заражаться вектором Culicoides и затем передаваться другим жвачным (Anderson, Stott et al. 1985; MacLachlan 1994; MacLachlan and Pearson 2004). Экология многих видов векторов Culicoides плохо изучена, их место расположения не охарактеризовано, и их скорости распространения не известны. Culicoides sonorensis представляет главный вектор BTV в Северной Америке. Самки насекомых Culicoides становятся устойчиво инфицированными BTV и могут переносить вирус после наружного периода инкубации, длящегося до 14 дней (Mullens, Tabachnick et al. 1995). BTV, перезимовавший в умеренных зонах, может проникать посредством вертикального инфицирования инсектицидными векторами, хотя последние данные показывают, что наблюдается сниженная экспрессия внешних капсидных генов в течение персистентной инфекции BTV на стадиях личинки векторов насекомых (White, Wilson et al. 2005).

Вирионы BTV имеют диаметр ~69 нм с двухслойным покрытием (капсид), который иногда окружается липопротеиновой "псевдо-оболочкой", полученной из клеточных мембран инфицированных клеток. BTV геном включает 10 разных сегментов двухцепочечной РНК, которые вместе кодируют семь структурных (VP1 - VP7) и четыре неструктурных (NS1, NS2, NS3 и NS3a) протеина (Roy 1996); 9 геномных сегментов являются моноцистронными, при этом сегмент 10 кодирует и NS3 и NS3A, используя второй, внутрирамочный стартовый кодон. Геномная РНК заключена в капсид в двадцатигранной вирионной частице посредством двухслойного протеинового капсида (Verwoerd, Els et al. 1972). Двадцатигранное ядро состоит из двух главных (VP3 и VP7) и трех минорных протеинов (VP1, VP4, VP6) и окружено внешним капсидом, который состоит из VP2 и VP5, которые соответственно кодируются геномными сегментами 2 и 5 (Roy 1996). VP2 является ответственным за связывание и вхождение BTV в клетки, нейтрализацию, серотип-специфичность и гемагглютинацию. Многомерные формы VP2 (димеры и тримеры) отделывают большую часть поверхности VP5, помещенного на внешнюю поверхность вирусных частиц (Hassan and Roy 1999). VP2 различается наиболее среди 24 BTV серотипов, и уровни анти-VP2 антитела коррелируют с вирусной нейтрализацией in vitro и in vivo (Huismans and Erasmus 1981). VPS также отличается значительно между различными серотипами и штаммами BTV (de Mattos, de Mattos et al. 1994; DeMaula, Bonneau et al. 2000), и хотя не было определено VP5-специфичных нейтрализующих MAb, данные полагают, что этот протеин играет роль в нейтрализации и определении серотипа через его конформационное влияние на VP2 (Huismans and Erasmus 1981; Roy, Urakawa et al. 1990; DeMaula et al., 2000). Очищенный VP2, иммуноабсорбированный с помощью BTV anti-core сыворотки с устранением следовых количеств VP7, был введен овцам. Начальная доза в 50 микрограммов VP2 была достаточной для индуцирования VP2-оседающих антител, а также нейтрализующих и ингибирующих гемагглютинацию антител. Эти овцы были полностью защищены против провокации вирулентным штаммом этого же серотипа BTV. Более низкие дозы VP2 еще обеспечивали значимый уровень защиты, даже если нейтрализующее антитело не определялось перед провокацией (Huismans, van der Walt et al. 1987). Последние результаты показали, что VP2 и NS1 экспрессируют эпитопы, узнаваемые цитотоксичными Т-лимфоцитами (CTL) (Andrew, Whiteley et al. 1995), хотя невероятно, что VP7 и VP5 имеют CTL эпитопы. В данное время VP3, VP4, VP6, NS2 и NS3 не стимулируют CTL ответ у овец (Lobato, Coupar et al. 1997). Таблица 1 (модифицированные из (Wilson and Mecham 2000)) ниже суммирует гены BTV и их протеиновые функции:

Таблица 1
Гены вируса синий язык и кодирующие протеины с положением, свойствами и действием протеинов
Часть генома Протеин Положение Свойства и действие
L1 (3954 пн) (150 кДа) VP1 В sub-core на оси 5 порядка РНК-зависимая РНК-полимераза
L2 (2926 пн) (111 кДа) VP2 Наружный капсид (тример) Наружный капсид, серотип специфичный антиген, протеин связывающий клетки млекопитающих, нейтрализующие эпитопы
L3 (2770 пн) (103 кДа) VP3 Sub-core капсидный слой (Т=2 симметрия) Отдаленная протеиновая капсидная оболочка, sub-core капсидный слой, самосборные, поддерживает двадцатигранную симметрию, РНК связывание, взаимодействует с внутренними малыми протеинами
М4 (2011 пн) (76кДа) VP4 В sub-core на оси 5 порядка (димер) Кэппинг фермент. Гуанилилтрансфераза
М5 (1638 пн) (59 кДа) VP5 Наружный капсид (тример) Внутренний внешний капсидный протеин, может затрагивать характеристики вирусного серотипа
М6 (1769 пн) (64 кДа) NS1 Цитоплазма Формы тубул в клеточной цитоплазме
S7 (1156 пн) (38кДа) VP7 Наружный капсид (Т=13 симметрия, тример) Наружный core поверхностный протеин, иммуно-доминантный главный специфичный к серогруппе антиген, протеин прикрепления для векторных инсектиционных клеток, взаимодействует с 'core нейтрализирующими 'антителами
S8 (1124 пн) (41 кДа) NS2 Цитоплазма, вирусные тельца включения (VIB) Важные вирусные включения основной матрицы протеин, ssRNA связывание, фосфорилированный, может связываться с внешним капсидом
S9 (1046 пн) (36 кДа) VP6 В sub-core на оси 5 порядка ssRNA и dsRNA связывание, геликаза, МТРаза
S10 (822 пн) (24 кДа) NS3, NS3a Клеточные мембраны Гликопротеины, мембранные протеины, включенные в клеточный выход

Lobato и Coupar (Lobato, Coupar et al. 1997) разработали вакцинные основанные на вирусе экспрессирующие векторы, содержащие различные включения, соответствующие нуклеотидным последовательностям, кодирующим структурные протеины VP2, VP5 и VP7 BTV для обоих in vivo и in vitro исследований. Эти экспрессирующие векторы вводили кроликам и овцам с развитием иммунного ответа относительно ELISA и титра нейтрализующих антител и исследовали защитную эффективность VP2 и VP5 конструкций у овец. Вакцинные вирус-экспрессирующие VP2, VP5 и VP2+VP5 являлись защитными, с наиболее повторяемой защитой, проявляющейся у животных, иммунизированных обоими VP2 и VP5, хотя защита даже этими конструкциями различалась.

Будет выгодно обеспечить усовершенствованные иммуногенные и вакцинные композиции против BTV и способы приготовления и применения таких композиций, включая такие композиции, которые обеспечивают способы дифференциальной диагностики, анализы и наборы.

Каждая из вышеуказанных заявок совместно с документом, цитируемым здесь, и каждый из документов, на который ссылаются и который цитируется здесь, объединены посредством ссылки.

Каждый документ, цитируемый в тексте ("документы, цитируемые в заявке"), и каждый документ, цитируемый или на который ссылаются в каждом документе, цитируемом в заявке, и любые характеристики производителя или инструкции для любых продуктов упомянуты в тексте и в любом документе, объединенном в этом тексте, объединены здесь посредством ссылки; и технология в каждом из документов, объединенных здесь посредством ссылки, может использоваться в способе применения данного изобретения.

Цитата или определение любого документа в данной заявке не является признанием, что такой документ является пригодным в качестве уровня техники настоящего изобретения.

Сущность изобретения

Изобретение обеспечивает иммуногенную или вакцинную композицию для индуцирования иммунного ответа или защитной иммунной реакции против Orbivirus, в особенности вируса синий язык (BTV), у животных, восприимчивых к BTV, или сходного вируса, содержащую или состоящую преимущественно из фармацевтически или ветеринарно-приемлемого связующего вещества или наполнителя и вектора, который содержит или состоит преимущественно из гетерологичной(ых) молекулы(л) нуклеиновой кислоты и который экспрессирует в животном in vivo Orbivirus - BTV протеин, антиген, иммуноген или его эпитоп, такие как, но не ограничиваясь, BTV VP2 (L2) и BTV VP5 (М5) полипептиды.

Вектором может быть рекомбинантная ДНК плазмида или рекомбинантный вирус, такой как рекомбинантный аденовирус, вирус герпеса или вирус оспы, напр., вирус avipox, такой как вирус оспы канареек или вирус оспы птиц. Животное может выбираться из группы парнокопытных, состоящей из овцы, быки, свиньи, козы, антилопы, лошади, ламы и других.

Преимущественно молекула нуклеиновой кислоты содержит или состоит преимущественно из нуклеотидов 20-2887 (SEQ ID NO:3 и 1), кодирующих BTV VP2 (L2), и соответственно нуклеотидов 30-1610 (SEQ ID NO:4 и 2), кодирующих BTV протеин VP5 (М5). Предпочтительное воплощение содержит или состоит из молекул нуклеиновой кислоты млекопитающих с оптимизированными кодонами.

Иммуногенная или вакцинная композиция может дополнительно содержать адъювант, такой как карбомер.

Иммуногенная или вакцинная композиция может дополнительно содержать антиген или иммуноген или его эпитоп из патогена животного, иного, чем BTV, или вектор, который содержит молекулу нуклеиновой кислоты, кодирующую антиген, иммуноген или его эпитоп, и экспрессирует ее in vivo в животном, или инактивированный или ослабленный патоген, другой, чем BTV.

Изобретение дополнительно включает набор, содержащий или состоящий преимущественно из (а) иммуногенной или вакцинной композиции, и (b) антигена или иммуногена или его эпитопа из патогена, отличного от BTV, животного, или вектора, который содержит молекулу нуклеиновой кислоты, кодирующую антиген, иммуноген или его эпитоп, и экспрессирует ее in vivo в животном, или инактивированный или ослабленный патоген, отличный от BTV, животного, в котором (а) и (b) находятся в раздельных контейнерах, и набор необязательно содержит инструкции для смешивания и/или введения (а) и (b).

Изобретение также охватывает способ индуцирования иммунологического или защитного иммунного ответа против BTV в животном, который может содержать введение животному иммуногенной или вакцинной композиции, которая содержит молекулу нуклеиновой кислоты, кодирующую антиген, иммуноген или ее эпитоп.

Изобретение дополнительно охватывает способ индуцирования иммунологического или защитного иммунного ответа против BTV у животного, который может содержать введение животному (а) иммуногенной или вакцинной композиции, и (b) BTV изолированного антигена, иммуногена или эпитопа, в котором (а) вводится до (b) в режиме двукратной иммунизации, или (b) вводится до (а) в режиме двукратной иммунизации, или (а) и (b) вводятся совместно, либо последовательно, либо в смеси. Изобретение также включает набор для осуществления этого, который может содержать (а) и (b) в раздельных контейнерах, необязательно с инструкциями для смешивания и/или введения.

Изобретение даже дополнительно охватывает двукратную иммунизацию или вакцинацию против BTV, где примирование (а) ДНК вакциной(ами) или иммунологической или иммуногенной композицией(ями), которая содержит или состоит преимущественно из (а) молекулы(л) нуклеиновой кислоты, кодирующей и экспрессирующей in vivo BTV иммуноген, антиген или эпитоп, и стимулирование осуществляется (а) вакциной(ами) или иммунологической или иммуногенной композицией(ями), которая является BTV инактивированным, или ослабленным, или субъединичным (антиген, иммуноген и/или эпитоп) препаратом(ами), и/или (а) рекомбинантной или модифицированной вирусной вакциной, или иммунологической или иммуногенной композицией(ами), которая содержит или состоит преимущественно из (а) молекулы нуклеиновой кислоты, кодирующей и экспрессирующей in vivo BTV иммуноген(ы), антиген(ы) или эпитоп(ы). Таким образом, изобретение обеспечивает способ двукратной иммунизации или вакцинации против BTV, такой как двукратная иммунизация или вакцинация, которая может содержать введение мишеневым видам животных (а) ДНК вакцины(н) или иммунологической или иммуногенной композиции(й) изобретения (которая содержит или состоит преимущественно из молекул(ы) нуклеиновой кислоты, кодирующей и экспрессирующей(их) in vivo BTV антиген(ы), иммуноген(ы) или эпитоп(ы) (в качестве затравки) и с последующим введением (в качестве стимула) инактивированного BTV и/или ослабленного BTV или BTV субъединичного (антиген, иммуноген и/или эпитоп) препарата(ов)) и/или рекомбинантной или модифицированной вирусной вакцины или иммунологической или иммуногенной композиции, которая может содержать молекулу(ы) нуклеиновой кислоты, кодирующую и экспрессирующую in vivo BTV иммуноген(ы), антиген(ы) или эпитоп(ы), преимущественно (а) рекомбинантной вакцины или иммунологической или иммуногенной композиции(й), которая экспрессирует BTV иммуноген, антиген или эпитоп in vivo. Стимул может преимущественно совмещаться с затравкой, напр., стимул содержит или состоит преимущественно из или экспрессирует, по меньшей мере, один антиген, эпитоп или иммуноген, который экспрессируются посредством затравки.

Режим двукратной иммунизации согласно изобретению может использоваться у животных любого возраста, преимущественно у молодых животных (напр., животных, которые имеют определяемые материнские антитела и/или находятся на грудном вскармливании), у еще не взрослых животных (животных, которые старше молодых животных, но еще не достигли зрелости или периода полового созревания или возраста, пригодного для спаривания или размножения), у взрослых животных (напр., животных, которые находятся в возрасте спаривания или размножения или старше), и является выгодным применение режима двукратной иммунизации у беременных самок или самок перед родами, кладкой или оплодотворением.

Изобретение также относится к таким иммуногенным и вакцинным композициям и наборам из них, пригодным для использования в таком режиме двукратной иммунизации и режимах двукратной иммунизации. Хозяин или мишеневый вид, для которого практикуется режим двукратной иммунизации, включает любого животного (мишеневого или хозяина) вида, восприимчивого к заболеванию, вызванному инфекцией Orbivirus, включая млекопитающих, рептилий, птиц, в особенности людей, парных млекопитающих или животных, таких как, но не ограничиваясь, собак, кошек, лошадей, млекопитающих из зоопарков или животных, таких как морские млекопитающие, напр., тюлени, кошки, лошади, зоопарковые рептилии, такие как змеи, крокодилы, аллигаторы, и птичьи виды.

Режим двукратной иммунизации в особенности выгоден для применения у молодого животного, поскольку это позволяет провести вакцинацию или иммунизацию в раннем возрасте, например первое введение в режиме двукратной иммунизации, когда практикуется для молодого животного, может быть в возрасте, при котором молодое животное имеет материнские антитела. Другое преимущество этого режима состоит в том, что может обеспечиваться уровень безопасности для беременных самок, присутствующих в этой же местности или в непосредственной близости к молодому животному или друг к другу. Таким образом, изобретение обеспечивает двукратную иммунизацию или способ вакцинации против BTV, и способ может осуществляться для молодого животного, такого как ягненок, щенок или котенок, например, если примирование осуществляется во время, когда молодое животное имеет материнские антитела против BTV, при этом стимулирование выполняется преимущественно во время, когда материнские антитела могут быть ослаблены или снижены или не присутствовать, как, например, в период после кормления грудью.

Таким образом, изобретение также включает наборы для осуществления режима двукратной иммунизации, содержащие или состоящие преимущественно из примирующей вакцинной или иммунологической или иммуногенной композиции и стимулирующих вакцинных, или иммунологических, или иммуногенных композиций, в раздельных контейнерах, необязательно с инструкциями для смешивания и/или введения.

Дополнительно, изобретение обеспечивает способ дифференциальной диагностики, содержащий введение животному иммуногенной или вакцинной композиции и/или BTV антигена, иммуногена или эпитопа, и тестирование животного на предмет наличия или отсутствия BTV протеина или антитела, не экспрессирующегося иммуногенной или вакцинной композицией и/или не присутствующего в BTV антигене, иммуногене или эпитопе. Изобретение дополнительно включает набор для осуществления этого способа, содержащий иммуногенную или вакцинную композицию и/или BTV антиген, иммуноген или эпитоп, и анализ для тестирования по поводу присутствия или отсутствия BTV протеина, в раздельных контейнерах, необязательно с инструкциями для введения иммуногенной или вакцинной композиции и/или BTV антигена, иммуногена или эпитопа и/или для осуществления анализа.

Необходимо указать, что в данном описании и в особенности в формуле изобретения и/или параграфах, термины, такие как "содержит", "содержащий" и подобные и такие термины как "состоящий преимущественно из" и "включает преимущественно", имеют значения, приписываемые им патентным законом США, напр., они предназначены для элементов, неточно изложенных, но исключая элементы, которые имеются в уровне техники или которые затрагивают основные или новые характеристики изобретения.

Эти и другие воплощения описываются и следуют из и охватываются следующим подробным описанием.

Краткое описание чертежей

Следующее подробное описание, представленное посредством примера, но не предназначенное для ограничения изобретения только по описываемым специфичным воплощениям, лучше будет понимаемым в сочетании с сопутствующими чертежами.

Фиг.1 изображает последовательность нуклеиновой кислоты BTV-17 нативного VP2 (BTV-17 VP2 native - SEQ ID NO:3) по сравнению с синтетическим BTV17 VP2 с оптимизированными кодонами (synthetic BTV-17 VP2 - SEQ ID NO:1).

Фиг.2 изображает последовательность нуклеиновой кислоты BTV-17 нативного VP5 (BTV-17 VP5 native - SEQ ID NO:4) по сравнению с синтетическим BTV17 VP5 с оптимизированным кодоном (synthetic BTV-17 VP5 - SEQ ID NO:2).

Фиг.3 представляет схематическую конструкцию плазмиды 043004pPCR - Script, кодирующую оптимизированный синтетический протеин BTV VP2.

Фиг.4 представляет схему реакционной карты донорной плазмиды pNVH6C5LSP-18.

Фиг.5 представляет схематическую конструкцию pCXL148.2, ALVAC донорной плазмиды.

Фиг.6 показывает нуклеиновую последовательность pCXL148.2 донорной плазмиды (SEQ ID NO:13).

Фиг.7 представляет схематическую конструкцию pALVAC С5Н6р-синтетического BTV VP2 (pLH2030.2), донорная плазмида.

Фиг.8 представляет схематическую конструкцию плазмиды 043005pPCR - Script, кодирующую оптимизированный синтетический протеин BTV VP5 для добавления 42Kp синтетической промоторной последовательности энтомологического вируса оспы Amsacta moorei к фрагменту BTV-VP5.

Фиг.9 представляет схематическое изображение схемы клонирования для 42Кp запускаемого промотором оптимизированного синтетического BTV VP5 в PCR 2.1 ТОРО клонирующий/челночный вектор (создание PCR 2-42KpVP5) для амплификации кассеты 42KpVP5.

Фиг.10 представляет схематическое изображение конструкции итогового донорского гомологичного вектора pС5Н6рVР2 42KpVP5 (pLH2078.15), содержащего оптимизированный VP2, запускаемый промотором Н6, и оптимизированный BTV VP5, запускаемый 42K промотором, с векторной гомологией с C5R областью из ALVAC.

Фиг.11 обеспечивает данные о последовательности нуклеиновых кислот и протеиновой последовательности для pLH2078.15 (рС5 Н6р синтетический BTV-VP2 42Kр синтетический BTV-VP5), итогового гомологичного вектора для создания рекомбинантной ALVAC+BTV. А раскрывает SEQ ID NOS:20-21 соответственно в порядке появления. В раскрывает SEQ ID NO:19, кодирующую SEQ ID NOS: 20-21. С раскрывает нуклеотиды 1800-6293 из SEQ ID NO:19, кодирующей SEQ ID NOS:20-21. D раскрывает SEQ ID NO:22.

Фиг.12 изображает схему, иллюстрирующую конструкцию рекомбинантного ALVAC вирусного вектора, кодирующего BTV оптимизированные синтетические VP2 и VP5 (vCP2289).

Фиг.13 представляет теоретическую карту расщепления RE для рекомбинантной ALVAC-BTV vCP2289, образованной из плазмиды и ALVAC последовательности нуклеиновых кислот, приготовленной посредством Vector NTI (Invitrogen, Carlsbad, CA).

Фиг.14 представляет окрашенный агарозный гель, показывающий расщепление рестрикционной эндонуклеазой геномной ДНК, выделенной из ALVAC+BTV рекомбинантного вируса vCP2289 (сравнение с теоретически ожидаемым характером исчерченности, как показано на фиг.13, выше).

Фиг.15 показывает анализ Саузерн-блот рестрикционной эндонуклеазы, расщепляющей vCP2289 геномную ДНК, зондированную BTV-специфичным ДНК зондом.

Фиг.16 представляет Вестерн-блот фракций лизата CEF и супернатанта, приготовленных после инфицирования двумя различными изолятами vCP2289, зондируя для экспрессии VP5 из ALVAC рекомбинантного вируса. Первичный антительный зонд представлял кроличью анти-ВТV-17 VP5 специфичную поликлональную сыворотку, использующуюся в разведении 1:2000.

Фиг.17 представляет карту средних температур тела овец, иммунизированных vCP2289 по сравнению с WNV-CP контрольной вакциной после провокации вирулентным BTV-17 дикого типа.

Фиг.18 представляет карту, показывающую среднее количество лейкоцитов (WBC) овец, иммунизированных vCP2289 по сравнению с WNV-CP контрольной вакциной после провокации вирулентным BTV-17 дикого типа.

Фиг.19 представляет карту, показывающую среднее количество лимфоцитов овец, иммунизированных vCP2289 по сравнению с WNV-CP контрольной вакциной после провокации вирулентным BTV-17 дикого типа.

Фиг.20 представляет карту, показывающую среднее количество тромбоцитов овец, иммунизированных vCP2289 по сравнению с WNV-CP контрольной вакциной после провокации вирулентным BTV-17 дикого типа.

Фиг.21 изображает последовательность праймеров для амплификации экспрессионной касеты 42Kp-BTV VP5.

Подробное описание изобретения

Как здесь указано, настоящее изобретение относится к векторам, содержащим, по меньшей мере, один полинуклеотид BTV или, по меньшей мере, одну молекулу нуклеиновой кислоты, кодирующей, по меньшей мере, один BTV антиген, иммуноген или эпитоп, напр., in vivo и in vitro экспрессирующим векторам, содержащим, по меньшей мере, один полинуклеотид BTV, или in vivo и in vitro экспрессирующим векторам, содержащим и экспрессирующим, по меньшей мере, один BTV антиген, иммуноген или эпитоп, а также к иммуногенным композициям и вакцинам против заболевания синий язык; например, таким композициям или вакцинам, которые содержат один или более векторов и/или один или более продуктов экспрессии векторов.

Преимущественно иммуногены, антигены содержат внешний капсидный протеин VP2 (L2), или внешний капсидный протеин VP5 (М5), или эпитопы или комбинации их, напр., VP2 и VP5; VP2; и VP5 или их фрагменты. Комбинации могут состоять из отдельных протеинов или полипротеинов. Композиции или вакцины могут, таким образом, содержать один или более векторов, экспрессирующих более одного протеина, напр., различные протеины. Композиции или вакцины могут содержать, или векторы из них экспрессировать, протеины из различных штаммов или изолятов BTV. Таким образом, композиции или вакцины могут содержать, или векторы из них экспрессировать, VP2, VP5 или их комбинации, при этом VP2 и VP5 происходят из различных штаммов или изолятов.

В этой связи необходимо отметить, что используется серотип 17 BTV изолята или штамма, напр., полевых изолятов (депонированных как сегменты в GenBank:(de Mattos, de Mattos et al. 1994)[VP2] изолят 17В81, SEQ ID No. S72158; (Mecham and Johnson 2005)[VP5] изолят FL99, SEQ ID No: AY855281); и/или Американской коллекции типовых культур VR-875™ (депонированные как BTV серотип 17; кровь от овцы с типичной болезнью синий язык Wyoming, 1962). Вследствие сегментной природы генома BTV геномные нуклеотидные последовательности для каждого сегмента определяются индивидуально для каждого сегмента серотипа. В Таблице 2 перечисляются последовательности, пригодные для ВТV серотипа 17.

Также необходимо отметить, что сравнительный филогенетический анализ VP2 последовательностей в серотипах показывает степень гомологии, однако имеется достаточно естественная изменчивость в различиях вирусных линий в одном серотипе. BTV серотип контролируется в первую очередь вирусным внешним капсидным протеином VP2, кодируемым геномным сегментом 2. Предусматривается, что анализ последовательностей сегмента 2 может использоваться не только для идентификации вирусного серотипа, а также посредством сравнения последовательности исходных штаммов для идентификации происхождения отдельных вирусных штаммов.

Преимущественно в воплощениях, включающих, по меньшей мере, один эпитоп, присутствующий в, или экспрессирующийся посредством вектора или векторов в, композициях или вакцинах изобретения, эпитоп или эпитопы из VP2, VP5 или их комбинаций, и эпитоп или эпитопы могут быть из различных штаммов или изолятов. В этой связи необходимо указать, что один может локализовываться или эпитопы картирования в BTV антигенах или иммуногенах, такие как VP5 протеин; см., напр., (Martinez-Torrecuadrada, Langeveld et al. 1999) и (Wang, Du Plessis et al. 1995), VP2 протеин (Heidner, Rossitto et al. 1990; Rossitto and MacLachlan 1992; DeMaula, Bonneau et al. 2000) и VP1 протеин (Huang, Hwang et al. 1995).

Также, как здесь указано, изобретение относится к способам применения векторов, иммунологических композиций и вакцин, включая иммунизацию и вакцинацию против этого вируса, экспрессию полипептидов, кодируемых полинуклеотидом(ами), и способам применения продуктов экспрессии в анализах или для получения антител, использующихся в анализах, а также к способам приготовления полинуклеотида(ов), векторов, композиций, вакцин, анализов, inter alia.

Настоящее изобретение, таким образом, относится к способам профилактики и/или борьбы с заболеваниями, вызванными BTV, так как снижаются или прекращаются клинические симптомы, и/или виремия, и/или очаги повреждения.

Изобретение относится к таким иммуногенным и вакцинным композициям, которые пригодны для использования у различных животных (мишеневых или хозяев) видов, восприимчивых к заболеванию, вызванному BTV, включая, но не ограничиваясь, млекопитающих, рептилий, птиц, в особенности людей, парных млекопитающих или животных, таких как, но не ограничиваясь, собак, кошек, лошадей, млекопитающих из зоопарков или животных, таких как морские млекопитающие, напр., тюлени, кошки, лошади, зоопарковые рептилии, такие как змеи, крокодилы, аллигаторы, и птичьи виды.

Изобретение дополнительно относится к способам иммунизации и вакцинации, включающим иммуногенные и вакцинные композиции, для мишеневых или хозяйских видов. И в этом аспекте изобретения упоминается, что относительно диких или неодомашненных животных, таких как, но не ограничиваясь, дикие или неодомашненные птицы или млекопитающие, композиции, содержащие один или более векторов, которые экспрессируют один или более BTV эпитопов, или антигенов, или иммуногенов, могут доставляться посредством пищи, напр., каплей для приманки, или пищи для млекопитающих или птиц, оставленной для потребления дикими или неодомашненными птицами или млекопитающими, которая включает или содержит один или более векторов, так, они могут быть введены им перорально путем потребления млекопитающими или птицами пищи. Этот путь введения может быть выгодным, когда один или более векторов представляет один или более вирус оспы, напр., вирус оспы птиц, такой как ослабленный вирус оспы канареек, например ALVAC, или ослабленный вирус оспы птиц, например TROVAC, или вакцинный вирус, такой как ослабленный вакцинный вирус, например NYVAC. Таким образом, изобретение предусматривает пероральное или слизистое введение, а также съедобные композиции, которые содержат одно или более векторов изобретения, родственных с вирусом бешенства MERIAL, продукта RABORAL™. Из данного описания и уровня техники следует, что квалифицированный специалист может составить съедобную пищу для птиц или млекопитающих, которая содержит пригодную дозу одного или более векторов изобретения. Кроме того, изобретение охватывает местное введение композиций, содержащих векторы, см., напр., Патент США №6,348,450 относительно местного введения векторных композиций, и устройства для местного введения композиций диким или неодомашненным животным, см., напр., WO01/95715, Заявка США №10/374,627, поданная 26 февраля 2003, для таких устройств для грызунов и птиц; каждый из которых, вместе с каждым документом, цитированным или приведенным здесь, как с каждым документом, процитированным здесь, и каждым документом, указанным здесь или цитированным в каждом документе, объединены здесь посредством ссылки.

Изобретение дополнительно относится к устройствам и способам, которые делают возможным проведение дифференциальной диагностики, напр., способам, которые делают возможным осуществление, или позволяют провести, различий между животным, инфицированным патогенным BTV, и животным, которому ввели вакцину или иммуногенную композицию изобретения.

В дополнение к полинуклеотиду, кодирующему VP2 и VP5, экспрессирующие векторы изобретения могут содержать один или более других полинуклеотидов, кодирующих другие протеины BTV, предпочтительно структурные протеины BTV и указанные последовательности предпочтительно выбираются из тех, которые кодируют структурные вирусные протеины.

Вектор предпочтительно содержит полинуклеотид, кодирующий участки, соответствующие, напр., VP2, VP5, или преимущественно VP2 и VP5, или их эпитопам; а именно экспрессия множества протеинов или их эпитопов считается выгодной. Вектор, содержащий несколько отдельных полинуклеотидов, кодирующих различные протеины (напр., VP2 и/или VP5 или их эпитопы), также входит в объем настоящего изобретения. Вектор, особенно для in vivo экспрессии, может также содержать полинуклеотиды, соответствующие более чем одному BTV серотипу, штамму или изоляту, например два или более полинуклеотидов, кодирующих VP2 или VP5, или их эпитоп(ы), различных штаммов. Из всех различных серотипов, таких как, но не ограничиваясь, серотипы 1, 2, 4, 9, 10, 11, 13, 16 и 17.

Аналогично, иммуногенная или вакцинная композиция может содержать один или более векторов для экспрессии полинуклеотидов, соответствующих более одному BTV серотипу, штамму или изоляту, например два или более полинуклеотидов, кодирующих VP2 или VP5, или их эпитоп(ы), различных штаммов. Вектор, в особенности для экспрессии in vivo, может дополнительно содержать одну или более нуклеотидных последовательностей, кодирующих иммуногены других патогенных агентов и/или цитокинов.

Термин полинуклеотид, кодирующий протеин BTV, главным образом означает фрагмент ДНК или изолированную молекулу ДНК, кодирующую указанный протеин, или комплементарный штамм; однако РНК не исключается, поскольку, как известно из уровня техники, что тимидин (Т) в ДНК последовательности рассматривается как эквивалентный урацилу (U) в РНК последовательности. Таким образом, РНК последовательности для использования в изобретении, напр., для использования в РНК векторах, могут быть получены из ДНК последовательностей, посредством того, что тимидин (Т) в ДНК последовательности считается эквивалентным урацилу (U) в РНК последовательности.

Термин протеин включает пептиды и полипептиды. Фрагмент протеина является иммунологически активным в смысле, что однажды введенный хозяину является способным вызывать иммунный ответ гуморального и/или клеточного типа, направленный против протеина. Предпочтительно, фрагмент протеина является таким, что он имеет по существу аналогичную иммунологическую активность, как и общий протеин. Таким образом, фрагмент протеина изобретения содержит или состоит преимущественно из или включает, по меньшей мере, один эпитоп или антигенную детерминанту. Термин эпитоп относится к участку протеина, способному вызывать иммунную реакцию гуморального типа (В клетки) и/или клеточного типа (Т клетки).

Таким образом, минимальной структурой полинуклеотида является такая, которая содержит или состоит преимущественно из или включает нуклеотиды, которые кодируют эпитоп или антигенную детерминанту BTV протеина. Полинуклеотид, кодирующий фрагмент полного протеина, более преимущественно, содержит или состоит преимущественно из или включает минимум 21 нуклеотид, преимущественно, по меньшей мере, 42 нуклеотида, и предпочтительно, по меньшей мере, 57, 87 или 150 последовательных или соседних нуклеотидов последовательности, кодирующей полный протеин или полипротеин. Как указывалось ранее, процедуры определения эпитопов, такие как сконструированные библиотеки перекрывающихся пептидов (Hemmer, Pinilla et al. 1998), Pepscan (Geysen, Meloen et al. 1984); (Geysen, Barteling et al. 1985); (Van der Zee, Van Eden et al. 1989); (Geysen 1990); Multipin® Peptide Synthesis Kits de Chiron) и алгоритмы (De Groot and Rothman 1999), могут использоваться в практической части изобретения, без проведения дополнительного эксперимента. Другие документы, цитированные здесь, могут также быть консультативными относительно способов определения эпитопов иммуногена или антигена и, таким образом, молекул нуклеиновых кислот, которые кодируют такие эпитопы.

Элементы для экспрессии полинуклеотида или полинуклеотидов преимущественно присутствуют в векторе изобретения. Минимальным образом он содержит, состоит преимущественно из или включает стартовый кодон (ATG), стоп-кодон и промотор и необязательно также последовательность полиаденилирования для определенных векторов, таких как плазмида, и определенных вирусных векторов, напр., вирусных векторов, других, чем вирус оспы. Если полинуклеотид кодирует фрагмент протеина, напр., преимущественно, в векторе, ATG помещается на 5' рамки считывания и стоп-кодон помещается на 3'. Могут присутствовать и другие элементы для контролирования экспрессии, такие как энхансерные последовательности, стабилизирующие последовательности и сигнальные последовательности, обеспечивая секрецию протеина.

Способы приготовления и/или введения вектора, или рекомбинантов, или плазмид для экспрессии генных продуктов от генов изобретения либо in vivo либо in vitro могут быть любыми желаемыми способами, напр., способ, который является таким или аналогичным способам, описанным в или раскрытым в цитируемых документах в: патентах США №6,130,066, 5,494,807, 5,514,375, 5,744,140, 5,744,141, 5,756,103, 5,762,938, 5,766,599, 5,990,091, 6,004,777, 6,130,066, 6,497,883, 6,464,984, 6,451,770, 6,391,314, 6,387,376, 6,376,473, 6,368,603, 6,348,196, 6,306,400, 6,228,846, 6,221,362, 6,217,883, 6,207,166, 6,207,165, 6,159,477, 6,153,199, 6,090,393, 6,074,649, 6,045,803, 6,033,670, 6,485,729, 6,103,526, 6,224,882, 6,312,682, 6, 312,683, 6,348,450, 4,603,112; 4,769,330; 5,174,993; 5,505,941; 5,338,683; 5,494,807; 4,394,448; 4,722,848; 4,745,051; 4,769,331; 5,591,639; 5,589,466; 4,945,050; 5,677,178; 5,591,439; 5,552,143; и 5,580,859; патентной заявке США №920,197, поданной 16 октября 1986; WO 94/16716; WO 96/39491; WO 91/11525; WO 98/33510; WO 90/01543; EP 0370573; ЕР 265785; (Paoletti 1996); (Moss 1996); Richardson (Ed) (1995) Methods in Molecular Biology 39, "Baculovims Expression Protocols," Humana Press Inc.; (Smith, Summers et al. 1983); (Pennock, Shoemaker et al. 1984); (Roizman 1996); (Andreansky, He et al. 1996); (Robertson, Ooka et al. 1996); (Frolov, Hoffman et al. 1996); (Kitson, Burke et al. 1991); (Ballay, Levrero et al. 1985); (Graham 1990); (Prevec, Schneider et al. 1989); (Feigner, Kumar et al. 1994); (Ulmer, Donnelly et al. 1993); (McClements, Armstrong et al. 1996); (Ju, Edelstein et al. 1998); и (Robinson and Torres 1997). Таким образом, вектором в изобретении может быть любой пригодный рекомбинантный вирус или вирусный вектор, такой как вирус оспы (напр., вакцинный вирус, вирус оспы птиц, вирус оспы канареек, вирус оспы птиц, вирус оспы енотовых, вирус оспы свиней и др.), аденовирус (напр., собачий аденовирус), вирус герпеса, бакуловирус, ретровирус и др. (как в документах, объединенных здесь посредством ссылки); или вектором может быть плазмида. Цитируемые здесь и объединенные посредством ссылки документы, в дополнение к представленным примерам векторов, пригодным в применении изобретения, могут также обеспечивать источники для не-BTV протеинов или их эпитопов, напр., не-BTV иммуногенов или их эпитопов, цитокинов, и др., которые экспрессируются посредством вектора или векторов в, или включены в, комбинированных или смешанных иммуногенных композициях или вакцинах изобретения.

Настоящее изобретение также относится к препаратам, содержащим векторы, такие как экспрессирующие векторы, напр., вакцинные или иммуногенные композиции. Препараты могут содержать, состоять преимущественно из или включать один или более векторов, напр., экспрессирующие векторы, такие как экспрессирующие векторы in vivo, содержащие, состоящие преимущественно из или включающие (и преимущественно экспрессирующие) один или более BTV полинуклеотидов, кодирующих VP2, VP5, или комбинации или их полипротеины, в особенности, как выше приведено (напр., VP2, VP5, VP2 и VP5 или, по меньшей мере, их эпитоп); и, преимущественно, вектор содержит и экспрессирует полинуклеотид. который включает, состоит преимущественно и содержит кодирующую область, кодирующую BTV VP2 и/или VP5, в фармацевтически или ветеринарно приемлемом носителе, наполнителе или связующем веществе. Таким образом, согласно воплощению изобретения другой вектор или векторы в препарате содержит, состоит преимущественно из или включает полинуклеотид, который кодирует, и при подходящих обстоятельствах, вектор экспрессирует один или более других протеинов BTV, напр., VP2, VP5, или их эпитоп.

Согласно другому воплощению вектор или векторы в препарате содержат, состоят преимущественно из или включают полинуклеотид(ы), кодирующие один или более протеинов или их эпитоп(ы) BTV, напр., один или более BTV серотипов, штаммов или изолятов; и, преимущественно, в пригодной клетке-хозяине или при подходящих условиях, вектор или векторы экспрессируют полипептиды, кодируемые полинуклеотидом(ами). Препарат изобретения преимущественно содержит, состоит преимущественно из или включает, по меньшей мере, два вектора, содержащих, состоящих преимущественно из или включающих и преимущественно также экспрессирующих, предпочтительно in vivo при подходящих условиях, или пригодных условиях, или в пригодной клетке-хозяине, полипептиды, кодируемые полинуклеотидами из различных BTV серотипов, штаммов или изолятов, кодирующих аналогичные протеины, и/или для различных протеинов, но предпочтительно для аналогичных протеинов. Относительно препаратов, содержащих один или более векторов, содержащих, состоящих преимущественно из или включающих полинуклеотиды, кодирующие, и предпочтительно экспрессирующие, преимущественно in vivo, BTV VP2, или VP5, или их эпитоп, является предпочтительным, чтобы продукты экспрессии были из двух, трех или более различных BTV серотипов, штаммов или изолятов, преимущественно штаммов. Изобретение также направлено к смесям векторов, которые содержат, состоят преимущественно из или включают кодирующие для, и экспрессируют, VP2, или VP5 различных штаммов. Предпочтительным является то, чтобы в таких смесях, по меньшей мере, один вектор содержал, состоял преимущественно из или включал, кодирующий для, и экспрессировал, VP2.

Согласно еще другому воплощению и, как будет показано более подробно здесь, другой вектор или векторы в препарате содержат и экспрессируют один или более цитокинов и/или один или более иммуногенов одного или более других патогенных агентов. Источники для цитокинов, иммуногенов для других патогенных агентов или их эпитопа(ов), и молекул нуклеиновой кислоты, кодирующих аналогичные, могут быть найдены в цитируемых здесь документах, а также в WO02096349, WO0208162, WO0020025, WO00152888, WO0145735, WO00127097, WO0116330, WO0077210, WO0077188, WO0077043, WO9842743, WO9833928, WO9749826, WO9749825, Патентах США №6,387,376, 6,306,400, 6,159,477, 6,156,567, 6,153,199, 6,090,393, 6,074,649, 6,033,670.

Изобретение также относится к различным комбинациям различных воплощений, описываемым здесь, напр., к композициям или вакцинам, содержащим различные векторы, композициям или вакцинам, содержащим вектор и протеин (BTV и/или не-BTV) и/или цитокин и др.

Препараты, содержащие in vitro или in vivo экспрессирующий вектор, содержащий и экспрессирующий полинуклеотид, кодирующий VP2, VP5, составляют предпочтительное воплощение изобретения.

Согласно дополнительно выгодному воплощению один или более дополнительных структурных протеинов VP7 и/или VP3 экспрессируются вместе с VP2 и VP5 структурными протеинами, согласно изобретению, либо через аналогичный экспрессирующий вектор, либо посредством их собственного экспрессирующего вектора. Они предпочтительно экспрессируются вместе на основе одного полинуклеотида, напр., как полипротеин. В некоторых воплощениях, вектор дополнительно содержит, состоит преимущественно из или включает один или более нуклеотидов, кодирующих VP7 и/или VP3, или композиция или вакцина дополнительно содержит, состоит преимущественно из или включает один или более дополнительных векторов, который содержит, состоит преимущественно из или включает один или более нуклеотидов, кодирующих VP7 и/или VP3; этот вектор или эти векторы преимущественно экспрессируют(ет) структурный(е) протеин(ы); и VP7 и VP3 преимущественно экспрессируются совместно, и, более преимущественно, как полипротеин.

Согласно дополнительно выгодному воплощению один или более неструктурных протеинов NS1, NS2 и NS3 и/или VP1, VP4 экспрессируются вместе с VP2 и VP5 структурными протеинами, согласно изобретению, либо через аналогичный экспрессирующий вектор, либо посредством их собственного экспрессирующего вектора. В некоторых воплощениях, вектор дополнительно содержит, состоит преимущественно из или включает один или более нуклеотидов, кодирующих VP1, VP4, NS1, NS2, и/или NS3, или композиция или вакцина дополнительно содержит, состоит преимущественно из или включает один или более дополнительных векторов, который содержит, состоит преимущественно из или включает один или более нуклеотидов, кодирующих VP1, VP4, NS1, NS2 и/или NS3; этот вектор или эти векторы преимущественно экспрессируют(ет) структурный(е) протеин(ы); и VP1, VP4, NS1, NS2 и/или NS3 преимущественно экспрессируются. Таким образом, изобретение также относится к вектору, такому как in vivo или in vitro экспрессирующий вектор, содержащий, состоящий преимущественно из или включающий полинуклеотид(ы), кодирующие VP1, VP4, NS1, NS2 и NS3, их комбинации, включая их полипротеины. Вектором может быть один вышеописанный вектор, содержащий, состоящий преимущественно из или включающий полинуклеотид, кодирующий один или более структурных протеинов, напр., комбинации из VP2, VP5, VP7 и/или VP3 и их полипротеины, напр., такой вектор, который содержит или состоит преимущественно из полинуклеотидов, кодирующих структурный протеин, или протеины, или их эпитопы, может также содержать или состоять преимущественно из полинуклеотидов, кодирующих один или более неструктурных протеинов, их комбинации, их полипротеины или их эпитопы. В качестве альтернативы, изобретение относится к препарату, который здесь описывается, также включающему, по меньшей мере, один вектор, который содержит полинуклеотид(ы), кодирующий и преимущественно экспрессирующий неструктурный протеин, и необязательно фармацевтически или ветеринарно приемлемый носитель, связующее вещество или наполнитель.

Для получения вектора, напр., экспрессирующих векторов, согласно изобретению, квалифицированный специалист имеет доступные различные серотипы, штаммы и изоляты из BTV и описание нуклеотидной последовательности их генома, см., напр., обсуждение здесь, также относится к 24 BTV серотипам, где информация о последовательности нуклеиновых кислот доступна в (Wilson and Mecham 2000).

Ссылка, например, относится к штамму BTV-17. Для каждого протеина обеспечивается соответствующая нуклеотидная последовательность (de Mattos, de Mattos et al. 1994; Huang, Hwang et al. 1995; Bernard, Israel et al. 1997). Путем сравнения и выравнивания последовательности, определение полинуклеотида, кодирующего такой протеин в другом BTV серотипе или штамме, без труда определяется.

Как здесь указано, термин полинуклеотид подразумевает последовательность нуклеиновых кислот, кодирующую протеин или его фрагмент или его эпитоп, специфичный к определенному штамму BTV; и, по аналогии, термин полинуклеотид включает соответствующие нуклеотидные последовательности различных штаммов BTV и нуклеотидные последовательности, различающиеся из-за дегенерации кодонов. Таким образом, полинуклеотид, кодирующий VP2 BTV, понимается как содержащий, состоящий преимущественно из или включающий (a) nt 20-2887 из BTV-17 (SEQ ID NO:3), (b) соответствующие последовательности различных штаммов BTV, и (с) нуклеотидные последовательности, которые кодируют VP2 BTV, но отличающиеся от (а) и (b) вследствие кодонной дегенерации.

Ген L2 из BTV, который кодирует внешний капсидный протеин, VP2, имеет более высокую степень генетической изменчивости между глобальными штаммами BTV. Не удивительно, что этот протеин отвечает как за вирусную нейтрализацию, так и за серотип-специфичность (Mecham, Dean et al. 1986; Roy 1992) и по-видимому подвергается действию генетического дрейфа и отбору по эффекту основателя. Генетический дрейф и эффект основателя может приводить к появлению вариантов с повышенной вирулентностью (Bernard, Israel et al. 1997). Определяется число нейтрализирующих детерминант (Ghiasi, Fukusho et al. 1987; DeMaula, Heidner et al. 1993; Jewell and Mecham 1994). Показано, что VP2 является протеином, главным образом ответственным за прикрепление и внедрение у клетки-хозяина млекопитающих (Hassan and Roy 1999). Различия между серотипами обычно приводят к расщеплению вирусов, основанных на серотипе независимо от географического происхождения выделения при использовании филогенетического анализа (Pritchard and Gould 1995; Bonneau, Zhang et al. 1999). Ген М5 из BTV кодирует внутренний внешний капсидный протеин, VP5, и имеет вторую наиболее высокую степень генетической изменчивости среди генов BTV, демонстрируя 51-71% идентичность с данной серогруппой. VP5 может вызывать конформационное изменение внешней капсидной структуры и изменять нейтрализирующие характеристики (Cowley and Gorman 1989; DeMaula, Bonneau et al. 2000). VP5 может также обеспечивать узнавание клеткой-хозяином (Roy 1992).

Вследствие собственной генетической изменчивости в и без серотипов изобретение покрывает полинуклеотиды, кодирующие протеины, имеющие аминокислотные последовательности, чья идентичность последовательностей или гомология с консенсусной BTV аминокислотной последовательностью для протеина проявляет функциональную эквивалентность. Например, экспрессирующийся VP2 капсидный протеин может иметь более 20% идентичности с соответствующей капсидной последовательностью полипептида, экспрессированного из (а) содержащего нуклеотиды 20-2887 из s сегмента 2 BTV-17 (SEQ ID NO:3), (b) соответствующих последовательностей различных BTV штаммов, и/или (с) нуклеотидных последовательностей, которые кодируют BTV VP2, но отличаются от (а) и (b) вследствие кодонной дегенерации, и от (а) и (b) благодаря генетической изменчивости штамма, серотипа и серогруппы. Несмотря на эту изменчивость функционально полинуклеотиды кодируют VP2 капсидный полипептид.

Таким образом, изобретение охватывает полинуклеотиды, которые экспрессируют такие функционально гомологичные полипептиды; и соответствующие степени гомологии и идентичности этих полинуклеотидов с полинуклеотидами, кодирующими полипептиды, к которым гомологичные полипептиды имеют гомологию и идентичность. Homologous полипептиды преимущественно содержат один или более эпитопов из полипептида, к которому они являются идентичными или гомологичными, так что гомологичные полипептиды проявляют иммунологическое сходство и идентичность с полипептидом, к которому они гомологичны или идентичны, напр., гомологичный полипептид получает похожий или более лучший иммунный ответ (для квалифицированного иммунолога), чем полипептид, к которому проявляется идентичность или гомология, и/или гомологичный полипептид связывает антитела, полученные посредством и/или к которым полипептид, к которому они гомологичны или идентичны, присоединяется, преимущественно и нет с другими антителами.

Таким образом, фрагменты гомологичных полипептидов и полипептидов, к которым проявляется гомологичность или идентичность, преимущественно те фрагменты, которые проявляют иммунологическое сходство и идентичность с гомологичными полипептидами или полипептидами, к которым имеется гомологичность или идентичность, и представлены как экспрессирующиеся, и, следовательно, полинуклеотиды, которые могут представлять фрагменты полинуклеотидов гомологичных полипептидов и полипептидов, к которым проявляется гомология или идентичность, и также представлены посредством и пригодными в рассматриваемом изобретении.

Термин "идентичность последовательности" показывает количественное измерение степени гомологии между двумя аминокислотными последовательностями одинаковой длины или между двумя нуклеотидными последовательностями одинаковой длины. Если две последовательности, которые сравниваются, не одинаковой длины, они должны выравниваться с наилучшим соответствием возможно со вставкой из разрывов или, альтернативно, процессингом на концах протеиновой последовательности. Идентичность последовательностей может рассчитываться как ((Nref-Ndif)/Nref)×100, где Ndif представляет общее количество неидентифицированных остатков в двух последовательностях, когда выровнены, и где Nref представляет число остатков в одной из последовательности. Таким образом, ДНК последовательность AGTCAGTC будет иметь 75% идентичность последовательности с последовательностью ААТСААТС (Ndif=2 и Nref=8). Разрыв считается как неидентифицированный специфичный остаток(ки), т.е. ДНК последовательность AGTGTC будет иметь 75% идентичность последовательности с ДНК последовательностью AGTCAGTC (Ndif=2 и Nref=8). Идентичность последовательности может альтернативно рассчитываться посредством программ BLAST, напр., программы BLASTP (Pearson and Lipman 1988)(www.ncbi.nlm.nih.gov/cgi-bin/BLAST). В одном аспекте изобретения, выравнивание выполняется со способом выравнивания последовательностей ClustalW со стандартными параметрами, как описывается в (Thompson, Higgins et al. 1994), доступной на сайте http://www2.ebi.ac.uk/clustalw/. Таким образом, полинуклеотидом может быть любая молекула нуклеиновой кислоты, включая ДНК, РНК, LNA (закрытые нуклеиновые кислоты), PNA, RNA, dsRNA, RNA-DNA-гидрид и неприродные нуклеозиды.

И из данного описания, преимущественно, протеины или полипептиды, экспрессирующиеся посредством векторов изобретения, представляют собой иммунологически активные пептиды и полипептиды, напр., относительно полипептидов или протеинов BTV-17, протеины или полипептиды, экспрессирующиеся посредством векторов изобретения, могут быть:

a) соответствующие протеины или полипептиды одного или более различных BTV серотипов, штаммов или изолятов,

b) протеины, отличающиеся от них (от BTV-17 и/или а), но сохраняющие нативного BTV протеинома идентичность, равную или более 20%. Таким образом, ссылка на BTV протеин может включать дополнительные протеины, которые здесь обсуждаются.

Различные BTV серотипы и штаммы доступны в коллекциях, в особенности в Американской коллекции типовых культур (АТСС), напр., под входящими номерами VR-875, VR-1231, VR-187, VR-873, VR-983, VR-1231AF или VR-1231CAF, и, как здесь описывается, полный ген может также быть химически синтезированным.

В изобретении предпочтительно полинуклеотид также содержит нуклеотидную последовательность, кодирующую сигнальный пептид, расположенный в обратном направлении от кодирующей области экспрессирующегося протеина с обеспечением его секреции; и таким образом, изобретение охватывает экспрессию BTV полипептида, такого как BTV антиген, иммуноген или их фрагмент, напр., эпитоп, с лидерной или сигнальной последовательностью. Лидерная или сигнальная последовательность может являться эндогенной последовательностью, напр., природной сигнальной последовательностью из BTV полипептида. Лидерная или сигнальная последовательность может также быть гетерологичной последовательностью и, таким образом, кодируемой нуклеотидной последовательностью, которая гетерологична BTV. Например, лидерная последовательность может быть эндогенной по отношению к вектору, или лидерной или сигнальной последовательности, которая гетерологична и вектору и BTV, такая как сигнальный пептид тканевого активатора плазминогена (tPA), напр., человеческого tPA, и таким образом, вектор или полинуклеотид могут включать последовательность, кодирующую лидерный или сигнальный пептид, напр., лидерный или сигнальный пептид человеческого тканевого активатора плазминогена (tPA) (Hartikka, Sawdey et al. 1996). Нуклеотидная последовательность, кодирующая сигнальный пептид, преимущественно вставляется в рамку и в обратном направлении от последовательности, кодирующей BTV полипептид, напр., VP2, VP5 или комбинации, напр., VP2 и VP5.

Согласно воплощению изобретения векторы, напр., in vivo экспрессирующие векторы, являются вирусными векторами.

Вирусными векторами, напр., вирусными экспрессирующими векторами, являются преимущественно: вирус оспы, напр., вакцинный вирус или ослабленный вакцинный вирус (например, MVA, модифицированный штамм Ankara, полученный после более чем 570 пассажей вакцинного штамма Ankara на фибробластах эмбриона цыпленка; см. (Stickl and Hochstein-Mintzel 1971; Sutler and Moss 1992); доступный как АТСС VR-1508; или NYVAC, см. Патент США №5,494,807, например Примеры 1-6 и далее Патент США №5,494,807, который раскрывает конструкцию NYVAC, а также варианты NYVAC с дополнительными ORF, исключенных из генома вакцинного штамма вируса Copenhagen, a также вставку из гетерологичных кодирующих молекул нуклеиновой кислоты в участки этого рекомбинанта, и также, применение сходных промоторов; см. также WO96/40241), вирус оспы птиц или ослабленный вирус оспы птиц (напр., оспы канареек, оспы птиц, оспы голубей, оспы поросят, оспы перепелки, ALVAC или TROVAC; см., напр., Патенты США №5,505,941, 5,494,807), оспы свиней, оспы енота, оспы верблюда или вирус миксоматоза; аденовирусы, такие как птиц, собак, свиней, быков, аденовирусы человека; или герпес вирусы, такие как вирус герпеса овец (OHV 1 и 2), вирус герпеса лошадей (EHV серотипы 1 и 4), вирус герпеса собак (CHV), вирус герпеса кошек (FHV), вирус герпеса быков (BHV серотипы 1 и 4), вирус герпеса свиней (PRV), вирус болезни Марека (MDV серотипы 1 и 2), вирус герпеса индюков (HVT или MDV серотип 3) или вирус герпеса уток. Если применяется вирус герпеса, вектор HVT предпочтителен для вакцинации птичьих видов, бычий вектор - для вакцинации крупного рогатого скота, овечий вектор - для вакцинации овец и вектор EHV - для вакцинации лошадей.

Кроме того, в определенных воплощениях может быть выгодным подбор вектора для хозяина, такого как вирус лошадей, напр., EHV, для использования у лошадей, или вектора, который является птичьим патогеном, такого как оспы птиц, HVT, MDV или герпеса уток для применения у птиц, таких как дичь или цыплята, или вектора, который представляет овечий патоген, такого как OHV, патоген жвачных, такого как BHV, для применения у жвачных, таких как коровы, или вектора, который представляет патоген свиней, такого как вирус герпеса свиней для использования у свиней, или вектора, который является собачим патогеном, такого как собачий аденовирус или собачий вирус герпеса для использования у собак, таких как собаки, вектора, который является кошачьим патогеном, такого как FHV, для использования у кошек, как это позволяет осуществить иммунный ответ против вектора и, таким образом, обеспечивает иммунную реакцию против патогена хозяина или мишеневых видов в дополнение к иммунному ответу против Orbivirus.

Тем не менее, необходимо также указать, что может быть выгодным, чтобы вектором не был природный патоген хозяина; например, так, чтобы вектор мог иметь экспрессию экзогенной, напр., BTV, кодирующей последовательности, но с ограничением или без репликации; например, применение вектора оспы птиц у млекопитающего хозяина, как в Патенте США №5,174,993. Также следует отметить, что изобретение охватывает вакцины, иммунологические и иммуногенные композиции, с теми понятиями, которые используются в смысле, приписываемом им в уровне техники; см., напр., цитируемые здесь документы, такие как Патент США №6,497,883.

Согласно другому воплощению изобретения вектор вируса оспы, напр., экспрессирующий вектор, представляет вектор вируса оспы канареек или вируса оспы птиц, преимущественно ослабленный вирус оспы канареек или вирус оспы птиц. В этой связи, выпускается вирус оспы канареек, доступный из АТСС под входящим номером VR-111. Ослабленные вирусы оспы канареек описываются в Патенте США №5,756,103 (ALVAC) и WO01/05934. Различные вакцинные штаммы вируса оспы птиц также доступны, напр., DIFTOSEC СТ штамм, продаваемых MERIAL, и NOBILIS VARIOLE вакцина, продаваемая Intervet; и ссылка также приводится на Патент США №5,766,599, который относится к ослабленному штамму оспы птиц TROVAC.

Для информации о вирусе оспы, как получить его рекомбинанты и как ввести его рекомбинанты, квалифицированный специалист может обращаться к документам, цитированным здесь, и к WO90/12882, напр., упоминание о вакцинном вирусе находится в Патентах США №4,769,330, 4,722,848, 4,603,112, 5,110,587, 5,494,807 и 5,762,938 inter alia; касательно оспы птиц, упоминание приведено в Патентах США №5,174,993, 5,505,941 и US-5,766,599 inter alia, относительно оспы канареек, упоминается в Патенте США №5,756,103 inter alia; относительно оспы свиней упоминается в Патенте США №5,382,425 inter alia; и относительно оспы енота упоминается в WO00/03030 inter alia.

Если экспрессирующий вектор представляет собой вакцинный вирус, участок встраивания или участки для полинуклеотида или полинуклеотидов, которые экспрессируются, преимущественно располагается на гене тимидинкиназы (ТК) или участке встраивания, гене гемагглютинина (НА) или участке встраивания, области, кодирующей вирусные включения типа A (ATI); см. также документы, цитируемые здесь, в особенности те, которые касаются вакцинного вируса. Для вируса канареек, преимущественно участок встраивания или участки представляют ORF С3, С5 и/или С6; см. также документы, цитируемые здесь, в особенности те, которые относятся к вирусу оспы канареек. В случае оспы птиц, преимущественно участок встраивания или участки представляют ORF F7 и/или F8; см. также документы, цитируемые здесь, в особенности те, которые относятся к вирусу оспы птиц. Встраиваемый участок или участки для MVA вирусной области, преимущественно как в различных публикациях, включая (Carroll, Overwijk et al. 1997); (Stittelaar, Wyatt et al. 2000); (Sutler, Wyatt et al. 1994); и, в этой связи, также необходимо указать, что полный геном MVA описывается в (Antoine, Scheiflinger et al. 1998), который позволяет квалифицированному специалисту использовать другие встраиваемые участки и другие промоторы.

Предпочтительно, когда экспрессирующий вектор представляет собой вирус оспы, полинуклеотид, который экспрессируется, вставляется при контроле промотора, специфичного к вирусу оспы, напр., вакцинного промотора 7,5 кДа (Cochran, Puckett et al. 1985), вакцинного промотора I3L (Riviere, Tartaglia et al. 1992), вакцинного промотора НА (Shida 1986), промотор оспы коров ATI (Funahashi, Sato et al. 1988), вакцинного промотора Н6 (Taylor, Weinberg et al. 1988); (Guo, Goebel et al. 1989); (Perkus, Limbach et al. 1989)), ineer alia.

Предпочтительно, для вакцинации млекопитающих экспрессирующий вектор представляет оспу канареек или оспу птиц. Таким образом, могут быть экспрессированы гетерологичные протеины, напр., BTV протеины, с ограничительной или не продуктивной репликацией. Предпочтительно, для вакцинации птиц, напр., цыплят, уток, индеек и гусей, экспрессирующий вектор представляет вирус оспы канареек или оспы птиц.

Если экспрессирующий вектор представляет собой вирус герпеса индеек или HVT, выгодный встраиваемый участок или участки располагаются в BamHI I фрагменте или в BamHI М фрагменте HVT. HVT BamHI I фрагмент рестрикции содержит несколько открытых рамок считывания (ORFs) и три межгенных участка и содержит несколько предпочтительных встраиваемых зон, таких как три межгенных участка 1, 2 и 3, которые являются предпочтительными участками, и ORF UL55 (см., напр., FR-A-2 728 795, Патент США №5,980,906). HVT BamHI M рестрикционный фрагмент содержит ORF UL43, которая также является предпочтительным встраиваемым участком (см., напр., FR-A-2 728 794, Патент США №5,733,554).

Если экспрессирующий вектор является EHV-1 или EHV-4 герпес вирусом, выгодный участок встраивания или участки включают ТК, UL43 и UL45 (см., напр., ЕР-А-668355).

Предпочтительно, когда экспрессирующий вектор представляет герпес вирус, полинуклеотид, который экспрессируется, вставляется под контролем эукариотического промотора, такого как сильный эукариотический промотор, предпочтительно CMV-IE (мышиный или человеческий) промотор; а именно, в приведенных здесь воплощениях, полинуклеотид, который экспрессируется, функционально связан с промотором, и в воплощениях относительно вируса герпеса, преимущественно полинуклеотид, который экспрессируется, функционально связан с сильным эукариотическим промотором, таким как mCMV-IE или hCMV-IE промотор. Сильные промоторы также указаны здесь в отношении плазмид как векторов.

В соответствии с еще дополнительным воплощением изобретения вектор, напр., in vivo экспрессирующий вектор, представляет плазмидный вектор или ДНК плазмидный вектор, напр., тип плазмидного вектора, использующегося в том отношении, которое известно как ДНК вакцина (по сравнению с трансфекционной плазмидой, применяемой в гомологичной рекомбинации с получением рекомбинантного вируса, который не используется в ДНК вакцине).

Термин плазмида покрывает любую ДНК транскрипционную единицу в форме полинуклеотидной последовательности, содержащей полинуклеотид изобретения и элементы, необходимые для in vivo экспрессии такого, который кодирует полинуклеотид в клетке или клетках желаемого хозяина или мишени; и, в этой связи, необходимо указать, что существует сверхспиральная и несверхспиральные кольцевые плазмиды, а также линейные и многомерные формы, все из которых предназначены для нахождения в области изобретения.

Каждая плазмида содержит, или включает, или состоит преимущественно из, в дополнение к полинуклеотиду, кодирующему антиген(ы) или эпитоп(ы) патогена или патогенов, напр., BTV (или BTV и другой патоген), промотор для экспрессии, в клетках-хозяевах полинуклеотида; и, полинуклеотид может указываться как функционально связанный с промотором или под контролем промотора или зависит от промотора. В целом, выгодным является использование эукариотического промотора, напр., сильного эукариотического промотора. Предпочтительным сильным эукариотическим промотором является предранний цитомегаловирусный промотор (CMV-IE) человека или мышей, или необязательно имеющий другое происхождение, как, например, крысиный или гвинейских свиней. CMV-IE промотор может содержать активную часть промотора, которая может или не может быть связана с частью энхансера. Ссылка может быть приведена к ЕР-А-260 148, ЕР-А-323 597, Патентам США №5,168,062, 5,385,839 и 4,968,615, а также к РСТ WO87/03905. CMV-IE промотор представляет предпочтительно человеческий CMV-IE (Boshart, Weber et al. 1985) или мышиный CMV-IE.

В более общих понятиях промотор имеет либо вирусное либо клеточное происхождение. Сильный вирусный промотор, другой, чем CMV-IE, который может пригодным образом использоваться в способе изобретения, является ранним/поздним промотором вируса SV40 или LTR промотором вируса саркомы Рауса. Сильный клеточный промотор, который может быть использован в способе изобретения, представляет промотор гена цитоскелета, такой как, напр., десминовый промотор (Kwissa, van Kampen et al. 2000), или актиновый промотор (Miyazaki, Takaki et al. 1989).

Функциональные субфрагменты этих промоторов, т.е. части этих промоторов, которые сохраняют адекватную промоторную активность, включены в настоящее изобретение, напр., усеченные CMV-IE промоторы согласно WO98/00166 или Патенту США №6,156,567 могут использоваться в способе изобретения. Промотор в способе изобретения поэтому включает производные и субфрагменты полноразмерного промотора, который сохраняет адекватную промоторную активность и, таким образом, функцию как промотор, предпочтительно промоторная активность, по существу, похожа с таковой активного или полноразмерного промотора, из которого получено производное или субфрагмент, напр., сходна с активностью усеченных CMV-IE промоторов из Патента США №6,156,567, с активностью полноразмерных CMV-IE промоторов. Таким образом, CMV-IE промотор в практике изобретения может содержать, или состоять преимущественно из, или включать промоторную часть полноразмерного промотора и/или энхансерную часть полноразмерного промотора, а также производные и субфрагменты.

Предпочтительно, плазмиды содержат или состоят преимущественно из других элементов, контролирующих экспрессию. В особенности является выгодным объединение стабилизирующей последовательности(ей), напр., интронной последовательности(ей), предпочтительно интрона II кроличьего гена β-глобина (van Ooyen, van den Berg et al. 1979).

Что касается сигнала полиаденилирования (поли А) для плазмид и вирусных векторов, отличающихся от вируса оспы, применение может больше осуществляться с использованием поли А сигнала бычьего гена гормона роста (bGH) (см. Патент США №5,122,458), или поли (А) сигнала кроличьего гена β-глобина, или поли (А) сигнала вируса SV40.

Что касается других контролирующих экспрессию элементов, используемых в плазмидах, внимание направлено к контролирующим экспрессию элементам, которые пригодны для экспрессирующих векторов вируса герпеса.

Согласно другому воплощению изобретения экспрессирующие векторы представляют собой экспрессирующие векторы, использующиеся для in vitro экспрессии протеинов в подходящей клеточной системе. Экспрессирующиеся протеины могут быть собраны в или из культурального супернатанта после или не после секреции (если нет секреции, то происходит или осуществляется клеточный лизис), необязательно концентрированы способами концентрирования, такими как ультрафильтрование и/или очистка способами очистки, такими как способы аффинной, ионообменной или гельфильтрационной хроматографии.

Продукция протеинов может осуществляться путем трансфекции клеток млекопитающих посредством плазмид, путем репликации или экспрессии без продуктивной репликации вирусных векторов в клетках млекопитающих или в птичьих клетках, или путем репликации бакуловируса (см., напр., Патент США №4,745,051; (Vialard, Lalumiere et al. 1990); Luckow (Luckow and Summers 1988), напр. Autographa californica Вируса Ядерного Полиэдроза AcNPV, или в клетках насекомых (напр., Sf9 клетках Spodoptera frugiperda, ATCC CRL 1711; см. также Патенты США №6,228,846, 6,103,526). Клетки млекопитающих, которые могут использоваться, представляют hamster клетки хомяков (напр. СНО или BHK-21) или клетки обезьян (напр., COS или VERO). Таким образом, изобретение охватывает экспрессирующие векторы, включающие полинуклеотид изобретения, а также, таким образом, продуцирующиеся или экспрессирующиеся BTV протеины или их фрагменты из экспрессии in vitro, и препараты, содержащие их.

Таким образом, настоящее изобретение также относится к BTV протеин-концентрированным и/или очищенным препаратам. Если полинуклеотид кодирует несколько протеинов, они являются расщепляемыми, и указанные препараты затем содержат расщепленные протеины.

Настоящее изобретение также относится к иммуногенным композициям и вакцинам против BTV, содержащим, по меньшей мере, один in vivo экспрессирующий вектор изобретения и фармацевтически или ветеринарно приемлемый наполнитель или носитель или связующее вещество, и необязательно адъювант.

Иммуногенная композиция покрывает любую композицию, которая, однажды введенная мишеневым видам, индуцирует иммунный ответ против BTV. Термин вакцина относится к композиции, способной вызывать эффективную защиту. Мишеневые виды включают млекопитающих, напр., лошадей, собак, кошек, быков, овец, свиней и людей; рептилий, и птиц или птичьих. Этот перечень включает воспроизводящих животных, откладывающих яйца животных, производящих животных и парных животных.

Фармацевтически или ветеринарно приемлемые носители, или связующие вещества, или наполнители хорошо известны из уровня техники для специалиста. Например, фармацевтически или ветеринарно приемлемый носитель, или связующее вещество, или наполнитель может представлять 0,9% NaCl физиологический раствор или фосфатный буфер. Фармацевтически или ветеринарно приемлемый носитель, или связующее вещество, или наполнители могут быть любым соединением или комбинацией соединений, облегчающих введение вектора (или протеина, экспрессированного из вектора изобретения in vitro); преимущественно, носитель, связующее вещество или наполнитель может способствовать трансфекции и/или повышению сохранности вектора (или протеина). Дозы и дозовые объемы здесь обсуждаются в общем описании способов иммунизации и вакцинации и могут также определяться квалифицированным специалистом из приведенного описания в сочетании с уровнем техники, без проведения какого-либо дополнительного эксперимента.

Иммуногенные композиции и вакцины изобретения предпочтительно содержат или состоят преимущественно из одного или более адъювантов. Особенно пригодными адъювантами для использования в практической части настоящего изобретения являются (1) полимеры акриловой и метакриловой кислоты, малеиновый ангидрид и полимеры из производных алкенила, (2) иммуностимулирующие последовательности (ISS), такие как олигодеоксирибонуклеотидные последовательности, имеющие одну или более не-метилированных CpG единиц (Klinman, Yi et al. 1996); WO98/16247), (3) эмульсия масло в воде, такая как SPT эмульсия, описанная на стр.147 в "Vaccine Design, The Subunit and Adjuvant Approach" опубл. M. Powell, M. Newman, (Powell and Newman 1995), и эмульсия MF59, описываемая на стр.183 этой же работы, (4) катионные липиды, содержащие четвертичную аммониевую соль, (5) цитокины, (6) гидроксид алюминия или фосфат алюминия или (7) другие адъюванты, обсуждаемые в любом документе, цитируемом и объединенном ссылкой в рассматриваемой заявке, или (8) любые комбинации или их смеси.

Эмульсия масло в воде (3), которая является в особенности подходящей для вирусных векторов, может быть основана на:

- светлом жидком парафиновом масле (тип в соответствии с Европейской фармакопеей),

- изопреноидном масле, таком как сквалан, сквален,

- масле, полученном в результате олигомеризации алкенов, напр., изобутена или декана,

- сложных эфирах кислот или спиртов, имеющих разветвленную алкильную группу, таких как растительные масла, этилолеат, пропиленгликоль, ди(каприлат/капрат), глицерин три(каприлат/капрат) и пропиленгликольдиолеат или

- сложных эфирах разветвленных, жирных спиртов или кислот, в особенности эфиров изостеариновой кислоты.

Масло используется в комбинации с эмульгаторами для образования эмульсии. Эмульгаторами могут быть неионные сурфактанты, такие как:

- сложные эфиры, с одной стороны сорбит, маннит (напр. ангидридманнитола олеат), глицерин, полиглицерин или пропиленгликоль и, с другой стороны, олеиновые, изостеариновые, рицинолевые или гидроксистеариновые кислоты, при этом указанные сложные эфиры необязательно этоксилированы,

- блоки сополимеров полиоксипропилена и полиоксиэтилена, такие как Pluronic, напр., L121.

Среди типа (1) адъювантных полимеров предпочтение отдается полимерам сшитой акриловой или метакриловой кислоты, в особенности сшитой посредством полиалкениловых эфиров сахаров или полиспиртов. Эти соединения известны под названием карбомер (Pharmeuropa, vol. 8, no. 2, June 1996). Специалист в данной области может также касаться Патента США №2,909,462, который обеспечивает такие акриловые полимеры, сшитые посредством полигидроксильного соединения, имеющего, по меньшей мере, три гидроксильные группы, предпочтительно не более восьми таких групп, атомы водорода, по меньшей мере, трех гидроксильных групп, которые замещены ненасыщенными, алифатическими радикалами, имеющими, по меньшей мере, два атома углерода. Предпочтительные радикалы те, которые содержат от 2 до 4 атомов углерода, напр., винилы, аллилы и другие группы, ненасыщенные этиленами. Ненасыщенные радикалы могут также содержать другие заместители, такие как метил. Продукты, продаваемые под названием Carbopol (BF Goodrich, Ohio, USA), являются в особенности пригодными. Они сшиты аллильной сахарозой или аллилпентаэритритолом. Среди них, ссылка предоставляется на Carbopol 974P, 934Р и 971Р.

Что касается производных сополимеров малеинового ангидрида и алкенилов, предпочтение отдается EMA (Monsanto), которые являются неразветвленными или сшитыми сополимерами малеинового ангидрида и этилена, и они, например, сшиты посредством винилового эфира. Ссылка также дается на (Regelson, Kuhar et al. 1960).

Относительно структуры полимеры акриловой или метакриловой кислоты и EMA предпочтительно формируются на основе единиц, имеющих следующую формулу:

в которой:

- R1 и R2, которые могут быть одинаковыми или отличаться, представляют Н или CH3,

- x=0 или 1, предпочтительно x=1,

- y=1 или 2, с тем что x+y=2.

Для ЕМА, x=0 и y=2 и для карбомеров x=y=1.

Эти полимеры являются растворимыми в воде или в физиологическом растворе (20 г/л NaCl) и рН может доводиться до 7,3-7,4, напр., посредством соды (NaOH), с обеспечением адъювантного раствора, в который может вводиться экспрессирующий вектор(ы). Концентрация полимера в итоговой вакцинной композиции может находиться в пределе между 0,01 и 1,5% масса/объем, преимущественно 0,05 и 1% масса/объем и предпочтительно 0,1 и 0,4% масса/объем.

Катионные липиды (4), содержащие четвертичную аммониевую соль, которые преимущественно, но не только, пригодны для плазмид, являются предпочтительно такими, которые имеют следующую формулу:

в которой R1 представляет насыщенный или ненасыщенный неразветвленный алифатический радикал, имеющий 12-18 атомов углерода, R2 представляет другой алифатический радикал, содержащий 2 или 3 атома углерода, и Х представляет амин или гидроксильную группу.

Среди таких катионных липидов предпочтение отдается DMRIE (N-(2-гидроксиэтил)-N,N-диметил-2,3-бис(тетрадецилокси)-1-пропан аммонию; WO96/34109), предпочтительно связанному с нейтральным липидом, предпочтительно DOPE (диолеоил-фосфатидил-этанол амин; Behr J. Р., 1994, Bioconjugate Chemistry, 5, 382-389), с образованием DMRIE-DOPE.

Предпочтительно, смесь плазмиды с адъювантом формируется спонтанно и предпочтительно одновременно при введении препарата или непосредственно перед введением препарата; например, непосредственно перед или до введения, формируется смесь плазмида-адъювант, преимущественно, если предполагается достаточно времени, перед введением смеси с образованием комплекса, напр., между около 10 и около 60 минутами перед введением, например, приблизительно за 30 минут до введения.

Если присутствует DOPE, молярное соотношение DMRIE:DOPE представляет предпочтительно от около 95 к около 5 до от около 5 к около 95, более предпочтительно от около 1: около 1, напр., 1:1.

Массовое соотношение DMRIE или DMRIE-DOPE адъюванта к плазмиде может составлять между около 50: около 1 и около 1: около 10, как, например, около 10: около 1 и около 1:около 5, и предпочтительно около 1: около 1 и около 1: около 2, напр., 1:1 и 1:2.

Цитокин или цитокины (5) могут быть в форме протеина в иммуногенной или вакцинной композиции, или могут ко-экспрессироваться в хозяине вместе с иммуногеном, или иммуногенами, или его(их) эпитопом(ами). Предпочтение отдается ко-экспрессии цитокина или цитокинов, либо посредством того же вектора, который экспрессирует иммуноген, или иммуногены, или его(их) эпитоп(ы), либо посредством другого вектора.

Цитокин(ы) могут выбираться из: интерлейкина 18 (IL-18), интерлейкина 12 (IL-12), интерлейкина 15 (IL-15), MIP-la (воспалительного белка макрофагов la; (Marshall, Woolara d et al. 1997), GM-CSF (гранулоцитарно-моноцитарного колониестимулирующего фактора). Особое внимание уделяется птичьим цитокинам, например, куриным, таким как cIL-18 (Schneider, Puehler et al. 2000), cIL-15 (Xin, Hamajima et al. 1999), и лошадиным цитокинам, например, лошадиному GM-CSF (WO00/77210). Предпочтительно, применяются цитокины тех видов, к которым они вакцинируются; а именно преимущественно, цитокин соответствует мишени или типам хозяев, и, в качестве примера, собачий GM-CSF (пример 8 из WO00/77043), кошачий GM-CSF (пример 9 из WO00/77043).

WO00/77210 обеспечивает нуклеотидную последовательность и аминокислотную последовательность, соответствующую лошадиному GM-CSF, in vitro GM-CSF продукции и конструкции векторов (напр., плазмиды вирусных векторов), обеспечивая экспрессию лошадиного GM-CSF in vivo. Эти протеины, плазмиды и вирусные векторы могут использоваться в иммуногенных композициях и вакцинах для лошадей согласно изобретению. Например, может осуществляться применение плазмиды pJP097, описанной в примере 3 из WO00/77210, или может осуществляться применение для обучения последнего относительно других векторов или для продукции in vitro лошадиного GM-CSF и введения векторов или лошадиного GM-CSF в иммуногенные композиции или лошадиные вакцины согласно изобретению.

Настоящее изобретение также относится к иммуногенным композициям и так называемым субъединичным вакцинам, включающим, или содержащим, или состоящим преимущественно из протеина VP2 и необязательно одного или более других упомянутых здесь протеинов BTV, напр., VP5 или VP7, и преимущественно полученных посредством экспрессии in vitro по способу, здесь указанному, а также фармацевтически или ветеринарно приемлемого носителя, или связующего вещества, или наполнителя.

Фармацевтически или ветеринарно приемлемый носитель, или связующее вещество, или наполнитель может определяться квалифицированным специалистом без проведения дополнительных экспериментов от описанного здесь и знаний уровня техники, напр., исходя из документов, цитированных и включенных здесь, или документов, указанных в цитируемых здесь документах и включенных здесь посредством ссылки; и могут, например, быть 0,9% NaCl солевым раствором или фосфатным буфером.

Иммуногенные композиции и субъединичные вакцины согласно изобретению предпочтительно содержат или состоят преимущественно из одного или более адъювантов. В особенности пригодными для применения в настоящем изобретении являются (1) полимер акриловой или метакриловой кислоты, или полимер производного малеинового ангидрида и алкенила, (2) иммуностимулирующая последовательность (ISS), такая как олигодеоксирибонуклеотидная последовательность, имеющая одну или более неметилированных CpG единиц (Klinman, Yi et al. 1996), (3) эмульсия масло в воде, такая как эмульсия SPT, описанная на стр.147 в "Vaccine Design, The Subunit and Adjuvant Approach", опубликованная M. Powell, M. Newmann, (Powell and Newman 1995), и эмульсия MF59, описанная на стр.183 этой же работы, (4) эмульсия вода в масле (ЕР-А-639 071), (5) сапонин, такой как Quil-A, или (6) гидроксид алюминия или эквивалент. Разные типы адъювантов, указанные под 1), 2) и 3), описываются здесь подробно по отношению к вакцинам на основе экспрессирующего вектора и иммуногенным композициям.

Дозы и дозовые объемы здесь обсуждаются применительно к общему описанию способов иммунизации и вакцинации.

Животные, иммунизированные иммуногенными композициями или вакцинами по изобретению, развивают специфический иммунитет против BTV, который в период инфекции BTV включает снижение виремии и фактически может полностью блокировать вирус, по сравнению с невакцинированными контрольными животными. Этот выгодный аспект изобретения может использоваться для остановки трансмиссии BTV с ограничением существования вирусных резервуаров млекопитающих и для предотвращения вспышек заболевания синий язык.

Другой выгодный аспект изобретения состоит в том, что защитный иммунитет может передаваться от вакцинированных субъектов потомству.

Согласно изобретению вакцинация против BTV может сочетаться с другими вакцинациями в рамках программ вакцинирования, в виде наборов для или способов иммунизации или вакцинации или в виде комбинированных иммуногенных композиций и комбинированных вакцин, т.е. содержащих или состоящих преимущественно из, по меньшей мере, одного вакцинного компонента против BTV и, по меньшей мере, одного вакцинного компонента против, по меньшей мере, одного другого патогенного агента. Это также включает экспрессию аналогичным экспрессирующим вектором генов, по меньшей мере, двух патогенных агентов, включая BTV.

Следовательно, изобретение также относится к комбинированной или "смешанной" иммуногенной композиции или комбинированной или "смешанной" вакцине против BTV против, по меньшей мере, одного другого патогена мишеневых типов, с использованием in vivo одинакового экспрессирующего вектора, содержащего или экспрессирующего, по меньшей мере, один полинуклеотид BTV согласно изобретению и, по меньшей мере, один полинуклеотид, экспрессирующий иммуноген другого патогена. Что касается комбинации или комбинированных или "смешанных" иммуногенных композиций или вакцин, а также их иммуногенов, или антигенов, или эпитопов, которые присутствуют или экспрессируются такими композициями или вакцинами, внимание направлено здесь на цитируемые и включенные посредством ссылки документы, а также к патентам США №5843456 и 6368603.

"Иммуноген", экспрессирующийся вектором изобретения или использующийся в комбинированных или "смешанных" композициях или вакцинах, означает протеин, гликопротеин, полипептид, пептид, эпитоп или производное, напр., слитый протеин, вызывающий иммунный ответ, предпочтительно иммунной природы.

Как здесь обсуждается, эти комбинированные композиции или вакцины могут также содержать или состоять преимущественно из фармацевтически или ветеринарно приемлемого носителя, или связующего вещества, или наполнителя, и необязательно адъюванта.

Изобретение также относится к комбинированной иммуногенной композиции или комбинированной вакцине, содержащей, по меньшей мере, один экспрессирующий вектор in vivo, в который вставлен, по меньшей мере, один полинуклеотид вируса синий язык (и экспрессирующийся in vivo) и, по меньшей мере, второй экспрессирующий вектор, в который вставлен полинуклеотид, кодирующий иммуноген другого патогенного агента (и экспрессирующийся in vivo). Такие комбинированные композиции или вакцины также содержат или состоят преимущественно из фармацевтически или ветеринарно приемлемого носителя, или связующего вещества, или наполнителя, и необязательно адъюванта.

Для антигена(ов), или иммуногена(ов), или эпитопа(ов), которые включаются в или экспрессируются комбинированной иммуногенной композицией или вакциной (в дополнении к BTV антигену(ам), иммуногену(ам) или эпитопу(ам)), включая относительно определяемого или устанавливаемого эпитопа(ов), квалифицированный специалист может обратиться к цитируемым здесь документам и документам, цитируемым в приведенных здесь документах, все из которых включены посредством ссылки в рассматриваемую заявку.

Для овечьих комбинированных иммуногенных композиций и комбинированных вакцин дополнительный(ые) овечий(ьи) патоген(ы), относительно которых дополнительные овечьи антиген(ы), или иммуноген(ы), или их эпитоп(ы) включаются в и/или экспрессируются комбинированными иммуногенными композициями и комбинированными вакцинами, преимущественно выбираются из группы, включающей такие вирусы, как вирус герпеса овец 1 типа (OHV-1), вирус герпеса овец 2 типа (OHV-2), вирус пограничной болезни овец (BDV), вирус болезни Борна, Pestes des petit ruminants, вирус болезни найробианских овец (NSDV), вирус эктимы (овечий вирус рагарох), вирус бешенства (рабдовирус), кошачий парвовирус (FPV), овечий ротавирус, овечий пестивирус, овечий аденовирус, вирус ящура (FMDV), вирус лихорадки долины Рифт и их комбинации. Дополнительные антигены, пригодные для использования в композициях настоящего изобретения, включают антигены, полученные из бактериальных и вирусных патогенов овцы. Предпочтительные бактериальные и паразитические антигены включают Cryptosporidium parvum, Chlamydia, Coxiella bumetti, Clostridium sp., Pasteurella multocida, Pasteurella haemolytica, Salmonella typhimurium, Brucella, Erysipelothrix rhusiopathiae, Haemonchus contortis, Ostertagia, Coccidia и Escherichia coli.

Для бычьих комбинированных иммуногенных композиций и комбинированных вакцин дополнительный(е) лошадиный(е) патоген(ы), а также дополнительный(е) лошадиный(е) антиген(ы), или иммуноген(ы), или эпитоп(ы) от них, включенные в и/или экспрессирующиеся посредством комбинированных иммуногенных композиций и комбинированных вакцин, преимущественно выбираются из группы, включающей: бычий вирус герпеса 1 типа (BHV-1), также называемый инфекционный бычий ринотрахеит (IBR), бычий респираторно-синцитиальный вирус (BRSV), вирус вирусной диареи, также называемый бычий пестивирус 1 типа или 2 типа (бычий вирус вирусной диареи или BVDV-1 и BVDV-2), и вирус парагриппа 3 типа, для каждой валентности, один или более генов, выбранных из группы, состоящей из gB и gD для бычьего вируса герпеса, F и G для бычьего респираторно-синцитиального вируса, Е2, С+Е1+Е2 и Е1+Е2 для вируса вирусной диареи и HN и F для вируса парагриппа 3 типа. Дополнительные антигены, пригодные для использования в композициях настоящего изобретения, включают антигены, полученные из бактериальных и вирусных патогенов крупного рогатого скота. Предпочтительные бактериальные антигены включают антигены к клостридиям, таким как Clostridium botulinum С и D, Clostridium perfringens типа А, В, С и D, Clostridium septicum, Clostridium tetani, Clostridium chauvoei, Clostridium novyi типа В, Clostridium sordellii, Clostridium haemolyticum; антигены к лептоспирам, например, Leptospira interrogans, таким как Leptospira hardjo, Leptospira Pomona, Leptospira copenhageni, Leptospira zanoni, Leptospira tarassovi; антигены к пастеуреллам, таким как Pasteurella multocida и Pasteurella haemolytica; антигены к коринебактериям, таким как Corynebacterium pseudotuberculosis, Corynebacterium renale, Corynebacterium cystitis, Corynebacterium pilosum и Corynebacterium bovis; и антигены к гемоглобинофильным бактериям, таким как Haemophilus somnus и Haemophilus pleuropneumoniae; Dichelobacter nodosus pilus; антигены к микоплазмам, таким как Mycoplasma agalactiae, Mycoplasma bovis и Mycoplasma ovipneumoniae. Предпочтительные вирусные антигены включают антигены к Бычьей Вирусной Диарее (BVD), антигены к Бычьему Вирусу Ринотрахеита (IBR), антигены к Парагриппу-3, антигены к Респираторно-Синцитиальному Вирусу (RSV) и антигены к Бычьей Эфемерной Лихорадке (BEF). Таким образом, изобретение охватывает применение полинуклеотида(ов), кодирующего(х) иммунологически активный(е) фрагмент(ы) или эпитоп(ы) такого(их) иммуногена(ов).

Для лошадиных комбинированных иммуногенных композиций и комбинированных вакцин дополнительный(е) лошадиный(е) патоген(ы), а также дополнительный(е) лошадиный(е) антиген(ы), или иммуноген(ы), или эпитоп(ы) от них, включенные в и/или экспрессирующиеся посредством комбинированных иммуногенных композиций и комбинированных вакцин, преимущественно выбираются из группы, включающей вирусы лошадиного гриппа (EI), африканской чумы лошадей ([AHSV]предпочтительно с комбинацией из иммуногенов VP2 и VP5), вирус лошадиного энцефалита ([EEV] также с комбинацией из VP2 и VP5), Вирус Западного Энцефалита Лошадей (WEEV), Вирус Венесуэльского Энцефалита Лошадей (VEEV), Вирус Восточного Энцефалита Лошадей (EEEV), Вирус лихорадки Западного Нила (WNV), Clostridium tetani (тетанус) и их комбинации. Предпочтительно, для AHSV иммуногенами являются VP2 и/или VP5, для EIV иммуноген представляет преимущественно НА, NP и/или N; для вирусов энцефалита, иммуноген представляет преимущественно С и/или Е2; и для Clostridium tetani иммуногеном является весь или часть от субъединицы С столбнячного токсина. Таким образом, изобретение охватывает применение полинуклеотида(ов), кодирующего(х) иммунологически активный(е) фрагмент(ы) или эпитоп(ы) такого(их) иммуногена(ов).

Для собачьих комбинированных иммуногенных композиций и комбинированных вакцин дополнительный(е) собачий(ьи) патоген(ы), а также дополнительный(е) собачий(ьи) антиген(ы), или иммуноген(ы), или эпитоп(ы) от них, включенные в и/или экспрессирующиеся посредством комбинированных иммуногенных композиций и комбинированных вакцин, преимущественно выбираются из группы, включающей следующие вирусы: вирус кори, собачий аденовирус 1 (CAV-1), собачий аденовирус 2 (CAV-2), собачий вирус чумы (CDV), собачий вирус парагриппа 2 тип (CPI-2), собачий вирус герпеса 1 тип (CHV-1), вирус бешенства (рабдовирус), собачий парвовирус (CPV), собачий коронавирус (CCV), собачий аденовирус, Borrelia burgdorferi, Leptospira и их комбинации. Предпочтительно, для CDV иммуногеном является преимущественно F и/или НА (см. также Патенты США №6,309,647, 5,756,102, относительно CDV иммуногенов и конструкций); для CPV иммуногеном является преимущественно VP2; для CCV иммуногеном является преимущественно S и/или М; для CHV-1 иммуногеном является преимущественно gB, и/или gC, и/или gD (см. также Патент США №5,688,920, 5,529,780, касательно CHV иммуногенов и конструкций); для вируса бешенства иммуногеном является преимущественно G (см. также Патент США №5,843,456 относительно комбинированных композиций против бешенства); для Borrelia burgdorferi иммуногеном является преимущественно OspA (см. также Патент США №6,368,603 относительно OspA комбинированных композиций). Изобретение, таким образом, охватывает применение полинуклеотида(ов), кодирующего(х) иммунологически активный(е) фрагмент(ы) или эпитоп(ы) такого(их) иммуногена(ов).

Для кошачьих комбинированных иммуногенных композиций и комбинированных вакцин дополнительный(е) кошачий(ьи) патоген(ы), а также дополнительный(е) собачий(ьи) антиген(ы), или иммуноген(ы), или эпитоп(ы) от них, включенные в и/или экспрессирующиеся посредством комбинированных иммуногенных композиций и комбинированных вакцин, преимущественно выбираются из группы, включающей следующие вирусы: кошачий вирус герпеса 1 типа (FHV-1), кошачий калицивирус (FCV), вирус бешенства (рабдовирус), кошачий парвовирус (FPV), вирус кошачьего инфекционного перитонита (FIPV), кошачий вирус лейкемии (FeLV), кошачий вирус иммунодефицита (FIV), Chlamydia и их комбинации. Предпочтительно, для FeLV иммуногеном является преимущественно А, и/или В, и/или gag, и/или pol, напр., gag/pol; для FPV иммуногеном является преимущественно VP2; для FIPV иммуногеном является преимущественно S, и/или М, и/или N, напр., S и М и/или N (см. также Патенты США №6,348,196 и 5,858,373 и их иммуногены и конструкции); для FHV иммуногеном является преимущественно gB, и/или gC, и/или gD, напр., gB и gC и/или gD (см. также Патенты США №5,338,683, 6,183,750; для вируса герпеса иммуногены и конструкции, экспрессирующие их же); для FCV иммуногеном является преимущественно С; для FIV иммуногеном является преимущественно env, и/или gag, и/или pro, напр., gag/pro, env или env и gag/pro (см. также иммуногены и конструкции, обсуждаемые в Tartaglia et al., заявка США №08/746,668, поданная 14 ноября 1996); для вируса бешенства иммуногеном является преимущественно G. Изобретение, таким образом, охватывает применение полинуклеотида(ов), кодирующего(х) иммунологически активный(е) фрагмент(ы) или эпитоп(ы) такого(их) иммуногена(ов).

Для птичьих комбинированных иммуногенных композиций и комбинированных вакцин дополнительный(е) птичий(ьи) патоген(ы), а также дополнительный(е) птичий(ьи) антиген(ы), или иммуноген(ы), или эпитоп(ы) от них, включенные в и/или экспрессирующиеся посредством комбинированных иммуногенных композиций и комбинированных вакцин, преимущественно выбираются из группы, включающей следующие вирусы: вирус нейролимфоматоза птиц (MDV) (напр., серотипы 1 и 2, предпочтительно 1), вирус ньюкаслской болезни птиц (NDV), вирус болезни Гамборо или вирус инфекционного бурсита птиц (IBDV), вирус инфекционного бронхита (IBV), вирус инфекционной анемии или вирус анемии кур (CAV), вирус инфекционного ларинготрахеита (ILTV), вирус энцефаломиелита или вирус энцефаломиелита птиц (AEV или вирус лейкоза птиц ALV), вирус геморрагического энтерита индеек (HEV), пневмовирус (TRTV), вирус куриной чумы (птичий грипп), вирус гидроперикардита кур, птичьи реовирусы, Escherichia coli, Mycoplasma gallinarum, Mycoplasma gallisepticum, Haemophilus avium, Pasteurella gallinarum, Pasteurella multocida gallicida и их комбинации. Предпочтительно, для MDV иммуногеном является преимущественно gB и/или gD, напр., gB и gD, для NDV иммуногеном является преимущественно HN и/или F, напр., HN и F; для IBDV иммуноген преимущественно представляет VP2; для IBV иммуногеном является преимущественно S (более преимущественно S1), и/или М, и/или N, напр., S (или S1) и М и/или N; для CAV иммуногеном является преимущественно VP1 и/или VP2; для ILTV иммуногеном является преимущественно gB и/или gD; для AEV иммуноген преимущественно представляет env и/или gag/pro, напр., env и gag/pro или gag/pro; для HEV иммуногеном является преимущественно 100K протеин и/или гексон; для TRTV иммуногеном является преимущественно F и/или G, и для куриной чумы иммуногеном является преимущественно НА, и/или N, и/или NP, напр., НА и N и/или NP. Изобретение, таким образом, охватывает применение полинуклеотида(ов), кодирующего(х) иммунологически активный(е) фрагмент(ы) или эпитоп(ы) такого(их) иммуногена(ов).

В качестве примера в комбинированной иммуногенной композиции или комбинированной вакцине по изобретению, к которой необязательно добавлены один или более адъювантов (и, вследствие чего, композиция содержит, или состоит преимущественно из, или включает один или более адъювантов), как здесь указано, и которая относится к лошадиным видам, является возможным объединение (и, вследствие чего, для композиции или вакцины, содержащей, состоящей преимущественно из или включающей) одной или более плазмид, указанных в WO98/03198, преимущественно как обсуждается в приведенных там примерах 8-25, и/или тех, которые указаны в WO00/77043 и которые относятся к лошадиным видам, преимущественно те, которые описаны в указанных там примерах 6 и 7. Для собачьих видов комбинированная композиция или вакцина может содержать, или состоять преимущественно из, или включать одну или более плазмид, указанных в WO98/03199, преимущественно как обсуждается в приведенных там примерах 8-16, и/или те, которые указаны в WO00/77043 и которые относятся к собачим видам, преимущественно те, которые описаны в указанных там примерах 2, 3 и 4; и такие композиции или вакцины могут содержать, состоять преимущественно из или включать один или более адъювантов. Для кошачьих видов комбинированная композиция или вакцина может содержать, или состоять преимущественно из, или включать одну или более плазмид, указанных в WO98/03660, преимущественно в приведенных там примерах 8-19, и/или те, которые указаны в WO00/77043 и которые относятся к кошачьим видам, преимущественно те, которые описаны в примере 5; и такие композиции или вакцины могут содержать, состоять преимущественно из или включать один или более адъювантов. И для птичьих видов комбинированная композиция или вакцина может содержать, или состоять преимущественно из, или включать одну или более плазмид, указанных в WO98/03659, преимущественно в примерах 7-27; такие композиции или вакцины могут содержать, состоять преимущественно из или включать один или более адъювантов.

Иммуногенные композиции или вакцины, как здесь указано, могут также комбинироваться с, по меньшей мере, одной традиционной вакциной (напр., инактивированной, живой ослабленной или субъединичной), направленной против того же патогена или, по меньшей мере, одного другого патогена от видов, на которые композиция или вакцина направлена. Иммуногенные композиции или вакцины, указанные здесь, могут вводиться до или после применения традиционной вакцины, напр., в режиме «двукратной иммунизации» ("двукратная иммунизация").

Изобретение дополнительно охватывает комбинированную(ые) иммуногенную(ые) композицию(и), применяемую(ые) для вакцинации, и субъединичную(ые) вакцину(ы) согласно изобретению. Таким образом, изобретение также относится к комбинированным иммуногенным композициям и комбинированным вакцинам, содержащим один или более протеинов изобретения и один или более иммуногенов (при этом термин иммуноген представляет собой указанный здесь), по меньшей мере, из одного другого патогенного агента (преимущественно из такого, который указан здесь и в цитированных документах и включенных здесь посредством ссылки) и/или из другого патогенного агента в инактивированной или ослабленной форме или в качестве субъединицы. В описываемом способе эти комбинированные вакцины или композиции также содержат, состоят преимущественно из или включают фармацевтически или ветеринарно приемлемое связующее вещество или наполнитель и необязательно один или более адъювантов.

Настоящее изобретение также относится к способам для иммунизации и вакцинации мишеневых видов, напр., какие здесь указаны.

Настоящее изобретение также относится к способам для иммунизации и/или вакцинации мишеневых видов при использовании режима двукратной иммунизации. Термин "двукратная иммунизация" относится к успешным введениям двух различных типов вакцин или типов иммуногенных или иммунологических композиций, имеющих, по меньшей мере, один общий иммуноген. Первичное введение (примирование) представляет введение первой вакцины или типа иммуногенной или иммунологической композиции и может содержать одно, два или более введений. Повторное введение представляет введение второй вакцины или иммуногенной или иммунологической композиции и может содержать одно, два или более введений и, например, может содержать или состоять преимущественно из периодических введений.

Воплощение двукратной иммунизации или вакцинации против BTV согласно изобретению представляет двукратную иммунизацию или вакцинацию, где животному вводят (примирование) первую ДНК вакцину или иммунологическую или иммуногенную композицию, содержащую или состоящую преимущественно из и экспрессирующую in vivo, по меньшей мере, один иммуноген, антиген или эпитоп BTV, с последующим введением (стимуляцией) второго типа вакцины или иммуногенной или иммунологической композиции, содержащей или состоящей преимущественно из или экспрессирующей, по меньшей мере, один иммуноген, антиген или эпитоп, который является общим с первичной вакциной или иммуногенной или иммунологической композицией. Этот второй тип вакцины может быть инактивированной, или ослабленной, или субъединичной вакциной, или иммуногенной или иммунологической композицией, или вектором, напр., рекомбинантной или модифицированной вирусной вакциной или иммуногенной или иммунологической композицией, которая обладает способностью экспрессировать in vivo (напр., вирус оспы, вирус герпеса, аденовирус). Преимущественно могут применяться вирусы оспы, напр., ослабленные вирусы коровьей оспы, типа MVA или NYVAC, и вирусы оспы птиц, типа вирусы оспы канареек и вирусы оспы домашних птиц.

Преимущественно ДНК вакцина предназначена для индукции первичного иммунного ответа, специфичного для экспрессирующегося иммуногена, антигена или эпитопа, или "ДНК индуцированный иммунный ответ" (такой, как гамма-интерферон+(IFNγ+) Т-клеточный вторичный иммунный ответ, специфичный для экспрессирующегося иммуногена, антигена или эпитопа) способен к повторению (может быть повторяемым) за счет последующего введения (иммунизации) инактивированной вакцины или иммунологической композиции или живой рекомбинантной вакцины, содержащей или состоящей преимущественно из вирусного вектора, такой как живой рекомбинантный вирус оспы, содержащий или состоящий преимущественно из и экспрессирующий in vivo, по меньшей мере, аналогичный иммуноген(ы), или антиген(ы), или эпитоп(ы), экспрессирующиеся посредством ДНК вакцины. IFNγ+Т-клеточный иммунный ответ, специфичный для экспрессированного BTV иммуногена, может быть показан в количественном анализе энзимо-опосредованный иммуноспот (ELISPOT) с использованием мононуклеаров периферической крови (PBMCs) (Laval, Paillot et al. 2002).

"Стимулирование" может применяться через от около 2 недель до около 6 месяцев после "примирования", как, например, через от около 3 до около 8 недель после примирования, и преимущественно от около 3 до около 6 недель после примирования, и более преимущественно, через около 4 недель после примирования.

Для овец, быков или лошадей примирование может осуществляться ДНК вакциной, или иммуногенной, или иммунологической композицией, содержащей, или состоящей преимущественно из, или экспрессирующей in vivo молекулу(ы) нуклеиновой кислоты, кодирующую BTV иммуноген, антиген или эпитоп изобретения, и стимулирование преимущественно выполняется посредством вакцины или иммуногенной или иммунологической композиции, содержащей рекомбинантный живой вирусный вектор (напр., вирус оспы, вирус герпеса, аденовирус), такой как рекомбинантный вирус оспы птиц или рекомбинантный вирус оспы канареек, рекомбинантный, OHV-1 или OHV-2, BHV-1 или BHV-2, EHV-1 или EHV-4, содержащий или состоящий преимущественно из молекулы(л) нуклеиновой кислоты, кодирующей и экспрессирующей in vivo, по меньшей мере, один одинаковый BTV иммуноген(ы), антиген(ы) или эпитоп(ы), как при экспрессии ДНК вакцины или иммуногенной или иммунологической композиции. В другом воплощении эти примирующие и стимулирующие вакцины или иммунологические или иммуногенные композиции могут быть усилены, например, посредством DMRIE-DOPE для примирования ДНК вакцины или иммунологической или иммуногенной композиции и посредством Carbopol® для стимулирования рекомбинантной вакцины или иммунологической или иммуногенной композиции.

Примирование может выполняться для молодой овцы, теленка или жеребенка, которые могут иметь материнские антитела против BTV (против которого направлена иммунизация или вакцинация). Преимущественно ДНК вакцина или иммунологическая или иммуногенная композиция вводится молодому животному с момента рождения до и включая около 16-недельный возраст, как, например, от рождения до и включая около 8-недельный возраст, например, от рождения до и включая около 6-недельный возраст, напр., от рождения до и включая около 4-недельный возраст.

Для кошек примирование может осуществляться ДНК вакциной или иммуногенной или иммунологической композицией, содержащей, или состоящей преимущественно из, или экспрессирующей in vivo молекулу(ы) нуклеиновой кислоты, кодирующую BTV иммуноген, антиген или эпитоп изобретения, и стимулирование преимущественно выполняется посредством вакцины или иммуногенной или иммунологической композиции, содержащей рекомбинантный живой вирусный вектор (напр., вирус оспы, вирус герпеса, аденовирус, преимущественно рекомбинантный вирус оспы птиц или рекомбинантный вирус оспы канареек, рекомбинантный FHV, рекомбинантный собачий аденовирус), содержащий или состоящий преимущественно из молекулы(л) нуклеиновой кислоты, кодирующей и экспрессирующей in vivo, по меньшей мере, один одинаковый BTV иммуноген(ы), антиген(ы) или эпитоп(ы), как при экспрессии ДНК вакцины. В другом воплощении эти примирующие и стимулирующие вакцины или иммунологические или иммуногенные композиции могут быть усилены, например, посредством DMRIE-DOPE для примирования ДНК вакцины или иммунологической или иммуногенной композиции и посредством Carbopol® для стимулирования рекомбинантной вакцины или иммунологической или иммуногенной композиции.

Примирование может выполняться для молодого котенка, который может иметь материнские антитела против BTV (против которого направлена иммунизация или вакцинация). ДНК вакцина или иммунологическая или иммуногенная композиция может вводиться молодому котенку с момента рождения до и включая около 12-недельный возраст, как, например, от рождения до и включая около 8-недельный возраст, например, от рождения до и включая около 6-недельный возраст, напр., от рождения до и включая около 4-недельный возраст.

Для собак примирование может осуществляться ДНК вакциной или иммуногенной или иммунологической композицией, содержащей, или состоящей преимущественно из, или экспрессирующей in vivo молекулу(ы) нуклеиновой кислоты, кодирующую BTV иммуноген, антиген или эпитоп изобретения, и стимулирование преимущественно выполняется посредством вакцины или иммуногенной или иммунологической композиции, содержащей рекомбинантный живой вирусный вектор (напр., вирус оспы, вирус герпеса, аденовирус, преимущественно рекомбинантный вирус оспы птиц или рекомбинантный вирус оспы канареек, рекомбинантный CHV, рекомбинантный собачий аденовирус), содержащий или состоящий преимущественно из молекулы(л) нуклеиновой кислоты, кодирующей и экспрессирующей in vivo, по меньшей мере, один одинаковый BTV иммуноген(ы), антиген(ы) или эпитоп(ы), как при экспрессии ДНК вакцины. В другом воплощении эти примирующие и стимулирующие вакцины или иммунологические или иммуногенные композиции могут быть усилены, например, посредством DMRIE-DOPE для примирования ДНК вакцины или иммунологической или иммуногенной композиции и посредством Carbopol® для стимулирования рекомбинантной вакцины или иммунологической или иммуногенной композиции.

Примирование может выполняться для молодого щенка, который может иметь материнские антитела против BTV (против которого направлена иммунизация или вакцинация). ДНК вакцина или иммунологическая или иммуногенная композиция может вводиться молодому щенку с момента рождения до и включая около 12-недельный возраст, как, например, от рождения до и включая около 8-недельный возраст, например, от рождения до и включая около 6-недельный возраст, напр., от рождения до и включая около 4-недельный возраст.

Для птиц примирование может осуществляться ДНК вакциной или иммуногенной или иммунологической композицией, содержащей, или состоящей преимущественно из, или экспрессирующей in vivo молекулу(ы) нуклеиновой кислоты, кодирующую BTV иммуноген, антиген или эпитоп изобретения, и стимулирование преимущественно выполняется посредством вакцины или иммуногенной или иммунологической композиции, содержащей рекомбинантный живой вирусный вектор (напр., вирус оспы, вирус герпеса, аденовирус, преимущественно рекомбинантный вирус оспы птиц или рекомбинантный вирус оспы канареек, рекомбинантный HVT, рекомбинантный MDV, рекомбинантный птичий аденовирус), содержащий или состоящий преимущественно из молекулы(л) нуклеиновой кислоты, кодирующей и экспрессирующей in vivo, по меньшей мере, один одинаковый BTV иммуноген(ы), антиген(ы) или эпитоп(ы), как при экспрессии ДНК вакцины. В другом воплощении эти примирующие и стимулирующие вакцины или иммунологические или иммуногенные композиции могут быть усилены, например, посредством DMRIE-DOPE для примирования ДНК вакцины или иммунологической или иммуногенной композиции и посредством Carbopol® для стимулирования рекомбинантной вакцины или иммунологической или иммуногенной композиции.

В воплощении примирующая ДНК вакцина или иммунологическая или иммуногенная композиция содержит или состоит преимущественно из плазмид, кодирующих и экспрессирующих VP2, VP5 или VP2 и VP5 полипептиды, таких как плазмида pLH2078.15 (фиг.10), с которой объединен убиквитарный эукариотический промотор, т.е. промотор предраннего гена цитомегаловируса человека (CMV-IE), для получения эффективной экспрессии протеинов VP2 и VP5, и стимулирующая рекомбинантная вакцина или иммунологическая или иммуногенная композиция содержит или состоит преимущественно из вируса оспы, такого как вирус оспы канареек, например, рекомбинантный вирус оспы канареек vCP2289 (Пример 9). В другом воплощении эти примирующие и стимулирующие вакцины или иммунологические или иммуногенные композиции могут быть усилены: ДНК вакцина или иммунологическая или иммуногенная композиция, содержащая плазмиду pLH2078.15 (фиг.10), содержащая, но не ограничиваясь, CMV-IE промотор, может быть усилена DMRIE-DOPE, как, например, описано в патентной заявке США №20050255127; и рекомбинантная вакцина или иммунологическая или иммуногенная композиция, содержащая vCP2289, может быть усилена посредством Carbopol®, как, например, описывается в патентной заявке США №20050255127.

Изобретение также относится к наборам для осуществления способов двукратной иммунизации, содержащим или состоящим преимущественно из примирующей вакцины или иммунологической или иммуногенной композиции и стимулирующей вакцины или иммунологической или иммуногенной композиции в раздельных контейнерах, необязательно с инструкциями для смешивания и/или введения.

Количества (дозы), вводимые при примировании и стимулировании, и способы введения для примирования и стимулирования могут соответствовать здесь описанному, так что из данного описания и сведений из уровня техники режим двукратной иммунизации может практиковаться без проведения дополнительного эксперимента. Кроме того, из данного описания и сведений из уровня техники, квалифицированный специалист может практиковать указанные здесь способы, наборы и др. относительно любых упомянутых здесь мишеневых видов.

Эти способы могут содержать, состоять преимущественно из или включать введение эффективного количества иммуногенной композиции или вакцины по изобретению. Это введение может осуществляться парентеральным путем, напр. подкожное, внутрикожное или внутримышечное введение, и/или оральным и/или назальным путями. Преимущественно такое введение представляет внутримышечное или подкожное. Могут применяться одно или более введений, как, например, два введения.

Вакцины или иммуногенные композиции могут инъецироваться посредством безыгольного инъектора, струйного инъектора или распылительного инъектора. Для плазмид также возможным является применение золотых частиц, покрытых плазмидой и инъецируемых таким образом, что они проникают в клетки кожи иммунизируемого субъекта (Tang, DeVit et al. 1992). Другие документы, цитируемые и объединенные здесь, могут являться консультативными относительно способов и устройств введения вакцин или иммуногенных композиций изобретения. Безыгольный инъектор может также быть, например, Biojector 2000 (Bioject Inc., Portland OR, USA).

Преимущественно иммуногенные композиции и вакцины изобретения содержат или состоят преимущественно из или включают эффективное количество для вызывания иммунологической реакции, такой как, но не ограничиваясь, реакция на нейтрализующие антитела и/или защитная иммунологическая реакция одного или более экспрессирующих векторов и/или полипептидов, как здесь указано; и эффективное количество может определяться из сведений, приведенных в данном описании, включая документы, включенные здесь, и уровень техники, без проведения дополнительных экспериментов. Преимущественно иммуногенные композиции и вакцины изобретения содержат, состоят преимущественно из или включают эффективное количество одного или более экспрессирующих векторов и/или полипептидов, как здесь указано, защитная реакция, такая как, но не ограничиваясь, уменьшение или исчезновение клинических симптомов, таких как, но не ограничиваясь, гипертермия, лейкопения, лимфопения, тромбоцитопения и/или уменьшение или исчезновение виремии.

В случае иммуногенных композиций или вакцин, основанных на плазмидном векторе, доза может содержать, состоять преимущественно или включать, в общих чертах, от около 10 мкг до около 2000 мкг, преимущественно от около 50 мкг до около 1000 мкг. Дозовые объемы могут составлять от около 0,1 до около 2 мл, предпочтительно между около 0,2 и около 1 мл.

Эти доза и дозовые объемы пригодны для вакцинации лошадей и других мишеневых видов, которые являются млекопитающими, таких как овцы, быки, собаки, кошки.

Для вакцинации или иммунизации птиц доза составляет преимущественно между около 10 мкг и около 500 мкг и предпочтительно между около 50 мкг и около 200 мкг. Дозовые объемы могут составлять между около 0,1 и около 1 мл, предпочтительно между около 0,2 и около 0,5 мл.

Специалист в данной области может определить эффективную дозу плазмиды для использования для каждого вида и протокола иммунизации или вакцинации из сведений, представленных в данном описании и уровне техники.

Для иммуногенных композиций или вакцин, основанных на вирусе оспы, доза может составлять между около 102 БОЕ и около 109 БОЕ.

Для овец, быков, лошадей и других мишеневых видов, которые являются млекопитающими, такими как кошки и собаки, если вектором является вакцинный вирус, доза составляет более преимущественно между около 104 БОЕ и около 109 БОЕ, предпочтительно между около 106 БОЕ и около 108 БОЕ и, если вектором является вирус оспы канареек, доза составляет более преимущественно между около 105 БОЕ и около 109 БОЕ и предпочтительно между около 105,5 БОЕ или около 106 БОЕ и около 108 БОЕ.

Для птиц, если вектором является вирус оспы, такой как вирус оспы канареек, доза составляет более преимущественно между около 103 БОЕ и около 107 БОЕ, предпочтительно между около 104 БОЕ и около 106 БОЕ; и, если вектором является вирус оспы, такой как вирус оспы птиц, доза более преимущественно составляет между около 102 БОЕ и около 105 БОЕ, предпочтительно между около 103 БОЕ и около 105 БОЕ. Из данного описания и уровня техники следует, что квалифицированный специалист может определить пригодную дозу, если вектором является другой птичий вирус оспы, такой как оспа голубей, оспа уток и др.

Для иммуногенных композиций или вакцин для млекопитающих мишеневых видов, основанных на вирусном векторе, отличающемся от вируса оспы, как, например, герпес вирусе или аденовирусе, доза обычно составляет между около 103 БОЕ и около 108 БОЕ; и, в случае таких иммуногенных композиций для птиц или птичьих вакцин, основанных на вирусном векторе, который не является вирусом оспы, доза главным образом выбирается между около 103 БОЕ и около 106 БОЕ. Для таких иммуногенных композиций или вакцин для более крупных мишеневых видов млекопитающих, которые основаны на вирусном векторе, не являющемся вирусом оспы, напр., для более крупных кошек (напр., содержащихся в зоопарке) или лошадей, напр., в случае лошадиных иммуногенных композиций или вакцин, доза преимущественно составляет между около 106 БОЕ и около 108 БОЕ.

Дозовый объем иммуногенных или вакцинных композиций для мишеневых видов, которые являются млекопитающими, напр., дозовый объем лошадиных иммуногенных или вакцинных композиций, основанных на вирусных векторах, напр., иммуногенные или вакцинные композиции, основанные на вирусном векторе, не являющемся вирусом оспы, составляет в целом между около 0,5 и около 2,5 мл, такой как между около 0,5 и около 2,0 мл, предпочтительно между около 1,0 и около 2,0 мл, предпочтительно около 1,0 мл. Дозовый объем иммуногенных или вакцинных композиций для птиц, основанных на вирусных векторах, напр., дозовый объем птичьих иммуногенных или вакцинных композиций, основанных на вирусном векторе, не являющемся вирусом оспы, составляет обычно между около 0,1 и около 1,0 мл, предпочтительно между около 0,1 и около 0,5 мл и более преимущественно между около 0,2 и около 0,3 мл. Также по отношению к такой вакцинной или иммуногенной композиции из приведенного описания и уровня техники квалифицированный специалист может определить количество введений, путь введения и дозы, которые необходимо использовать для каждого протокола иммунизации или вакцинации, без проведения какого-либо дополнительного эксперимента. Например, могут осуществляться два введения овце, корове или лошади, напр., в интервалах из 35 дней.

В случае субъединичных иммуногенных композиций или субъединичных вакцин относительно количества активного ингредиента, напр., субъединицы (антиген, иммуноген, эпитоп), доза содержит, или состоит преимущественно из, или включает, в общих чертах, от около 10 мкг до около 2000 мкг, преимущественно от около 50 мкг до приблизительно 1000 мкг. Дозовый объем таких иммуногенных или вакцинных композиций для мишеневых видов, которые представляют собой млекопитающих, напр., для лошадей, соответствует в целом между около 1,0 и около 2,0 мл, предпочтительно между около 0,5 и около 2,0 мл и более преимущественно около 1,0 мл. Дозовые объемы таких иммуногенных или вакцинных композиций для птиц находятся, в общем, между около 0,1 и около 1,0 мл, предпочтительно между около 0,1 и около 0,5 мл и более преимущественно между 0,2 и 0,3 мл. Также для такой вакцинной или иммуногенной композиции квалифицированный специалист из данного описания и уровня техники может без проведения какого-либо дополнительного эксперимента определить количество введений, путь введения и дозы, которые необходимо использовать для каждого протокола иммунизации или вакцинации.

Изобретение также относится к применению in vivo экспрессирующего вектора или приготовлению векторов и/или полипептидов изобретения для составления иммуногенной композиции или вакцины, предназначенной для защиты мишеневых видов, или вызова в мишеневых видах иммунологического ответа, против BTV, и в некоторых воплощениях против, по меньшей мере, одного другого патогенного агента.

Вакцина, основанная на плазмиде, или вирусная вакцина, экспрессирующая один или более протеинов BTV, или BTV субъединичная вакцина настоящего изобретения не будет вызывать образования в иммунизированном или вакцинированном животном антител против других протеинов вируса, которые не представлены в или посредством иммуногенной композиции или вакцины (напр., не присутствуют в иммуногенной композиции или вакцине и/или не экспрессируются посредством иммуногенной композиции или вакцины). Кроме этого признака, рассматриваемое изобретение обеспечивает дифференциальные способы диагностики. Настоящее изобретение обеспечивает возможность проводить различия между животными, инфицированными патогенными штаммами BTV, и животными, вакцинированными или иммунизированными вакцинами или композициями изобретения. В прошлом, протеины и/или антитела, направленные против них, присутствуют и могут определяться посредством реакции антиген-антитело. У последних (животных, вакцинированных или иммунизированных согласно изобретению) дело обстоит не так, и такие животные остаются негативными в такой реакции антиген-антитело, так как протеины не присутствуют в или посредством иммуногенной или вакцинной композиции или их антител. Для обуславливания такого различия в способе диагностики применяется протеин, который не представлен в или посредством вакцинной или иммуногенной композиции (не присутствует и/или не экспрессируется), напр., протеин VP7, NS1, NS2 или NS3, когда он не представлен в вакцинной или иммуногенной композиции.

Таким образом, рассматриваемое изобретение охватывает диагностические анализы или наборы, в которых используется протеин или его антитело, который не представлен в или посредством вакцинной или иммуногенной композиции изобретения; и наборы, которые содержат такой диагностический анализ или набор и такую вакцинную или иммуногенную композицию, при этом пользователь может инокулировать и/или вакцинировать животных и в дальнейшем протестировать животных с определением тех животных, которые подвержены действию BTV в отличие от тех животных, которые были только иммунизированы и/или вакцинированы против BTV.

Таким образом, настоящее изобретение относится к применению векторов, препаратам и полипептидам изобретения для приготовления иммуногенных композиций и вакцин, создавая возможность определять различия между вакцинированными или иммунизированными животными и инфицированными животными.

Рассматриваемое изобретение также относится к способу иммунизации и вакцинации, связанному со способом диагностики, обеспечивая такие различия.

Протеин, выбранный для диагностики, или один из его фрагментов или эпитопов используется как антиген в диагностическом тесте и/или используется для получения поликлональных или моноклональных антител.

Специалист в данной области обладает достаточными практическими знаниями для получения антител и для обеспечения антигенов и/или антител в традиционных диагностических способах, напр., иммуноферментные тесты ELISA, и, тем самым, выполнения дифференциальных диагностических тестов рассматриваемого изобретения.

Изобретение будет в дальнейшем дополнительно описано и проиллюстрировано следующими неограничивающими примерами.

Сведения, подтверждающие возможность осуществления изобретения

Все конструкции выполнены с использованием стандартных молекулярно-биологических методов (клонирования, расщепления рестрикционными ферментами, синтеза комплементарной одноцепочечной ДНК, полимеразной цепной реакции, удлинения олигонуклеотида с помощью ДНК-полимеразы и др.), описанных Sambrook J. et al. (Sambrook and Russell. 2001). Все рестрикционные фрагменты, использующиеся для этих примеров настоящего изобретения, а также различные продукты полимеразной цепной реакции (PCR) изолированы и очищены с использованием наборов Qiagen для экстракции из геля или PCR очистки.

Пример 1. Культивирование вируса, вызывающего инфекционную катаральную лихорадку овец (BTV)

Везде использовался серотип 17 BTV, штамм, который первоначально был изолирован из крови овцы из Tulare County, CA (США), которая погибла от болезни синий язык. Вирус дважды перевивали серонегативным животным перед выделением из первичной культуры эндотелиальных клеток микрососудов легких крупного рогатого скота. Для амплификации, этот штамм серотипа 17 BTV (Bonneau, DeMaula et al. 2002; DeMaula, Leutenegger et al. 2002) культивировали в культуре клеток BHK-21 (клеток почки новорожденного хомячка), полученных из Американской коллекции типовых культур (АТСС) под номером CCL-10.

Клетки BHK-21 культивировали в среде Игла (ЕМЕМ), дополненной 10% фетальной бычьей сывороткой (Hyclone Laboratories), 10% триптозным фосфатным бульоном и 1% пенициллином со стрептомицином. Клетки культивировали при +37°С в атмосфере, содержащей 5% CO2.

Клеточный монослой сливали в течение 3 дней. Культуральную среду затем заменяли свежей средой ЕМЕМ, дополненной 10% FBS, и добавляли BTV при уровне приблизительно 5 БОЕ/клетку. Когда цитопатогенетическое действие заканчивалось (СРВ) (в общем, через 48-72 часа от начала культивирования), вирусные суспензии собирали и затем очищали путем центрифугирования и замораживали при -70°С. Один или два успешных пассажа требовались для получения вирусной серии, которая замораживалась при -70°С.

Пример 2. Синтез оптимизированных BTV VP2 и VP5

Предпочтение по кодону среди разных типов может резко различаться. Для повышения уровня экспрессии чужеродного протеина, т.е. BTV VP2 и VP5, с использованием экспрессирующей системы на основе вируса Canarypox (ALVAC) в овечьих/бычьих/лошадиных клетках млекопитающих, очень важным является уточнение частоты встречаемости кодонов чужеродного протеина по сравнению с таковой экспрессирующей системой хозяина (Kim, Oh et al. 1997). Для кодонной оптимизации специалисты по биоинформатике приняли во внимание множество других факторов, напр., вторичную структуру, содержание GC, повторяющиеся кодоны, участки расщепления рестрикционной эндонуклеазой и др., и разработали собственные алгоритмы. Geneart GmbH (Regensburg, Germany) разработали собственное программное обеспечение GeneOptimizer™ (патентная заявка находится на стадии рассмотрения), которое осуществляет оптимизацию множества параметров при одной простой операции. Учитывая наиболее важные параметры одновременно, программное обеспечение производит в целом до 500000 оптимизированных вариантов в развиваемом способе и выбирает один, который является наиболее подходящим. Отмечалось, что такие оптимизированные гены обладают до 100-кратного повышения выхода продуктов экспрессии по сравнению с первоначальной генной последовательностью (Bradel-Tretheway, Zhen et al. 2003; Disbrow, Sunitha et al. 2003).

Сведения о последовательностях нуклеиновых кислот для BTV-17 VP2 (SEQ ID NO:3) (de Mattos, de Mattos et al. 1994) и для BTV-17 VP5 (SEQ ID NO:4) были представлены Geneart для применения как "нативные" BTV-17 последовательности. Эта информация о последовательностях была применена к программному обеспечению GeneOptimizer™ посредством Geneart, и были получены оптимизированные синтетические последовательности для VP2 и VP5.

Фиг.1 обеспечивает сравнение/выравнивание нуклеотидных последовательностей между нативной VP2 (SEQ ID NO:3) и оптимизированной (посредством Geneart) синтетической VP2 (SEQ ID NO:1). Фиг.2 обеспечивает сравнение/выравнивание нуклеотидных последовательностей между нативной VP5 (SEQ ID NO:4) и оптимизированной синтетической VP5 (SEQ ID NO:2). Оптимизированная последовательность для VP2 и VP5 была использована Geneart как основа для химического синтеза набора высокоточных олигонуклеотидов, которые вместе охватывают полную синтетическую кодирующую последовательность для каждого из генов. Олигонуклеотиды для каждого гена затем объединяются с использованием PCR (полимеразной цепной реакции) на основании принципа сбора полной синтетической кодирующей последовательности VP2 и VP5.

Пример 3. Клонирование с помощью pPCR-Script оптимизированных синтетической VP2 и синтетической VP5 BTV-17

Синтетическая VP2, Клонирующий вектор pPCR-Script® Amp SK(+), доступный от Stratagene (San Diego, CA, USA), был линеаризирован по его Множественному Сайту Клонирования (MCS) путем расщепления Рестрикционными Эндонуклеазами (RE) Sac I и Kpn I. 2913 нуклеотидную линейную полностью объединенную синтетическую кодирующую последовательность VP2, содержащую 3'конец промотора Н6, непосредственно вверху инициирующего кодона ATG, затем лидировали в плазмидный вектор с Т4 ДНК-лигазой. Лигированная ДНК использовалась для трансформации компетентных клеток Е.coli. Положительные трансформанты, которые проявляли резистентность к Ампициллину (несущие плазмидный вектор) и которые содержали синтетическую генную последовательность VP2 при посредстве их 'белого' фенотипа на индикаторных планшетах XGal (ген β-галактозидазы, разрушенный путем вставки VP2 в MCS из pPCR-Script®), выбирались для дополнительного исследования. Один клон, 043004 pPCR-Script (5779 пн), изолировали и определяли правильность посредством анализа ДНК последовательности. Фиг.3 иллюстрирует предыдущую стратегию клонирования. Клон 043004 использовался для последующих клонирований.

Синтетическая VP5, Клонирующий вектор pPCR-Script® Amp SK(+), доступный от Stratagene (San Diego, CA, USA), был линеаризирован в его область MCS путем расщепления с помощью RE Sac I и Kpn I. 1638 нуклеотидную линейную полностью объединенную синтетическую кодирующую последовательность VP5 затем лидировали в плазмидный вектор с помощью Т4ДНК-лигазы. Лигированная ДНК использовалась для трансформации ультракомпетентных клеток ДНК Е.coli. Положительные трансформанты, которые проявляли резистентность к Ампициллину (несущие плазмидный вектор) и которые содержали синтетическую генную последовательность VP5 при посредстве их 'белого' фенотипа на индикаторных планшетах XGal (ген β-галактозидазы, разрушенный путем вставки VP2 в MCS из pPCR-Script®), выбирались для дополнительного исследования. Один клон, 043005 pPCR-Script (4492 пн), изолировали и определяли правильность посредством анализа ДНК последовательности. Фиг.8 иллюстрирует предыдущую стратегию клонирования. Этот клон использовался в последующих клоновых стратегиях.

Пример 4. Донорная плазмида pNVQH6C5LSP-18 ALVAC. Описывается конструкция донорной плазмиды pNVQH6C5LSP-18 ALVAC (патентная заявка США №20050255127). Был идентифицирован локус ДНК canarypox, содержащий 5 т.п.н. и кодирующий ORF, обозначаемую С5, начинающийся в положении 1864 и заканчивающийся в положении 2187 вирусного генома. Последующее описывает инсерционную плазмиду С5, сконструированную путем удаления большей части ORF C5 и перемещения ее с помощью, Н6 промотор, множественного сайта клонирования (MCS) и последовательности для терминации транскрипции и трансляции во все рамки считывания. Фрагмент PCR, содержащий 1590 пн и плечо C5R в обратном направлении, амплифицировали из геномной ДНК саnаrурох с использованием праймеров С5А1 и С5В1 (SEQ ID NO:5) C5A:

- 5' GGCCGAATTCTGAATGTTAAATGTTATACTTT 3'

(SEQ ID NO:6): С5 В1:

- 5' CCCGGGATCGATGGATCCTTTTTATAGCTAATTAGTCACGTACCTTT GAGAGTACCACTTCAGCTA 3'

Амплифицированный фрагмент включает сайт EcoR I на 5'-конце, терминирующие последовательности и MCS, содержащий сайты BamH I, Cla I и Xma I на 3'-конце.

Фрагмент PCR, содержащий 458 пн и плечо C5L в прямом направлении, амплифицировали из геномной ДНК canarypox при использовании праймеров С5С1 и C5D1:

(SEQ ID NO:7) С5С1:

- 5' GGATCCATCGATCCCGGGTTTTTATGACTAGTTAATCACGGCCGCTT ATAAAGATCTAAAATGCAT 3'

(SEQ ID NO:8) C5D1

- 5' GGCTGCAGGTATTCTAAACTAGGAATAGAT 3'

Амплифицированный фрагмент включает сайты расщепления эндонуклеазами 5' BamH I, Cla I и Xma I, терминирующие последовательности и сайт Pst I на 3'-конце.

Вышеуказанные фрагменты PCR были слиты друг с другом посредством проведения повторной амплификации (реамплификации) с праймерами С5А и C5D (вышеприведенные), получив фрагмент EcoR I-Pst I, который содержит 2030 пн и который клонировали в плазмидный вектор pUC 8, образуя pUC/C5L/B Cia Xm/C5R. Следующие олигонуклеотиды использовались для введения уникальной последовательности Not I на 5'-конец плеча C5R путем вставки олигонуклеотидов в сайт EcoR I, получая pUC/Not I/C5R/MCS/C5L:

Олигонуклеотиды для введения Not I 5' AATTGCGGCCGC 3' (SEQ ID NO:18)

Промотор Н6 вируса осповакцины содержит плазмиду pBSH6-1.

Фрагмент с 176 пн (Н6 фрагмент), содержащий Н6 промотор и узнающие последовательности для множественного сайта клонирования, содержащего Asp718 I, Xho I, Xba I, Cla I и Sma I, был амплифицирован с использованием праймеров Н6А1 и Н6В1:

(SEQ ID NO:9) H6A1:

- 5' TCGTTAATTAATTAGAGCTTCTTTAT-TCTATACTTAAAAAG 3'

(SEQ ID NO:10) Н6В1:

- 5' AAAACCCGGGATCGATTCTAGACTCGAGGGTACCTACGATACAAACTTAACGGATA 3'

Фрагменты, кодирующие Н6 (вышеуказанный), были объединены и реамплифицированы при использовании и Н6В1 с получением фрагмента Н6р/MCS с 232 пн, который вставлялся в pUC/C5L/B Cla Xm/C5R между сайтами BamH I и Xma I. Фиг.4 показывает итоговую плазмиду, pNH6C5LSP-18, инсерционную плазмиду С5, содержащую промотор Н6, терминаторы транскрипции и трансляции, функциональные во всех рамках считывания, и MCS.

Пример 5. Конструкция донорной плазмиды pCXL148.2 ALVAC. Анализ нуклеотидной последовательности донорной плазмиды pNVQH6C5LSP-18 показал, что там присутствует точечная мутация в области C5R донорной плазмиды pNVQH6C5LSP-18 ALVAC (описанной в заявке США №20050255127) относительно таковой вирусного вектора ALVAC (последовательность не представлена). Следовательно, pCXL148 была разработана, как указано выше, с модифицированием последовательности донорной плазмиды для получения точного совпадения с таковой клонированного (очищенного от бляшек) ALVAC, так что любые различия последовательностей, которые могут увеличиваться в процессе получения рекомбинантно-образованной конструкции вируса синего языка овец ALVAC, минимизируются. Фиг.5 иллюстрирует стратегию получения конструкции.

Плазмида pNVQH6C5LSP-18 (Заявка США №20050255127) была расщеплена рестрикционными эндонуклеазами SnaBI+BsrGI с получением фрагмента с 3923 пн и фрагмента с 962 пн. RE гидролизаты разделяли с помощью электрофореза в агарозном геле и из геля был вырезан фрагмент, содержащий 3923 пн. Фрагмент ДНК очищали с использованием набора для выделения ДНК из геля QIAquick (Qiagen Inc., USA; Cat. #28704), как описывается производителем.

Затем геномную ДНК ALVAC использовали в качестве темплата для реакции PCR вместе с набором праймеров 7634CXL и 7521CXL (см. ниже) с получением фрагмента PCR, содержащего 1,89 т.п.н., который перекрывает область C5R вируса. (SEQ ID NO:11) 7521CXL (прямой):

- 5' TTATTTAGAAATTATGCATTTTAGA

(SEQ ID NO:12) 7634CXL (обратный):

- 5' GTTCTCGTAGGAGAGAACTATTGAC

1,89 т.п.н. PCR амплифицированный фрагмент расщеплялся с SnaQI+BsrGI с получением трех фрагментов: 361 пн, 569 пн и 962 пн. Этот RE гидролизат проявлялся с помощью электрофореза в агарозном геле, и из геля вырезали фрагмент с 962 пн и ДНК очищали с использованием набора для выделения ДНК из геля QIAquick (Qiagen Inc., USA; Cat. #28704), в соответствии с инструкцией производителя.

Реконструкция донорной плазмиды pNVQH6C5LSP-18 ALVAC, в которой мутированный "Т" нуклеотид в кодирующей области C5R донорной плазмиды заменен на соответствующий нуклеотид "С" дикого типа ALVAC, осуществляется путем объединения RE фрагментов с созданием pCXL148.2, как указано ниже:

а. Очищенный 3923 пн фрагмент из RE (SnaBO+BsrGT) гидролизата из pNVQH6C5LSP-18 направленно лигировали вместе с Т4 ДНК-лигазой к фрагменту SnaBI+BsrGI с 962 пн, полученному из амплифицированного с помощью PCR участка C5R ALVAC.

b. Реакции лидирования использовались для трансформации компетентных клеток Е.coli и реакции трансформации осуществлялись при выборе Ампициллина.

Выбирали трансформантов, и их плазмидные ДНК характеризовались RE гидролизатами. Было обнаружено, что нуклеотидная последовательность одного клона-кандидата pCXL148.2 содержит правильный "С" нуклеотид в области C5R. Новая С5 донорная плазмида pCXL148.2 имеет точную гомологию с соответствующей последовательностью в вирусном векторе ALVAC. Последовательность нуклеиновых кислот донорной плазмиды pCXL148.2 представлена на фиг.6 (SEQ ID NO:13).

Пример 6. Конструкция рС5 H6pVP2

Плазмида VP2 BTV 17 (043004, фиг.3) являлась RE расщепленной с EcoR V+Xho I с получением уникального фрагмента, состоящего из 2913 пн и содержащего: сайт 5' EcoR V, с последующим полноразмерным синтетическим кодоном, оптимизированным BTV-VP2, с последующим сайтом 3' Xho I. Этот RE гидролизат проявляли с помощью электрофореза в агарозном геле и фрагмент из 2913 пн вырезали из геля и ДНК очищали с использованием набора для выделения ДНК из геля QIAquick (Qiagen Inc., USA; Cat. #28704), как описано производителем.

pCXL148.2 (донорная плазмида рС5, см. фиг.5) расщеплялась вместе с EcoR V и Xho I с образованием линеаризированного гомологичного вектора из 4879 пн, содержащего правое плечо С5, Н6 промотор и левое плечо С5.

Очищенный фрагмент из 2913 пн от RE (Eco RV+Xho I) гидролизата из 043004pVP2 BTV 17 непосредственно лигировали с Т4 ДНК лигазой к 4879 пн Есо RV+Xho I, расщепленному и линеаризированному донорской плазмидой pCXL-148.2 ALVAC. Реакции дотирования использовались для трансформации компетентных клеток Е.coli, и реакции трансформации выполнялись при отборе Ампициллина. Трансформанты выбирались, выращивались и их плазмидная ДНК характеризовалась посредством RE гидролизатов. Клоны с правильными RE картами были апробированы методом Саузерн-блоттинг вместе с VP2-специфичными нуклеиновыми кислотами и олигонуклеотидами. Один положительный клон, pALVAC С5Н6р-синтетический BTV VP2, выбирался для последующего клонирования. Указанная стратегия представлена на фиг.7.

Пример 7. PCR амплификация VP5, содержащего промотор 42K.

Промотор Entomopoxvirus Amsacta moorei 42K (Barcena, Lorenzo et al. 2000) выбирали для регулирования экспрессии оптимизированного синтетического гена VP5. Последовательность нуклеиновых кислот промотора 42К (см. ниже: промоторная последовательность выделена курсивом и подчеркнута) помещалась, примыкая к 5' ATG инициирующему кодону синтетического гена VP5, с использованием стратегии на основе метода PCR, где промотор 42K прикреплялся к 5' концу прямого синтетического праймера. С использованием этого праймера в сочетании с обратным праймером, запускалась амплификация непосредственно от плазмиды VP5 BTV 17 (043005), которая служит в качестве темплата (см. фиг.8). Пара праймеров 13247.JY / 13248.JY (ниже и фиг.21) использовались в реакции PCR для амплификации фрагмента ДНК, содержащего экспрессионную кассету 42Kp-VP5, фланкированную сайтами Xho I.

Праймеры для амплификации экспрессионной кассеты 42Kp-BTV VP5:

(SEQ ID NO:14) 13247.JY прямой:

- 5' GCGCTCGAGTTTTTATTCAAAATTGAAAATATATAATTACAATATAAAATGGGCAAGATCATCAAGAGCCTG

(SEQ ID NO:15) 13247.JY обратный:

- 5' ATCTCGAGATAAAAATCATCAGGCGTTCCTCAGGAACAGGGGCACGTC

Полимеразная цепная реакция с использованием обратной транскриптазы (реакция PCR) осуществлялась с применением вышеуказанных праймеров, и итоговый PCR продукт клонировали в участок XhoI клонирующего вектора PCR®2.1-TOPO согласно рекомендациям производителя (Invitrogen Corp., Carlsbad, CA, USA) с получением pLH2033.1 (PCR 2.1 42Kp синтетический BTV-VP5). Подтверждали, что эта конструкция содержит правильную последовательность. Такая стратегия клонирования проиллюстрирована на фиг.9. Клон pLH2033.1 был расширен для продуктов амплификации плазмиды при необходимости в последующих действиях по клонированию.

Пример 8. Конструкция донорского гомологичного вектора pLH2078.15 (pC5H6VP242KpVP5)

pLH2033.1 скрытая 42Kp-синтетическая BTV VP5 последовательность была расщеплена с помощью Xho I, который вырабатывает 1,647 пн фрагмент, который кодирует BTV VP5. Этот Xho I гидролизат отображали с помощью электрофореза в агарозном геле, и 1,647 пн VP2 фрагмент был вырезан из геля, и ДНК очищали с использованием QIAquick набора для выделения ДНК из геля (Qiagen Inc., USA; Cat. #28704), как описывается производителем.

pLH2030.2 (pALVAC С5Н6р-синтетические BTV VP2 рС5 донорные плазмиды, см. фиг.7) были расщеплены с помощью Xho I с образованием линеаризированного 7,744 пн гомологичного вектора, содержащего С5 правое плечо, Н6 промотор, синтетический BTV VP2 и С5 левое плечо.

Очищенный 1,647 пн фрагмент из Xho I расщепления pLH2033.1 дотировали с Т4 ДНК лигазой с 7,744 пн Xho I линеаризованной pLH2030.2 донорной ALVAC плазмидой. Реакции лигирования применялись для трансформации компетентных клеток Е.coli, и реакции трансформации выполнялись при отборе Ампициллина. Трансформанты выбирались, выращивались и их плазмидная ДНК характеризовалась посредством RE гидролизатов. Поскольку описываемое дотирование не является направленным, элементный компонент клонового отбора вызывает правильное положение 42Kp-синтетической VP5 вставки относительно H6pVP2 в донорной плазмиде, в этом воплощении предпочтительным направлением является голова-к-хвосту, напр., VP2 и VP5 транскрибируются и транслируются в одинаковом 5'-3' направлении в плазмиде. Клоны с корректным паттерном RE выбираются для дальнейшей характеристики. Один положительный клон, pLH2978.15 был выбран и секвенирован. Описываемая стратегия клонирования конструкции итоговой ALVAC-BTV донорной плазмиды представлена на фиг.10. Указанная нуклеотидная последовательность pLH2978.15 представлена на фиг.11.

Пример 9. Образование и характеристика ALVAC BTV (vCP2289).

Для образования ALVAC-основанных BTV рекомбинантов первичные фибробласты зародыша цыпленка (CEFs) трансфицировали с помощью 15 мкг Not I-линеаризированной pLH2078.15 донорской плазмиды DNA (рС5 Н6р-BTV VP2-42Kp-BTV VP5), смешанной с FuGENE-6 трансфекционным реагентом (Roche). Трансфицированные клетки последовательно инфицировали ALVAC (6,3×109 БОЕ/мл НМ1372) как спасательный вирус при MOI=10. Через 24 часа трансфицированные-инфицированные клетки собирали, обрабатывали ультразвуком и использовали для очистки бляшек и проводили скрининг рекомбинантного вируса. Через 24-48 часов содержания в свежем СЕР рекомбинантные бляшки переносили на нейлоновую мембрану и гибридизировали с BTV-специфичным ДНК зондом, который был помечен пероксидазой хрена в соответствии с протоколом производителя (Amersham Cat# RPM3001). Вслед за 4 последовательными раундами очистки бляшек отдельные бляшки амплифицировали с получением групп, разрабатываемых как vCP2289.1.2.1.1 и vCP2289. I.I.I. Рекомбинантные вирусы подтверждали посредством гибридизации как 100% позитивные для вставки BTV и 100% негативные для пустого С5 участка.

Отдельные бляшки выбирали из итогового круга очистки бляшек и повышали с получением Р1 (Т-25 флакон), Р2 (Т-75 флакон) и Р3 (роллерный флакон) групп для амплификации vCP2289.1.2.1.1 и vCP2289.2. I.I.I. Рекомбинанты повторно подтверждали на уровне Р2 путем гибридизации и нашли, что они были 100% позитивными для вставки BTV и 100% негативными для пустого С5 участка. Инфицированную клеточную культуральную жидкость из роллерных флаконов собирали и концентрировали с получением вирусных групп (1,8 мл vCP2289.1.2.1.1 при 1,25×1010 БОЕ/мл и 1,9 мл и vСР2289.2.1.1.1 при 1,0×1010 БОЕ/мл). Фиг.12 представляет диаграмму конструкции рекомбинантных ALVAC+BTV VP2 и VP5 (vCP2289).

Пример 10. Характеристика ALVAC BTV (vCP2289).

1. Подтверждение генетической чистоты. Р3 группы повторно подтверждали путем гибридизации, как 100% позитивные для BTV вставки и 100% негативные для пустого участка С5.

2. Геномный анализ.

а. Карта рестрикции:

i. Теоретический фрагментарный анализ рестрикционных эндонуклеаз (RE) и гель-электрофореза для геномной ДНК был разработан в Vector NTI (Invitrogen, США) и показан на фиг.13.

ii. Геномную ДНК экстрагировали из vCP2289.1.2.1.1 и vCP2289.2.1.1.1, расщепленные BamH I, Hind III или Pst I, и разделяли посредством 0,8% электрофореза в агарозном геле. Эти результаты показывают корректную вставку чужеродной генной последовательности (см. фиг.14).

b. Саузерн-блот: Геномную ДНК, расщепленную BamH I, Hind III или Pst I, переносили на нейлоновую мембрану и выполняли анализ Саузерн-блота путем исследования BTV проб. BTV-специфичные 9508 пн BamH 1, 14974 пн Hind III и 2901 пн Pst I полосы наблюдали при ожидаемых размерах. Результаты показывают корректное внесение BTV вставки в С5 локус. Фиг.15 обеспечивает результаты Саузерн-блота.

3. Анализ экспрессии:

а. Вестерн блот. 1°CEF клетки инфицировали Р3 группой из vCP2289.1.2.1.1 и vCP2289.2. I.I.I при MOI 10 и инкубировали при 37°С в течение 24 часов. Клетки и культуральный супернатант затем собирали. Образец протеинов разделяли на 10% SDS-PAGE геле, электроблот переносили на нейлоновую мембрану Immobilon и зондировали кроличьим анти-ВТУ17 VP5, аффинно очищенным IgG (University of California, Davis, USA) в разведении 1:2000. Использовали пероксидазу, конъюгированную с козлиной анти-кроличьей антисывороткой в качестве вторичного антитела, и полосы рассматривали с использованием реагентов для определения Amersham. Две протеиновые полосы между 47 кДа и 60 кДа были обнаружены в клеточных пеллетах из vCP2289.1.2.1.1 и vCP2289.2.1.1.1, показывая экспрессию BTV-17 VP5 протеина (см. фиг.16). Экспрессированный BTV-17 VP5 протеин секретировался в клеточной культуральной среде.

b. Иммунофлуоресценция. С использованием смеси из четырех мышиных анти-ВТУ-17 VP2 антител (АВХ IgG 17.81 α-BTV 17; PA IgG17.815 α-BTV 17; PA IgG 17.85 α-BTV 17; PA IgG 17.813 α-BTV-17, из Калифорнийского Университета, Davis, США), вестерн блоты и анализы иммунофлуоресценции для VP2 экспрессии были негативными, возможно из-за конформационных чувствительностей реагентов и 'денатурирующе-подобной' среды, налагаемой за счет переноса и гибридизации. В результате, 1°CEF клетки были инфицированы Р3 группами из vCP2289.1.2.1.1 и vCP2289.2.1.1.1 при MOI 0,1 и инкубированы при 37°С в течение 24 часов. Клетки затем фиксировали с помощью 3% параформальдегида и осуществляли нарушение проницаемости мембраны с помощью 0,5% Triton X-100. Смесь из четырех мышиных анти-ВТУ17 VP2 антител (АВХ IgG 17.81 анти-BTV 17, PA IgG17.815 анти-BTV 17, PA IgG 17.85 анти-BTV 17, PA IgG 17.813 анти-BTV-17, из University of California, США) использовали в качестве первичного антитела при разведении 1:100 и FITC конъюгированное козлиное анти-мышиное антитело использовали в качестве вторичного антитела. Стойкие зеленые флуоресцентные клетки визуализировали под флуоресцентным микроскопом Nikon Eclipse ТЕ300, показывающим экспрессию BTV VP2 протеина (данные не показаны).

4. Анализ последовательностей: Более подробный анализ Р3 основной геномной ДНК осуществляли путем PCR амплификации и анализ последовательностей фланкированных плеч из С5 локуса и вставки BTV. Праймеры 793 I.DC и 7932.DC, расположенные за плечами С5 локуса, использовались для амплификации полного фрагмента, состоящего из C5R и BTV вставки и C5L.

Праймеры для PCR амплификации vCP2289 C5 плечей плюс вставка:

(SEQ ID NO:16) 7931.DC:

- 5 GAATCTGTTAGTTAGTTACTTGGAT

(SEQ ID NO:17) 7932.DC:

- 5 TGATTATAGCTATTATCACAGACTC

Эти результаты показывают, что последовательности BTV вставки и С5 левого и правого плечей вокруг BTV вставки в vCP2289.1.2.1.1 и vCP2289.2.1.1.1 были правильными.

Пример 11. Получение рекомбинантных вакцин

Для приготовления овечьих, бычьих или лошадиных вакцин рекомбинантный вирус оспы канареек vCP2289 (Пример 9) усиливался карбомерными растворами под названием Carbopol™974P, произведенными BF Goodrich, Ohio, США (молекулярная масса около 3,000,000).

1,5% Carbopol™974P основной раствор был изначально приготовлен в дистиллированной воде, содержащей 1 г/л хлорида натрия. Этот основной раствор затем использовался для приготовления 4 мг/мл раствора Carbopol™974P в физиологическом растворе. Основной раствор смешивали с достаточным объемом физиологического раствора, либо в одну стадию, либо несколькими последовательными стадиями, значение рН доводили в каждой стадии с помощью IN раствора гидроксида натрия (или даже более концентрированным) для получения итогового значения рН от 7,3 до 7,4.

Готовый к использованию раствор Carbopol™974P, полученный таким способом, использовался для поглощения рекомбинантных лиофилизированных вирусов или для разбавления концентрированных рекомбинантных вирусных основных растворов. Например, для получения вирусной суспензии, содержащей 108 БОЕ/1 мл, вирусный основной раствор разбавляли с получением титра 108,3 БОЕ/мл, с последующим разбавлением в равных частях указанным готовым к использованию 4 мг/мл Carbopol™974P раствором.

Пример 12. Продукция ДНК вакцин для овец, быков или лошадей

Для ДНК иммунизации будут сконструированы плазмиды, в которых кодон, оптимизированный BTV VP2 нуклеотидной последовательностью (Чертеж 1, SEQ ID: 1), располагается на одной плазмиде, и BTV VP5 (SEQ ID: 2) нуклеотидные последовательности располагаются на другой плазмиде. Экспрессия BTV последовательности каждой плазмиды может запускаться, но не ограничиваясь, CMV-IE промотором (человеческий CMV или мышиный CMV). Poly Adenine (polyA) сигнальные последовательности (либо от гена бычьего гормона роста либо от кроличьего гена бета глобина, но не ограничиваясь) будет включены на 3' конце BTV кодирующей последовательности в каждой плазмиде.

Может быть желаемой экспрессия BTV VP2 и VP5 из той же плазмиды с обеспечением ко-экспрессии BTV протеинов в этой же клетке. В данном случае, плазмида, схожая с pLH2078.15 (Пример 8, Чертеж 10), будет сконструирована, в которой промоторы вируса оспы замещаются, но не ограничиваясь, убиквитарными эукариотическими промоторами, такими как промотор CMV-IE человека. Экспрессия BTV VP2 и VP5 будет обязательно контролироваться различными промоторами. PolyA сигнальные последовательности будут включены на 3' конце каждой BTV нуклеотидной последовательности.

ДНК раствор, содержащий плазмиду(ы), описанные выше, будет сконцентрирован преципитацией этанолом способом, описанным Sambrook et al. (1989). ДНК пеллету выбирают раствором 0,9% NaCl с получением концентрации 1 мг/мл. 0,75 мМ DMRIE-DOPE раствор будет приготовлен путем взятия DMRIE-DOPE лиофилизата посредством пригодного объема стерильной H2O.

Образование ДНК комплексов плазмида-липид будет достигаться путем разбавления равных частей 0,75 мМ DMRIE-DOPE раствора (1:1) 1 мг/мл ДНК раствором в 0,9% NaCl. ДНК раствор будет прогрессивно вводиться с помощью 26G извитой иглы вдоль стенки флакона, содержащего катионный липидный раствор, с тем чтобы предотвратить образование пены. Осуществляют аккуратное перемешивание, как только два раствора смешались. В итоге, получается композиция, содержащая 0,375 мМ DMRIE-DOPE и 500 мкг/мл плазмиды.

Является желаемым при проведении всех действий, которые здесь описываются, использовать все растворы при комнатной температуре. DNA/DMRIE-DOPE комплексообразование происходит при комнатной температуре в течение 30 минут перед иммунизацией животных.

Пример 13. Вакцинация овец рекомбинантными вирусами оспы канареек

Одиннадцать безрогих овечек Dorset (9 самцов, 2 самок) были представлены от поставщика с северо-запада СА, области, свободной от инфекции BTV. Животных разместили в изолирующие устройства, защищенные от насекомых, на время всего описываемого эксперимента, и перед вакцинацией им проводили конкурентный анализ ELISA для подтверждения отсутствия у них антител к BTV. Приблизительно в 13-месячном возрасте (11/22/05), 6 овечек каждую инокулировали SQ/IM приблизительно 1 мл BTV-CP, разведенного в PBS (0,2 мл неразведенного [109.5TCID50/мл] vCP2289/овцу=~6.3×108 вирусных частиц), и 5 вакцинировали рекомбинантным вирусом оспы канареек (экспрессирующего preM и Е протеины вируса Западного Нила vCP/WNV; Recombitek), который восстанавливали и вводили в соответствии с инструкциями производителя. Все овцы были ревакцинированы через 22 дня (12/14/05) соответствующей вакциной, вводимой в той же дозе, что и при первичной иммунизации. Животные были размещены независимо от типа вакцины.

Пример 14. Титрирование анти-BTV нейтрализующих антител

Серии разведений проводили для каждой сыворотки при скорости 3 в DMEM среде, к которой добавляли 10% фетальную телячью сыворотку в 96-луночные планшеты клеточно культурального типа. К 0,05 мл разведенной сыворотке добавляли 0,05 мл культуральной среды, содержащей приблизительно 100 CCIP50/мл BTV. Эта смесь инкубировалась в течение 2 часов при 37°С в печи в атмосфере, содержащей 5% CO2.

0,15 мл суспензии из BHK-21 клеток, содержащей приблизительно 100000 клеток/мл затем добавляли к каждой смеси. Цитопатическое действие (СРЕ) наблюдали с помощью фазово-контрастной микроскопии через 4-5 дней после культивирования при 37°С в атмосфере, содержащей 5% CO2. Нейтрализующие титры каждой сыворотки рассчитывали с использованием способа Karber. Титры приведены в виде наибольшего разведения, ингибирующего цитопатический эффект для 50% лунок. Титры экспрессировали в log 10 VN50. Каждая сыворотка титрировалась, по меньшей мере, дважды и предпочтительно четыре раза.

Пример 15. Инфицирование BTV овец и отбор образцов

Все 11 овечек провоцировали посредством подкожной инокуляции 105,5 TCID50 BTV-17 на 34 день после второй вакцинации. Животных осматривали ежедневно в течение 3 недель после инокуляции на предмет манифестации синего языка. Кровь для гематологии (собирали в EDTA) собирали перед инокуляцией и на 3, 6, 9, 13 и 16 дни после инокуляции (DPI) для полного анализа крови (СВС). Образцы крови (кислая цитрат-декстроза) собирали на 0, 1, 3, 5, 7, 9, 11, 14 и 21 DPI для выделения вируса. Сыворотку собирали ("Tiger Top", сепаратор сыворотки) от всех овец в недельные интервалы непосредственно перед вакцинацией. Овец гуманно подвергали эвтаназии на 25 день после вызванной вспышки BTV.

Пример 16. Выделение вируса BTV

Выделение вируса осуществлялось из цельной крови овцы, как ранее описывалось в (Bonneau, Mullens et al. 2001; Bonneau, DeMaula et al. 2002; DeMaula, Leutenegger et al. 2002). Коротко, пробирки с вакуумом центрифугировали при 2500 G в течение 10 минут при 4 градусах С. Сыворотку переливали и выбрасывали. Эритроциты/лейкоциты промывали 1х с 5 мл стерильного PBS (1х), повторно центрифугировали и клеточную пеллету ресуспендировали в равном количестве стерильной двукратно дистиллированной воды (ddH2O). Промытые/визированные клетки крови обрабатывали ультразвуком в течение 1-2 мин перед разведением (10-1 до 10-4) в ЕМЕМ и инокуляцией (0,25 мл/лунку) на конфлюэнтных BHK-21 монослоях в 24-луночных планшетах. Культуры инкубировали в течение 1 часа при 37°С, когда добавляли поддерживающую среду. Культуры изучали ежедневно в течение 10 дней и определяли вирусные титры способом Reed and Munch.

Пример 17. Иммуногенность BTV-vCP2289 рекомбинантного ALVAC у овец

Все овцы являлись серонегативными в отношении BTV по результатам обоих конкурентного иммуноферментного анализа ELISA и анализа на нейтрализацию BTV-17 перед вакцинацией (данные не показаны). Овцы, вакцинированные экспрессионным вектором vCP/BTV, вырабатывали нейтрализующие антитела к BTV-17, тогда как те, которых иммунизировали vCP/WNV, - не вырабатывали (см. таблицу 3, ниже). Все овцы оставались живыми и не проявляли побочных эффектов после вакцинации.

Таблица 3
Титры BTV 17 нейтрализующих антител
Недели после Вакцинации
-1 2 4 6
Вакцинированные:
353 <10 <10 80 40
355 <10 <10 80 40
359 <10 10 160 80
361 <10 <10 160 80
363 <10 10 80 160
364 <10 10 80 160
Контроли:
354 <10 <10 <10 <10
356 <10 <10 <10 <10
357 <10 <10 <10 <10
358 <10 <10 <10 <10
362 <10 <10 <10 <10

Пример 18. Защита овец, иммунизированных BTV-CP, после провокации

Способность vCP/BTV протективно иммунизировать овец определялась путем сравнения титров BTV-17 в крови vCP/BTV VCP2289 и vCP/WNV иммунизированных овец после провокационного воздействия на BTV-17.

Таблица 4
Титры вируса синий язык в крови овец, провоцированных вирусом, с последующей иммунизацией рекомбинантными вирусами оспы канарейки, экспрессирующих вирусные протеины как вируса синего языка (vCP/BTV), так и вируса лихорадки Западного Нила (vCP/WNV)
Обработка/ ИН Овец Вирусный Титр log10 TCID50 на мл крови (дни после инокуляции)
1 3 5 7 9 11 14 21
Вакцинированные:
353 -* - - - - - - -
355 - - - - - - - -
359 - - - - - - - -
361 - - - - - - - -
363 - - - - - - - -
364 - - - - - - - -
Контроли:
354 - 104.1 104.1 103.6 103.1 103.1 102.1 101.6
356 - 102.1 103.1 103.1 103.1 101.6 - -
357 - - 103.6 103.1 102.1 102.1 - -
358 - 102.1 102.6 103.6 103.1 101.6 - 102.1
362 - 103.6 104.1 103.1 - - - -
* показывает, что вирус не был изолирован из 50 мкл отмытых и лизированных клеток крови

Результаты (таблица 4) показывают, что контрольные овцы (WNV-CP) активно инфицировались вирусом, вызывающим BTV, на 3 день после провокации. Контроли продолжают проявлять виремию в течение всего срока из 21 дня после провокации, через который эксперимент завершался.

Овцы, которых иммунизировали вакциной BTV-CP, проявляли совершенную защиту от виремии после инфекции, вызванной экспериментальным способом, так как BTV не определялся в крови вакцинированных овец на протяжении 21 дня исследования. Все шестеро BTV-CP иммунизированные овцы были полностью резистентны к вирулентной провокации, показывая эффективность вакцины.

Пример 19. Клинические проявления у овец, инфицированных BTV

Сравнение клинического проявления у овец, вакцинированных с BTV-CP (вакцинированные) и WNV-CP (контроли) после провокации с BTV-17, представлено следующим образом:

1. Температура тела (ВТ). В течение 14 дней после провокации, температуру тела измеряли ежедневно для всех 6 ВТС-СР вакцинированных и для всех 5 контрольных (WNV-CP иммунизированных) овец. Температурные данные от вакцинированных овец показаны ниже в Таблице 5 и на Чертеже 17. Данные показывают увеличение на ~1°С средней ВТ на 3 день после провокации у контролей, при этом без изменений в средней ВТ у BTV-CP вакцинированных. На 6 день наблюдался 4°С температурный пик (105°С) у контрольных животных. Это является типичным ответом для виремичных животных, инфицированных BTV. BTV-CP иммунизированные животные проявляют нормальные температуры, что незначительно отклоняется от животных, предварительно иммунизированных. Эти результаты подтверждают эффективность вакцины (BTV-CP).

2. Количество лейкоцитов. В течение 16 дней после иммунизации измеряли количество лейкоцитов (WBC) на 0 день и приблизительно в 3-дневные интервалы в течение 16 дней для всех 6 ВТС-СР вакцинированных и для всех 5 контрольных (WNV-CP иммунизированных) овец. Данные по WBC от иммунизированных овец показаны ниже в Таблице 6 и на Чертеже 18. Данные показывают начальное слабое снижение среднего количества WBC через 8 дней после провокации с последующим повышением среднего WBC на 9-16 дни после провокации в контроле, при этом без изменения среднего значения WBC у вакцинированных BTV-CP. Замедленное повышение количества WBC после провокации представляет типичный ответ для виремического животного, инфицированного BTV. BTV-CP иммунизированные животные проявляли нормальные количества WBC, которые значительно не отклоняются от предварительно инфицированных животных. Эти результаты подтверждают эффективность вакцины (BTV-CP).

3. Количество лимфоцитов. В течение 16 дней после иммунизации измеряли количество лимфоцитов на 0 день и приблизительно в 3-дневные интервалы в течение 16 дней для всех 6 ВТС-СР вакцинированных и для всех 5 контрольных (WNV-CP иммунизированных) овец. Данные о количестве лимфоцитов от провоцированных овец показаны ниже в Таблице 7 и на Чертеже 19. Данные показывают начальное слабое уменьшение среднего значения WBC через 8 дней после провокации с непрерывным повышением среднего количества лимфоцитов на 9-16 дни после провокации в контроле, при этом без изменений среднего количества лимфоцитов у вакцинированных BTV-CP. Замедленное повышение количества лимфоцитов после провокации представляет типичный ответ для виремического животного, инфицированного BTV. BTV-CP иммунизированные животные проявляли нормальные количества WBC, которые значительно не отклоняются от предварительно инфицированных животных. Эти результаты подтверждают эффективность вакцины (BTV-CP).

4. Количество тромбоцитов. В течение 16 дней после иммунизации измеряли количество тромбоцитов на 0 день и приблизительно в 3-дневные интервалы в течение 16 дней для всех 6 ВТС-СР вакцинированных и для всех 5 контрольных (WNV-CP иммунизированных) овец. Данные о количестве тромбоцитов провоцированных овец показаны ниже в Таблице 8 и на Чертеже 20. Данные показывают начальное снижение количеств тромбоцитов через 8 дней после провокации с непрерывным повышением среднего количества тромбоцитов на 9-16 дни после провокации в контролях. У BTV-CP вакцинированных наблюдается постепенное увеличение тромбоцитов на протяжении исследования. У BTV-CP вакцинированных уровни тромбоцитов превосходили вышеуказанные контроли на протяжении исследования. Снижение количества тромбоцитов после провокации представляет типичный ответ для виремического инфицированного BTV животного. BTV-CP иммунизированные животные проявляют нормальные уровни тромбоцитов. Результаты подтверждают эффективность вакцины (BTV-CP).

Источники информации

Anderson, G. A., J. L. Stott, et al. (1985). "Subclinical and clinical bluetongue disease in cattle: clinical, pathological and pathogenic considerations." Prog Clin Biol Res 178:103-7.

Andreansky, S. S., B. He, et al. (1996). "The application of genetically engineered herpes simplex viruses to the treatment of experimental brain tumors." Proc Natl Acad Sci U S A 93(21): 11313-8.

Andrew, M., P. Whiteley, et al. (1995). "Antigen specificity of the ovine cytotoxic Т lymphocyte response to bluetongue virus." Vet Immunol Immunopathol 47(3-4): 311-22.

Antoine, G., F. Scheiflinger, et al. (1998). "The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses." Virology 244(2): 365-96.

Ballay, A., M. Levrero, et al. (1985). "In vitro and in vivo synthesis of the hepatitis В virus surface antigen and of the receptor for polymerized human serum albumin from recombinant human adenoviruses." Embo J 4(13B): 3861-5.

Barcena, J., M. M. Lorenzo, et al. (2000). "Sequence and analysis of a swinepox virus homologue of the vaccinia virus major envelope protein P37 (F13L)." J Gen Virol 81(Pt 4): 1073-85.

Bernard, K. A., B. A. Israel, et al. (1997). "Sequence and cognitive analyses of two virulence-associated markers of bluetongue virus serotype 17." Intervirology 40(4): 226-31.

Bonneau, K. R., С. D. DeMaula, et al. (2002). "Duration of viraemia infectious to Culicoides sonorensis in bluetongue virus-infected cattle and sheep." Vet Microbiol 88(2): 115-25.

Bonneau, K. R., B. A. Mullens, et al. (2001). "Occurrence of genetic drift and founder effect during quasispecies evolution of the VP2 and NS3/NS3A genes of bluetongue virus upon passage between sheep, cattle, and Culicoides sonorensis." J Virol 75(17): 8298-305.

Bonneau, K. R., N. Zhang, et al. (1999). "Sequence comparison of the L2 and S10 genes of bluetongue viruses from the United States and the People's Republic of China." Virus Res 61(2); 153-60.

Boshart, M., F. Weber, et al. (1985). "A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus." Cell 41(2): 521-30.

Bradel-Tretheway, B. G., Z. Zhen, et al. (2003). "Effects of codon-optimization on protein expression by the human herpesvirus 6 and 7 U51 open reading frame." J Virol Methods 111(2): 145-56.

Carroll, M. W., W. W. Overwijk, et al. (1997). "Highly attenuated modified vaccinia virus Ankara (MVA) as an effective recombinant vector: a murine tumor model." Vaccine 15(4): 387-94.

Cochran, M. А., С. Puckett, et al. (1985). "In vitro mutagenesis of the promoter region for a vaccinia virus gene: evidence for tandem early and late regulatory signals." J Virol 54(1): 30-7.

Cowley, J. A. and B. M. Gorman (1989). "Cross-neutralization of genetic reassortants of bluetongue virus serotypes 20 and 21." Vet Microbiol 19(1): 37-51.

De Groot, A. S. and F. G. Rothman (1999). "In silico predictions; in vivo veritas." Nat Biotechnol 17(6): 533-4.

De Mattos, C. A., C. C. de Mattos, et al. (1994). "Heterogeneity of the L2 gene of field isolates of bluetongue virus serotype 17 from the San Joaquin Valley of California." Virus Res 31(1): 67-87.

DeMaula, C. D., K. R. Bonneau, et al. (2000). "Changes in the outer capsid proteins of bluetongue virus serotype ten that abrogate neutralization by monoclonal antibodies." Virus Res 67(1): 59-66.

DeMaula, C. D., H. W. Heidner, et al. (1993). "Neutralization determinants of United States bluetongue virus serotype ten." Virology 195(1): 292-6.

DeMaula, C. D., C. M. Leutenegger, et al. (2002). "The role of endothelial cell-derived inflammatory and vasoactive mediators in the pathogenesis of bluetongue." Virology 296(2): 330-7.

Disbrow, G. L., I. Sunitha, et al. (2003). "Codon optimization of the HPV-16 E5 gene enhances protein expression." Virology 311(1): 105-14.

Felgner, J. H., R. Kumar, et al. (1994). "Enhanced gene delivery and mechanism studies with a novel series of cationic lipid formulations." J Biol Chem 269(4): 2550-61.

Frolov, I., T. A. Hoffman, et al. (1996). "Alphavirus-based expression vectors: strategies and applications." Proc Natl Acad Sci USA 93(21): 11371-7.

Funahashi, S., T. Sato, et al. (1988). "Cloning and characterization of the gene encoding the major protein of the A-type inclusion body of cowpox virus." J Gen Virol 69 (Pt 1): 35-47.

Geysen, H. M. (1990). "Molecular technology: peptide epitope mapping and the pin technology." Southeast Asian J Trop Med Public Health 21(4): 523-33.

Geysen, H. M., S. J. Barteling, et al. (1985). "Small peptides induce antibodies with a sequence and structural requirement for binding antigen comparable to antibodies raised against the native protein." Proc Natl Acad Sci USA 82(1): 178-82.

Geysen, H. M., R. H. Meloen, et al. (1984). "Use of peptide synthesis to probe viral antigens for epitopes to a resolution of a single ammo acid." Proc Natl Acad Sci USA 81(13): 3998-4002.

Ghiasi, H., A. Fukusho, et al. (1987). "Identification and characterization of conserved and variable regions in the neutralization VP2 gene of bluetongue virus." Virology 160(1): 100-9.

Graham, F. L. (1990). "Adenoviruses as expression vectors and recombinant vaccines." Trends Biotechnol 8(4): 85-7.

Guo, P. X., S. Goebel, et al. (1989). "Expression in recombinant vaccinia virus of the equine herpesvirus 1 gene encoding glycoprotein gp13 and protection of immunized animals." J Virol 63(10): 4189-98.

Hartikka, J., M. Sawdey, et al. (1996). "An improved plasmid DNA expression vector for direct injection into skeletal muscle." Hum Gene Ther 7(10): 1205-17.

Hassan, S. S. and P. Roy (1999), "Expression and functional characterization of bluetongue virus VP2 protein: role in cell entry." J Virol 73(12): 9832-42.

Heidner, H. W., P. V. Rossitto, et al. (1990). "Identification of four distinct neutralizing epitopes on bluetongue virus serotype 10 using neutralizing monoclonal antibodies and neutralization-escape variants." Virology 176(2): 658-61.

Hemmer, В., С. Pinilla, et al. (1998). "The use of soluble synthetic peptide combinatorial libraries to determine antigen recognition of Т cells." J Pept Res 52(5); 338-45.

Huang, I. J., G. Y. Hwang, et al. (1995). "Sequence analyses and antigenic epitope mapping of the putative RNA-directed RNA polymerase of five U.S. bluetongue viruses." Virology 214(1): 280-8.

Huismans, H. and B. J. Erasmus (1981). "Identification of the serotype-specific and group-specific antigens of bluetongue virus." Onderstepoort J Vet Res 48(2): 51-8.

Huismans, H., N. T. van der Walt, et al. (1987). "Isolation of a capsid protein of bluetongue virus that induces a protective immune response in sheep." Virology 157(1): 172-9.

Jewell, J. E. and J. O. Mecham (1994). "Identification of an ammo acid on VP2 that affects neutralization of bluetongue virus serotype 10." Virus Res 33(2); 139-44.

Ju, Q., D. Edelstein, et al. (1998). "Transduction of non-dividing adult human pancreatic beta cells by an integrating lentiviral vector." Diabetologia 41(6): 736-9.

Kim, С.H., Y. Oh, et al. (1997). "Codon optimization for high-level expression of human erythropoietin (EPO) in mammalian cells." Gene 199(1-2): 293-301.

Kitson, J. D., K. L. Burke, et al. (1991). "Chimeric polioviruses that include sequences derived from two independent antigenic sites of foot-and-mouth disease virus (FMDV) induce neutralizing antibodies against FMDV in guinea pigs." J Virol 65(6): 3068-75.

Klinman, D. M., A. K. Yi, et al. (1996). "CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon gamma." Proc Natl Acad Sci USA 93(7): 2879-83.

Kwissa, M., K. van Kampen, et al. (2000). "Efficient vaccination by intradermal or intramuscular inoculation of plasmid DNA expressing hepatitis В surface antigen under desmin promoter/enhancer control." Vaccine 18(22): 2337-44.

Laval, F., R. Paillot, et al. (2002). "Quantitative analysis of the antigen-specific IFNgamma+ Т cell-mediated immune response in conventional outbred pigs: kinetics and duration of the DNA-induced IFNgamma+CD8+ Т cell response." Vet Immunol Immunopathol 90(3-4): 191-201.

Lobato, Z. I., В. Е. Coupar, et al. (1997). "Antibody responses and protective immunity to recombinant vaccinia virus-expressed bluetongue virus antigens." Vet Immunol Immunopathol 59(3-4): 293-309.

Luckow, V. A. and M. D. Summers (1988). "Signals important for high-level expression of foreign genes in Autographa califomica nuclear polyhedrosis virus expression vectors." Virology 167(1): 56-71.

MacLachlan, N. J. (1994). "The pathogenesis and immunology of bluetongue virus infection of ruminants." Comp Immunol Microbiol Infect Dis 17(3-4): 197-206.

MacLachlan, N. J. and J. Е. Pearson (2004). Bluetongue: Prodeedings of the Third International Symposium. Bluetongue: Prodeedings of the Third International Symposium. N. J. MacLachlan and J. Е. Pearson, Vet Italiana. 40: 1-730.

Marshall, Е., L. B. Woolford, et al. (1997). "Continuous infusion of macrophage inflammatory protein MIP-1 alpha enhances leucocyte recovery and haemopoietic progenitor cell mobilization after cyclophosphamide." Br J Cancer 75(12): 1715-20.

Martinez-Torrecuadrada, J. L., J. P. Langeveld, et al. (1999). "Antigenic profile of African horse sickness virus serotype 4 VP5 and identification of a neutralizing epitope shared with bluetongue virus and epizootic hemorrhagic disease virus." Virology 257(2): 449-59.

McClements, W. L., M. Е. Armstrong, et al. (1996). "Immunization with DNA vaccines encoding glycoprotein D or glycoprotein B, alone or in combination, induces protective immunity in animal models of herpes simplex virus-2 disease." Proc Natl Acad Sci USA 93(21): 11414-20.

Mecham, J. O., V. С.Dean, et al. (1986). "Correlation of serotype specificity and protein structure of the five U.S. serotypes of bluetongue virus." J Gen Virol 67 (Pt 12): 2617-24.

Mecham, J. O. and D. J. Johnson (2005). "Persistence of bluetongue virus serotype 2 (BTV-2) in the southeast United States." Virus Res 113(2): 116-22.

Miyazaki, J., S. Takaki, et al. (1989). "Expression vector system based on the chicken beta-actin promoter directs efficient production ofinterleukin-5." Gene 79(2): 269-77.

Moss, В. (1996). "Genetically engineered poxviruses for recombinant gene expression, vaccination, and safety." Proc Natl Acad Sci USA 93(21): 11341-8.

Mullens, В. A., W. J. Tabachnick, et al. (1995). "Effects of temperature on virogenesis of bluetongue virus serotype 11 in Culicoides variipennis sonorensis." Med Vet Entomol 9(1): 71-6.

Paoletti, E. (1996). "Applications of pox virus vectors to vaccination: an update." Proc Natl Acad Sci USA 93(21): 11349-53.

Pearson, W. R. and D. J. Lipman (1988). "Improved tools for biological sequence comparison." Proc Natl Acad Sci USA 85(8): 2444-8.

Pennock, G. D., C. Shoemaker, et al. (1984). "Strong and regulated expression of Escherichia coli beta-galactosidase in insect cells with a baculovirus vector." Mol Cell Biol 4(3): 399-406.

Perkus, M. E., K. Limbach, et al. (1989). "Cloning and expression of foreign genes in vaccinia virus, using a host range selection system." J Virol 63(9): 3829-36.

Powell, M. F. and M. J. Newman (1995). Vaccine Design, The Subunit and Adjuvant Approach. A Compendium of Vaccine Adjuvants and Excipients. F. Vogel and M. Powell. New York, Plenum Press. 6: 147, 183.

Prevec, L., M. Schneider, et al. (1989). "Use of human adenovirus-based vectors for antigen expression in animals." J Gen Virol 70 (Pt 2): 429-34.

Pritchard, L. I. and A. R. Gould (1995). "Phylogenetic comparison of the serotype-specific VP2 protein of bluetongue and related orbiviruses." Virus Res 39(2-3): 207-20.

Regelson, W., S. Kuhar, et al. (1960). "Synthetic polyelectrolytes as tumour inhibitors," Nature 186: 778-80.

Riviere, M., J. Tartaglia, et al. (1992). "Protection of mice and swine from pseudorabies virus conferred by vaccinia virus-based recombinants." J Virol 66(6): 3424-34.

Robertson, E. S., T. Ooka, et al. (1996). "Epstein-Barr virus vectors for gene delivery to В lymphocytes." Proc Natl Acad Sci USA 93(21): 11334-40.

Robinson, H. L. and С.A. Torres (1997). "DNA vaccines." Semin Immunol 9(5): 271-83.

Roizman, В. (1996). "The function of herpes simplex virus genes: a primer for genetic engineering of novel vectors." Proc Natl Acad Sci USA 93(21): 11307-12.

Rossitto, P. V. and N. J. MacLachlan (1992). "Neutralizing epitopes of the serotypes of bluetongue virus present in the United States." J Gen Virol 73 (Pt 8): 1947-52.

Roy, P. (1992). "Bluetongue virus proteins." J Gen Virol 73 (Pt 12): 3051-64.

Roy, P. (1996). "Orbivirus structure and assembly." Virology 216(1): 1-11.

Roy, P. (1996). Orbiviruses and their replication. Fields Virology. B. N. Fields, D.M. Knipe, P.M. Howley. Philadelphia, PA, Lippincott-Raven: 1709-1734.

Roy, P., Т. Urakawa, et al. (1990). "Recombinant virus vaccine for bluetongue disease in sheep." J Virol 64(5): 1998-2003.

Sambrook, J. and D. W. Russell (2001). Molecular Cloning: a laboratory manual / Joseph Sambrook, David W. Russell. Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press.

Schneider, K., F. Puehler, et al. (2000). "cDNA cloning of biologically active chicken interleukin-18." J Interferon Cytokine Res 20(10): 879-83.

Shida, H. (1986). "Nucleotide sequence of the vaccinia virus hemagglutinin gene." Virology 150(2): 451-62.

Smith, G. E., M. D. Summers, et al. (1983). "Production of human beta interferon in insect cells infected with a baculovirus expression vector." Mol Cell Biol 3(12); 2156-65.

Spreull, J. (1905). "Malarial catarrhal fever (bluetongue) of sheep in South Africa." J. Comp. Path.. Ther. 18: 321-337.

Stickl, H. and V. Hochstein-Mintzel (1971). "[Intracutaneous smallpox vaccination with a weak pathogenic vaccinia virus ("MVA virus")]." Munch Med Wochenschr 113(35): 1149-53.

Stittelaar, K. J., L. S. Wyatt, et al. (2000). "Protective immunity in macaques vaccinated with a modified vaccinia virus Ankara-based measles virus vaccine in the presence of passively acquired antibodies." J Virol 74(9): 4236-43.

Sutter, G. and B. Moss (1992). "Nonreplicating vaccinia vector efficiently expresses recombinant genes." Proc Natl Acad Sci USA 89(22): 10847-51.

Sutter, G., L. S. Wyatt, et al. (1994). "A recombinant vector derived from the host range-restricted and highly attenuated MVA strain of vaccinia virus stimulates protective immunity in mice to influenza virus." Vaccine 12(11): 1032-40.

Tang, D. C., M. DeVit, et al. (1992). "Genetic immunization is a simple method for eliciting an immune response." Nature 356(6365): 152-4.

Taylor, J., R. Weinberg, et al. (1988). "Protective immunity against avian influenza induced by a fowlpox virus recombinant." Vaccine 6(6): 504-8.

Thompson, J. D., D. G. Higgins, et al. (1994). "CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice." Nucleic Acids Res 22(22): 4673-80.

Ulmer, J. В., J. J. Donnelly, et al. (1993). "Heterologous protection against influenza by injection of DNA encoding a viral protein." Science 259(5102): 1745-9.

Van der Zee, R., W. Van Eden, et al. (1989). "Efficient mapping and characterization of a Т cell epitope by the simultaneous synthesis of multiple peptides." Eur J Immunol 19(1): 43-7.

Van Ooyen, A., J. van den Berg, et al. (1979). "Comparison of total sequence of a cloned rabbit beta-globin gene and its flanking regions with a homologous mouse sequence." Science 206(4416): 337-44.

Verwoerd, D. W., H. J. Els, et al. (1972). "Structure of the bluetongue virus capsid." J Virol 10(4): 783-94.

Vialard, J., M. Lalumiere, et al. (1990). "Synthesis of the membrane fusion and hemagglutinin proteins of measles virus, using a novel baculovirus vector containing the beta-galactosidase gene." J Virol 64(1): 37-50.

Wang, L. F., D. H. Du Plessis, et al. (1995). "Use of a gene-targeted phage display random epitope library to map an antigenic determinant on the bluetongue virus outer capsid protein VP5." J Immunol Methods 178(1): 1-12.

White, D. M., W. C. Wilson, et al. (2005). "Studies on overwintering of bluetongue viruses in insects." J Gen Virol 86(Pt 2): 453-62.

Wilson, W. C. and J. O. Mecham (2000). "Molecular Evolution of Orbiviruses." Proc USAHA 104:169-180.

Xin, K. Q., K. Hamajima, et al. (1999). "IL-15 expression plasmid enhances cell-mediated immunity induced by an HIV-1 DNA vaccine." Vaccine 17(7-8): 858-66.

* * * Таким образом, были подробно описаны предпочтительные воплощения настоящего изобретения, при этом необходимо понимать, что изобретение, определяемое приведенной формулой изобретения, не ограничивается частными деталями, указанными в вышеприведенном описании, поскольку возможно осуществление многих их очевидных вариантов без выхода за рамки сущности или объема настоящего изобретения.

1. Иммуногенная композиция для индуцирования иммунного ответа против вируса Orbivirus (OV) у животного, восприимчивого к заболеваниям, вызванным Orbivirus, содержащая рекомбинантный вирус оспы, где рекомбинантный вирус оспы содержит одну или несколько молекул нуклеиновой кислоты, кодирующих белок VP2 вируса катаральной лихорадки овец (BTV), имеющий последовательность, изложенную в SEQ ID NO:20, или кодирующих белок VP5 вируса BTV, имеющий последовательность, изложенную в SEQ ID NO:21, или кодирующих их рекомбинанты.

2. Иммуногенная композиция по п.1, в которой рекомбинантный вирус оспы представляет собой рекомбинантный вирус оспы птиц.

3. Иммуногенная композиция по п.2, в которой рекомбинантный вирус оспы птиц представляет собой вирус оспы канареек.

4. Иммуногенная композиция по п.3, в которой вирус оспы канареек является ALVAC.

5. Иммуногенная композиция по п.1, дополнительно содержащая адъювант.

6. Иммуногенная композиция по п.5, в которой адъювант представляет собой карбомер.

7. Иммуногенная композиция по п.1, дополнительно содержащая антиген, или иммуноген, или их эпитоп из патогена, отличного от BTV животного, или вектор, который содержит и экспрессирует в животном молекулу нуклеиновой кислоты, кодирующую антиген, иммуноген или их эпитоп, или инактивированный или ослабленный патоген, отличный от BTV животного.

8. Иммуногенная композиция по п.1, в которой животным является овца, бык, кошка или лошадь.

9. Иммуногенная композиция по п.1, в которой одна или несколько молекул нуклеиновых кислот функционально связаны с одним или несколькими промоторами.

10. Иммуногенная композиция по п.9, в которой одна или несколько молекул нуклеиновой кислоты, кодирующих белок VP2 BTV и имеющих последовательность, изложенную в SEQ ID NO:20, функционально связаны с промотором Н6, и/или в которой одна или несколько молекул нуклеиновой кислоты, кодирующих белок VP5 BTV и имеющих последовательность, изложенную в SEQ ID NO:21, функционально связаны с промотором 42К.

11. Иммуногенная композиция по п.9, в которой молекула нуклеиновой кислоты, имеющая последовательность, изложенную в SEQ ID NO:1, функционально связана с промотором Н6, и/или в которой молекула нуклеиновой кислоты, имеющая последовательность, изложенную в SEQ ID NO:2, функционально связана с промотором 42К.

12. Иммуногенная композиция для индуцирования иммунного ответа против вируса Orbivirus (OV) у животного, восприимчивого к заболеваниям, вызванным Orbivirus, содержащая рекомбинантный вирус оспы, где рекомбинантный вирус оспы содержит одну или несколько молекул нуклеиновой кислоты, содержащих последовательность, изложенную в SEQ ID NO:1, или последовательность, изложенную в SEQ ID NO:2, или их комбинации.

13. Иммуногенная композиция по п.12, в которой рекомбинантный вирус оспы представляет собой рекомбинантный вирус оспы птиц.

14. Иммуногенная композиция по п.13, в которой рекомбинантный вирус оспы птиц представляет собой вирус оспы канареек.

15. Иммуногенная композиция по п.14, в которой вирус оспы канареек является ALVAC.

16. Иммуногенная композиция по п.12, дополнительно содержащая адъювант.

17. Иммуногенная композиция по п.16, в которой адъювант представляет собой карбомер.

18. Иммуногенная композиция по п.12, дополнительно содержащая антиген, или иммуноген, или их эпитоп из патогена, отличного от BTV животного, или вектор, который содержит и экспрессирует в животном молекулу нуклеиновой кислоты, кодирующую антиген, иммуноген или их эпитоп, или инактивированный или ослабленный патоген, отличный от BTV животного.

19. Иммуногенная композиция по п.12, в которой животным является овца, бык, кошка или лошадь.

20. Иммуногенная композиция по п.12, в которой одна или несколько молекул нуклеиновых кислот функционально связаны с одним или несколькими промоторами.

21. Иммуногенная композиция по п.20, в которой одна или несколько молекул нуклеиновой кислоты, кодирующих белок VP2 BTV и имеющих последовательность, изложенную в SEQ ID NO:20, функционально связаны с промотором Н6, и/или в которой одна или несколько молекул нуклеиновой кислоты, кодирующих белок VP5 BTV и имеющих последовательность, изложенную в SEQ ID NO:21, функционально связаны с промотором 42К.

22. Иммуногенная композиция по п.20, в которой молекула нуклеиновой кислоты, имеющая последовательность, изложенную в SEQ ID NO:1, функционально связана с промотором Н6, и/или в которой молекула нуклеиновой кислоты, имеющая последовательность, изложенную в SEQ ID NO:2, функционально связана с промотором 42К.

23. Способ индуцирования иммунологического или защитного иммунного ответа против BTV у животного, включающий введение животному иммуногенной композиции по любому из пп.1 и 22.

24. Способ по п.23, дополнительно включающий адъювант-карбомер.

25. Способ по любому из пп.23 и 24, в котором животным является овца, бык, кошка или лошадь.

26. Способ индуцирования иммунологического ответа против BTV у животного, включающий введение животному (а) иммуногенной композиции по любому из пп.1-22 и (b) изолированного из BTV антигена, иммуногена или их эпитопа, в котором (а) вводится до (b) в режиме двукратной иммунизации, или (b) вводится до (а) в режиме двукратной иммунизации, или (а) и (b) вводятся совместно, либо последовательно, либо в смеси.

27. Способ по п.26, в котором животным является овца, бык, кошка или лошадь.

28. Набор, содержащий (а) иммуногенную композицию по любому из пп.1-22 и (b) антиген, или иммуноген, или их эпитоп из патогена, отличного от BTV животного, или вектор, который содержит и экспрессирует in vivo в животном молекулу нуклеиновой кислоты, кодирующую антиген, иммуноген или их эпитоп, либо инактивированного, либо ослабленного патогена, отличного от BTV животного, где (а) и (b) находятся в раздельных контейнерах, и набор необязательно содержит инструкции для смешивания и/или введения (а) и (b).

29. Набор по п.28, в котором животным является овца, бык, кошка или лошадь.



 

Похожие патенты:

Изобретение относится к медицине, а именно к онкологии, и может быть использовано для прогнозирования метастазирования у больных раком желудка с разной морфологической структурой.

Изобретение относится к области медицины, кардиологии и терапии и описывает способ прогнозирования течения ишемической болезни сердца путем исследования сыворотки крови, при этом до и после лечения одновременно определяют в сыворотке крови ЛПВП, общий холестерин и ЛП(а) путем дополнительной обработки 0,3 мл 0,1% раствора Тритона Х-100 и инкубации 15 мин при 20°С, перемешиванием смеси методом встряхивания 120 раз в 1 мин, последующей инкубацией сыворотки крови больного с раствором судана Б в течение 1 ч в темном термостате при 40°С, и затем внесения пробы в лунку в геле агарозы с площадью основания 4×20 мм для электрофореза и последующей фиксацией электрофореграмм, их высушиванием, денситометрией и при одновременном снижении уровня общего холестерина на 20% и более и ЛП(а) на 35% и более и увеличением ЛПВП с 13% до 28% и более по сравнению с исходным уровнем прогноз течения заболевания считают благоприятным, способствующим переходу стенокардии напряжения из функционального класса III-IV в функциональный класс I-II, а при снижении общего холестерина менее 20%, уровня ЛП(а) менее 35% и увеличением ЛПВП до 27% по сравнению с исходным прогноз считают неблагоприятным.

Изобретение относится к медицине, кардиологии, терапии и может быть использовано для оценки эффективности лечения ишемической болезни сердца. .
Изобретение относится к медицине, а именно к гинекологии, и может быть использовано в детской и подростковой гинекологии для оценки эффективности патогенетического лечения нарушений репродуктивной функции у девочек с гипоталамическим синдромом пубертатного периода.
Изобретение относится к области медицины и касается способа прогноза некроза лейомиомы матки у беременных во втором триместре. .
Изобретение относится к медицине, а именно к кардиологии, и может быть использовано для ранней диагностики субклинического поражения почек у больных гипертонической болезнью с нормальной скоростью клубочковой фильтрации при отсутствии микроальбуминурии.
Изобретение относится к области медицины, а именно к детской кардиологии, и касается способа прогнозирования дизадаптации сердечной деятельности у детей, перенесших кардиохирургическую коррекцию врожденного порока сердца, включающего исследование сыворотки крови и определение уровня тропонина-Т и активности миокардиальной изоформы креатинфосфокиназы, отличающегося тем, что за 5-7 дней до операции определяют уровень тропонина-Т и активность миокардиальной изоформы креатинфосфокиназы в сыворотке крови и при величине уровня тропонина-Т от 9 до 13 нг/мл и активности миокардиальной изоформы креатинфосфокиназы 0,35 до 0,38 мккат/л, прогнозируют выраженную дизадаптацию сердечной деятельности в ранние сроки послеоперационного периода, а при величине уровня тропонина-Т от 1,6 до 6,0 нг/мл и активности миокардиальной изоформы креатинфосфокиназы от 0,082 до 0,11 мккат/л, прогнозируют умеренную дизадаптацию сердечной деятельности на ранних сроках послеоперационного периода.

Изобретение относится к области биотехнологии, вирусологии и медицины. .

Изобретение относится к генной инженерии, конкретно к получению слитого белка Fc-фрагмента иммуноглобулина и интерферона-альфа, и может быть использовано для лечения гепатита.

Изобретение относится к биотехнологии и может быть использовано для создания функционирующих тирозин-специфических протеинкиназных химер. .

Изобретение относится к области биотехнологии ветеринарных препаратов. .

Изобретение относится к способам получения протеазных ингибиторов, в особенности ингибиторов сериновых протеаз. .

Изобретение относится к новым пиридо[2,3-d]пиримидинам формулы (V) и к применению соединений формулы (I), включающей соединения формулы (V), для изготовления лекарственного средства, полезного для ингибирования репликации HCV у млекопитающего, инфицированного HCV, а также фармацевтической композиция на их основе.

Изобретение относится к таким иммуногенным и вакцинным композициям, которые пригодны для использования у различных животных видов, восприимчивых к заболеванию, вызванному BTV, включая, но не ограничиваясь, млекопитающих, рептилий, птиц, в особенности людей, парных млекопитающих или животных, таких как, но не ограничиваясь, собак, кошек, лошадей, млекопитающих из зоопарков или животных, таких как морские млекопитающие, напр., тюлени, кошки, лошади, зоопарковые рептилии, такие как змеи, крокодилы, аллигаторы, и птичьи виды

Наверх