Синтетические олигонуклеотидные праймеры и способ выявления streptococcus thermophilus в заквасочных культурах при производстве твердых сыров


 


Владельцы патента RU 2455363:

Государственное научное учреждение Институт экспериментальной ветеринарии Сибири и Дальнего Востока Российской академии сельскохозяйственных наук (ГНУ ИЭВСиДВ Россельхозакадемии) (RU)

Изобретение относится к биотехнологии, а именно к ДНК-технологиям. Предложены синтетические олигонуклеотидные праймеры и способ выявления Streptococcus thermophilus в заквасочных культурах при производстве твердых сыров. Предложенный способ включает проведение ПЦР. В случае выявления фрагмента ДНК размером 655 н.п. делают заключение о наличии в исследуемом биоматериале Streptococcus thermophilus. Способ может быть использован в молокоперерабатывающей промышленности для выявления и идентификации штаммов и культур Streptococcus thermophilus в заквасочных культурах при производстве твердых сыров. 2 н.п. ф-лы, 1 табл., 3 пр.

 

Изобретение относится к биотехнологии, а именно к ДНК-технологиям, и может быть использовано в молокоперерабатывающей промышленности для генотипирования штаммов и культур Streptococcus thermophilus.

До настоящего времени основным способом типирования штаммов и изолятов Streptococcus thermophilus является способ, основанный на накоплении данных бактерий в питательной среде. Для выделения молочнокислых стрептококков 1 г пробы растирают в стерильной ступке и готовят разведение 1:10 на физиологическом растворе. Полученную суспензию засевают в стерильное молоко (0,25-0,5 см3 инокулята на 10 см3 среды). Если культуру выделяют из кисломолочных продуктов, то одну каплю продукта вносят бактериологической петлей в стерильное молоко. Посевы термостатируют при 40°С до свертывания молока. Изучение биологических и биохимических свойств и сопоставление полученных данных с данными дифференциальной таблицы (табл.17.16.) определителя микроорганизмов Берджи (Определитель бактерий Берджи. В 2-х т. - Т.2. - Под ред. Дж.Хоулта, П.Крига, П.Снита, Дж.Стейли, С.Уилльмса. - М.: Мир. - 1997. - С.560-566) позволяет провести типирование исследуемых бактерий.

К недостаткам данного способа можно отнести необходимость проведения большого числа биохимических дифференцирующих тестов, длительность процесса тестирования и высокую стоимость.

Наиболее близким решением данного изобретения являются праймеры и способ генотипирования Streptococcus thermophilus, включающий синтез олигонуклеотидных праймеров на 16S rRNA (С.Г.Ботина. Штаммы S. thermophilus, ферментирующие галактозу//Молочная промышленность. - 2008. - №4. - С.59). Осуществляется синтез и секвенирование последовательности гена 16S rRNA. Затем проводится сравнение последовательности данного гена с последовательностями, характерными для Streptococcus thermophilus из базы данных GenBank.

К недостаткам данного способа можно отнести необходимость проведения секвенирования ампликонов, сравнение каждого с базой данных GenBank, длительность процесса тестирования и высокую стоимость.

Задачей изобретения является расширение арсенала специфических олигонуклеотидных праймеров и способов выявления Streptococcus thermophilus при помощи специфических синтетических олигонуклеотидных праймеров.

Поставленная задача решается тем, что синтезируются синтетические олигонуклеотидные праймеры для выявления Streptococcus thermophilus в заквасочных культурах при производстве твердых сыров, согласно изобретению, праймеры имеют нуклеотидные последовательности:

Stt1F 5' - GGGCAACAGTATGTTCCAGG - 3' и

Stt2R 5' - CCATGATAGCTTTAACGGC - 3'.

Задача решается тем, что в способе выявления Streptococcus thermophilus в заквасочных культурах при производстве твердых сыров, включающем проведение ПЦР с синтетическими олигонуклеотидными праймерами, согласно изобретению, праймеры имеют нуклеотидную последовательность

Stt1F 5' - GGGCAACAGTATGTTCCAGG - 3' и

Stt2R 5' - CCATGATAGCTTTAACGGC - 3',

а в случае выявления фрагмента ДНК размером 655 н.п. делают заключение о наличии в исследуемом биологическом материале Streptococcus thermophilus.

Изобретение иллюстрируется следующими примерами.

Пример 1. Способ получения синтетических олигонуклеотидных праймеров

Поиск новых специфических праймеров осуществляют на основе выбранного фрагмента ДНК гена пенициллин-связывающего протеина 2 В (pbp2b gene), характерного только для Streptococcus thermophilus, при анализе полных геномов референтных штаммов Streptococcus thermophilus: LMG18311, CNRZ1066 и LMD9, представленных в базе данных GenBank (http://www.ncbi.nlm.nih.gov/GenBank Search.html). Выбранные фрагменты ДНК тестируют с помощью программы Blast (http://www.ncbi.nlm.nih.gov/blast).

Окончательный выбор праймеров основывается на следующих критериях: высокий уровень сходства фрагментов ДНК с ДНК различных штаммов Streptococcus thermophilus, содержание оснований GC не менее 50%, не образуют димеры, комплементарны последовательности ДНК на границах специфического фрагмента.

Химический синтез праймеров осуществляют амидофосфитным методом на автоматическом синтезаторе ASM-102U.

Концентрацию специфических олигонуклеотидных праймеров в маточном растворе определяют спектрометрическим методом.

Таким образом, указанный способ позволяет получать синтетические олигонуклеотидные праймеры, комплементарные ДНК фрагмента гена пенициллин-связывающего протеина 2 В (pbp2b gene), характерного только для Streptococcus thermophilus.

Пример 2. Способ применения синтетических олигонуклеотидных праймеров для выявления Streptococcus thermophilus в заквасочных культурах при производстве твердых сыров

Способ осуществляется в несколько этапов.

Этап 1. Выделение ДНК Streptococcus thermophilus.

Для выделения ДНК берут суспензии штаммов и изолятов Streptococcus thennophilus, выделенных на питательном бульоне из гидролизованного молока (БГМ), а также биоматериал от кисломолочных продуктов.

При выделении из бактериальной культуры клетки осаждают в бляшку центрифугированием 1-2 мин при 5000-7000 об/мин. Надосадочную жидкость удаляют 50 мкл культуры добавляют к 300 мкл подогретого до +80°С 10% СТАВ, перемешивают и инкубируют при +80°С в течение 40 минут. Затем охлаждают до комнатной температуры и добавляют 0,5 объема (300-400 мкл) смеси фенол/хлороформ/изоамиловый спирт (25:24:1), плавно перемешивают 2-3 раза в течение 1-2 мин и центрифугируют в течение 10 мин при 13000 об/мин. Водную фазу переносят в другую пробирку и к ней приливают 300 мкл смеси хлороформ/изоамиловый спирт (24:1), перемешивают 1 мин и центрифугируют 6 мин при 13000 об/мин. К водной фазе прибавляют 50 мкл (1/10 объема) 3М ацетата натрия рН 4,8 и 1000 мкл этанола, перемешивают и помещают на 1 час при -20°С. Пробу центрифугируют 10 мин при 13000 об/мин, осадок промывают 70% этанолом, высушивают при наклонном положении пробирки при +37°С в течение 25-30 мин и растворяют в 30-50 мкл автоклавированной бидистиллированной воды.

Этап 2. Проведение полимеразной цепной реакции.

Состав реакционной смеси: Для каждой исследуемой пробы ДНК готовят ПЦР-смесь: 650 мМ трис-НСl рН 8,9; 160 мМ (NH)4SO4; 30 мМ MgCl; 0,5% Tvin-20; 2,5 мМ dNTP, no 0,15 мкг каждого праймера; 0,5 е.а. Taq-ДНК полимеразы; 2 мкл пробы ДНК и автоклавированной бидистиллированной воды до 25 мкл.

Температурный режим проведения ПНР: Программа амплификации состоит из следующих температурных режимов: прогревание реакционной смеси при 95°С в течение 3 мин - 1 цикл, затем денатурация при 94°С 0,2 мин, отжиг при 60°С 0,2 мин, элонгация при 72°С 0,4 мин - 35 циклов и досинтез при 72°С в течение 0,8 мин.

Этап 3. Определение размера продуктов ПЦР.

Продукты ПЦР анализируют методом электрофореза в 0,5х трис-боратном буфере, приготовленном из 5х ТБЕ буфера (0,089 М трис-борат; 0,089 М борная кислота; 0,002 М ЭДТА).

Продукты ПЦР визуализировали путем электрофореза в 1%-ном геле агарозы с бромистым этидием при силе тока 25-40 мА в течение 30-40 мин. 12,5 мкл ампликона смешивают с 3 мкл буфера для нанесения (0,25% бромфенолового синего, 30% глицерин в бидистиллированной воде) и вносят в лунки геля под электрофорезный буфер. Электрофорез проводят при напряжении 10 в/см длины геля до тех пор, пока краситель пройдет от старта не менее 2,0-2,5 см геля (примерно 35-40 минут). Результаты электрофореза учитывают, просматривая гель в ультрафиолетовом свете с длиной волны 254 нм на приборе «Трансиллюминатор».

В качестве маркера используют ДНК pSKII(+), гидролизованную Mspl на фрагменты 710, 489, 404, 328, 242, 190 н.п. или 100bр.

Результат ПЦР считают положительным, если продукт ПЦР соответствует размеру фрагмента ДНК в 655 н.п.

Пример 3. Определение специфичности ПЦР.

Результаты исследований по определению специфичности реакции с праймерами Stt1F и Stt2R представлены в таблице 1, которые показывают, что положительные анализы продуктов ПЦР получают только тогда, когда в качестве матрицы используют ДНК фрагмента гена пенициллин-связывающего протеина 2 В (pbp2b gene), характерного только для Streptococcus thermophilus. Анализы были отрицательными, когда использовали ДНК других бактерий.

Таблица 1.
№ п/п Наименование культуры ПЦР
с праймерами SttIF и Stt2R
1 Staphylococcus aureus Отрицательно
2 Staphylococcus albus Отрицательно
3 Streptococcus pyogenes Отрицательно
4 Streptococcus epidermitis Отрицательно
5 Escherihia coli Отрицательно
6 Salmonella Dublin Отрицательно
7 Proteus vulgaris Отрицательно
8 Streptococcus thermophilus 1244 Коллекция ВНИИМС (Углич) Положительно
9 Streptococcus thermophilus 1254 Коллекция ВНИИМС (Углич) Положительно
10 Streptococcus thermophilus Д/И Коллекция ВНИИМС (Углич) Положительно
11 Streptococcus thermophilus 28-2 Коллекция ГНУ СибНИИС (Барнаул) Положительно
12 Streptococcus thermophilus 10-1 Коллекция ГНУ СибНИИС (Барнаул) Положительно
13
14 Streptococcus thermophilus CK9 Коллекция ГНУ СибНИИС (Барнаул) Положительно
15 Streptococcus thermophilus 9-1 Коллекция ГНУ СибНИИС (Барнаул) Положительно
16 Дистиллированная вода Отрицательно

Для подтверждения специфичности тестируемого фрагмента гена пенициллин-связывающего протеина 2В (pbp2b gene), характерного только для Streptococcus thermophilus, наработали фрагмент на матрице ДНК штамма Streptococcus thermophilus 1244 (Коллекция ВНИИМС, Углич) и провели секвенирование. Анализ нуклеотидных последовательностей синтезируемых фрагментов провели методами выравнивания с другими опубликованными последовательностями полных геномов референтных штаммов Streptococcus thermophilus: LMG18311, CNRZ1066 и LMD9, представленных в базе данных GenBank (http://www.ncbi.nlm.nih.gov/Search.html). Установили, что рассматриваемая нуклеотидная последовательность штамма Streptococcus thermophilus 1244 (Коллекция ВНИИМС, Углич) совпадала с нуклеотидной последовательностью, когда в качестве матрицы используют ДНК фрагмента гена GenBank вышеназванных референтных штаммов Streptococcus thermophilus.

Таким образом, разработанные синтетические олигонуклеотидные праймеры и способ выявления Streptococcus thermophilus в заквасочных культурах при производстве твердых сыров обладают высокой специфичностью и позволяют эффективно проводить идентификацию штаммов и культур Streptococcus thermophilus, используемых в молокоперерабатывающей промышленности.

1. Синтетические олигонуклеотидные праймеры для выявления Streptococcus thermophilus в заквасочных культурах при производстве твердых сыров, согласно изобретению, праймеры имеют нуклеотидные последовательности
Stt1F 5'-GGGCAACAGTATGTTCCAGG-3' и
Stt2R 5'-CCATGATAGCTTTAACGGC-3'

2. Способ выявления Streptococcus thermophilus в заквасочных культурах при производстве твердых сыров, включающий проведение ПЦР с синтетическими олигонуклеотидными праймерами, согласно изобретению, праймеры имеют нуклеотидную последовательность
Stt1F 5'-GGGCAACAGTATGTTCCAGG-3' и
Stt2R 5'-CCATGATAGCTTTAACGGC-3',
а в случае выявления фрагмента ДНК размером 655 н.п.делают заключение о наличии в исследуемом биологическом материале Streptococcus thermophilus.



 

Похожие патенты:

Изобретение относится к области биотехнологии, а именно к способу определения первичной структуры рибонуклеиновых кислот. .

Изобретение относится к медицине, а именно к молекулярно-генетической диагностике в онкологии, и касается способа прогнозирования развития профессиональных злокачественных новообразований кожи у работников производства стекловолокна.

Изобретение относится к области медицины, в частности к молекулярной онкологии, и может быть использовано для молекулярно-генетической диагностики чувствительности опухоли у пациентов с раком легкого на терапию гефитинибом.

Изобретение относится к области медицины. .

Изобретение относится к области биотехнологии, а именно к способу обнаружения точечных нуклеотидных замен в генах человека, ответственных за предрасположенность и развитие сердечно-сосудистых заболеваний и биочипу, используемому в данном способе.

Изобретение относится к области биотехнологии, а именно к способу получения образца для амплификации нуклеиновой кислоты и к набору для получения образца для амплификации нуклеиновой кислоты.

Изобретение относится к области медицины, онкологии и молекулярной биологии и может быть использовано для диагностики рака молочной железы. .

Изобретение относится к области биотехнологии, а именно к способу детекции специфических нуклеотидных последовательностей и нуклеотидных замен с помощью ПЦР в режиме реального времени.
Изобретение относится к микробиологии и может быть использовано в медицинской бактериологии для количественной оценки адгезивных свойств стафилококков, выделенных от человека и объектов окружающей среды при его бактериологической идентификации, для характеристики его вирулентных свойств in vitro по уровню адгезии к биополимерным молекулам.
Изобретение относится к биотехнологии и может быть использовано для ускоренной индикации и дифференциации энтеробактерий. .

Изобретение относится к биотехнологии и может быть использовано для идентификации видов Streptococcus по появлению трех разных оттенков выявляемых микроорганизмов и появлению испускания флуоресценции в дополнение к изменениям окраски среды.

Изобретение относится к биотехнологии и может быть использовано в микробиологической лабораторной диагностике инфекционных заболеваний. .

Изобретение относится к области медицины, а именно к микробиологии и эпидемиологии. .

Изобретение относится к области медицины, а именно к микробиологии и эпидемиологии, и может быть использовано при бактериологической диагностике. .
Изобретение относится к области медицины, а именно к лабораторным исследованиям при травматологической патологии. .
Изобретение относится к иммунологии. .

Изобретение относится к медицинской микробиологии и может быть использовано для ранней диагностики дисбиотических состояний. .

Изобретение относится к области биотехнологии, а именно к способу детектирования и типирования папилломавируса человека (HPV) в образце, а также к реакционному сосуду, набору и зонду для детектирования и типирования HPV.
Наверх