Способ стабилизации вакцинного туляремийного штамма



Способ стабилизации вакцинного туляремийного штамма
Способ стабилизации вакцинного туляремийного штамма
Способ стабилизации вакцинного туляремийного штамма

 

C12N15 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2457249:

Федеральное государственное учреждение науки Государственный научный центр прикладной микробиологии и биотехнологии (ФГУН ГНЦ ПМБ) (RU)

Изобретение относится к области биотехнологии и молекулярной генетики. Способ стабилизации вакцинного туляремийного штамма заключается во введении делеции гена recA в хромосомную ДНК F.tularensis 15/10 с помощью суицидной плазмиды pPVΔrecА, несущей участок хромосомы F.tularensis с делетированным геном recA, в результате аллельного обмена между модифицированным фрагментом ДНК с делетированным геном recA и гомологичной областью хромосомной ДНК вакцинного штамма. Изобретение позволяет исключить реверсию вакцинных свойств и способствует постоянству генома вакцинного штамма туляремийного микроба. 1 з.п. ф-лы, 2 ил., 6 табл.

 

Изобретение относится к области биотехнологии и молекулярной генетики и может быть использовано для стабилизации вакцинного штамма Francisella tularensis. Впервые живая аттенуированная вакцина была получена в 40-х гг. в СССР. Аттенуирование штамма было достигнуто в результате многократных пассажей природного изолята на питательной среде, содержащей нормальную сыворотку (L.M.Khatenever, 1943. The allergic diagnosis, specific prophylaxis and vaccine therapy of tularemia.// In E.B; Balsky, I.G.Kochergin, and V.V.Porin (ed.), Microbiology and epidemiology. Medical Publications Ltd, London, United Kingdom, p.62-79). В 1934 г. Б.Я.Эльберт с сотрудниками прививали животных полученным аттенуированным штаммом Москва, в результате чего иммунизированные животные стали устойчивы к заражению вирулентными штаммами туляремийного микроба. Этот штамм в дальнейшем был использован для иммунизации людей (Туляремия. / Под ред. Олсуфьева Н.Г. и Руднева Г.П. М.: МЕДГИЗ. 1960). Эффективность иммунизации штаммом Москва успешно продемонстрирована на добровольцах, однако в процессе хранения вакцинные свойства штамма Москва были потеряны (Туляремия. / Под ред. Олсуфьева Н.Г. и Руднева Г.П. М.: МЕДГИЗ. 1960.) (W.D.Tigertt. Soviet viable Pasteurella tularensis vaccines: a review of selected articles. 1962. Bacteriol. Rev. 26:354-373). По подобной схеме был создан аттенуированный вакцинный штамм 15, который успешно использовался для вакцинации людей (Emelianova О.S. 1959. Variation of the tularemia organism under artificial conditions, p.109-115. In V.D.Timakov, ed., Microbial variation. Pergamon Press translation, New York; Емельянова О.С. 1959. Различное хранение Pasteurella tularensis в разных лабораторных условиях. ЖМЭИ. N.3, 22-26).

Однако в процессе производства живой туляремийной вакцины штамм 15 стал более аттенуированным и менее вирулентным для мышей (Туляремия. / Под ред. Олсуфьева Н.Г. и Руднева Г.П. М.: МЕДГИЗ. 1960.). Ослабленный штамм после пассирования через животных восстановил протективные свойства, и в результате был получен штамм 15 восстановленный.

Вакцинный препарат на основе штамма 15 (восстановленного) был передан в Соединенные Штаты. (Sandstrom, G. 1994. The tularemia vaccine. J.Chem. Tech. Biotech. 59:315-320). Однако выращенные из переданной ампулы бактериальные колонии отличались морфологически - колонии "голубые" и "серые". Причем "голубые" колонии обладали иммуногенными свойствами, а "серые" не обладали такими свойствами, что дополнительно свидетельствовало о нестабильности вакцинных свойств вакцинного туляремийного штамма 15.

Как видно из вышеизложенного, полученные ранее туляремийные вакцинные штаммы были нестабильными.

Известно, что одним из механизмов изменчивости является внутригеномная гомологичная рекомбинация, а продукт гена recA является ключевым ферментом в процессе гомологичной рекомбинации (S.C.Kowalczykowski, D.A.Dixon, А.К.Eggleston, S.D.Lauder, and W.M.Rehrauer. Biochemistry of homologous recombination in Escherichia coli//1994. Microbial. Rev. Vol.58, No.3. p.401-465).

Туберкулезная вакцина на основе штамма Bacille Calmette-Guerin (BCG), который был получен из Mycobacterium bovis, широко используется в настоящее время в мире. В разных странах живую туберкулезную вакцину готовят на основе вариантов штамма BCG - Pasteur, Frappier, Denmark, Russia. Среди вариантов только штамм Russia, имеющий дефектый recA ген, практически не отличается по уровню экспрессии протективных антигенов, иммуногенности и протективном действии от исходного штамма BCG, тогда как другие штаммы эволюционно изменились и проявляют различную протективную активность (М.Keller, Е.С.Boettger, P.Sande.// Tuberculosis vaccine strain Mycobacterium bovis BCG Russia is a natural recA mutant. Nature Precedings. 2008). Это наблюдение является дополнительным подтверждением влияния продукта гена recA на изменчивость бактерий.

Известна лишь одна работа, посвященная инактивации гена recA у природного подвида F.tularensis subsp. novicida (J.M.Berg, E.Khisimuzi MDLULI, F.Nano. Infect. and immun. 1992. p.690-693. V.60. N.2). Но в этой работе отсутствовали данные о влиянии этой мутации на гомологичную рекомбинацию и иммуногенность F.tularensis subsp. novicida. Способы стабилизации вакцинных свойств туляремийного штамма с помощью инактивации гена recA в геноме F.tularensis в литературе не известны.

Задачей настоящего изобретения является инактивация гена recA, исключающая гомологичную рекомбинацию и способствующая постоянству генома вакцинного штамма туляремийного микроба.

Поставленная задача решается тем, что предложен способ стабилизации вакцинного туляремийного шамма путем введения делеции гена recA в хромосомную ДНК F.tularensis 15/10 с помощью суицидной плазмиды pPVΔrecA, несущей участок хромосомы F. tularensis с делетированным геном recA, в результате аллельного обмена между модифицированным фрагментом ДНК с делетированным геном recA и гомологичной областью хромосомной ДНК вакцинного штамма.

Суицидная плазмида pPVΔrecA создана на основе плазмиды pUC19, фрагментов ДНК с генами sacB, cat, mob и фрагмента хромосомной ДНК F.tularensis 15/10 с делецией recA гена.

Для создания рРVΔrecA используется фрагмент хромосомной ДНК F.tularensis 15/10 размером 2984 п.о. с делецией структурной области recA гена размером 1060 п.о., который встраивается в плазмидный вектор pPV, сконструированный на основе плазмиды pUC19, неспособной к репликации в F.tularensis, содержащий гены sacB, cat, mob.

Инактивация гена recA препятствует гомологичной рекомбинации и способствует постоянству генома вакцинного штамма туляремийного микроба. Такой модифицированный штамм сохраняет полезные вакцинные свойства.

Штамм Francisella tularensis 15/10ΔrecA депонирован в коллекции микроорганизмов Федерального государственного учреждения науки «Государственный научный центр прикладной микробиологии и биотехнологии» (ФГУН ГНЦ ПМБ) коллекционный номер 6622.

Штамм создан на основе штамма Francisella tularensis. subsp. holarctica 15/10 и отличается от исходного штамма отсутствием гена recA в геноме.

Штамм получен в результате аллельного обмена участка ДНК с делетированным геном recA из плазмиды pPVΔrecA на природный вариант в хромосоме F.tularensis 15/10. Отбор клонов с фенотипом Cmr проводили на среде с хлорамфениколом (3 мкг/мл). Для элиминации плазмиды pPVΔrecA культуру выращивали на среде с сахарозой. Изолированные колонии анализировали методом ПЦР. В результате был отобран клон с делетированным фрагментом генома размером 2,949 т.п.о. без гена recA.

Штамм предназначен в качестве модели для изучения стабилизации протективных свойств вакцинного штамма и для создания стабильных штаммов-продуцентов антигенов.

Отсутствие гена recA подтверждено методом ПЦР с использованием специфических праймеров.

Питательные среды для культивирования

Плотная питательная среда на основе эритрит-агара с добавлением черного альбумина. Жидкая среда (состав среды на 1 л): 5 г ферментативного гидролизата казеина, 5 г дрожжевого экстракта, 5 г хлористого натрия, 12 г однозамещенного фосфата калия, рН 7,2, 1% глюкоза, 10 мг цистеина, 10 мг хлористого железа. В среды можно добавлять полимиксин в концентрации 100 мкг мл-1 для подавления посторонней микрофлоры.

Способ хранения

В лиофилизированном состоянии: 40%-ная сахарозо-желатиновая защитная среда, хранение при температуре (4-8)°С, перезакладка через 5 лет.

Культурально-морфологические особенности штамма

Растет на обогащенных естественными субстратами питательных средах (кровь, яичный желток). Темп развития замедленный. Оптимальная температура выращивания 37°С, рН 7,0-7,5. На плотной среде на основе эритрит-агара с добавлением черного альбумина за 48-72 часа образуются колонии диаметром около 2,0-2,5 мм, выпуклые, блестящие, гладкие, голубовато-белые, непрозрачные, однородные. Под микроскопом бактериальные клетки видны как очень мелкие грамотрицательные коккообразные клетки около 0,5 мкм, неподвижные, спор и капсул не образуют.

Генетические особенности штамма

Делетирован фрагмент хромосомной ДНК с геном recA.

Устойчивость (чувствительность) к антибиотикам, фагам и т.п.

Устойчив к 100 мкг/мл полимиксина, 100 мкг/мл ампициллина, 50 мкг/мл эритромицина. Лизирующие фаги не обнаружены. Устойчив к бактерицидному действию нормальной сыворотки животных.

Прочие генетические особенности

Ауксотроф.

Изобретение иллюстрируется следующими примерами.

Пример 1. Конструирование плазмиды для аллельного обмена pPVΔrecA

Создание плазмиды для аллельного обмена pPVΔrecA для гомологичной рекомбинации представлено на схеме 1.

Для получения фрагмента хромосомной ДНК с делецией recA гена получают два ампликона (амплифицируют два фрагмента ДНК) размерами: 1592 п.о. с использованием праймеров FSA и RBA и 1392 п.о. с использованием праймеров FBA и RSA (таблица 1, схема 2). Расчет праймеров проводят с использованием нуклеотидной последовательности генома F.tularensis ssp holarctica LVS (AM233362), взятого из банка генов (www.ncbi.nlm.nih.gov). Праймеры синтезированы в ЗАО «Синтол». Концевая 5' часть праймера FSA содержит сайт рестрикции SalI, концевая 5'-часть праймера RBA содержит сайт рестрикции BamHI и стоп-кодон ТТА, аналогично концевая 5'-часть праймера FBA содержит сайт рестрикции BamHI и стоп-кодон ТАА, а праймер RSA на 5'-конце содержит сайт рестрикции SalI.

ПЦР проводят с помощью высокоточной полимеразы (High fidelity enzymes mix, «Fermentas», Lithuania). Реакционная смесь содержит буфер для ДНК-полимеразы 10х, фирмы «Fermentas», Lithuania (75 мМ Трис-HCl рН 8,8, 20 мМ (NH4)2SO4, 0,01% Tween 20), 2,5 мМ MgCl2; 0,5 мкМ прямого и обратного праймеров (праймеры указаны в таблице 1), 0,2 мкМ каждого дНТФ (10 mM dNTP) и 1 ед. Taq-ДНК-полимеразы фирмы «Fermentas», Lithuania; 50-100 нг ДНК. ПЦР-амплификацию проводят в следующем режиме: 95°С - 3 мин, 1 цикл; 94°С - 30 сек, 51°С (53°С для 4,0 т.п.о. фрагмента, содержащего ген recA) - 30 сек, 72°С - 1 мин (4 мин для 4,0 т.п.о. фрагмента, содержащего ген recA), 30 циклов; 72°С - 7 мин (10 мин для 4,0 т.п.о. фрагмента, содержащего ген recA), 1 цикл. Продукты реакции разделяют электрофорезом в 0,7% агарозном геле.

Таблица 1
Праймеры, используемые для амплификации гена recA
Название Последовательнось 5'-3' Ген-мишень
FSA AAAGTCGACCTGGTGGTTTGATGGTT RecA (левое плечо)
RBA AAAGGATCCTTAAACTGATTCTAGCGCCTTT RecA (левое плечо)
FBA AAAGGATCCTAAGCAGTTACTCAAGATGAG RecA (правое плечо)
RSA AAAGTCGAC TACCATTCTCAAGGTACT RecA (правое плечо)

Очистку ампликонов проводят с использованием DNA Extraction Kit (Fermentas, Lithuania). Ампликоны размером 1592 п.о. и 1392 п.о. обрабатывают рестриктазами Sa1I и BamHI и встраивают в Sa1I сайт рестрикции векторной плазмиды pPV, предварительно линеаризованной рестриктазой Sa1I.

Полученную рекомбинантную плазмиду переносят в клетки штамма E.coli DH5α методом кальциевой трансформации. Отбор трансформантов с плазмидой pPVΔrecA проводят по признаку ампициллинустойчивости и наличия фрагмента хромосомной ДНК F.tularensis 15/10 с делецией гена recA с помощью ПЦР, используя праймеры FSA и RSA.

Пример 2. Получение штамма F.tularensis 15/10ΔrecA и его свойства

Создание штамма Е.coli S17-1 для переноса плазмиды pPVΔrecA в F.tularensis 15/10

Плазмиду pPVΔrecA переносят в клетки штамма Е.coli S17-1 (thi, thr, leu, tonA, lacY, supE, recA::RP4-2-Tc::Mu, Kn::Tn7) методом кальциевой трансформации. Отбор трансформантов с плазмидой рРVΔrecA проводят по признаку устойчивости к ампициллину, хлорамфениколу, чувствительности к сахарозе и наличия фрагмента хромосомной ДНК F.tularensis 15/10 с делецией гена recA с помощью ПЦР, используя праймеры FSA и RSA.

Конъюгационный перенос pPVΔrecA в F.tularensis

Для скрещевания готовят суспензию объемом 100 мкл, содержащую 1·108 клеток донорного штамма Е.coli S17-1(pPVΔrecA) и 3·1010 клеток реципиентного штамма F.tularensis 15/10, наносят пятнами по 25 мкл на агаровую среду Лурия-Бертани (LB) и инкубируют при температуре 25°С в течение 18 час.

Бактериальную культуру из пятен собирают, суспендируют в забуференном физиологическом растворе (ЗФР) и высевают из соответствующих десятикратных разведений на плотную питательную среду FT-агар (ФГУН ГНЦ ПМБ).

В среду добавляют 100 мкг мл-1 полимиксина В и 3 мкг мл-1 хлорамфеникола, и инкубируют посевы при температуре 37°С. Выросшие колонии через 120 час инкубации пересевают на среду FT-агар, содержащую 100 мкг мл-1 полимиксина В и 5% сахарозы, до изолированных колоний и инкубируют при температуре 37°С.

Среди выросших колоний через 48 часов инкубации отбирают колонии с фенотипом CmS, способные расти на FT-агарe с 5% сахарозой. Отобранные колонии проверяют в ПЦР с использованием праймеров FSA и RSA. Клоны, обладающие делеционным вариантом recA гена, дают синтез укороченного ампликона размером 2949 п.о., тогда как клоны исходного штамма 15/10 дают синтез ампликона размером 4009 п.о. В результате был отобран клон F.tularensis 15/10 с ΔrecA генотипом. Этот клон проверялся с помощью ПЦР на отсутствие гена cat (детерминирующего устойчивость к хлорамфениколу) с использованием праймеров CCF (5'-ACAATTGGAAGAGAAAAGA-3') и CCR (5'-CTATCTGACAATTCCTGA-3'). У исследованного клона отсутствовал ген cat.

Особенности роста F.tularensis 15/10ΔrecA

Для изучения динамики роста вакцинного штамма F.tularensis 15/10ΔrecA используют жидкую питательную среду F2 (г/л) следующего состава:

кислотный гидролизат казеина - 5 г;

дрожжевой экстракт - 5 г;

цистеина гидрохлорида моногидрат - 0,1 г;

фосфат калия однозамещенный - 12 г;

калий гидроксид - 3,9 г;

натрий хлористый - 5 г;

сульфат железа (II) семиводный - 6 мг;

глюкозы - 10 г;

воды - до 1 л;

рН среды - 7,2.

Автоклавирование среды проводят при 1 атм в течение 30 минут.

Культивирование проводят в качалочных колбах объемом 750 мл, содержащих 30 мл среды F2. Культивирование проводят на качалке с перемешиванием при 200 об/мин и температуре 37°С. Для сравнения динамики роста исследуемого штамма используют исходный вакцинный штамм F.tularensis 15/10.

Данные по величинам ОП (оптическая плотность суспензии на длине волны 590 нм) и БК (концентрация клеток по данным высева на плотную питательную среду) растущих культур приведены в таблице 3.

Таблица 3
Динамика роста вакцинных штаммов F. tularensis 15/10 и F.tularensis 15/10ΔrecA
Время инкубации, ч Оптическая плотность / Lg КОЕ/мл
F.tularensis 15/10 F.tularensis 15/10 ΔrecA
0 0,05 / 9,38 0,046 / 9,11
1 0,043 0,052
2 0,0504 / 9,07 0,053 / 8,95
3 0,08 0,063
4 0,119 / 9,20 0,0761 / 9,14
5 0,148 0,103
6 0,186 / 9,88 0,19 / 9,92
7 0,21 0,215

Результаты, представленные в таблице, свидетельствуют о том, что мутация в гене recА не затрагивает клеточные процессы, влияющие на рост F.tularensis 15/10ΔrecA.

Частоты гомологичной рекомбинации у F.tularensis 15/10ΔrecA и F.tularensis 15/10

Для проверки отсутствия гомологичной рекомбинации в полученном штамме F.tularensis 15/10ΔrecA, дефектном по recA гену, производят конъюгационный перенос плазмид pPV/ΔiglC (плазмида pPV, содержащая фрагмент хромосомы F.tularensis 15/10 с инактивированным геном iglC), из Е.coli S17-1 в F.tularensis 15/10ΔrecA. В качестве контроля используют исходный штамм F.tularensis 15/10, в который также переносят плазмиду pPV//ΔiglC. Для определения эффективности переноса плазмид из Е.coli S17-1 в исследуемые штаммы F.tularensis использовали Е.coli S17-1 с плазмидой pHV33-mob, способной автономно реплицироваться в туляремийном микробе.

Высев конъюгатов проводят на FT-агар, содержащий 100 мкг мл-1 полимиксина В и 3 мкг мл-1 хлорамфеникола. Полученные результаты свидетельствуют о том, что частота конъюгационного переноса плазмиды pHV33-mob из Е.coli S17-1 в исследуемые штаммы F.tularensis одинакова и составляет 107 КОЕ. Но при конъюгационном переносе рекомбинантной плазмиды pPV/ΔiglC в делеционный штамм F.tularensis 15/10ΔrecA не было получено ни одного клона, тогда как в результате переноса плазмиды pPV//ΔiglC из Е.coli S17-1 в F.tularensis 15/10 получено 102 КОЕ. Это свидетельствует о том, что гомологичная рекомбинация в F.tularensis 15/10ΔrecA существенно снижена.

Устойчивость штамма F.tularensis 15/10 ΔrecA к УФ-облучению

Для опыта по облучению УФ готовят клеточную суспензию по стандарту мутности на 10 оптических единиц (что соответствует концентрации бактерий F.tularensis 15/10-5·109 кл./мл) из ночной агаровой культуры. Затем суспензию разводят до концентрации 1·106 кл/мл в ЗФР и 10 мл разведенной бактериальной суспензии переносят в чашку Петри диаметром 10 см. Облучение проводят при длине волны 365 нм, при постоянном перемешивании на УФ-трансиллюминаторе. После облучения суспензию высевают на FT-агар из исходного разведения и первых трех десятикратных разведений и инкубируют при температуре 37°С в течение 72 часов. Результаты высева облученных клеток F.tularensis 15/10ΔrecA приведены в таблице 4. Для сравнения в этой таблице приведены данные по выживаемости штаммов F.tularensis 15/10, F.tularensis 15/10ΔrecA (pHV33-mob/recA), F.tularensis 15/10ΔrecA (pHV33-mob).

Для создания вектора pHV33-mob/recA используют вектор pHV33-mob. Вектор pHV33-mob создан на основе плазмиды pHV33, реплицирующейся как в клетках Е.coli, так и в клетках F.tularensis. В BamHI сайт плазмиды pHV33 встраивают mob фрагмент из плазмиды pPV, содержащий origin переноса oriT из плазмиды RP4, что позволяет использовать полученную конструкцию для мобилизационного переноса клонированного в ней генетического материала из реципиентного штамма Е.coli S17-1 в штаммы F.tularensis.

Плазмида pHV33-mob/rec4 была получена в результате встраивания в векторную плазмиду pHV33-mob по сайту рестрикции SalI ампликона размером 4009 п.о. с интактным геном recA. Этот ампликон был получен на матрице хромосомной ДНК F.tularensis 15/10 с праймерами FSA и RSA (таблица 1).

Таблица 4
Воздействие УФ на туляремийные вакцинные штаммы
Время экспозиции, сек F.tularensis 15/10 F.tularensis 15/10ΔrecA F.tularensis 15/10ΔrecA: pHV33-mob/recA F.tularensis 15/10 ΔrecA: pHV33-mob
Концентрация живых клеток после УФ-облучения (Lg КОЕ/мл)
0 9,14 9,3 8,91 9,2
10 9,04 7 8,81 7,01
20 9,01 6,6 8,47 6,02
40 8,7 6,25 8,37 5,36
80 8,0 5 8,16 4,47
160 6,9 - 7,51 -

Делеция фрагмента хромосомной ДНК F.tularensis 15/10 с геном recA приводит к увеличению чувствительности бактериальных клеток модифицированного штамма F.tularensis 15/10ΔrecA к УФ-облучению по сравнению с исходным штаммом F.tularensis 15/10 и штаммом F.tularensis 15/10ΔrecA (pHV33-mob/recA), полученным в результате переноса плазмиды, несущей полноразмерный ген recA F.tularensis 15/10, в штамм F.tularensis 15/10ΔrecA.

Определение устойчивости F.tularensis 15/10ΔrecA к действию нормальной кроличьей сыворотки (НКС)

Бактерицидная активность НКС для штаммов F.tularensis 15/10ΔrecA и F.tularensis 15/10 была практически одинакова и составляла 30% выживаемости после инкубировании в течение 18 часов и температуре 37°С.

Определение вирулентности F.tularensis 15/10ΔrecA для мышей линии BALB/c

Мыши линии BALB/c (по 5 мышей в группе, возраст 6-8 недель) инфицируют подкожно бактериальной суспензией в дозах 1·101, 1·102, 1·103 и 1·104 КОЕ/мышь. Животных наблюдают в течение 30 дней. LD50 определяют по методу Кербера в модификации И.П.Ашмарина. Результаты определения LD50 для штамма F.tularensis 15/10ΔrecA представлены в таблице 5. Для сравнения в этой таблице приведено значение LD50 для вакцинного штамма F.tularensis 15/10.

Таблица 5
Определение LD50 для штаммов F.tularensis 15/10 и F.tularensis 15/10ΔrecA
Штаммы F.tularensis LD50, КОЕ
15/10 5,0·102
15/10ΔrecA 5,0·103

Данные, приведенные в таблице, показывают, что утрата способности продуцировать белок RecA приводит к снижению вирулентности делеционного варианта по гену recA в 10 раз по сравнению с вакцинным штаммом F.tularensis 15/10.

Оценка протективности штамма F.tularensis 15/10ΔrecA

Мыши линии BALB/c (по 5 животных в группе) иммунизировали подкожно бактериальной суспензией исследуемого штамма F.tularensis дозами 1·101, 1·102, 1·103 и 1·104 КОЕ/мышь. Мышам контрольной группы был введен ЗФР. На 45 сутки после иммунизации проведено подкожное заражение животных всех групп штаммом F.tularensis 503 дозой 1·102 КОЕ/мышь (при подкожном заражении DCL F.tularensis 503 равна 1 клетке). Наблюдение за зараженными животными проводят в течение 21 суток. Протективные свойства штамма оценивают по доле выживших после заражения животных в процентах.

Данные по выживаемости животных, предварительно иммунизированных вакцинным штаммом F.tularensis 15/10ΔrecA, представлены в таблице 6. Для сравнения в этой таблице приведены данные по выживаемости животных, предварительно иммунизированных вакцинным штаммом F.tularensis 15/10.

Таблица 6
Протективность штаммов F.tularensis 15/10 и F.tularensis 5/10ΔrecA
Доза иммунизации, КОЕ/мышь Доза заражения КОЕ/мышь Процент выживших животных
Иммунизация 15/10 Иммунизация 15/10ΔrecA
1·101 100 60
1·102 100 100
1·103 1·102 100 100
1·103 100 100
1·104 НД 100

Протективные свойства штаммов F.tularensis 15/10 и F.tularensis 15/10ΔrecA практически не отличаются.

Полученные результаты позволяют сделать вывод о том, что инактивация гена recA в F.tularensis 15/10:

1. Приводит к подавлению гомологичной рекомбинации в F.tularensis 15/10ΔrecA.

2. Не приводит к изменению культуральных свойств.

3. Не приводит к изменению устойчивости к компонентам нормальной кроличьей сыворотки.

4. Приводит к снижению остаточной вирулентности для мышей.

5. Не приводит к изменению протективных свойств вакцинного штамма.

Таким образом, предлагаемое изобретение позволяет сохранить постоянство генома и протективные свойства вакцинного штамма.

1. Способ стабилизации вакцинного туляремийного штамма путем введения делеции гена recA в хромосомную ДНК F.tularensis 15/10 с помощью суицидной плазмиды pPVΔrecA, несущей участок хромосомы F.tularensis с делегированным геном recA, в результате аллельного обмена между модифицированным фрагментом ДНК с делегированным геном recA и гомологичной областью хромосомной ДНК вакцинного штамма.

2. Способ по п.1, где суицидная плазмида pPVΔrecA на основе плазмиды pUC19 содержит фрагменты ДНК с генами sacB, cat, mob и фрагмента хромосомной ДНК F.tularensis 15/10 с делецией recA гена.



 

Похожие патенты:
Изобретение относится к области биотехнологии и может быть использовано в микробиологической и пищевой промышленности для получения глюкоамилазы с целью дальнейшего ее применения для осахаривания (гидролиза) крахмалосодержащего сырья в спиртовой, хлебопекарной, крахмалопаточной и пивоваренной промышленности.
Изобретение относится к области биотехнологии и может быть использовано в микробиологической и пищевой промышленности для получения глюкоамилазы с целью дальнейшего ее применения для осахаривания (гидролиза) крахмалосодержащего сырья в спиртовой, хлебопекарной, крахмалопаточной и пивоваренной промышленности.
Изобретение относится к области биотехнологии и может быть использовано в микробиологической и пищевой промышленности для получения комплексных препаратов глюкоамилазы и ксиланазы с целью дальнейшего их применения для гидролиза крахмалосодержащего сырья в различных отраслях пищевой и перерабатывающей промышленности (спиртовой, хлебопекарной, пивоваренной, кондитерской промышленности, при производстве диетического питания, пищевых добавок, кормов для животных).
Изобретение относится к области биотехнологии и может быть использовано в микробиологической и пищевой промышленности для получения комплексных препаратов глюкоамилазы и ксиланазы с целью дальнейшего их применения для гидролиза крахмалосодержащего сырья в различных отраслях пищевой и перерабатывающей промышленности (спиртовой, хлебопекарной, пивоваренной, кондитерской промышленности, при производстве диетического питания, пищевых добавок, кормов для животных).

Изобретение относится к области биотехнологии и вирусологии. .

Изобретение относится к области биотехнологии, а именно к получению антимикробного пептида дефенсина чечевицы обыкновенной Lens culinaris, который может найти применение в качестве лекарственного средства в медицинской и ветеринарной практике, а также средства, повышающего устойчивость растений к инфекции в сельском хозяйстве.

Изобретение относится к биохимии. .

Изобретение относится к области биотехнологии и представляет собой выделенную нуклеиновую кислоту, включающую регуляторную последовательность РНК-полимеразы I собаки и содержащую (i) по меньшей мере 250, или по меньшей мере 350, или по меньшей мере 450 соприкасающихся нуклеотидов или всю нуклеотидную последовательность, представленную в виде последовательности SEQ ID NO:26, (ii) полинуклеотид, который по меньшей мере на 80% идентичен указанной выше нуклеотидной последовательности (i) или включает комплементарную или обратно комплементарную (i) или (ii) последовательность

Изобретение относится к области биотехнологии и представляет собой выделенную нуклеиновую кислоту, включающую регуляторную последовательность РНК-полимеразы I собаки и содержащую (i) по меньшей мере 250, или по меньшей мере 350, или по меньшей мере 450 соприкасающихся нуклеотидов или всю нуклеотидную последовательность, представленную в виде последовательности SEQ ID NO:26, (ii) полинуклеотид, который по меньшей мере на 80% идентичен указанной выше нуклеотидной последовательности (i) или включает комплементарную или обратно комплементарную (i) или (ii) последовательность

Изобретение относится к области биотехнологии, к защитным генам растений, кодирующим биологически активные пептиды с антифунгальной активностью

Изобретение относится к биохимии и представляет собой человеческое моноклональное антитело или его фрагмент, которые специфически связываются с GM-CSF приматов и нейтрализуют его

Изобретение относится к области биотехнологии и касается целлюлазных слитых белков

Изобретение относится к области биотехнологии и касается целлюлазных слитых белков

Изобретение относится к области биотехнологии и касается целлюлазных слитых белков
Наверх