Сорго, устойчивое к гербицидам, действующим на ацетил-коа карбоксилазу


 


Владельцы патента RU 2457674:

КАНЗАС СТЕЙТ ЮНИВЕРСИТИ РИСЕРЧ ФАУНДЕЙШН (US)

Изобретение относится к биотехнологии. Описан гибрид сорго, с зародышевой плазмой, придающей устойчивость к ингибированию одному или более действующим на ацетил-КоА карбоксилазу гербицидам. Раскрыт способ получения линии растения гибрида сорго, устойчивой к одному или более действующим на ацетил-КоА карбоксилазу гербицидам, включающий: идентификацию зародышевой плазмы, придающей устойчивость к гербициду, и введение зародышевой плазмы в элитную линию растения сорго путем введения гетерологичного гена. Также представлен способ идентификации линий растений сорго, устойчивых к гербицидам, действующим на ацетил-КоА карбоксилазу, включающий: получение образца нуклеиновой кислоты из растения сорго, предоставление амплификационных праймеров, применение их к образцу нуклеиновой кислоты участка гена ацетил-КоА карбоксилазы и идентификацию растений, устойчивых к действующим на ацетил-КоА карбоксилазу гербицидам, где устойчивость основана на наличии одной или более мутаций. Описано семя гибрида сорго, для выращивания растения сорго, устойчивого к одному или более действующим на ацетил-КоА карбоксилазу гербицидам. Изобретение позволяет получать устойчивые к гербицидам растения сорго. 4 н. и 6 з.п. ф-лы, 1 ил., 1 табл., 3 пр.

 

Настоящая заявка заявляет приоритет Предварительной Заявки Соединенных Штатов №60/880125 поданной 12 января 2007 года, включенной в настоящее описание посредством ссылки полностью.

ОБЛАСТЬ ТЕХНИКИ

Изобретение обеспечивает составы и способы для получения устойчивых к гербицидам сельскохозяйственных культур. В частности, настоящее изобретение относится к растениям сорго, растительным тканям и семенам, которые содержат гены и белки измененной ацетил-КоА карбоксилазы (АКК), устойчивой к ингибированию гербицидами, которые обычно ингибируют активность белка АКК.

УРОВЕНЬ ТЕХНИКИ

Сорго - это вторая по важности выращиваемая в Соединенных Штатах зерновая кормовая культура.

Производство экономически важно для ферм, работающих на периферии районов достаточного увлажнения, в связи со способностью сорго выдерживать засуху и высокую температуру. Животноводство и биоэнергетическая промышленность утилизируют сорго как энергетический субстрат, таким образом, делая его универсальной сельскохозяйственной культурой.

В мире сорго является пятой по значению зерновой культурой. В связи с толерантностью к засухе и высокой температуре оно является нетрудоемкой, наиболее широко выращиваемой пищевой зерновой культурой в полупустынных областях субсахелианской Африки и в сухой центральной части полуостровного региона Индии. Также сорго используется для употребления человеком в наиболее сухих областях мира, что делает его критически важной пищевой сельскохозяйственной культурой в этих местах.

Разработка устойчивости к гербицидам у растений дает значительные экономические и производственные преимущества; также использование гербицидов для контроля роста сорняков и растений в сельскохозяйственных культурах стало почти универсальной практикой. Однако использование таких гербицидов может также приводить к смерти или замедленному росту растений необходимой сельскохозяйственной культуры, что делает время и способ применения гербицида критическими или, в некоторых случаях, невыполнимыми.

Особый интерес для фермеров представляет использование гербицидов с большой эффективностью, широким спектром сорняков и с высокой скоростью деградации в почве. Растения, растительные ткани и семена с устойчивостью к этим химическим соединениям будут представлять собой привлекательное решение, т.к. позволят использовать гербициды для контроля роста сорняков без риска нанесения ущерба сельскохозяйственной культуре. Одним таким классом гербицидов широкого спектра являются химические соединения, которые ингибируют активность энзима ацетил-КоА карбоксилазы (АКК) в растениях. Такие гербициды принадлежат к семействам арилоксифеноксипропионатных (ФОП) и циклогександионовых (ДИМ) производных. Например, сорго восприимчиво к большинству ингибирующих АКК гербицидов, поражающих однодольные виды растений, делая почти невозможным использование этих гербицидов для контроля травяных сорняков. Было обнаружено, что некоторые виды травяных сорняков показывают измененную чувствительность к ФОП и ДИМ гербицидам. Один из видов травы, лисохвост мышехвостниковидный (A.myosuroides [Huds.]), является основным травяным сорняком в Европе. В геноме некоторых растений лисохвоста мышехвостниковидного было найдено несколько мутаций, которые придают устойчивость к некоторым, но не ко всем, ФОП и ДИМ гербицидам (Delye, et al., 2005, Plant Phys. 137:794-806; Delye, et al., 2002, Theor. Appl. Genet. 104:1114-1120). Подобные находки были обнаружены в мутантных травяных сорняках, таких как плевел жесткий (L.rigidum [Gaud.]; Delye, et al., 2002, Pest Manag. Sci. 58:474-478), щетинник зеленый (S.viridis [L.Beauv.]; Zhang and Devine, 2000, Weed Sci. Soc. Am. 40:33; Delye, et al., 2002, Planta 214:421-427) и овсюг (A.fatua [L.]; Christoffers et al., 2002, Genome 45:1049-1056). Один устойчивый к гербицидам гибрид кукурузы (DK592 фирмы Декалб (Dekalb)) имеет мутацию в энзиме АКК, подобную тем, что были найдены в травяных сорняках (Zagnitko et al., 2001, Proc. Natl. Acad. Sci. 98:6617-22).

Из-за важности в мировом масштабе сорго как сельскохозяйственной культуры необходимы гибриды сорго, являющиеся устойчивыми к ингибиторным эффектам АКК-гербицидов, что позволило бы увеличить урожайность при использовании этих гербицидов для контроля травяных сорняков.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение обеспечивает составы и способы для получения культивируемых культур сорго, устойчивых к гербицидам. В частности, настоящее изобретение относится к растениям сорго, растительным тканям и семенам, которые содержат гены и белки измененной ацетил-КоА карбоксилазы (АКК), устойчивой к ингибированию гербицидами, которые обычно ингибируют активность белка АКК.

Культивируемое сорго [Sorghum bicolor (L.) Moench] восприимчиво ко многим ингибирующим АКК гербицидам, которые поражают однодольные растения или травяные виды сорняков. Однако, как описано в настоящем описании, был найден генотип сорго, который показал толерантность к ингибирующим АКК гербицидам. Генетический анализ идентифицировал в зародышевой плазме сорго дикого типа генетические различия, которые в результате дают фенотип устойчивости к АКК гербицидам.

В одном воплощении, данное изобретение относится к одному или более растению сорго, чья зародышевая плазма несет мутацию, которая приводит к устойчивости растения к АКК гербицидам. Кроме того, в дальнейших воплощениях изобретение имеет отношение к потомкам (например, F1, F2, F3 и т.д.) гибридов указанных растений, в которых зародышевая плазма указанных потомков имеет такую же мутацию, как и в родительском растении. Следовательно, воплощения данного изобретения предусматриваются для гибридов сорго, чья зародышевая плазма содержит мутацию, которая определяет, что фенотипом растений является устойчивость к АКК гербицидам. В некоторых воплощениях, указанные потомки (например, F1, F2, F3 и т.д.) являются результатом скрещивания между элитными линиями сорго, по меньшей мере, одна из которых содержит в зародышевой плазме мутацию, которая дает толерантность к АКК гербицидам.

В одном воплощении, настоящее изобретение обеспечивает гибриды сорго, в которых указанная зародышевая плазма придает сопротивляемость к ингибированию одним или более действующим на ацетил-КоА карбоксилазу гербицидом на уровнях, на которых указанные один или более гербицид в норме ингибирует рост гибридов сорго. В некоторых воплощениях, указанный один или более действующий на ацетил-КоА карбоксилазу гербицид является представителем семейств арилоксифеноксипропионатных (ФОП) и циклогександионовых (ДИМ) производных. В некоторых воплощениях, указанная зародышевая плазма гибридов сорго, которая придает сопротивляемость к ингибированию одним или более действующим на ацетил-КоА карбоксилу гербицидом, содержит в себе одну или более мутацию в гене ацетил-КоА карбоксилазы, как установлено в ATCC No. PTA-8033 или как установлено в ATCC No. PYA-8034.

В одном воплощении, настоящее изобретение обеспечивает способ контроля сорняков вблизи гибридов сорго, который включает: предоставление одного или более действующего на ацетил-КоА карбоксилазу гербицида; применение указанного одного или более действующего на ацетил-КоА гербицида на поле с гибридом сорго и контроля сорняков в непосредственной близости от указанного гибрида сорго так, чтобы применение указанного одного или более гербицида отрицательно сказывалось на росте сорняков, а рост указанного гибрида сорго не был отрицательно затронут. В некоторых воплощениях, указанный один или более действующий на ацетил-КоА карбоксилазу гербицид является представителем арилоксифеноксипропионат (ФОП) и циклогександион (ДИМ) химических семейств. В некоторых воплощениях, указанный гибрид сорго содержит в себе одну или более мутацию в гене ацетил-КоА карбоксилазы, как установлено в ATCC No. PTA-8033 или ATCC No. PYA-8034.

В одном воплощении настоящего изобретения обеспечивается гибрид сорго, который содержит зародышевую плазму, содержащую одну или более мутацию в гене ацетил-КоА карбоксилазы, такую, что устойчивость к одному или более действующему на ацетил-КоА гербициду придается указанному гибриду. В некоторых воплощениях, указанный гибрид сорго создан с помощью интрогрессии зародышевой плазмы сорго, которая содержит указанную одну или более мутацию для придания устойчивости к одному или более действующему на ацетил-КоА карбоксилазу гербициду. В некоторых воплощениях указанный гибрид сорго создан путем вставки гетерологичного гена, содержащего одну или более мутаций для придания сопротивляемости к одному или более действующему на ацетил-КоА карбоксилазу гербициду.

В одном воплощении, настоящее изобретение обеспечивает способ для получения растительной линии гибрида сорго устойчивой к одному или более действующему на ацетил-КоА карбоксилазу гербициду, содержащую идентифицированную зародышевую плазму, придающую указанную устойчивость к гербициду, в которой указанная устойчивая к гербициду зародышевая плазма получается из устойчивого к гербициду растения сорго и указанная зародышевая плазма вводится в элитную растительную линию сорго. В некоторых воплощениях, указанное введение указанной зародышевой плазмы в указанную элитную растительную линию сорго проводится путем интрогрессии. В некоторых воплощениях, указанное введение указанной зародышевой плазмы в указанную элитную растительную линию сорго проводится путем введения гетерологичного гена.

В одном воплощении настоящее изобретение предусматривает гибрид сорго, в котором зародышевая плазма указанного гибрида придает устойчивость к одному или более действующему на ацетил-КоА каробоксилазу гербициду и устойчивость к одному или более химическому соединению, принадлежащему к одной или более группе гербицидов, которая не является ингибитором ацетил-коА карбоксилазы. В одном воплощении, настоящее изобретение предусматривает для идентификации растительных линий сорго, устойчивых к гербицидам, действующим на ацетил-КоА карбоксилазу, способ, включающий в себя получение образца нуклеиновой кислоты из растения сорго; включающий в себя амплификационные праймеры для амплификации участка гена, соответствующего гену ацетил-КоА карбоксилазы в указанном образце нуклеиновой кислоты; включающий в себя применение указанных амплификационных праймеров к указанному образцу нуклеиновой кислоты так, чтобы произошла амплификация указанного участка гена указанной ацетил-КоА карбоксилазы, и включающий в себя идентификацию растений сорго, устойчивых к гербицидам, действующим на ацетил-КоА карбоксилазу, основанную на наличии одной или более мутации соответствующей устойчивости к действующим на ацетил-КоА карбоксилазу гербицидам в указанном образце нуклеиновой кислоты.

В одном воплощении настоящее изобретение относится к семенам сорго, в которых указанная зародышевая плазма указанных семян включает мутантный ген ацетил-КоА карбоксилазы так, чтобы указанная мутация придавала устойчивость к ингибированию гербицидами, действующими на ацетил-КоА карбоксилазу. В некоторых воплощениях зародышевая плазма указанных семян сорго содержит мутантный ген ацетил-КоА карбоксилазы, как установлено в ATCC No PTA-8033 или ATCC No. PYA-8034. В некоторых воплощениях, настоящее изобретение относится к растениям сорго, которые выращиваются из указанных семян и производных частей растений, содержащихся в указанных растениях сорго, выращенных из указанных семян. В некоторых воплощениях мутантная форма гена ацетил-КоА карбоксилазы является функциональным фрагментом гена, как установлено в ATCC No. PTA-8033 или ATCC No. PYA-8034, при этом фрагмент гена кодирует фрагмент белка, который является достаточным, чтобы придать растениям сорго устойчивость к ингибированию гербицидами, действующим на ацетил-КоА карбоксилазу. В некоторых воплощениях, настоящее изобретение относится к растениям сорго, которые выращиваются из указанных семян и производных частей растений, содержащихся в указанных растениях сорго, выращенных из указанных семян. В некоторых воплощениях, настоящее изобретение относится к гибриду сорго, содержащему ген, который гомологичен по меньшей мере на 70%, гомологичен по меньшей мере на 80%, гомологичен по меньшей мере на 85%, гомологичен по меньшей мере на 90%, гомологичен по меньшей мере на 95%, гомологичен по меньшей мере на 97% и гомологичен по меньшей мере на 99% гену ацетил-КоА карбоксилазы, как установлено в ATCC No. PTA-8033 или ATCC No. PYA-8034. В некоторых воплощениях, ген устойчивости к гербицидам, действующим на ацетил-КоА карбоксилазу, гомологичен по меньшей мере на 70%, гомологичен по меньшей мере на 80%, гомологичен по меньшей мере на 85%, гомологичен по меньшей мере на 90%, гомологичен по меньшей мере на 95%, гомологичен по меньшей мере на 97% и гомологичен по меньшей мере на 99% последовательности нуклеотидов SEQ ID NO:1, как установлено в ATCC No. PTA-8033 и/или ATCC No. PYA-8034, содержащую одну или более аминокислотную замену, например Trp2027Cys в SEQ ID NO: 1. В одном воплощении, настоящее изобретение далее относится к растениям гибрида сорго, которые имеют все физиологические и морфологические характеристики указанных растений, выращенных из указанных семян сорго. В дальнейших воплощениях, настоящее изобретение относится к культурам тканей и восстановленным культурам тканей, полученным из указанных семян сорго или частей указанных растений сорго, содержащих мутацию в указанном гене ацетил-КоА карбоксилазы, как установлено в ATCC No. PTA-8033 или ATCC No. PYA-8034.

В одном воплощении, настоящее изобретение обеспечивает способ получения семян сорго, включающий в себя скрещивание растений, содержащих мутантную форму гена ацетил-КоА карбоксилазы, как установлено в ATCC No. PTA-8033 или ATCC No. PYA-8034, с самими собой или со вторым растением сорго и включающий в себя сбор указанных семян указанных скрещиваний. В некоторых воплощениях, способ для получения указанных семян включает в себя посадку родительской семенной линии сорго, а именно указанной родительской семенной линии, содержащей зародышевую плазму, которая придает устойчивость к действующим на ацетил-КоА карбоксилазу гербицидам, и родительской линии сорго-опылителя, при этом зародышевая плазма указанного опылителя и/или семенной линии содержит зародышевую плазму, придающую устойчивость к действующим на ацетил-КоА карбоксилазу гербицидам; включает в себя совместное выращивание указанных родительских семенных и опылительных растений сорго, позволяющее указанным родительским семенным растениям сорго быть опыленными указанными родительскими растениями-опылителями; и включает в себя сбор семян, являющихся результатом указанного опыления.

КРАТКОЕ ОПИСАНИЕ ЧЕРТЕЖЕЙ

На фиг.1 показана мутация триптофана (TGG) в цистеин (TGC) в АКК гене сорго, которая ассоциирована с устойчивостью к АКК-гербицидам.

ОПРЕДЕЛЕНИЯ

Использованные в настоящем описании термины «разнообразие» и «культурный сорт растения» имеют отношение к растениям, которые определены выражением характеристик, следующих из данного генотипа или комбинации генотипов, отличающихся от любого другого типа группировки растений по выражению как минимум одной характеристики и рассматривающихся как единица относительно их пригодности для распространения в неизменном виде.

Использованный в настоящем описании термин «гибрид» относится к потомку или потомству генетически различных растений-родителей или к стоку, произведенному в результате контролируемого перекрестного опыления, в противоположность негибридному семени, произведенному в результате естественного опыления.

Использованный в настоящем описании термин «потомство» относится к поколениям растения, в которых происхождение поколения может быть прослежено обратно к указанному растению.

Использованный в настоящем описании термин «производное» устойчивого к гербициду растения включает как потомство этого устойчивого к гербициду растения, так и любое мутантное, рекомбинантное или генетически сконструированное производное этого растения как того же вида, так и других видов, в которое был перенесен признак(и) устойчивости к гербициду от исходного устойчивого к гербициду растения к производному растению.

Использованный в настоящем описании термин «растительная ткань» включает дифференцированные и недифференцированные ткани растений, включая те, что присутствуют как в корнях, побегах, листьях, пыльце, семенах и опухолях, так и в культуре (например, единичные клетки, протопласты, эмбрионы, каллус и т.д.). Растительная ткань может быть в растениях, в органной культуре, тканевой культуре или в клеточной культуре. Использованный в настоящем описании термин «часть растения» относится к структуре растения или растительной ткани, например пыльца, яйцеклетка, ткань, кожура, семя и клетка. В некоторых воплощениях настоящего изобретения трансгенные растения являются растениями, выращиваемыми в пищу.

Использованные в настоящем описании термины «сельскохозяйственная культура» и «растение, выращиваемое в пищу» использованы в их самом широком смысле. Термин включает в качестве неограничивающих примеров любой вид растений, съедобный для людей, или используемый в качестве корма для животных, рыбы или морских животных, или потребляемый людьми, или используемый для обозрения людьми, или любое растение, используемое в промышленности, или в торговле, или в образовании. Использованные в настоящем описании термины «поколение F» и «дочернее поколение» относятся к любому из последовательных поколений растений, клеток, тканей или организмов, полученных после скрещивания с участием обоих родителей. Поколение, получившееся в результате бипарентного скрещивания (т.е. с участием двух родителей), является по отношению к семени и его растению первым поколением гибридов (обозначаемое как «F1» и «F1»), а поколение, получившееся в результате скрещивания отдельных представителей поколения F1, является по отношению к семени и его растению вторым поколением гибридов (обозначаемое как «F2» или «F2»). Например, семя поколения F2 и выросшее из него растение получены путем самоопыления или перекрестного опыления поколения F1, а более поздние поколения получены путем самоопыления или перекрестного опыления непосредственно предшествующего поколения.

Использованный в настоящем описании термин «зародышевая плазма» относится к любому генетическому материалу растений, который содержит функциональные единицы наследственности.

Использованный в настоящем описании термин «элитная зародышевая плазма» в отношении растений относится к наследственному материалу с доказанным наследственным превосходством.

Использованный в настоящем описании термин «элитное растение» относится к растению, которое было получено выведением и селекцией для наилучшей агрономической продуктивности. Использованный в настоящем описании термин «признак» относится к наблюдаемой и/или измеряемой характеристике организма. Например, настоящее изобретение описывает растения, которые устойчивы к ФОП и ДИМ гербицидам.

Использованные в настоящем описании термины «маркер», «ДНК маркер» и «молекулярный маркер» по отношению к «селективному маркеру» относятся к физиологическому или морфологическому признаку, который может быть определен как маркер для его собственной селекции или для селекции других признаков, близко связанных с маркером. Например, таким маркером может быть ген или признак, ассоциированный с гербицидной толерантностью, включающий в качестве неограничивающих примеров повторы с простой структурой (simple sequence repeat-SSR), однонуклеотидные полиморфизмы (single nucleotide polymorphism-SNP), генетические вставки и/или делеции и т.п.

Использованные в настоящем описании термины «интрогрессировать», «интрогрессирование» и «интрогрессия» относятся к традиционной (т.е. классической) технике размножения опылением для вставки инородного генетического материала в линию производителей. Например, настоящее изобретение предоставляет для растений сорго интрогрессирование мутантным геном АКК устойчивости к гербициду путем скрещивания двух генераций растений.

Использованный в настоящем описании термин «дикий тип», примененный по отношению к гену, относится к функциональному гену, который является общим для популяции растений. Функциональный ген дикого типа - это тот, который наиболее часто наблюдается в популяции и, таким образом, произвольно определяет «нормальную» форму гена или форму «дикого типа». Использованные в настоящем описании термины «модифицированный», или «мутант», или «функциональный мутант» в применении по отношению к гену или продукту гена относятся, соответственно, к гену или продукту гена, которые демонстрируют изменения в последовательности и/или в функциональных свойствах (например, измененные характеристики) по сравнению с геном или продуктом гена дикого типа. Таким образом, термины «модифицированный» или «мутант», когда используются по отношению к нуклеотидной последовательности, относятся к последовательности нуклеиновой кислоты, которая отличается на один или более нуклеотидов от другой, обычно родственной последовательности нуклеиновой кислоты, а термин «функциональный мутант», когда используется по отношению к полипептиду, кодируемому указанной «модифицированной» или «мутантной» нуклеиновой кислотой, относится к белку или полипептиду, сохраняющему активность. В настоящем применении, мутантный АКК белок «или функциональный мутант» появляется вследствие сохранения АКК геном естественной активности для создания необходимых аминокислот.

Кроме того, «модифицированная» нуклеотидная последовательность интерпретируется на основе вырожденного генетического кода, что известно специалистам в данной области. Например, генетический код является вырожденным, так как существуют примеры, когда разные кодоны кодируют одну и ту же аминокислоту; также существуют примеры, когда в генетическом коде некоторые аминокислоты могут быть закодированы более чем одним кодоном каждая. Предполагается, что настоящее изобретение может заключать в себе такую вырожденность (например, в гибриде сорго содержится ген АКК, который гомологичен по меньшей мере на 70%, гомологичен по меньшей мере на 80%, гомологичен по меньшей мере на 85%, гомологичен по меньшей мере на 90%, гомологичен по меньшей мере на 95%, гомологичен по меньшей мере на 97% и гомологичен по меньшей мере на 99% последовательности нуклеотидов SEQ ID NO:1), основываясь, например, на зародышевой плазме сорго. Использованный в настоящем описании термин «гетерологичный», использованный в отношении гена, относится к гену, с которым были произведены манипуляции каким-либо способом.

Использованные в настоящем описании термины «часть» или «функциональный фрагмент», когда используются в отношении белка (как, например, «фрагмент данного белка», «фрагмент белка», «часть белка»), относятся к фрагментам этого белка. Фрагменты могут различаться по размеру в диапазоне от 4 аминокислот до полной аминокислотной последовательности минус одна аминокислота. В настоящем изобретении фрагмент белка является главным образом функциональным, так чтобы фрагмент белка придавал данному растению сопротивляемость к ингибированию АКК-гербицидами.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Ацетил-КоА карбоксилаза (АКК) является биотинилированным энзимом, который катализирует карбоксилирование ацетил-КоА для получения малонил-КоА. Это карбоксилирование является двухступенчатой, обратимой реакцией, состоящей из АТФ-зависимого карбоксилирования биотиновой группы на карбоксильном домене-переносчике с помощью биотин-карбоксилазной активности и последующего переноса карбоксильной группы с биотина на ацетил-КоА с помощью карбоксил-трансферазной активности (Nikolau et al., 2003, Arch. Biocehm. Biophys. 414:211-22). В растениях ацетил-КоА карбоксилаза является не только ключевым энзимом для биосинтеза жирных кислот, процесса, идущего в хлоропластах и митохондриях, но также АКК играет важную роль в образовании длинноцепочечных жирных кислот и флавоноидов, а также играет роль в малонилировании, происходящем в цитоплазме. Существует 2 изоформы АКК, и АКК хлоропластов ответственна более чем за 80% общей активности АКК (Herbert et al., 1996, Biochem. J. 318:997-1006). Арилоксифеноксипропионат (ФОП) и циклогександион (ДИМ) - это два класса химических веществ, которые, как известно, выборочно ингибируют хлоропластную форму АКК в травах (Rendina et al., 1990, J. Agric. Food Chem. 38: 1282-1287).

Семена из 83 диких популяций сорго из Боливии были высажены и оценены на предмет переносимости гербицидов, действующих на АКК. Один из диких генотипов сорго, Bol-71, проявлял высокий уровень переносимости к каждому тестируемому гербициду. В настоящем описании продемонстрировано, что скрещивание дикого сорго Bol-71 с растительной линией элитного родительского сорго дает хороший набор семян и устойчивость к АКК гербицидам в F1 гибридах. Например, семена из скрещивания Bol-71 и ATx623, обозначенные как KSU 06GHATx623xl74 (Fl потомство), были депонированы в ATCC, как описано в настоящем описании.

По существу, одно воплощение настоящего изобретения обеспечивает зародышевую плазму сорго, которая содержит измененные гены и белки АКК. В некоторых воплощениях, настоящее изобретение предусматривает использование АКК-гербицидов на полях выращиваемого в пищу гибридного сорго для уменьшения количества однодольных сорняков, присутствующих на указанных сельскохозяйственных угодьях, когда зародышевая плазма указанного гибрида сорго содержит измененный энзим АКК, который придает сопротивляемость к АКК-гербицидам, а указанные сорняки являются чувствительными к АКК-гербицидам.

В одном воплощении, настоящее изобретение предусматривает зародышевую плазму сорго, которая придает устойчивость к ингибированию АКК-гербицидами, отдельно или совместно с другими признаками устойчивости, например устойчивость к насекомым против огневки Chilo partellus (Girijashankar et al., 2005, Plant Cell Rep. 24:513-522, включено в настоящее описание полностью). В некоторых воплощениях, например, гибрид сорго, чья зародышевая плазма содержит синтетический ген cryl Ac из Bacillus thuringiensis (Bt), интрогрессируется в линию сорго, чья зародышевая плазма придает устойчивость к АКК-гербицидам. Также включение устойчивости к АКК-гербицидам и устойчивости к насекомым достигается с помощью трансгенеза в тот же самый гибрид сорго. Разбирающийся в данной области специалист распознает различные способы, описанные в настоящем документе, которые применимы для включения двух или более атрибутов устойчивости в один и тот же гибрид сорго.

В одном воплощении, настоящее изобретение предусматривает включение устойчивости к АКК-гербицидам в растениях сорго, содержащейся, например, в толерантной к АКК-гербицидам зародышевой плазме, обозначаемой как KSU 06GH701-715bk или KSU 06GHATx623x714 и депонированной под номерами доступа ATCC PTA-8033 и PYA-8034, соответственно, в элитные разновидности сорго путем селекции и отбора, тем самым обеспечивая создание устойчивых к гербицидам сельскохозяйственных культур гибридов сорго, которые будут выдерживать использование ингибирующих АКК гербицидов для контроля роста сорняков. Размещение этого признака переносимости гербицидов в указанные гибриды позволяет использование этих гербицидов для контроля однодольных сорняков, которые растут вместе с этими сельскохозяйственными культурами. В некоторых воплощениях, введение зародышевой плазмы с устойчивостью к АКК-гербицидам в элитные линии проводится с помощью интрогрессии или с помощью классических способов размножения. В некоторых воплощениях, введение гена устойчивости к АКК-гербицидам в элитные линии проводится методом трансгенеза гетерологичного гена. В некоторых воплощениях, изобретение предоставляет гибрид сорго, у которого, по меньшей мере, один предок гибрида сорго содержит ген устойчивости к АКК-гербицидам из зародышевой плазмы KSU 06GH701-715bk или KSU 06GHATx623x714, депонированной под номерами доступа ATCC PTA-8033 и PYA-8034, соответственно. В некоторых воплощениях, ген устойчивости к АКК-гербицидам гомологичен по меньшей мере на 70%, гомологичен по меньшей мере на 80%, гомологичен по меньшей мере на 85%, гомологичен по меньшей мере на 90%, гомологичен по меньшей мере на 95%, гомологичен по меньшей мере на 97% и гомологичен по меньшей мере на 99% гену устойчивости к АКК-гербицидам, найденному в зародышевой плазме 06GH701-715bk или KSU 06GHATx623x714. В некоторых воплощениях, ген устойчивости к АКК-гербицидам гомологичен по меньшей мере на 70%, гомологичен по меньшей мере на 80%, гомологичен по меньшей мере на 85%, гомологичен по меньшей мере на 90%, гомологичен по меньшей мере на 95%, гомологичен по меньшей мере на 97% и гомологичен по меньшей мере на 99% гену устойчивости к АКК-гербицидам, найденному в зародышевой плазме 06GH701-715bk или KSU 06GHATx623x714, включая аминокислотную замену.

В некоторых воплощениях, зародышевая плазма, устойчивая к АКК-гербицидам, интрогрессирована в элитную линию сорго с помощью классических способов размножения. Примеры классических способов размножения сорго могут быть найдены, например, в книге Sleper and Poehlman, 2006, Breeding Field Crops, Fifth Edition, Blackwell Publishing, в которой они полностью описаны. В одном воплощении, зародышевая плазма с устойчивостью к АКК-гербицидам интрогрессируется в сорго, используемое для употребления в пищу человеком. В некоторых воплощениях, зародышевая плазма с устойчивостью к АКК-гербицидам интрогрессируется в кормовое сорго для домашнего скота (например, для птицы, крупного рогатого скота, свиней, овец и т.д.). В некоторых воплощениях, зародышевая плазма, устойчивая к АСС гербицидам, интрогрессируется в сорго, используемое в промышленных процессах, таких как производство этанола. В одном воплощении, ген устойчивости к АКК-гербицидам вводится в геном растения путем трансгенеза с помощью векторов и методов, известных в данной области. В некоторых воплощениях, настоящее изобретение предоставляет устойчивую к АКК-гербицидам зародышевую плазму частей растений сорго линий Bol-71 и Atx623, у которых семя указанных растений сорго депонировано в ATCC под номерами доступа PTA-8033 и PYA-8034, соответственно, а указанная часть растения сорго является одной или более из перечисленных: пыльцой, яйцеклеткой, тканью, плодом, семенем и клеткой. В одном воплощении, настоящее изобретение предоставляет гибриды поколения F1, чья зародышевая плазма содержит ген устойчивости к АКК-гербицидам, как описано в настоящем описании. В некоторых воплощениях, F1-гибриды являются результатом скрещивания между двумя элитными линиями сорго, по меньшей мере, одна из которых содержит ген устойчивости к АКК-гербицидам, как описано в настоящем описании.

В одном воплощении, настоящее изобретение предоставляет способы для контроля сорняков на полях с сельскохозяйственной культурой гибридного сорго. В некоторых воплощениях, контроль сорняков заключает в себе применение АКК-гербицидов на указанных полях растений сорго так, чтобы рост сорняков подавлялся, а рост сорго не был затронут неблагоприятными последствиями. В некоторых воплощениях, применяемый АКК-гербицид принадлежит к арилоксифеноксипропионатному (ФОП) семейству гербицидов, включая в качестве неограничивающих примеров: клодинафоп-пропаргил (clodinafop-propargyl), цигалофоп-бутил (cyhalofop-butyl), диклофоп-метил (diclofop-methyl), феноксапроп-p-этил (fenoxaprop-p-ethyl), флуазифоп-b-бутил (fluazifop-b-butyl), галоксифоп-этоксиэтил (haloxyfop-ethoxyethyl), галоксифоп-этотил (haloxyfop-etotyl), галоксифоп-R-метил (haloxyfop-R-methyl), пропаквизафоп (propaquizafop), квизалофоп-p-этил (quizalofop-p-ethyl) и квизало-P-рефурил (quizalo-P-refuryl). В некоторых воплощениях, применяемый АКК-гербицид принадлежит к циклогександионовому (ДИМ) семейству гербицидов, включая в качестве неограничивающих примеров: аллоксидим (alloxydim), бутроксидим (butroxydim), клефоксидим (clefoxydim), клетодим (clethodim), циклоксидим (cycloxydim), профоксидим (profoxydim), сетоксидим (sethoxydim), тепралоксидим (tepraloxydim) и тралкоксидим (tralkoxydim). В некоторых воплощениях, применяемый АКК-гербицид состоит из комбинации химических соединений из обоих ФОП и ДИМ семейств АКК-гербицидов, как раскрыто в настоящем описании. Тем не менее, нынешнее применение не ограничивается уже используемыми АКК-гербицидами и квалифицированный специалист по достоинству оценит новый АКК-гербицид, открытый в любой будущий момент времени и ингибирующий энзим АКК.

В одном воплощении, настоящее изобретение относится к гибридам сорго (например, F1, F2, F3, F4 и т.д.), чья зародышевая плазма придает устойчивость к АКК-гербицидам и устойчивость к одному или более дополнительным гербицидам из принадлежащих к одной или более различным группам гербицидов. Например, дополнительные группы гербицидов, используемые для ингибирования роста сорняков, включают в качестве неограничивающих примеров ингибиторы синтеза липидов (например, арилоксифеноксипропионаты (aryloxyphenoxypropionates), циклогексанодеионы (cyclohexanodeiones), бензофураны (benzofuranes), хлорокарбоновые кислоты (chloro-carbonic acids), фосфородитиоаты (phosphorodithioates), тиокарбаматы (thiocarbamates)), ингибиторы фотосинтеза фотосистемы II (например, фенил-карбаматы (phenyl-carbamates), пиридазиноны (pyridazinones), триазины (triazines), триазиноны (triazinones), триазолиноны (triazolinones), урацилы (uracils), амиды (amides), мочевины (ureas), бензотиадиазиноны (benzothiadiazinones), нитрилы (nitriles), фенил-пиридины (phenyl-pyridines)), ингибиторы фотосинтеза фотосистемы I (например, бипиридилиумы (bipyridyliums)), ингибиторы протопорфириноген оксидазы (например, дифенилэфиры (diphenylethers), N-фенилфталимиды (N-phenylphthalimides), оксадиазолы (oxadiazoles), оксизолидиндионы (oxyzolidinediones), фенилпиразолы (phenylpyrazoles), пиримидиндионы (pyrimidindiones), тиадиазолы (thiadiazoles)), ингибиторы биосинтеза каротиноидов (например, пиридазиноны (pyridazinones), пиридинкарбоксамиды (pyridinecarboxamides), изоксазолидиноны (isoxazolidinones), триазолы (triazoles)), ингибиторы 4-гидрксифенил-пируват-диоксигеназы (например, каллистемоны (callistemones), изоксазолы (isoxazoles), пиразолы (pyrazoles), трикетоны (triketones)), ингибиторы ЕПШП синтазы (например, глицины (glycines)), ингибиторы глутамин синтазы (например, фосфиновые кислоты (phosphinic acids)), ингибиторы дигидроптероат синтазы (например, карбаматы), ингибиторы сборки микротрубочек (например, бензамиды (benzamides), бензойные кислоты (benzoic acids), динитроанилины (dinitroanilines), фосфороамидаты (phosphoroamidates), пиридины (pyridines)), ингибиторы клеточного деления (например, ацетамиды (acetamides), хлороацетамиды (chloroacetamides), оксиацетамиды (oxyacetamides)), ингибиторы синтеза клеточной стенки (например, нитрилы (nitriles), триазолокарбоксамиды (triazolocarboxamides)) и ингибиторы транспорта ауксина (например, фталаматы (phthalamates), семикарбазоны (semicarbazones)). В некоторых воплощениях, настоящее изобретение предоставляет F1 гибриды из элитных линий сорго, которые содержат устойчивость к одному или более АКК-гербицидам отдельно или вместе с устойчивостью к гербицидам из одной или более указанных групп гербицидов.

В одном воплощении настоящее изобретение обеспечивает использование трансгена, содержащего гетерологичный ген, такой как ген, кодирующий мутантный белок АКК, для того, чтобы обеспечить селективный агрономический признак устойчивости к АКК-гербицидам. В одном воплощении, трансген содержит мутантную форму гена АКК, найденного в зародышевой плазме KSU 06GH701-715bk или KSU 06GHATx623x714, депонированной под номерами доступа ATCC PTA-8033 и PYA-8034, соответственно. В некоторых воплощениях трансген гомологичен по меньшей мере на 70%, гомологичен по меньшей мере на 80%, гомологичен по меньшей мере на 85%, гомологичен по меньшей мере на 90%, гомологичен по меньшей мере на 95%, гомологичен по меньшей мере на 97% и гомологичен по меньшей мере на 99% гену устойчивости к АКК-гербицидам, найденному в зародышевой плазме 06GH701-715bk или KSU 06GHATx623x714 (например, SEQ ID NO: 1). В некоторых воплощениях, ген устойчивости к АКК-гербицидам гомологичен по меньшей мере на 70%, гомологичен по меньшей мере на 80%, гомологичен по меньшей мере на 85%, гомологичен по меньшей мере на 90%, гомологичен по меньшей мере на 95%, гомологичен по меньшей мере на 97% и гомологичен по меньшей мере на 99% гену устойчивости к АКК-гербицидам, найденному в зародышевой плазме 06GH701-715bk или KSU 06GHATx623x714, включая аминокислотную замену Trp2027Cys.

Классическое разведение сорго

Полевые культуры классически были выведены на основе подходов, которые использовали преимущества метода(ов) опыления растений. Растение считается "самоопыляющимся", если пыльца из одного цветка может быть перенесена на этот же или другой цветок, а как "перекрестноопыляемые" рассматривается те растения, у которых для того, чтобы опыление могло произойти, пыльца должна быть перенесена с цветка на другом растении.

Растения, которые самоопылялись и отбирались в течении многих поколений, становятся гомозиготными по большинству, если не по всем, генным локусам, таким образом, продуцируя однородную популяцию истинного племенного потомства. Скрещивание между двумя гомозиготными растениями разного происхождения или между двумя разными гомозиготными линиями будет давать однородную популяцию гибридных растений, которые более чем вероятно будут гомозиготными в большом количестве генных локусов. Скрещивание двух растений, каждое из которых является гетерозиготным по большому количеству генных локусов, будет давать поколение гибридных растений, которые генетически различны и не являются однородными.

Растения сорго являются самоопыляющимися растениями, но их также можно разводить перекрестным опылением. Разработка гибридов сорго требует разработки родителей-опылителей (восстановителей плодородия) и семенных инбредных родителей с помощью системы мужской стерильности - восстановления фертильности; требует скрещивания семенных родителей и родителей-опылителей, а также требует оценки результатов скрещивания. Программа чистопородного разведения объединяет желаемые признаки; в настоящей заявке желаемым признаком является устойчивость растения к АКК-гербицидам. Этот признак помещается в пул разведения, состоящий из одной или более линии, так что новые инбредные линии создаются путем скрещивания и последующим отбором растений с желаемым признаком, последующими дополнительными скрещиваниями и т.д. Новые инбредные особи скрещиваются с другими инбредными линиями (например, с элитными растительными линиями, как описано в настоящем описании).

Элитное разведение начинается со скрещивания двух генотипов, таких как Bol-71, и элитной линии сорго (например, Tx430, 00MN7645, BTx623, ATx623, Wheatland, Tx3042, OKI 1, QL41 и Tx643, Tx2737, Tx2783 и HP162). Например, родитель дикого типа Bol-71 скрещивался с элитными родительскими линиями сорго, включая Tx430, 00MN7645, BTx623 и ATx623. Если двое исходных родителей не обеспечивают все желаемые свойства, то другие источники могут быть включены в популяцию для разведения. Например, если необходим гибрид с устойчивостью к АКК-гербицидам и с устойчивостью к другой группе гербицидов, то могут быть скрещены с помощью классических способов разведения растения с обоими этими атрибутами. В племенном методе, наилучшие растения самоопыляются и отбираются в последующих поколениях. В последующих поколениях, гетерозиготное состояние замещается гомозиготной линией в результате самоопыления и отбора. Обычно в племенном методе осуществляется пять или более циклов самоопыления и отбора (например, Sl, S2, S3, S4, S5 и т.д.).

Обратное скрещивание используется для улучшения растительной линии. Обратное скрещивание переносит специфический желаемый признак из одного источника в другой, который нуждается в данном признаке. Это достигается, например, скрещиванием донора (например, Bol-71) с инбредной линией (например, с элитной линией, как описано в настоящем описании). Потомство этого скрещивания затем скрещивается обратно (т.е. проводится обратное скрещивание) с элитной инбредной линией, с последующим отбором в получившемся потомстве желаемого признака (например, устойчивости к АКК-гербицидам). После пяти или более поколений обратного скрещивания с отбором желаемого признака потомство становится типично гетерозиготным по локусу, контролирующему желаемый фенотип, но будет походить на элитного родителя по другим генетическим признакам. Последнее обратное скрещивание обычно скрещивается с собой для того, чтобы создать чистое племенное потомство для передачи гена.

В текущих программах разведения гибридов сорго, новые родительские линии разрабатываются, чтобы быть или семенными родительскими линиями (например, Wheatland, Tx3042, OKI 1, QL41 и Tx643), или линиями родителей-опылителей (например, Tx430, Tx2737, Tx2783, 00MN7645 и HP162) в зависимости от того, содержат ли они гены восстановления фертильности; семенные родительские линии не имеют генов восстановления фертильности и обладают мужской стерильностью в определенных цитоплазмах (также известные как растения "А" линии) и обладают мужской фертильностью в других цитоплазмах (также известные как растения "B" линии), тогда как линии родителей-опылителей не обладают мужской стерильностью и содержат гены восстановления фертильности (также известные как растения "R" линии). Семенные родительские линии обычно создаются так, чтобы обладать цитоплазматической мужской стерильностью и чтобы пыльники в этих растениях были либо минимального размера, либо отсутствовали вообще и, следовательно, требовалось перекрестное опыление. Семенные родительские линии будут производить только семя, и цитоплазма переносится только через яйцеклетку. Пыльца для перекрестного опыления предоставляется линиями родителей-опылителей, которые содержат гены, необходимые для полного восстановления фертильности в гибридах F1, и скрещивание объединяется с обладающим мужской стерильностью семенным родителем для получения высокоурожайного простого гибрида с хорошим качеством зерна. Обычно, эта система цитоплазматической стерильности/восстановления фертильности используется для получения гибридного семени путем высаживания блоков грядок с растениями с мужской стерильностью (семенными родителями) и блоков грядок с растениями восстановителями фертильности (родителями-опылителями), так чтобы растения семенных родителей опылялись ветром пыльцой с растения родителя-опылителя. Этот процесс дает мощный простой гибрид, который собирается и выращивается потребителем. Обладающие мужской стерильностью растения семенных родителей могут быть также созданы с помощью генетической селекции в определенной популяции рецессивных ядерных генов мужской стерильности, однако цитоплазматическая система мужской стерильности-восстановления фертильности является основной системой, используемой при выведении гибрида сорго. Sleper and Poehlman, 2006, Breeding Field Crops, Fifth Ed., Blackwell Publishing, предлагают хороший обзор современных процедур по выведению сорго, что включено в настоящее описание полностью.

Настоящее изобретение не ограничивается перечисленными элитными родительскими линиями сорго, и разбирающийся в данной области поймет, что любая линия элитного сорго была бы равно пригодна для составов и способов, описанных в настоящем описании.

ТРАНСГЕНЕЗ РАСТЕНИЙ

Гетерологичные гены, предназначенные для экспрессии в растениях, вначале собираются в экспрессионных векторах, содержащих гетерологичный ген и соответствующие транскрипционные и трансляционные элементы, с помощью широко известных специалистам в данной области методов. Методы включают технологии рекомбинантных ДНК in vitro, синтетические технологии и генетическую рекомбинацию in vivo.

Типичные методы широко описаны для данной области (смотрите, например, Sambrook. et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y., и Ausubel, F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., перечисленное включено в настоящее описание посредством ссылки).

В общем, эти векторы содержат последовательность нуклеиновой кислоты, кодирующую гетерологичный ген, функционально связанную с промотором и другими регуляторными последовательностями (например, с энхансерами, сигналами полиаденилирования и т.п.), необходимыми для экспрессии в растении.

Промоторы включают в качестве неограничивающих примеров конститутивные промоторы, тканеспецифичные, органоспецифичные, связанные с развитием промоторы и индуцибельные промоторы. Примеры промоторов включают в качестве неограничивающих примеров конститутивный промотор 35S вируса мозаики цветной капусты, индуцируемый раной промотор лейцинаминопептидазы из помидоров (Chao et al., 1999, Plant Physiol 120:979-992, в настоящее описание включено посредством ссылки); химически индуцируемый "Pathogenesis-Related 1" промотор из табака (индуцируемый салициловой кислотой и S-метиловым эфиром бензотиадиазол-7-тиолкарбоновой кислоты (benzothiadiazole-7-carbothioic acid S-methyl ester)); промотор теплового шока (патент США №5187267, в настоящее описание включен посредством ссылки); тетрациклин-индуцируемый промотор (патент США №5057422, в настоящее описание включен посредством ссылки) и специфичные для семени промоторы.

Экспрессионные кассеты в дальнейшем могут содержать любые последовательности, необходимые для экспрессии мРНК. Такие последовательности включают в качестве неограничивающих примеров транскрипционные терминаторы, энхансеры, такие как интроны, вирусные последовательности и последовательности, предназначенные для направления генного продукта в специфичные органеллы и клеточные компартменты. Для использования в экспрессии последовательностей с помощью промоторов доступно множество транскрипционных терминаторов, что раскрыто в настоящем описании. Транскрипционные терминаторы ответственны за терминацию транскрипции в конце транскрипта и за его корректное полиаденилирование. Подходящие транскрипционные терминаторы и те, которые, как известно, функционируют в растениях, включают в качестве неограничивающих примеров CaMV 35 S терминатор, tml терминатор, rbcS E9 терминатор гороха и терминатор нопалин и октопин синтазы (Odell et al., 1985, Nature 313:810; Rosenberg et al., 1987, Gene, 56:125; Guerineau et al., 1991, Mol. Gen. Genet. 262: 141; Proudfoot, 1991, Cell, 64:671; Sanfacon et al., 1990, Genes Dev. 5:141; Mogen et al., 1990, Plant Cell, 2:1261; Munroe et al., 1990, Gene, 91:151; Ballas et al., 1989, Nucleic Acids Res. 17:7891; Joshi et al, 1987, Nucleic Acid Res., 15:9627, все перечисленное включено в настоящее описание посредством ссылки).

В некоторых воплощениях, конструкты для экспрессии гетерологичного целевого гена включают одну или более последовательностей, способных усиливать генную экспрессию внутри транскрипционной единицы. Эти последовательности могут быть использованы совместно с представляющей интерес последовательностью нуклеиновой кислоты для увеличения экспрессии в растениях. Было показано, что различные последовательности интронов способны усиливать экспрессию, особенно в клетках однодольных. Последовательности интронов обычно включались в векторы для трансформации растений, обычно внутри нетранслируемой лидерной последовательности.

В некоторых воплощениях, конструкт для экспрессии представляющей интерес гетерологичной последовательности нуклеиновой кислоты также включает регулятор, такой как сигнал ядерной локализации (Kalderon et al., 1984, Cell 39:499; Lassner et al., 1991, Plant Molecular Biology 17:229), такой как трансляционная консенсусная последовательность растений (Joshi, 1987, Nucleic Acids Research 15:6643), такой как интрон (Luehrsen and Walbot, 1991, Mol. Gen. Genet. 225:81) и т.п., функционально связанный с последовательностью нуклеиновой кислоты, кодирующей гетерологичный ген. При подготовке конструкта, содержащего последовательность нуклеиновой кислоты, кодирующей гетерологичный ген или кодирующей последовательность, разработанную для уменьшения экспрессии гетерологичного гена, могут быть использованы различные фрагменты ДНК для того, чтобы получить последовательность ДНК в желаемой ориентации (например, в смысловой или антисмысловой ориентации) и, при необходимости, в желаемой рамке считывания. Например, адаптеры и линкеры могут быть использованы для соединения фрагментов ДНК, или другие манипуляции могут быть использованы для получения подходящих сайтов рестрикции, удаления лишней ДНК, удаления рестрикционных сайтов и т.п. Для этой цели предпочтительно используются мутагенез in vitro, достройка праймерами, рестрикция, отжиг, резекция, лигирование и т.п., что связано с вставками, делециями и заменами (например, с транзициями и трансверсиями).

Для трансформации растений доступны многочисленные векторы для трансформации. Выбор вектора для использования будет зависеть от предпочитаемого метода трансформации и от целевого для трансформации вида. Для определенных целевых видов предпочтительны различные маркеры отбора на антибиотиках и гербицидах. Регулярно используемые в трансформации маркеры отбора включают ген nptll, который придает устойчивость к канамицину и подобным ему антибиотикам (Messing and Vierra, 1982, Gene 19: 259; Bevan et al., 1983, Nature 304: 184, все перечисленное включено в настоящее описание посредством ссылки), ген bar, который придает устойчивость к гербициду фосфинотрицину (White et al., 1990. Nucl Acids Res. 18:1062; Spencer et al., 1990, Theor. Appl. Genet. 79:625, все перечисленное включено в настоящее описание посредством ссылки), ген hph, который придает устойчивость к антибиотику гигромицину (Blochlinger and Diggelmann, 1984, Mol. Cell. Biol. 4:2929, включено в настоящее описание посредством ссылки), и ген dhfr, который придает устойчивость к метотрексату (Bourouis et al., 1983, EMBO J., 2:1099, включено в настоящее описание посредством ссылки). В некоторых воплощениях, Ti (T-ДНК) плазмидный вектор адаптируется для использования в опосредуемом агробактериями трансфекционном процессе так, как это описано в патенте США 6369298 (Сорго) и в патентах США 5981839, 6051757, 5981840, 5824877 и 4940838, все перечисленное включено в настоящее описание посредством ссылки во всей полноте. Создание рекомбинантных Ti и Ri плазмид в целом следует методам, обычно используемым с более распространенными векторами, такими как pBR322. Дополнительно можно использовать вспомогательные генетические элементы, иногда идущие вместе с нативной плазмидой, а иногда собираемые из инородных последовательностей. Это может включать в качестве неограничивающего примера структурные гены для устойчивости к антибиотикам в качестве селективных генов.

Сейчас используется две системы рекомбинантных Ti и Ri плазмидных векторов. Первая система называется "коинтегративной" системой. В этой системе челночный вектор содержит целевой ген, вставленный путем генетической рекомбинации в неопухолеродную Ti-плазмиду, которая содержит как cis-действующие, так и trans-действующие элементы, необходимые для трансформации растений, как, например, в векторе-переносчике pMLJl и неопухолеродной Ti-плазмиде pGV3850. Использование в конструкте T-ДНК в качестве фланкирующего участка для интеграции в Ti- или Ri-плазмиду описано в EPO №116718 и формах PCT №№ WO 84/02913, 02919 и 02920; Herrera-Estrella, 1983, Nature 303:209-213; Fraley et al., 1983, Proc. Natl. Acad. Sci, USA 80:4803-4807; Horsch et al., 1984, Science 223:496-498; и DeBlock et al., 1984, EMBO J. 3:1681-1689, все перечисленное включено в настоящее описание посредством ссылки. Вторая система называется "бинарной" системой, в которой используются две плазмиды и целевой ген вставлен в челночный вектор, содержащий cis-действующие элементы, необходимые для трансформации растений. Другие необходимые функции предоставлены "in trans" неопухолеродной Ti-плазмидой, примером чему могут служить челночный вектор pBIN19 и неопухолеродная Ti-плазмида PAL4404. Некоторые из этих векторов коммерчески доступны.

В некоторых воплощениях, целевая последовательность нуклеиновой кислоты направляется в определенный локус растительного генома. Сайт-направленная интеграция целевой последовательности нуклеиновой кислоты в геном растительной клетки может быть достигнута, например, гомологичной рекомбинацией с использованием последовательностей агробактерии dQ[eta]vQd. Как правило, растительные клетки инкубируются со штаммом агробактерии, содержащей целевой вектор, в котором последовательности, являющиеся гомологичными последовательности ДНК внутри целевового локуса, фланкированы последовательностями трансферной ДНК (Т-ДНК) агробактерии, как ранее описано в патенте США №5501967, включенном в настоящее описание посредством ссылки. Разбирающийся в данной области специалист знает, что гомологичная рекомбинация может быть достигнута с использованием целевых векторов, которые содержат последовательности, гомологичные к любой части целевого растительного гена либо принадлежащие к регуляторным элементам гена или кодирующего участка гена. Гомологичная рекомбинация может быть достигнута на любом участке растительного гена при условии, если известна последовательность нуклеиновой кислоты региона, фланкирующего целевой сайт. Agrobacterium tumefaciens - это распространенная почвенная бактерия, которая вызывает болезнь корончатых галлов путем переноса некоторой части своей ДНК в растение-хозяин. Переносимая ДНК (T-DNA - transferred DNA) стабильно интегрируется в растительный геном, где ее экспрессия приводит к синтезу растительных гормонов и, таким образом, к опухолевому росту клеток. Предполагаемый молекулярный комплекс формируется в процессе переноса Т-ДНК из бактериальной клетки в растительную клетку.

В некоторых воплощениях, для создания векторов используются нуклеиновые кислоты, полученные из (+)РНК-содержащих вирусов растений (например, вирус мозаики костра, вирус мозаики табака, вирус мозаики люцерны, вирус мозаики огурца, вирус мозаики томата, а также их комбинации и гибриды). В общем, вставленный гетерологичный полинуклеотид может быть экспрессирован с этих векторов как химерный белок (например, химерный белок оболочки) или с его собственного субгеномного промотора или другого промотора. Способы для конструирования и использование таких вирусов описаны в патентах США №№5846795; 5500360; 5173410; 5965794; 5977438; и 5866785, все перечисленное включено в настоящее описание посредством ссылки.

В некоторых воплощениях, гетерологичная последовательность нуклеиновой кислоты, содержащая мутантную форму трансгена АКК, например, найденную в зародышевой плазме, обозначенной как KSU 06GH701-715bk или KSU 06GHATx623x714, и депонированную под номерами доступа ATCC PTA-8033 и PYA-8034, соответственно, вводится непосредственно в растение. В некоторых воплощениях, трансген гомологичен по меньшей мере на 70%, гомологичен по меньшей мере на 80%, гомологичен по меньшей мере на 85%, гомологичен по меньшей мере на 90 %, гомологичен по меньшей мере на 95%, гомологичен по меньшей мере на 97% и гомологичен по меньшей мере на 99% гену устойчивости к АКК-гербицидам, найденному в зародышевой плазме 06GH701-715bk или KSU 06GHATx623x714 (например, SEQ ID NO: 1). В некоторых воплощениях, трансген гомологичен по меньшей мере на 70%, гомологичен по меньшей мере на 80%, гомологичен по меньшей мере на 85%, гомологичен по меньшей мере на 90%, гомологичен по меньшей мере на 95%, гомологичен по меньшей мере на 97% и гомологичен по меньшей мере на 99% гену устойчивости к АКК-гербицидам, найденному в зародышевой плазме 06GH701-715bk или KSU 06GHATx623x714, включая аминокислотную замену Trp2027Cys.

Одним из полезных векторов для способа прямого генного переноса в комбинации с селекцией на гербициде Баста (Basta) (или на фосфинотрицине (phosphinothricin)) является измененная версия плазмиды pCIB246, с промотором CaMV 35S в функциональном объединении с GUS геном E.coli и с транскрипционным терминатором CaMV 35S (WO 93/07278, в настоящее описание включено посредством ссылки). Как только последовательность нуклеиновой кислоты кодирующая гетерологичный ген функционально связывается с соответствующим промотором и вставляется в подходящий вектор для определенного используемого метода трансформации (например, в один из векторов, описанных выше), описанная выше рекомбинантная ДНК может быть введена в клетку растения множеством известных в данной области путей. Специалист в данной области поймет то, что выбор метода для трансформации зависит от типа целевого растения. В некоторых воплощениях, вектор поддерживается эписомально. В некоторых воплощениях, вектор интегрируется в геном. В некоторых воплощениях, прямая трансформация в геном пластиды используется для введения вектора в клетку растения (например, см. патенты США №№5451513; 5545817; 5545818; форму PCT WO 95/16783, все перечисленное в настоящее описание включено посредством ссылки во всей полноте). Основной метод для трансформации хлоропластов заключается во внесении в соответствующую целевую ткань участков клонированной пластидной ДНК, фланкирующей селективный маркер вместе с нуклеиновой кислотой, кодирующей целевые последовательности (например, с помощью биолистики или трансформации протопластов хлоридом кальция или ПЭГ). Фланкирующие участки размером от 1 т.п.о. до 1,5 т.п.о., названные целевыми последовательностями, облегчают гомологичную рекомбинацию с геномом пластиды и, таким образом, позволяют заменить или модифицировать специфический участок пластомы. Первоначально, точечные мутации в 16S рРНК хлоропластов и в гене rpsl2, придающие устойчивость к спектиномицину и/или стрептомицину, использовались как селективные маркеры для трансформации (Svab et al., 1990, Proc. Natl. Acad. Sci., 87:8526; Staub and Maliga, 1992, Plant Cell, 4:39, все перечисленное в настоящее описание включено посредством ссылки). Наличие сайтов клонирования между этими маркерами позволяет создание способа введения инородных молекул ДНК с помощью целевого пластидного вектора (Staub and Maliga, 1993, EMBO J., 12:601). Существенное увеличение в частоте трансформации достигается заменой рецессивной рРНК или r-белковых генов устойчивости к антибиотику на доминантный селективный меркер, бактериальный ген aadA, кодирующий спектиномицин-детоксифицирующий энзим аминогликозид-3'-аденилтрансферазу (Svab and Maliga, 1993, Proc. Natl. Acad. Sci., 90:913). Другие селективные маркеры, удобные для трансформации плазмид, известны в данной области и охвачены в рамках данного изобретения. Полученная растительная гомоплазма для геномов пластид, содержащая две последовательности нуклеиновых кислот, отделенных промотором данного изобретения, приспособлена к высокой экспрессии РНК, кодируемой молекулой ДНК.

В одном воплощении, векторы, полезные в практической реализации данного изобретения, вводятся микроинъекцией прямо в растительную клетку (Crossway, 1985, MoI. Gen. Genet, 202:179). В некоторых воплощениях, вектор переносится в растительную клетку с помощью полиэтиленгликоля (Krens et al., 1982, Nature, 296:72; Crossway et al., 1986, BioTechniques, 4:320); с помощью слияния протопластов с другими сущностями, такими как мини-клетки, клетки, лизосомы или другие растворимые, покрытые липидами тельца (Fraley et al., 1982, Proc. Natl. Acad. Sci., USA, 79: 1859); с помощью трансформации протопластов (EP 0292435); с помощью прямого генного переноса (Paszkowski et al., 1984, EMBO J., 3:2717; Hayashimoto et al., 1990, Plant Physiol. 93:857).

В некоторых воплощениях, вектор также может быть введен в растительные клетки с помощью электропорации (Fromm, et al., 1985, Proc. Natl Acad. Sci. USA 82:5824; Riggs et al., 1986, Proc. Natl. Acad. Sci. USA 83:5602). В этом методе, растительные протопласты электропорируются в присутствии плазмид, содержащих генный конструкт. Электрические импульсы с высокой напряженностью поля обратимо пермеабилизуют биомембраны, позволяя введение плазмид. Электропорированные растительные протопласты заново формируют клеточную стенку, затем делятся и формируют растительный каллус.

В дополнении к прямой трансформации, в некоторых воплощениях векторы, содержащие последовательность нуклеиновой кислоты, кодирующую гетерологичный ген, переносятся с помощью опосредованной агробактериями трансформации (Hinchee et al., 1988, Biotechnology, 6:915; Ishida et al., 1996, Nature Biotechnology 14:745, все перечисленное включено в настоящее описание посредством ссылки).

Агробактерия (Agrobacterium) - это репрезентативный род грамотрицательного семейства Rhizobiaceae. Его виды ответственны за образование растительных опухолей, таких как болезнь корончатых галлов и болезнь волосатых корней. В дедифференцированной ткани, характерной для опухолей, синтезируются и катаболизируются производные аминокислот, известные как опины. Бактериальные гены, ответственные за экспрессию опинов, являются удобным источником управляющих элементов для химерных экспрессионных кассет. Гетерологичные генетические последовательности (например, последовательности нуклеиновых кислот, функционально связанные с промотором настоящего изобретения) могут быть введены в соответствующие клетки растений посредством Ti-плазмиды Agrobacterium tumefaciens (ранее описанной). Ti-плазмида передается в растительные клетки с помощью заражения Agrobacterium tumefaciens и стабильно интегрируется в растительный геном (Schell, 1987, Science, 237: 1176). Восприимчивые к заражению агробактерией виды могут быть трансформированы in vitro. Методы трансформации для получения трансгенных растений сорго с помощью трансформации агробактериями штамма mQdiatQd обеспечиваются патентом США 6369298.

В некоторых воплощениях, вектор вводится с помощью баллистического ускорения частиц (патент США №4945050; Casas et al, 1993, Proc. Natl. Acad. Sci. USA 90:11212, все ссылки включены в настоящее описание полностью).

В некоторых воплощениях, цельные растения восстанавливаются после отбора трансформированного растительного материала, способного экспрессировать гетерологичный ген, кодирующий гетерологичный белок или его вариант. Восстановление растений из культивируемых протопластов описано в книгах Evans et al., Handbook of Plant Cell Cultures, Vol.1: MacMillan Publishing Co. New York, (1983); Vasil I. R. (ed.), Cell Culture and Somatic Cell Genetics of Plants, Acad. Press, Orlando, Vol.I, (1984) and Vol.III, (1986), все перечисленное включено в настоящее описание посредством ссылки во всей полноте. Известно, что многие растения могут быть восстановлены из культивируемых клеток или тканей, включая в качестве неограничивающих примеров все основные виды сахарного тростника, сахарной свеклы, хлопка, фруктовых и других деревьев, бобовых, овощей и однодольных растений (например, растений, описанных выше). Способы восстановления растений разнятся от вида к виду растений, но, в общем, сначала получают суспензию трансформированных протопластов, содержащих копии гетерологичного гена. Формируется каллусная ткань, а из каллуса могут быть получены побеги, которые в дальнейшем укореняются.

В качестве альтернативы может быть индуцировано формирование эмбриона из суспензии протопластов. Эти эмбрионы прорастают и формируют зрелое растение. Культуральная среда будет, как правило, содержать различные аминокислоты и гормоны, такие как ауксин и цитокинины. Побеги и корни обычно развиваются одновременно. Эффективное восстановление будет зависеть от среды, генотипа и истории культуры. Воспроизводимость восстановления зависит от контроля этих переменных. Следующие примеры предоставлены, чтобы продемонстрировать и далее иллюстрировать определенные привилегированные воплощения и аспекты настоящего изобретения и не должны быть рассмотрены как ограничение области его применения.

ПРИМЕРЫ

Пример 1 - Гербицидная устойчивость в генотипе дикого сорго

Семена из 83 диких популяций сорго из Боливии были высажены в теплице для сравнения с восприимчивым к гербицидам элитным генотипом сорго Tx2783. Дикие генотипы сорго были высажены на стеллажах, содержащих почву для горшечных культур MetroMix 360 (фирмы Sun Gro), и выращивались теплично. Tx2783 высаживался с дикими образцами на каждом стеллаже для сравнения. В одном способе отбора с помощью клетодима (clethodim), растения опрыскивались клетодимом в количестве 100,88 г действующего вещества на гектар (0,09 Ib ai /acre) на 18 день после посадки. Tx2783 и большая часть дикого сорго погибли, а толерантные к гербициду претенденты были пересажены в горшки для получения семян. В другом способе отбора с помощью флюазифопа-P (fluoazifop-P), стеллажи с Tx2783 с дикими образцами были опрысканы с нормой обработки 134,50 г действующего вещества флюазифопа-P на гектар (0,12 Ib ai/acre) на 18 день после посадки и 403,51 г действующего вещества флюазифопа-P на гектар (0,36 Ib ai /acre) на 32 день после посадки. Tx2783 и большая часть дикого сорго погибли, а толерантные к гербициду претенденты были пересажены в горшки для получения семян. В третьем эксперименте, растения были опрысканы с нормой обработки 56,04 г действующего вещества квизалофопа (quizalofop) на гектар (0,05 Ib ai/acre) на 18 день после посадки и 123,29 г действующего вещества квизалофопа на гектар (0,11 Ib ai/acre) на 32 день после посадки. Tx2783 и большая часть дикого сорго погибли, а толерантные к гербициду претенденты были пересажены в горшки для получения семян. Один из диких генотипов сорго, Bol-71, проявлял высокий уровень толерантности к каждому гербициду.

Пример 2 - Гибриды дикого генотипа сорго Bol-71 с элитными линиями сорго с определением наследственности

Bol-71 был скрещен с элитными родительскими линиями сорго, включая Tx430, 00MN7645, BTx623 и ATx623. Набор семян был превосходным в каждом скрещивании, демонстрируя то, что дикий генотип совместим в половом плане с культивируемым сорго и может быть использован программе выведения растений для получения вариетета толерантного к гербициду сорго.

Способ наследования толерантности к гербицидам был определен путем высаживания в теплице семян Bol-71, F1-поколения скрещивания ATx623xBol-71 и Pioneer 84G62 (восприимчивый к гербициду контроль) в стеллажах, содержащих почву для горшечных культур MetroMix 360, с использованием рандомизированного полноблочного плана (n=3). Растения опрыскивались в количестве 50,44 г действующего вещества флюазифопа-P (fluoazifop-P) на гектар (0,045 Ib ai/acre)<"> на 14 день после посадки. Pioneer 84G62 погибли между 12-16 днями после опрыскивания. Генотипы ATx623xBol-71 и Bol-71 показали отсутствие ущерба от гербицидов, демонстрируя то, что признак толерантности к гербицидам мог быть передан культивируемому сорго, и то, что толерантность к гербицидам по крайней мере частично была доминантной в F1 гибридах.

Пример 3 - Генное секвенирование АКК-устойчивости

Усилия по генному секвенированию были предприняты для определения генетической мутации, которая может объяснить фенотип гербицидной толерантности. ДНК экстрагировалась из толерантных к гербициду генотипов BoI-71 и R91 и из восприимчивых к гербициду генотипов Bol-36, ATx623 и Tx430. Для амплификации участков гена АКК, ассоциированных с выражением гербицидной толерантности, была использована полимеразная цепная реакция (ПЦР) с праймерами, описанными Delye and Michel (Weed Research, 2005, 45: 323-330; включено в настоящее описание полностью). Секвенирование ДНК (в центре секвенирования университета штата Канзас) получившихся в результате продуктов ПЦР толерантных и восприимчивых к гербицидам генотипов сорго показало, что восприимчивые генотипы содержат последовательность гена АКК дикого типа, как уже сообщалось для сорго (последовательность № TA3768_4558 базы совокупностей растительных транскриптов Института Геномных Исследований (TIGR), включено в настоящее описание полностью, смотрите также таблицу ниже) и для других видов зерновых культур; при этом толерантные к гербицидам генотипы содержат генетическую мутацию TGG->TGC, что приводит аминокислотной замене Trp2027Cys (SEQ ID NO: 1) в энзиме (фиг.1; смотрите Delye and Michel, Weed Research 2005, для выяснения нумерации аминокислот). Эта мутация является подобной той, что описана для толерантного к гербицидам лисохвоста мышехвостниковидного (Alopecurus myosuroides Huds.) (Delye et al., Plant Physiology 2005). Лисохвост мышехвостниковидный - разновидность сорняка, является единственным объектом в природе, для которого уже сообщалось об этой мутации, кроме того, ничего не сообщалось об этой мутации у сорго или для других видов сельскохозяйственных культур, или мутация не была описана как мишень для разработки гербицид-толерантных сельскохозяйственных культур.

Последовательность АКК карбоксилазы сорго (SEQ ID NO: 1)
TGGCAGAGCAAANCTTGGAGGAATTCCTGTGGGTGTCATAGCTGTGGAGACACAGAC CATGATGCAGCTTGTCCCTGCTGATCCAGGTCAGCTTGATTCCCATGAGCGATCCGT TCCTCGGGCTGGACAAGTGTGGTTCCCAGATTCTGCAACCAAGACAGCTCAGGCATT ATTAGACTTCAACCGTGAAGGATTGCCTCTGTTTATCCTGGCTAACTGGAGAGGTTT CTCTGGTGGACAGAGAGATCTCTTTGAAGGAATTCTTCAGGCTGGGTCAACAATTGT CGAGAACCTTAGGACATATAATCAGCCTGCGTTTGTCTACATTCCTATGGCTGGAGA GCTTCGTGGAGGAGCTTGGGTTGTGGTCGATAGCAAAATAAATCCAGACCGCATTGA GTGTTATGCTGAGAGGACTGCCAAAGGTAATGTTCTCGAACCTCAAGGGTTAATTGA AATCAAGTTCAGGTCAGAGGAACTCCAAGACTGTATGGGTAGGCTTGACCCCGAGTT GATAAATCTGAAAGCAAAACTCCAAGATGTAAAGCATGGAAATGGAAGTCTACCAGA CATAGAATCCCTTCAGAAGAGTATAGAAGCACGTACGAAACAGTTGCTGCCTTTATA TACCCAGATTGCAATACGGTTTGCTGAATTGCATGATACTTCCCTAAGAATGGCAGC TAAAGGCGTGATTAAGAAAGTTGTAGACTGGGAAGAATCACGCTCTTTCTTCTATAA
AAGGCTACGGAGAAGGATCTCTGAAGATGTTCTTGCAAAAGAAATAAGACATATAGT CGGTGACAACTTCACTCACCAATCAGCAATGGAGCTCATCAAGGAATGGTACCTGGC TTCTCCAGCCACAGCAGGAAGCACTGGATGGGATGACGATGATGCATTTGTTGCCTG GAAGGACAGTCCTGAAAACTACAATGGATATATCCAAGAGCTAAGGGCTCAAAAAGT GTCTCAGTCGCTCTCTGATCTCACTGACTCCAGTTCAGATCTACAAGCATTCTCGCA GGGTCTTTCTACGCTATTAGATAAGATGGATCCCTCTCAAAGAGCGAAGTTTGTTCA GGAAGTCAAGAAGGTCCTTGGTTGATGATATGATACCAACACATCCAACACTATGTG CATGCTACATGTTTTTGTTCAAGTACATACATAGAAGGATATTGCTTGGCCTCGTTT GCTTGGCCGTTTGATCATGTCTGATCTAAGTCGACCATTATTTGTTGAAACTTCCTT TTTGGACCTGGTGCTATGGTTGATGAATGTATATTGGACGTGTGCGACTGTGCGTTC TGCCAGGTGTAAGCTCAAATGTTTAGACAGACCGAGTTATGGTTAGGAAGAGCACGA GTGAACATGTTCTGGTTTTGCAGTGGTTCAGGAAGGCAGAAAGTTGTTTCACTGTAG TTCTGAGATGTACTACCAGCGGCCCCCTGCTGTAATTTTAGGGTGTATAATGCGGAT ACTAGTAAAACAATTGAGTGGTTCATTAAATTTTGAACTCGAATAATGTTTTTCTAG GCATATGTACCGTACCTCTACGTGAAATAAATGCTGTTGAAATAGCATTCGACACCA GAATATATGTACCTTACCTAAGAGCTAAGTATTATAATACAACAAGTTGCTGGCCGT AAGATTTCTTT

Все публикации и патенты, упомянутые в настоящем заявлении, включены в настоящее описание посредством ссылки. Различные модификации и вариации описанных способов и составов изобретения будут очевидны для разбирающегося в данной области специалиста без отхода от области и духа изобретения. Хотя изобретение описано в связи со специфическими предпочтительными воплощениями, нужно подразумевать, что изобретение, как заявлено, не должно быть чрезмерно ограничено такими определенными воплощениями. Более того, различные модификации описанных способов для осуществления изобретения, которые являются очевидными для специалиста в соответствующих областях, должны быть в рамках следующих требований.

1. Гибрид сорго, в котором зародышевая плазма указанного гибрида сорго придает устойчивость к ингибированию одним или более действующим на ацетил-КоА карбоксилазу гербицидам на уровнях, на которых указанный один или более гербицид в норме ингибирует рост гибридов сорго, где указанная зародышевая плазма указанного гибрида сорго, которая придает устойчивость к ингибированию одним или более действующим на ацетил-КоА карбоксилазу гербицидам, содержит последовательность SEQ ID NO: 1, которая дополнительно содержит нуклеотидное замещение гуанина на цитозин а положении 220.

2. Гибрид сорго по п.1, где указанный один или более действующий на ацетил-коА карбоксилазу гербицидов выбраны из группы, состоящей из арилфеноксипропионатов и циклогександионов.

3. Гибрид сорго по п.1 или 2, в котором указанная устойчивость к ингибированию одним или более действующим на ацетил-КоА карбоксилазу гербицидам вводится в указанную зародышевую плазму гибрида сорго с помощью интрогрессии.

4. Гибрид сорго по п.1, в котором семена, полученные от гибрида сорго, покрыты действующим на ацетил-КоА карбоксилазу гербицидом.

5. Гибрид сорго по п.2, где указанные действующие на ацетил-КоА карбоксилазу гербициды выбраны из группы, состоящей из клодинафоп-пропаргила, цигалофоп-бутила, диклофоп-метила, феноксапроп-р-этила, флуазифоп-b-бутила, галоксифоп-этоксиэтила, галоксифоп-этотила, галоксифоп-R-метила, пропаквизафопа, квизалофоп-р-этила, квизало-Р-рефурила аллоксидима, бутроксидима, клефоксидима, клетодима, циклоксидима, профоксидима, сетоксидима, тепралокидима, тралкоксидима и их комбинаций.

6. Способ получения линии растения гибрида сорго, устойчивой к одному или более действующему на ацетил-КоА карбоксилазу гербицидам, включающий:
а) идентификацию зародышевой плазмы, придающей указанную устойчивость к гербициду, в которой указанная устойчивая к гербициду зародышевая плазма получается из устойчивых к гербициду растений сорго по любому из пп.1-4 и
б) введение указанной зародышевой плазмы в элитную линию растения сорго путем введения гетерологичного гена.

7. Способ по п.6, в котором указанное введение указанной зародышевой плазмы в указанную элитную растительную линию сорго проводится путем интрогрессии.

8. Способ по п.6, в котором указанная устойчивая к гербициду зародышевая плазма содержит устойчивость к одному или более действующему на ацетил-КоА карбоксилазу гербицидам, а также устойчивость к одному или более химическим соединениям, принадлежащих к одной или более группе гербицидов, не являющейся действующими на ацетил-КоА карбоксилазу гербицидами.

9. Способ идентификации линий растений сорго, устойчивых к гербицидам, действующим на ацетил-КоА карбоксилазу, включающий:
а) получение образца нуклеиновой кислоты из растения сорго, где указанный образец нуклеиновой кислоты содержит последовательность SEQ ID NO: 1, которая дополнительно содержит нуклеотидное замещение гуанина на цитозин а положении 220,
б) предоставление амплификационных праймеров для амплификации участка растения сорго, соответствующего гену ацетил-КоА карбоксилазы, присутствующему в указанном образце нуклеиновой кислоты,
в) применение указанных амплификационных праймеров к указанному образцу нуклеиновой кислоты так, чтобы произошла амплификация указанного участка указанного гена ацетил-КоА карбоксилазы, и
г) идентификацию растений сорго, устойчивых к действующим на ацетил-КоА карбоксилазу гербицидам, основанной на наличии одной или более мутаций, придающих устойчивость к действующим на ацетил-КоА карбоксилазу гербицидам, в указанном амплифицированном образце нуклеиновой кислоты.

10. Семя гибрида сорго по любому из пп.1-4 для выращивания растения сорго, устойчивого к одному или более действующим на ацетил-КоА карбоксилазу гербицидам.



 

Похожие патенты:

Изобретение относится к сельскому хозяйству и может быть применено для защиты растений подсолнечника от болезней и повышения его урожайности. .

Изобретение относится к области сельского хозяйства и может быть применено для искусственного опыления растений. .

Изобретение относится к области сельского хозяйства, в частности к опылению растений в открытом грунте. .

Изобретение относится к области сельского хозяйства, в частности к средствам, способствующим опылению растений, произрастающих в открытом грунте. .

Изобретение относится к области сельского хозяйства и может быть применено для опыления растений. .

Изобретение относится к селекции растений и может быть использовано в сельском хозяйстве. .

Изобретение относится к области сельского хозяйства и, в частности, к селекции пшеницы. .

Изобретение относится к области биотехнологии и может быть использовано в сельском хозяйстве

Изобретение относится к биотехнологии и может быть использовано в сельском хозяйстве в области растениеводства на открытом грунте и в сооружениях защищенного грунта
Изобретение относится к области сельского хозяйства и селекции
Изобретение относится к области генетики и селекции и может быть использовано для индукции мутаций при создании исходного материала для селекции сельскохозяйственных культур

Изобретение относится к области сельского хозяйства, в частности к виноградарству
Изобретение относится к области сельского хозяйства и может быть использовано для оценки качества зерна генотипов ячменя пивоваренного направления

Изобретение относится к области биотехнологии

Изобретение относится к области физиологии и селекции растений

Изобретение относится к области сельского хозяйства, в частности к садоводству
Изобретение относится к области сельского хозяйства
Наверх