Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b



Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b
Способ предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина a2b

 


Владельцы патента RU 2457842:

ГАЙЛИД ПАЛО АЛЬТО, ИНК. (US)

Группа изобретений относится к области медицины. Способ лечения или предотвращения фиброза печени включает пероральное введение млекопитающему терапевтически эффективного количества антагониста рецептора аденозина А2B-3-этил-1-пропил-8-(1-{[3-(три фторметил) фенил] метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион. Способ снижения гепатотоксических побочных эффектов химиотерапии или лучевой терапии предусматривает пероральное введение млекопитающему, подвергающемуся такому лечению, терапевтически эффективного количества антагониста рецептора аденозина А2B-3-этил-1-пропил-8-(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион. Использование заявленной группы изобретений эффективно для предотвращения и лечения болезней печени. 13 з.п. ф-лы, 6 ил., 21 пр.

 

По настоящей заявке испрашивается приоритет на основании предварительной заявки на патент США № 60/783575, зарегистрированной 17 марта 2006 года, которая во всей полноте включена в описание посредством ссылки.

Область изобретения

Настоящее изобретение относится к способам предотвращения и лечения болезни печени с использованием антагонистов рецептора аденозина А. Данное изобретение находит применение в лечении и предотвращении поражения печени, вызванного злоупотреблением алкоголя, хирургическим вмешательством, вирусным гепатитом, приемом внутрь гепатотоксичных лекарственных средств, или других заболеваний печени. Изобретение также относится к фармацевтическим композициям, используемым в способе.

Уровень техники

Заболевание печени может быть различных видов, включающих, но не ограниченных ими, некроз, стеатоз, фиброз и холестаз. Другие виды заболевания печени могут являться результатом приема внутрь гепатотоксичных лекарственных средств, таких как химиотерапевтические и противораковые лекарственные средства, антибиотики, аналгезирующие средства, противорвотные средства и другие лекарственные препараты. Кроме того, хорошо известно, что злоупотребление алкоголем и лекарственными средствами также вызывает болезнь печени. Типичные причины, вызывающие заболевание печени, включают, но не ограничиваются ими, вирусный и алкогольный гепатит, болезнь Вильсона, гемохроматоз, стеатоз и неалкогольный стеатогепатит (NASH).

Фиброз печени является общим аспектом многих, если не всех, заболеваний печени и характеризуется образованием рубцовой ткани в печени. Рубцевание развивается в результате устранения печенью клеточного повреждения, вызванного приемом внутрь гепатотоксинов, вследствие хронического воспаления печени или вследствие физического повреждения. Фиброз печени также может возникать в результате хирургического вмешательства и гепатотоксичной лекарственной терапии, т.е. реплантации, или репарации, или химиотерапии печени. Во многих случаях фиброз печени вызывает необратимое рубцевание ткани печени, состояние, которое обычно называют циррозом печени.

Недавними исследованиями обнаружено, что аденозин принимает участие в развитии и прогрессировании фиброза печени. Исследователи Chunn et al. (2006) Am. J. Physiol. Lung Cell. Mol. Physiol, 290(3): L579-87, выявили повышенный фиброз печени у мышей с недостаточностью аденозиндезаминазы (ADA). Мыши, используемые Chunn et al., генетически модифицированы генно-инженерными методами таким образом, что у них проявляется частичная ферментативная активность ADA и, тем самым, накапливается аденозин в течение продолжительного периода времени.

Аденозин является природным нуклеозидом, который проявляет свои биологические эффекты путем взаимодействия с семейством аденозиновых рецепторов, известных как А1, А, А и А3, все из которых модулируют важные физиологические процессы. Было показано, что среди различных рецепторов аденозиновые рецепторы А модулируют синтез и высвобождение ангиогенных факторов и воспалительного цитокина и хемокинов и, как полагают, указанные рецепторы в большей степени вовлекаются в развитие воспалительных состояний посредством их участия в активации, вазодилятации и регуляции роста клеток (см. публикации Adenosine A2B Receptors as Therapeutic Targets, Drug Dev. Res. 45: 198; Feoktistov et al., Trends Pharmacol. Sci. 19: 148-153).

К удивлению, исследователями было обнаружено, что антагонисты аденозиновых рецепторов А являются также пригодными в предотвращении и лечении болезни печени. Таким образом, создание способа лечения и/или предотвращения болезни печени путем введения соединений, которые являются потенциальными, полностью или частично избирательными, антагонистами А, т.е. соединениями, которые ингибируют аденозиновые рецепторы А, является желательным.

Сущность изобретения

В одном варианте осуществления изобретения способ разработан для лечения и предотвращения болезни печени путем введения терапевтически эффективного количества антагониста рецепторов аденозина А нуждающемуся в этом млекопитающему. Болезнь печени может приобретать вид некроза, фиброза, холестаза, цирроза, вирусного и алкогольного гепатита, болезни Вильсона, гемохроматоза, стеатоза и неалкогольного стеатогепатита (NASH), или болезнь печени может быть результатом хирургического вмешательства или лекарственной терапии гепатотоксическим средством, т.е. реплантации, или репарации, или химиотерапии печени.

Во втором варианте осуществления изобретения способ разработан с целью уменьшения гепатотоксических побочных эффектов химиотерапии или лучевой терапии путем введения терапевтически эффективного количества антагониста аденозиновых рецепторов А млекопитающему, подвергающемуся такому лечению.

В другом варианте осуществления изобретения способ разработан для лечения и предотвращения болезни печени путем введения млекопитающему при необходимости терапевтически эффективного количества антагониста аденозиновых рецепторов А, имеющего структуру формулы I или формулы II:

Формула 1 Формула 2

где

R1 и R2 независимо выбраны из водорода, необязательно замещенного алкила или группы -D-E, в которой D является ковалентной связью или алкиленом и группа Е означает необязательно замещенный алкокси, необязательно замещенный циклоалкил, необязательно замещенный арил, необязательно замещенный гетероарил, необязательно замещенный гетероциклил, необязательно замещенный алкенил или необязательно замещенный алкинил при условии, что, когда D является ковалентной связью, Е не может быть алкокси;

R3 означает водород, необязательно замещенный алкил или необязательно замещенный циклоалкил;

Х означает необязательно замещенный арилен или необязательно замещенный гетероарилен;

Y является ковалентной связью или алкиленом, у которого один атом углерода может быть необязательно заменен на -О-, -S- или -NH-, и необязательно замещен гидрокси, алкокси, необязательно замещенным амино, или -COR, в котором R является гидрокси, алкокси или амино;

и

Z означает необязательно замещенный моноциклический арил или необязательно замещенный моноциклический гетероарил; или

Z является водородом, когда Х означает необязательно замещенный гетероарилен, и Y является ковалентной связью.

В другом варианте осуществления изобретения созданы фармацевтические препараты, включающие терапевтически эффективное количество антагониста аденозиновых рецепторов А и, по меньшей мере, один фармацевтически приемлемый носитель. Препарат предпочтительно предназначен для орального введения.

Одной предпочтительной группой соединений формулы I и II является группа, в которой R1 и R2 независимо означают водород, необязательно замещенный низший алкил или группу -D-E, в которой D является ковалентной связью или алкиленом и Е означает необязательно замещенный фенил, необязательно замещенный циклоалкил, необязательно замещенный алкенил или необязательно замещенный алкинил, особенно группа, в которой R3 является водородом.

В указанной выше группе первый предпочтительный класс соединений включает такие соединения, у которых R1 и R2 независимо означают низший алкил, необязательно замещенный циклоалкилом, предпочтительно н-пропил, и Х означает необязательно замещенный фенилен. В данном классе предпочтительным подклассом соединений является подкласс, в котором Y является алкиленом, включая алкилен, у которого атом углерода заменен кислородом, предпочтительно -О-СН2-, более предпочтительно, когда кислород является точкой соединения с фениленом. В данном подклассе предпочтительно, когда Z означает необязательно замещенный оксадиазол, особенно необязательно замещенный [1,2,4]-оксадиазол-3-ил, особенно [1,2,4]-оксадиазол-3-ил, замещенный необязательно замещенным фенилом или необязательно замещенным пиридилом.

Второй предпочтительный класс соединений включает такие cоединения, у которых Х означает необязательно замещенный 1,4-пиразолен. В данном классе предпочтительным подклассом соединений является подкласс, в котором Y является ковалентной связью или алкиленом, особенно низшим алкиленом, и Z означает водород, необязательно замещенный фенил, необязательно замещенный пиридил или необязательно замещенный оксадиазол. В данном подклассе один предпочтительный вариант осуществления изобретения включает соединения, у которых R1 является низшим алкилом, необязательно замещенным циклоалкилом, и R2 является водородом. Более предпочтительный вариант осуществления изобретения включает такие соединения, у которых Y означает -(СН2)- или -СН(СН3)- и Z означает необязательно замещенный фенил, или Y означает -(СН2)- или -СН(СН3)- и Z означает необязательно замещенный оксадиазол, особенно 3,5-[1,2,4]-оксадиазол, или Y означает -(СН2)- или -СН(СН3)- и Z означает необязательно замещенный пиридил. В данном подклассе также предпочтительными являются соединения, у которых R1 и R2 независимо означают низший алкил, необязательно замещенный циклоалкилом, особенно н-пропил. Более предпочтительными являются такие соединения, у которых Y является ковалентной связью, -(СН2)- или -СН(СН3)- и Z означает водород, необязательно замещенный фенил или необязательно замещенный пиридил, в частности соединения, где Y является ковалентной связью и Z является водородом.

Дополнительной подгруппой предпочтительных соединений является подгруппа, в которой R3 означает замещенную алкильную группу формулы -CHR4OR5, так что соединения имеют структуру формулы III:

где

R4 является водородом или метилом; и

R5 является -C(O)R, где R независимо означает необязательно замещенный низший алкил, необязательно замещенный арил или необязательно замещенный гетероарил; или

R5 является -P(O)(OR6)2, где R6 означает водород или низший алкил, необязательно замещенный фенилом или гетероарилом;

и их фармацевтически приемлемые соли.

В настоящее время предпочтительные соединения, используемые в изобретении, включают, но не ограничиваются ими, следующие соединения:

1-пропил-8-(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион;

1-пропил-8-[1-бензилпиразол-4-ил]-1,3,7-тригидропурин-2,6-дион;

1-бутил-8-(1-{[3-фторфенил]метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион;

1-пропил-8-[1-(фенилэтил)пиразол-4-ил]-1,3,7-тригидропурин-2,6-дион;

8-(1-{[5-(4-хлорфенил)-(1,2,4-оксадиазол-3-ил)]метил}пиразол-4-ил)-1-пропил-1,3,7-тригидропурин-2,6-дион;

8-(1-{[5-(4-хлорфенил)-(1,2,4-оксадиазол-3-ил)]метил}пиразол-4-ил)-1-бутил-1,3,7-тригидропурин-2,6-дион;

1,3-дипропил-8-пиразол-4-ил-1,3,7-тригидропурин-2,6-дион;

1-метил-3-втор-бутил-8-пиразол-4-ил-1,3,7-тригидропурин-2,6-дион;

1-циклопропилметил-3-метил-8-{1-[(3-трифторметилфенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

1,3-диметил-8-{1-[(3-фторфенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

3-метил-1-пропил-8-{1-[(3-трифторметилфенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

3-этил-1-пропил-8-{1-[(3-трифторметилфенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

1,3-дипропил-8-(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион;

1,3-дипропил-8-{1-[(3-фторфенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

1-этил-3-метил-8-{1-[(3-фторфенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

1,3-дипропил-8-{1-[(2-метоксифенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

1,3-дипропил-8-(1-{[3-(трифторметил)фенил]этил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион;

1,3-дипропил-8-{1-[(4-карбоксифенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

2-[4-(2,6-диоксо-1,3-дипропил-(1,3,7-тригидропурин-8-ил))пиразолил]-2-фенилуксусную кислоту;

8-{4-[5-(2-метоксифенил)-[1,2,4]оксадиазол-3-илметокси]фенил}-1,3-дипропил-1,3,7-тригидропурин-2,6-дион;

8-{4-[5-(3-метоксифенил)-[1,2,4]оксадиазол-3-илметокси]фенил}-1,3-дипропил-1,3,7-тригидропурин-2,6-дион;

8-{4-[5-(4-фторфенил)-[1,2,4]оксадиазол-3-илметокси]фенил}-1,3-дипропил-1,3,7-тригидропурин-2,6-дион;

1-(циклопропилметил)-8-[1-(2-пиридилметил)пиразол-4-ил]-1,3,7-тригидропурин-2,6-дион;

1-н-бутил-8-[1-(6-трифторметилпиридин-3-илметил)пиразол-4-ил]-1,3,7-тригидропурин-2,6-дион;

8-(1-{[3-(4-хлорфенил)-(1,2,4-оксадиазол-5-ил)]метил}пиразол-4-ил)-1,3-дипропил-1,3,7-тригидропурин-2,6-дион;

1,3-дипропил-8-[1-({5-[4-(трифторметил)фенил]изоксазол-3-ил}метил)пиразол-4-ил]-1,3,7-тригидропурин-2,6-дион;

1,3-дипропил-8-[1-(2-пиридилметил)пиразол-4-ил]-1,3,7-тригидропурин-2,6-дион;

3-{[4-(2,6-диоксо-1,3-дипропил-1,3,7-тригидропурин-8-ил)пиразолил]метил}бензойную кислоту;

1,3-дипропил-8-(1-{[6-(трифторметил)-(3-пиридил)метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион;

1,3-дипропил-8-{1-[(3-(1H-1,2,3,4-тетразол-5-ил)фенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

6-{[4-(2,6-диоксо-1,3-дипропил-1,3,7-тригидропурин-8-ил)пиразолил]метил}пиридин-2-карбоновую кислоту;

3-этил-1-пропил-8-[1-(2-пиридилметил)пиразол-4-ил]-1,3,7-тригидропурин-2,6-дион;

8-(1-{[5-(4-хлорфенил)изоксазол-3-ил]метил}пиразол-4-ил)-3-этил-1-пропил-1,3,7-тригидропурин-2,6-дион;

8-(1-{[3-(4-хлорфенил)-(1,2,4-оксадиазол-5-ил)]метил}пиразол-4-ил)-3-этил-1-пропил-1,3,7-тригидропурин-2,6-дион;

3-этил-1-пропил-8-(1-{[6-(трифторметил)-(3-пиридил)]метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион;

1-(циклопропилметил)-3-этил-8-(1-{[6-(трифторметил)-(3-пиридил)]метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион;

3-этил-1-(2-метилпропил)-8-(1-{[6-(трифторметил)-(3-пиридил)]метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион;

[3-этил-2,6-диоксо-1-пропил-8-(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)-1,3,7-тригидропурин-7-ил]метилацетат;

[3-этил-2,6-диоксо-1-пропил-8-(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)-1,3,7-тригидропурин-7-ил]метил 2,2-диметилпропаноат;

[3-этил-2,6-диоксо-1-пропил-8-(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)-1,3,7-тригидропурин-7-ил]метилбутаноат; и

[3-этил-2,6-диоксо-1-пропил-8-(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)-(1,3,7-тригидропурин-7-ил)]метилдигидрофосфат.

Краткое описание рисунков

Фигура 1 графически иллюстрирует уровни мРНК подтипов AdoR в HHSC. Тотальную РНК, выделенную из HHSC, подвергали ПЦР-анализу в режиме реального времени RT-PCR. Относительные уровни транскриптов AdoR представлены в виде процентов транскрипта β-актина. Данные представлены как средние величины ± SEM (n=4). Nd означает не определены.

На фигуре 2 представлены данные влияния агонистов и антагониста AdoR на накопление сАМР в HHSC. (A) Кривые зависимости концентрация-ответ CGS-21680 (CGS, кружочек) и NECA в отсутствие (квадрат) или присутствии (треугольник) антагониста рецептора А 8-(1-{[5-(4-хлорфенил)-(1,2,4-оксадиазол-3-ил)]метил}пиразол-4-ил)-1-пропил-1,3,7-тригидропурин-2,6-диона (соединение(1)) (1 мкМ). (В) Отсутствие влияния СРА (1 мкМ) и IB-MECA (IМ, 1 мкМ) на индуцированное форсколином (Fsk, 10 мкМ) накопление сАМР в клетке. Данные представлены как средние величины ± SEM (n=6 в А и n=5 в В).

На фигуре 3 графически изображено влияние аденозина (А) и NECA (B) на высвобождение IL-6 клетками HHSC. Клетки обрабатывали растворителем, аденозином и NECA в отсутствие или в присутствии соединения (1) в течение 24 ч. Среды от обработанных клеток собирали и концентрации IL-6 определяли, используя метод ELISA. Данные представлены как средние величины ± SEM (n=3). : р<0,05 по сравнению с контролем; #: р<0,05 по сравнению с клетками, обработанными NECA (10 мкМ) в В.

На фигуре 4 представлены данные влияния NECA на уровни мРНК α-актина гладких мышц (А) и α-1 проколлагена (В), определенного с использованием RT-PCR. HHSC инкубировали с NECA (10 мкМ) в течение 1 ч. Клетки, инкубированные с растворителем, использовали в качестве контроля. Уровни экспрессии мишеневой мРНК приводили к уровням β-актина. Данные представлены как средние величины ± SEM (n=4 в А, и n=5 в В). : р<0,05 по сравнению с контролем.

Фигура 5 иллюстрирует влияние NECA на продукцию коллагена клетками HHSC. Клетки обрабатывали растворителем, NECA в отсутствие или в присутствии соединения (1) или антитела против IL-6 в течение 24 ч. Среды от обработанных клеток собирали и концентрации коллагена определяли, используя анализ с Sirco1-пробой на коллаген. Данные представлены как средние величины ± SEM (n=4-6). : р<0,05 по сравнению с контролем; #: р<0,05 по сравнению с клетками, обработанными NECA (10 мкМ).

Фигура 6 иллюстрирует влияние антагониста рецептора А на уровни AST в плазме мышей ADA -⁄-. Плазму мыши собирали в EDTA и активность AST определяли, используя InfinityTM AST-анализ. Данные представлены как средние величины ± SEM (n=6-8). : р<0,05 по сравнению с мышами ADA +, обработанными растворителем (ADA+V); #: р<0,05 по сравнению с мышами ADA -⁄- , обработанными растворителем (ADA-⁄-V).

Подробное описание изобретения

Определения и общие параметры

Как используют в настоящем описании, следующие слова и фразы обычно предназначены иметь значения, изложенные ниже, кроме случаев, когда контекст, в котором их употребляют, указывает иное.

Термин “алкил” относится к монорадикальной разветвленной или неразветвленной насыщенной углеводородной цепи, имеющей 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 атомов углерода. Этот термин иллюстрируется группами, такими как метил, этил, н-пропил, изопропил, н-бутил, изобутил, трет-бутил, н-гексил, н-децил, тетрадецил и тому подобное.

Термин “замещенный алкил” относится к:

1) алкильной группе, как определено выше, имеющей 1, 2, 3, 4 или 5 заместителей, предпочтительно от 1 до 3 заместителей, выбранных из группы, состоящей из алкенила, алкинила, алкокси, циклоалкила, циклоалкенила, ацила, ациламино, ацилокси, амино, аминокарбонила, алкоксикарбониламино, азидо, циано, галогена, гидрокси, кето, тиокарбонила, карбокси, карбоксиалкила, арилтио, гетероарилтио, гетероциклилтио, тиола, алкилтио, арила, арилокси, гетероарила, аминосульфонила, аминокарбониламино, гетероарилокси, гетероциклила, гетероциклоокси, гидроксиамино, алкоксиамино, нитро, -SO-алкила, -SO-арила, -SO-гетероарила, -SO2-алкила, SO2-арила и -SO2-гетероарила. Если не ограничено определением, все заместители необязательно также могут быть замещены 1, 2 или 3 заместителями, выбранными из алкила, карбокси, карбоксиалкила, аминокарбонила, гидрокси, алкокси, галогена, CF3, амино, замещенного амино, циано и -S(O)nR, где R означает алкил, арил или гетероарил и n равно 0, 1 или 2; или

2) алкильной группе, как определено выше, углеводородная цепь которой прервана 1-10 атомами, независимо выбранными из кислорода, серы и NRa-, где Ra выбирают из водорода, алкила, циклоалкила, алкенила, циклоалкенила, алкинила, арила, гетероарила и гетероциклила. Все заместители могут быть необязательно замещены алкилом, алкокси, галогеном, CF3, амино, замещенным амино, циано или -S(O)nR, где R означает алкил, арил или гетероарил и n равно 0, 1 или 2; или

3) алкильной группе, как определено выше, которая имеет как 1, 2, 3, 4 или 5 заместителей, как определено выше, так и углеводородная цепь которой прервана 1-10 атомами, как определено выше.

Термин “низший алкил” относится к монорадикальной разветвленной или неразветвленной насыщенной углеводородной цепи, имеющей 1, 2, 3, 4, 5 или 6 атомов углерода. Этот термин иллюстрируется группами, такими как метил, этил, н-пропил, изопропил, н-бутил, изобутил, трет-бутил, н-гексил и тому подобное.

Термин “замещенный низший алкил” относится к низшему алкилу, как определено выше, имеющему от 1 до 5 заместителей, предпочтительно 1, 2 или 3 заместителя, как определено для замещенного алкила, или низшей алкильной группе, как определено выше, углеводородная цепь которой прервана 1, 2, 3, 4 или 5 атомами, как определено для замещенного алкила, или низшей алкильной группе, как определено выше, которая имеет 1, 2, 3, 4 или 5 заместителей, как определено выше, и также углеводородная цепь которой прервана 1, 2, 3, 4 или 5 атомами, как определено выше.

Термин “алкилен” относится к дирадикальной разветвленной или неразветвленной насыщенной углеводородной цепи, имеющей 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 атомов углерода, предпочтительно 1-10 атомов углерода, более предпочтительно 1, 2, 3, 4, 5 или 6 атомов углерода. Этот термин иллюстрируется группами, такими как метилен (-СН2-), этилен (-СН2-СН2-), изомеры пропилена (например, -СН2СН2СН2- и -СН(СН3)СН2-) и тому подобное.

Термин “низший алкилен” относится к дирадикальной разветвленной или неразветвленной насыщенной углеводородной цепи, предпочтительно имеющей 1, 2, 3, 4, 5 или 6 атомов углерода.

Термин “замещенный алкилен” относится к:

(1) алкиленовой группе, как определено выше, имеющей 1, 2, 3, 4 или 5 заместителей, выбранных из группы, состоящей из алкила, алкенила, алкинила, алкокси, циклоалкила, циклоалкенила, ацила, ациламино, ацилокси, амино, аминокарбонила, алкоксикарбониламино, азидо, циано, галогена, гидрокси, кето, тиокарбонила, карбокси, карбоксиалкила, арилтио, гетероарилтио, гетероциклилтио, тиола, алкилтио, арила, арилокси, гетероарила, аминосульфонила, аминокарбониламино, гетероарилокси, гетероциклила, гетероциклоокси, гидроксиамино, алкоксиамино, нитро, -SO-алкила, -SO-арила, -SO-гетероарила, -SO2-алкила, SO2-арила и -SO2-гетероарила. Если не ограничено определением, все заместители необязательно могут быть замещены 1, 2 или 3 заместителями, выбранными из алкила, карбокси, карбоксиалкила, аминокарбонила, гидрокси, алкокси, галогена, CF3, амино, замещенного амино, циано и -S(O)nR, где R означает алкил, арил или гетероарил и n равно 0, 1 или 2; или

(2) алкиленовой группе, как определено выше, углеводородная цепь которой прервана 1-20 атомами, независимо выбранными из кислорода, серы и NRa-, где Ra выбирают из водорода, необязательно замещенного алкила, циклоалкила, циклоалкенила, арила, гетероарила и гетероциклила, или групп, выбранных из карбонила, карбоксиэфира, карбоксиамида и сульфонила; или

(3) алкиленовой группе, как определено выше, которая имеет как 1, 2, 3, 4 или 5 заместителей, как определено выше, и углеводородная цепь которой также прервана 1-20 атомами, как определено выше. Примерами замещенных алкиленов являются хлорметилен (-СН(Cl)-), аминоэтилен (-CH(NH2)CH2-), метиламиноэтилен (-CH(NHMe)CH2-), изомеры 2-карбоксипропилена (-CH2CH(CO2H)CH2-), этоксиэтил (-CH2CH2O-CH2CH2-), этилметиламиноэтил (-CH2CH2N(CH3)CH2CH2-), 1-этокси-2-(2-этоксиэтокси)этан (-CH2CH2O-CH2CH2-OCH2CH2-OCH2CH2-) и тому подобное.

Термин “аралкил” относится к арильной группе, ковалентно связанной с алкиленовой группой, где арил и алкилен определены в описании выше. “Необязательно замещенный аралкил” относится к необязательно замещенной арильной группе, ковалентно связанной с необязательно замещенной алкиленовой группой. Такие аралкильные группы представлены бензилом, фенилэтилом, 3-(4-метоксифенил)пропилом и тому подобное.

Термин “алкокси” относится к группе R-O, где R означает необязательно замещенный алкил или необязательно замещенный циклоалкил или R является группой -Y-Z, в которой Y означает необязательно замещенный алкилен, и Z означает необязательно замещенный алкенил, необязательно замещенный алкинил; или необязательно замещенный циклоалкенил, где алкил, алкенил, алкинил, циклоалкил и циклоалкенил определены в описании выше. Предпочтительными алкоксигруппами являются необязательно замещенный алкил-О-, и они включают, в качестве примера, метокси, этокси, н-пропокси, изопропокси, н-бутокси, трет-бутокси, втор-бутокси, н-пентокси, н-гексокси, 1,2-диметилбутокси, трифторметокси и тому подобное.

Термин “алкилтио” относится к группе R-S, где R является группой, определенной для алкокси.

Термин “алкенил” относится к монорадикальной разветвленной или неразветвленной ненасыщенной углеводородной группе, предпочтительно имеющей от 2 до 20 атомов углерода, более предпочтительно от 2 до 10 атомов углерода и даже более предпочтительно от 2 до 6 атомов углерода, и имеющей 1-6, предпочтительно 1, двойную связь (винил). Предпочтительные алкенильные группы включают этенил или винил (-СН=СН2), 1-пропилен или аллил (-СН2СН=СН2), изопропилен (-С(СН3)=СН2), бицикло[2.2.2]гептен и тому подобное. В случае, когда алкенил соединен с атомом азота, двойная связь не может быть альфа относительно азота.

Термин “низший алкенил” относится к алкенильной группе, как определено выше, имеющей от 2 до 6 атомов углерода.

Термин “замещенный алкенил” относится к алкенильной группе, как определено выше, имеющей 1, 2, 3, 4 или 5 заместителей и предпочтительно 1, 2 или 3 заместителя, выбранные из группы, состоящей из алкила, алкенила, алкинила, алкокси, циклоалкила, циклоалкенила, ацила, ациламино, ацилокси, амино, аминокарбонила, алкоксикарбониламино, азидо, циано, галогена, гидрокси, кето, тиокарбонила, карбокси, карбоксиалкила, арилтио, гетероарилтио, гетероциклилтио, тиола, алкилтио, арила, арилокси, гетероарила, аминосульфонила, аминокарбониламино, гетероарилокси, гетероциклила, гетероциклоокси, гидроксиамино, алкоксиамино, нитро, -SO-алкила, -SO-арила, -SO-гетероарила, -SO2-алкила, SO2-арила и -SO2-гетероарила. Если не ограничено определением, все заместители могут необязательно быть замещены 1, 2 или 3 заместителями, выбранными из алкила, карбокси, карбоксиалкила, аминокарбонила, гидрокси, алкокси, галогена, CF3, амино, замещенного амино, циано и -S(O)nR, где R означает алкил, арил или гетероарил и n равно 0, 1 или 2.

Термин “алкинил” относится к монорадикалу ненасыщенного углеводорода, предпочтительно имеющего от 2 до 20 атомов углерода, более предпочтительно от 2 до 10 атомов углерода и даже более предпочтительно от 2 до 6 атомов углерода, и имеющему, по меньшей мере, 1 и предпочтительно 1-6 участков ненасыщенной ацетиленовой (тройной связь) связи. Предпочтительные алкинильные группы включают этинил (-СН=СН), пропаргил (или проп-1-ин-3-ил, -СН2С=СН) и тому подобное. В случае когда алкинил соединен с азотом, двойная связь не может быть альфа относительно азота.

Термин “замещенный алкинил” относится к алкинильной группе, как определено выше, имеющей 1, 2, 3, 4 или 5 заместителей и предпочтительно 1, 2 или 3 заместителя, выбранные из группы, состоящей из алкила, алкенила, алкинила, алкокси, циклоалкила, циклоалкенила, ацила, ациламино, ацилокси, амино, аминокарбонила, алкоксикарбониламино, азидо, циано, галогена, гидрокси, кето, тиокарбонила, карбокси, карбоксиалкила, арилтио, гетероарилтио, гетероциклилтио, тиола, алкилтио, арила, арилокси, гетероарила, аминосульфонила, аминокарбониламино, гетероарилокси, гетероциклила, гетероциклоокси, гидроксиамино, алкоксиамино, нитро, -SO-алкила, -SO-арила, -SO-гетероарила, -SO2-алкила, SO2-арила и -SO2-гетероарила. Если не ограничено определением, все заместители могут необязательно быть замещены 1, 2 или 3 заместителями, выбранными из алкила, карбокси, карбоксиалкила, аминокарбонила, гидрокси, алкокси, галогена, CF3, амино, замещенного амино, циано и -S(O)nR, где R означает алкил, арил или гетероарил и n равно 0, 1 или 2.

Термин “аминокарбонил” относится к группе -С(О)NRR, где каждая R-группа означает независимо водород, алкил, арил, гетероарил, гетероциклил или где обе R-группы соединены вместе с образованием гетероциклической группы (например, морфолино). Если не ограничено определением, все заместители могут быть необязательно замещены 1-3 заместителями, выбранными из алкила, карбокси, карбоксиалкила, аминокарбонила, гидрокси, алкокси, галогена, CF3, амино, замещенного амино, циано и -S(O)nR, где R означает алкил, арил или гетероарил и n равно 0, 1 или 2.

Термин “ациламино” относится к группе -NRC(O)R, где каждый R означает независимо водород, алкил, арил, гетероарил или гетероциклил. Если не ограничено определением, все заместители могут быть необязательно замещены 1-3 заместителями, выбранными из алкила, карбокси, карбоксиалкила, аминокарбонила, гидрокси, алкокси, галогена, CF3, амино, замещенного амино, циано и -S(O)nR, где R означает алкил, арил или гетероарил и n равно 0, 1 или 2.

Термин “ацилокси” относится к группам -О(О)С-алкил, -О(О)С-циклоалкил, -О(О)С-арил, -О(О)С-гетероарил и -О(О)С-гетероциклил. Если не ограничено определением, все заместители могут необязательно быть замещены алкилом, карбокси, карбоксиалкилом, аминокарбонилом, гидрокси, алкокси, галогеном, CF3, амино, замещенным амино, циано или -S(O)nR, где R означает алкил, арил или гетероарил и n равно 0, 1 или 2.

Термин “арил” относится к ароматической карбоциклической группе из 6-20 атомов углерода, включающей одно кольцо (например, фенил), или множество колец (например, бифенил), или множество конденсированных (слитых) колец (например, нафтил или антрил). Предпочтительные арилы включают фенил, нафтил и тому подобное.

Термин “арилен” относится к дирадикалу арильной группы, как определено выше. Данный термин иллюстрируется группами, такими как 1,4-фенилен, 1,3-фенилен, 1,2-фенилен, 1,4′-бифенилен и тому подобное.

Если не ограничено определением для арильного или ариленового заместителя, такие арильные или ариленовые группы могут необязательно быть замещены 1-5 заместителями, предпочтительно 1-3 заместителями, выбранными из группы, состоящей из алкила, алкенила, алкинила, алкокси, циклоалкила, циклоалкенила, ацила, ациламино, ацилокси, амино, аминокарбонила, алкоксикарбониламино, азидо, циано, галогена, гидрокси, кето, тиокарбонила, карбокси, карбоксиалкила, арилтио, гетероарилтио, гетероциклилтио, тиола, алкилтио, арила, арилокси, гетероарила, аминосульфонила, аминокарбониламино, гетероарилокси, гетероциклила, гетероциклоокси, гидроксиамино, алкоксиамино, нитро, -SO-алкила, -SO-арила, -SO-гетероарила, -SO2-алкила, SO2-арила и -SO2-гетероарила. Если не ограничено определением, все заместители могут необязательно быть замещены 1-3 заместителями, выбранными из алкила, карбокси, карбоксиалкила, аминокарбонила, гидрокси, алкокси, галогена, CF3, амино, замещенного амино, циано и -S(O)nR, где R означает алкил, арил или гетероарил и n равно 0, 1 или 2.

Термин “арилокси” относится к группе арил-О-, где арильная группа определена выше, и включает необязательно замещенные арильные группы, также определенные выше.

Термин “арилтио” относится к группе R-S-, где R является группой, определенной для арила.

Термин “амино” относится к группе -NH2.

Термин “замещенный амино” относится к группе -NRR, где каждый R независимо выбирают из группы, состоящей из водорода, алкила, циклоалкила, карбоксиалкила (например, бензилоксикарбонил), арила, гетероарила и гетероциклила, при условии, что обе R-группы не являются водородом, или группы -Y-Z, в которой Y означает необязательно замещенный алкилен и Z означает алкенил, циклоалкенил или алкинил. Если не ограничено определением, все заместители могут необязательно быть замещены 1-3 заместителями, выбранными из алкила, карбокси, карбоксиалкила, аминокарбонила, гидрокси, алкокси, галогена, CF3, амино, замещенного амино, циано и -S(O)nR, где R означает алкил, арил или гетероарил и n равно 0, 1 или 2.

Термин “карбоксиалкил” относится к группам -С(О)О-алкил или -С(О)О-циклоалкил, где алкил и циклоалкил определены в описании, и они могут необязательно быть замещены алкилом, алкенилом, алкинилом, алкокси, галогеном, CF3, амино, замещенным амино, циано или -S(O)nR, где R означает алкил, арил или гетероарил и n равно 0, 1 или 2.

Термин “циклоалкил” относится к карбоциклическим группам, состоящим из 3-20 атомов углерода, включающим одно циклическое кольцо или множество конденсированных колец. Такие циклоалкильные группы включают, в качестве примера, структуры из одного кольца, такие как циклопропил, циклобутил, циклопентил, циклооктил и тому подобное, или структуры из множества колец, такие как адамантанил, бицикло[2.2.1]гептан, 1,3,3-триметилбицикло[2.2.1]гепт-2-ил, (2,3,3- триметилбицикло[2.2.1]гепт-2-ил), или карбоциклические группы, которые конденсированы с арильной группой, например индан, и тому подобное.

Термин “замещенный циклоалкил” относится к циклоалкильным группам, имеющим 1, 2, 3, 4 или 5 заместителей и предпочтительно 1, 2 или 3 заместителя, выбранные из группы, состоящей из алкила, алкенила, алкинила, алкокси, циклоалкила, циклоалкенила, ацила, ациламино, ацилокси, амино, аминокарбонила, алкоксикарбониламино, азидо, циано, галогена, гидрокси, кето, тиокарбонила, карбокси, карбоксиалкила, арилтио, гетероарилтио, гетероциклилтио, тиола, алкилтио, арила, арилокси, гетероарила, аминосульфонила, аминокарбониламино, гетероарилокси, гетероциклила, гетероциклоокси, гидроксиамино, алкоксиамино, нитро, -SO-алкила, -SO-арила, -SO-гетероарила, -SO2-алкила, SO2-арила и -SO2-гетероарила. Если не ограничено определением, все заместители могут необязательно быть замещены 1, 2 или 3 заместителями, выбранными из алкила, карбокси, карбоксиалкила, аминокарбонила, гидрокси, алкокси, галогена, CF3, амино, замещенного амино, циано и -S(O)nR, где R означает алкил, арил или гетероарил и n равно 0, 1 или 2.

Термин “галоген” относится к фтору, брому, хлору и йоду.

Термин “ацил” означает группу -C(O)R, где R означает водород, необязательно замещенный алкил, необязательно замещенный циклоалкил, необязательно замещенный гетероциклил, необязательно замещенный арил и необязательно замещенный гетероарил.

Термин “гетероарил” относится к радикалу, произведенному от ароматической циклической группы (т.е. полностью ненасыщенной), имеющему 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 или 15 атомов углерода и 1, 2, 3 или 4 гетероатома, выбранные из кислорода, азота и серы, по меньшей мере, в одном кольце. Такие гетероарильные группы могут иметь одно кольцо (например, пиридил или фурил) или множество конденсированных колец (например, индолизинил, бензотиазолил или бензотиенил). Примеры гетероарилов включают, но не ограничиваются ими, [1,2,4]оксадиазол, [1,3,4]оксадиазол, [1,2,4]тиадиазол, [1,3,4]тиадиазол, пиррол, имидазол, пиразол, пиридин, пиразин, пиримидин, пиридазин, индолизин, изоиндол, индол, индазол, пурин, хинолизин, изохинолин, хинолин, фталазин, нафтилпиридин, хиноксалин, хиназолин, циннолин, птеридин, карбазол, карболин, фенантридин, акридин, фенантролин, изотиазол, феназин, изоксазол, феноксазин, фенотиазин, имидазолидин, имидазолин и тому подобное, а также N-оксидные и N-алкоксипроизводные азота, содержащие гетероарильные соединения, например пиридин-N-оксидпроизводные.

Термин “гетероарилен” относится к дирадикалу гетероарильной группы, как определено выше. Данный термин иллюстрируется группами, такими как 2,5-имидазолен, 3,5-[1,2,4]оксадиазолен, 2,4-оксазолен, 1,4-пиразолен и тому подобное. Например, 1,4-пиразолен представлен формулой:

где А означает точку присоединения.

Если только не ограничено определением для заместителя гетероарила или гетероарилена, такие гетероарильные или гетероариленовые группы могут быть необязательно замещены 1-5 заместителями, предпочтительно 1-3 заместителями, выбранными из группы, состоящей из алкила, алкенила, алкинила, алкокси, циклоалкила, циклоалкенила, ацила, ациламино, ацилокси, амино, аминокарбонила, алкоксикарбониламино, азидо, циано, галогена, гидрокси, кето, тиокарбонила, карбокси, карбоксиалкила, арилтио, гетероарилтио, гетероциклилтио, тиола, алкилтио, арила, арилокси, гетероарила, аминосульфонила, аминокарбониламино, гетероарилокси, гетероциклила, гетероциклоокси, гидроксиамино, алкоксиамино, нитро, -SO-алкила, -SO-арила, -SO-гетероарила, -SO2-алкила, SO2-арила и -SO2-гетероарила. Если не ограничено определением, все заместители могут необязательно быть замещены 1-3 заместителями, выбранными из алкила, карбокси, карбоксиалкила, аминокарбонила, гидрокси, алкокси, галогена, CF3, амино, замещенного амино, циано и -S(O)nR, где R означает алкил, арил или гетероарил и n равно 0, 1 или 2.

Термин “гетероаралкил” относится к гетероарильной группе, ковалентно связанной с алкиленовой группой, где гетероарил и алкилен определены в описании. “Необязательно замещенный гетероаралкил” относится к необязательно замещенной гетероарильной группе, ковалентно связанной с необязательно замещенной алкиленовой группой. Такие гетероаралкильные группы иллюстрируются 3-пиридилметилом, хинолин-8-илэтилом, 4-метокситиазол-2-илпропилом и тому подобное.

Термин “гетероарилокси” относится к группе гетероарил-О-.

Термин “гетероциклил” относится к монорадикальной насыщенной или частично ненасыщенной группе, включающей одно кольцо или множество конденсированных колец, имеющей от 1 до 40 атомов углерода и от 1 до 10 гетероатомов, предпочтительно 1, 2, 3 или 4 гетероатома, выбранные из азота, серы, фосфора и/или кислорода в кольце. Гетроциклические группы могут включать одно кольцо или множество конденсированных колец, и они включают тетрагидрофуранил, морфолино, пиперидинил, пиперазино, дигидропиридино и тому подобное.

Если только не ограничено определением для гетероциклического заместителя, такие гетероциклические группы могут быть необязательно замещены 1, 2, 3, 4 или 5 и предпочтительно 1, 2 или 3 заместителями, выбранными из группы, состоящей из алкила, алкенила, алкинила, алкокси, циклоалкила, циклоалкенила, ацила, ациламино, ацилокси, амино, аминокарбонила, алкоксикарбониламино, азидо, циано, галогена, гидрокси, кето, тиокарбонила, карбокси, карбоксиалкила, арилтио, гетероарилтио, гетероциклилтио, тиола, алкилтио, арила, арилокси, гетероарила, аминосульфонила, аминокарбониламино, гетероарилокси, гетероциклила, гетероциклоокси, гидроксиамино, алкоксиамино, нитро, -SO-алкила, -SO-арила, -SO-гетероарила, -SO2-алкила, SO2-арила и -SO2-гетероарила. Если только не ограничено определением, все заместители могут необязательно быть замещены 1-3 заместителями, выбранными из алкила, карбокси, карбоксиалкила, аминокарбонила, гидрокси, алкокси, галогена, CF3, амино, замещенного амино, циано и -S(O)nR, где R означает алкил, арил или гетероарил и n равно 0, 1 или 2.

Термин “тиол” относится к группе -SH.

Термин “замещенный алкилтио” относится к группе -S-замещенный алкил.

Термин “гетероарилтиол” относится к группе -S-гетероарил, где гетероарильная группа определена выше, включающей необязательно замещенные гетероарильные группы, которые также определены выше.

Термин “сульфоксид” относится к группе -S(O)R, в которой R означает алкил, арил или гетероарил. “Замещенный сульфоксид” относится к группе -S(O)R, в которой R означает замещенный алкил, замещенный арил или замещенный гетероарил, как определено в описании.

Термин “сульфон” относится к группе -S(O)2R, в которой R означает алкил, арил или гетероарил. “Замещенный сульфон” относится к группе -S(O)2R, в которой R означает замещенный алкил, замещенный арил или замещенный гетероарил, как определено в описании.

Термин “кето” относится к группе -C(O)-.

Термин “тиокарбонил” относится к группе -C(S)-.

Термин “карбокси” относится к группе -С(О)-ОН.

“Необязательный” или “необязательно” означает, что в дальнейшем описанное событие или случай может происходить или не может происходить и что описание включает примеры, где указанное событие или случай имеет место, и примеры, в которых не имеет места.

Термин “соединение формулы I и формулы II” предназначен охватить соединения согласно изобретению, которые описаны, и фармацевтически приемлемые соли, фармацевтически приемлемые сложные эфиры, пролекарства, гидраты и полиморфы таких соединений. Кроме того, соединения согласно изобретению могут иметь один или более центров асимметрии, и они могут быть получены в виде рацемической смеси или в виде индивидуальных энантиомеров или диастереоизомеров. Число стереоизомеров, присутствующих в любом данном соединении формулы I, зависит от числа имеющихся центров асимметрии (возможно, существуют 2n-стереоизомеры, где n означает число центров асимметрии). Индивидуальные стереоизомеры могут быть получены путем разделения рацемической или нерацемической смеси промежуточного продукта на некоторой соответствующей стадии синтеза или путем разложения соединения формулы I обычными способами. Индивидуальные стереоизомеры (включающие индивидуальные энантиомеры и диастереоизомеры), а также рацемические и нерацемические смеси стереоизомеров подпадают под объем настоящего изобретения, все из которых предназначены быть описанными посредством структур данного описания, если не указано иное.

“Изомеры” представляют собой различные соединения, которые имеют одинаковую молекулярную формулу.

“Стероизомеры” являются изомерами, которые отличаются только особенностью расположения атомов в пространстве.

“Энантиомеры” представляют собой пару стереоизомеров, которые являются неналагающимися зеркальными изображениями друг друга. Смесь 1:1 пары энантиомеров является “рацемической” смесью. Термин “(±)” используют для обозначения рацемической смеси, когда это уместно.

“Диастереоизомеры” являются стереоизомерами, которые имеют, по меньшей мере, два асимметрических атома, но которые не являются зеркальными изображениями друг друга.

Абсолютная стереохимия установлена согласно R-S-системе правил Cahn-Ingold-Prelog. Когда соединение является чистым энантиомером, стереохимия у каждого хирального атома углерода может быть указана либо R, либо S. Разделенные соединения, чья абсолютная конфигурация неизвестна, обозначают (+) или (-) в зависимости от направления (право- или левовращающие) вращения плоскости поляризованного света при длине волны линии D натрия.

“Местное введение” будет определено как доставка терапевтического средства к поверхности раны и прилегающего эпителия.

“Парентеральное введение” является системной доставкой терапевтического средства посредством инъекции больному.

Термин “терапевтически эффективное количество” относится к такому количеству соединения формулы I, которое оказывается достаточным для эффективного лечения, как определено ниже, когда вводят млекопитающему при необходимости такого лечения. Терапевтически эффективное количество будет изменяться в зависимости от специфической активности используемого терапевтического средства и возраста, физического состояния, существования других болезненных состояний и состояния питания больного. Кроме того, другое лекарственное средство, которое больной может получать, будет влиять на определение терапевтически эффективного количества терапевтического средства, которое применяют.

Термин “терапия” или “лечение” означает любое лечение заболевания у млекопитающего, включая:

(i) предотвращение заболевания, то есть содействие тому, что клинические симптомы заболевания не развиваются;

(ii) торможение заболевания, то есть подавление развития клинических симптомов; и/или

(iii) ослабление заболевания, то есть содействие регрессии клинических симптомов.

Во многих случаях соединения согласно данному изобретению проявляют способность к образованию солей с кислотой и/или основанием благодаря присутствию аминогрупп и/или карбоксильных групп или групп, подобных этим. Термин “фармацевтически приемлемая соль” относится к солям, которые сохраняют биологическую эффективность и свойства соединений формулы I и которые не являются биологически или иным образом нежелательными. Фармацевтически приемлемые аддитивные соли основания могут быть получены из неорганических и органических оснований. Соли, произведенные из органических оснований, включают, только в качестве примера, натриевые, калиевые, литиевые, аммониевые, кальциевые и магниевые соли. Соли, произведенные из органических оснований, включают, но не ограничиваются ими, соли первичных, вторичных и третичных аминов, такие как алкиламины, диалкиламины, триалкиламины, замещенные алкиламины, ди(замещенный алкил)амины, три(замещенный алкил)амины, алкениламины, диалкениламины, триалкениламины, замещенные алкениламины, ди(замещенный алкенил)амины, три(замещенный алкенил)амины, циклоалкиламины, ди(циклоалкил)амины, три(циклоалкил)амины, замещенные циклоалкиламины, дизамещенный циклоалкиламин, тризамещенные циклоалкиламины, циклоалкениламины, ди(циклоалкенил)амины, три(циклоалкенил)амины, замещенные циклоалкениламины, дизамещенный циклоалкениламин, тризамещенные циклоалкениламины, ариламины, диариламины, триариламины, гетероариламины, дигетероариламины, тригетероариламины, гетероциклические амины, дигетероциклические амины, тригетероциклические амины, смешанные ди- и триамины, где, по меньшей мере, два из заместителей у амина являются различными и выбранными из группы, состоящей из алкила, замещенного алкила, алкенила, замещенного алкенила, циклоалкила, замещенного циклоалкила, циклоалкенила, замещенного циклоалкенила, арила, гетероарила, гетероциклической группы и тому подобное. Также включены амины, у которых два или три заместителя вместе с азотом аминогруппы образуют гетероциклическую или гетероарильную группу.

Отдельные примеры подходящих аминов включают, только в качестве примера, изопропиламин, триметиламин, диэтиламин, три(изопропил)амин, три(н-пропил)амин, этаноламин, 2-диметиламиноэтанол, трометамин, лизин, аргинин, гистидин, кофеин, прокаин, гидрабамин, холин, бетаин, этилендиамин, глюкозамин, N-алкилглюкамины, теобромин, пурины, пиперазин, пиперидин, морфолин, N-этилпиперидин и тому подобное.

Фармацевтически приемлемые аддитивные соли кислоты могут быть получены из неорганических и органических кислот. Соли, произведенные из неорганических кислот, включают соли из хлористоводородной кислоты, бромистоводородной кислоты, серной кислоты, азотной кислоты, фосфорной кислоты и тому подобное. Соли, произведенные из органических кислот, включают соли из уксусной кислоты, пропионовой кислоты, гликолевой кислоты, пировиноградной кислоты, щавелевой кислоты, яблочной кислоты, малоновой кислоты, янтарной кислоты, малеиновой кислоты, фумаровой кислоты, винной кислоты, лимонной кислоты, бензойной кислоты, коричной кислоты, миндальной кислоты, метансульфокислоты, этансульфокислоты, пара-толуолсульфокислоты, салициловой кислоты и тому подобное.

Как используют в описании, “фармацевтически приемлемый носитель” включает любой или все растворители, дисперсионные среды, покрытия, противобактериальные и противогрибковые средства, изотоничные и задерживающие поглощение средства и тому подобное. Использование таких сред и средств для фармацевтически приемлемых веществ хорошо известно в данной области. За исключением того, что когда любые общепринятые среды и средства являются несовместимыми с активным ингредиентом, то их использование в терапевтических композициях рассматривается. Дополнительные активные ингредиенты также могут быть включены в композиции.

Номенклатура

Название и нумерацию соединений согласно изобретению иллюстрируют характерным соединением формулы I, в которой R1 означает н-пропил, R2 и R3 означают водород, Х является пиразол-4-иленом, Y означает метилен и Z означает 5-(4-хлорфенил)-(1,2,4-оксадиазол-3-ил),

соединение называют

8-(1-{[5-(4-хлорфенил)-(1,2,4-оксадиазол-3-ил)]метил}пиразол-4-ил)-1-пропил-1,3,7-тригидропурин-2,6-дион.

Способ изобретения

Настоящее изобретение относится к способам предотвращения и/или лечения заболевания печени путем введения терапевтически эффективного количества антагониста рецепторов аденозина А млекопитающему при необходимости. Не желая вдаваться в теоретические детали, было предположено, что способность антагониста рецепторов аденозина А предотвращать фиброгенез дает возможность указанным соединениям содействовать предотвращению и лечению заболевания печени.

Поскольку фиброгенез печени является важным процессом при развитии вирусного и алкогольного гепатита, болезни Вильсона, гемохроматоза, стеатоза и неалкогольного стеатогепатита и может быть результатом хирургического повреждения, т.е. реплантации или репарации печени, или гепатотоксического медикаментозного лечения, т.е. лучевой терапии, химиотерапии лекарственными средствами, антибиотиками, противорвотными средствами и тому подобное, способ изобретения, как правило, будет включать введение антагониста рецепторов аденозина А больному, страдающему от одного из упомянутых выше состояний или подвергаемому гепатотоксическому лечению.

Химиотерапия и лучевая терапия в лечении рака представляют собой два типа из самых распространенных типов гепатотоксического лечения. Гепатотоксические лекарственные средства, используемые в лечении рака, включают, но не ограничиваются ими, адриамицин, метотрексат, 6-меркаптопурин, карбоплатин, DTIC (дакарбазин), BiCNU, L-аспарагиназу и пентостатин.

Другие лекарственные средства, которые, как известно, вызывают гепатотоксические побочные эффекты, включают, но не ограничиваются ими, ацебутолол; ацетаминофен; актиномицин d; адренокортикальные стероиды; адриамицин; аллопуринол; амоксициллин/клавуланат; анаболические стероиды; противовоспалительные лекарственные средства; антитироидные лекарственные средства; аспирин; атенолол; азатиоприн; каптоприл; карбамазепин; карбимазол; кармустин; цефалоспорины; хлордиазепоксид; хлорпромазин; хлорпромазин/вальпроевую кислоту; хлорпропамид; хлорпропамид/эритромицин (комбинация); циметидин; клоксациллин флекаинид; циклофосфамид; циклофосфамид/циклоспорин; циклоспорин; дакарбазин; даназол; дантролен; диазепам; диклофенак; дилтиазем; дизопирамид; эналаприл; энфлюран; эритромицин; этамбутол; этионамид; флуразепам; флутамид; глибурид; золото; гризеофульвин; галоперидол; галотан; гидралазин; ибупрофен; имипрамин; индометацин; изониазид; кетоконазол; лабеталол; мапротилин; меркаптопурин; метотрексат; метилдопу; метилтестостерон; метопролол; миансерин; митомицин; напроксен; никотиновую кислоту; нифедипин; нитрофурантоин; нестероидные средства; норэтандролон; оральные контрацептивы; оксациллин; пара-аминосалициловую кислоту; пеницилламин; пенициллин; пенициллины; фенелзин; фениндион; фенобарбитал; фенотиазины; фенилбутазон; фенитоин; фенитоин тролеандомицин; пироксикам; пробенецид; прокаинамид; пропоксифен; пиразинамид; хинидин; хинин; ранитидин; салицилаты; сульфонамиды; сулиндак; тамоксифен; тербинафин HCl (ламизил, споранокс); тестостерон; тетрациклины; тиабендазол; тиогуанин; торотраст; толбутамид; трициклические антидепрессанты; вальпроевую кислоту; верапамил; винкристин и витамин А.

Фиброгенез печени начинается с активации звездчатых клеток печени человека (HHSC). При активации HHSC начинают синтезировать фиброзный матрикс, который богат коллагеном типа 1. В конечном счете, образование фиброзного матрикса приводит к рубцеванию, которое обычно называют фиброзом печени. Неожиданно заявители обнаружили, что рецепторы аденозина А принимают участие в развитии фиброза печени, поскольку активация рецепторов А в HHSC вызывает высвобождение IL-6 и экспрессию α-актина гладких мышц, маркера активации HHSC. Было показано, что высвобождение IL-6, в свою очередь, стимулирует продукцию коллагена. Было обнаружено, что ингибирование рецепторов А вызывает высвобождение IL-6, индуцированное NECA, и продуцирование коллагена.

Антагонист рецепторов аденозина А вводят в организм либо в виде перорального препарата, либо IV (внутривенного) препарата, но также он может быть введен прямо к ткани печени посредством инъекции. Такое введение может быть произведено в виде однократной дозы или в виде повторяющихся доз, данных при множестве назначенных интервалов. Специалисты в данной области смогут оценить, что предпочтительный режим дозировки будет изменяться в зависимости от больного и от тяжести состояния, которое подвергается лечению.

Фармацевтические композиции

В тех случаях, когда выбирают антагонист рецепторов аденозина А, соединения формулы I вводят в виде фармацевтических композиций. Поэтому настоящее изобретение касается фармацевтических композиций, которые содержат, в качестве активного ингредиента, одно или более соединений формулы I или формулы II или их фармацевтически приемлемую соль или сложный эфир и один или более фармацевтически приемлемых наполнителей, носителей, включающих инертные твердые разбавители и наполнители, разбавители, включающие стерильные водные растворы и различные органические растворители, солюбилизаторы и адъюванты. Соединения формулы I и/или формулы II могут быть введены сами по себе или в комбинации с другими терапевтическими средствами. Такие композиции приготовляют способом, хорошо известным в фармацевтической области (см. Remington's Pharmaceutical Sciences, Mace Publishing Co., Philadelphia, PA 17th Ed. (1985) and “Modern pharmaceutics”, Marcel Dekker, Inc. 3rd Ed. (G.S. Banker & C.T. Rhodes, Eds.).

Антагонисты рецепторов аденозина А

Любой антагонист рецепторов аденозина А может быть использован в способе изобретения. Многочисленные соединения, которые оказывают противодействие рецепторам А, известны в данной области, поскольку существуют методы определения такой активности у отдельного соединения. Например, обзорная статья Feoktistov and Baggioni ((1997) Pharmacological Reviews 49: 381-402) касается связывающего сродства восьми агонистов и восьми антагонистов рецепторов аденозина для всех четырех подтипов рецепторов аденозина. Ссылки, цитируемые в описании, дают подробную информацию относительно используемых процедур. (Robeva et al., (1996) J. Drug Dev. Res. 39: 243-252; Jacobson et al. (1996) J. Drug Dev. Res. 39: 289-300; Feoktistov and Baggioni (1993) Molecular Pharmacology 43: 909-914). В эффективных методах определения сродства к связыванию соединения относительно рецептора используют меченный радиоактивным изотопом агонист или антагонист и проводят корреляцию связывания этого соединения с мембранной фракцией, которая, как известно, содержит этот рецептор; например, для того, чтобы определить, является ли соединение антагонистом рецептора А, мембранная фракция должна содержать рецептор аденозина А. Другая наиболее эффективная процедура определения способности соединения быть антагонистом рецептора А описана в патенте США № 5854081.

Поэтому соединения, выбранные для подтипа рецептора А, являются предпочтительными для выполнения настоящего изобретения. Примером такого соединения, но не ограниченного им, является 3-н-пропилксантин (энпрофилин). Подходящие соединения также описаны в патенте США № 6545002. Соединения, которые вызывают противодействие других рецепторов, кроме рецептора А, являются также подходящими для использования в настоящем изобретении. Одним примером такого соединения является 1,3-дипропил-8-(пара-акрил)фенилксантин.

Одним наиболее предпочтительным классом антагонистов рецепторов А является класс соединений, описанных в одновременно заявленном и, как правило, переуступленном патенте США № 6825349, в заявке на патент США № 10/719102, совместно рассматриваемой и, как правило, переуступленной, которая опубликована как заявка на патент № 20040176399, и в одновременно заявленной и, как правило, переуступленной заявке на патент США № 11/453414, которая опубликована как заявка на патент США № 20060293283. Соединения, описанные в этих заявках, имеют структуру формулы I, II и III, как представлено выше в разделе “Сущность изобретения”, и могут быть синтезированы, как описано в ссылках или детально описано ниже.

Характеристики реакций синтеза

Термины “растворитель”, “инертный органический растворитель” или “инертный растворитель” означают растворитель, инертный в условиях реакции, приведенной в описании [включая, например, бензол, толуол, ацетонитрил, тетрагидрофуран (“ТГФ”), диметилформамид (“ДМФА”), хлороформ, метиленхлорид (или дихлорметан), диэтиловый эфир, метанол, пиридин и тому подобное]. Если не указано иное, растворители, используемые в реакциях согласно настоящему изобретению, являются инертными органическими растворителями, и реакции осуществляют в атмосфере инертного газа, предпочтительно азота.

Термин “q.s.” (к.д.) означает количество, достаточное для достижения установленной функции, например довести раствор до желаемого объема (т.е. 100%).

Синтез соединений формулы I и II

Один предпочтительный способ получения соединений формулы I или II, где R3 означает водород, представлен на схеме реакции 1.

Схема реакции 1

Стадия 1 - Получение соединения формулы (2)

Соединение формулы (2) получают из соединения формулы (1) путем реакции восстановления. Могут быть использованы обычные способы восстановления, например использование дитионита натрия в водном растворе аммиака; предпочтительно восстановление осуществляют с водородом и в присутствии металлического катализатора. Реакцию проводят в инертном растворителе, например метаноле, в присутствии катализатора, например 10% палладия-на-угле в атмосфере водорода, предпочтительно под давлением, например, приблизительно при 30 фунтах/кв. дюйм, в течение приблизительно 2 часов. Когда реакция в основном заканчивается, продукт формулы (2) выделяют обычными методами с получением соединения формулы (2).

Стадия 2 - Получение соединения формулы (3)

Затем соединение формулы (2) подвергают взаимодействию с карбоновой кислотой формулы Z-Y-X-CO2H в присутствии карбодиимида, например гидрохлорида 1-(3-диметиламинопропил)-3-этилкарбодиимида. Реакцию проводят в протонном растворителе, например метаноле, этаноле, пропаноле и тому подобном, предпочтительно в метаноле, при температуре приблизительно 20-30ºС, предпочтительно приблизительно при комнатной температуре, в течение приблизительно 12-48 часов, предпочтительно приблизительно в течение 16 часов. Когда реакция, в основном, заканчивается, продукт формулы (3) выделяют обычным способом, например удалением растворителя при пониженном давлении и промыванием продукта. С другой стороны, следующую стадию можно осуществлять без какой-либо дальнейшей очистки.

Альтернативное получение соединения формулы (3)

Альтернативно, вначале карбоновую кислоту формулы Z-Y-X-CO2H превращают в галогенидангидрид формулы Z-Y-X-C(O)L, где L означает хлор или бром, путем взаимодействия с галогенирующим средством, например тионилхлоридом или тионилбромидом, предпочтительно тионилхлоридом. Также в качестве галогенирующего средства могут быть использованы оксалилхлорид, пентахлорид фосфора или оксихлорид фосфора. Предпочтительно реакцию проводят в отсутствие растворителя, используя избыток галогенирующего средства, например, при температуре приблизительно 60-80ºС, предпочтительно приблизительно 70ºС, в течение приблизительно 1-8 часов, предпочтительно приблизительно 4 часов. Когда реакция, в основном, заканчивается, продукт формулы Z-Y-X-C(O)L выделяют обычным способом, например удалением избытка галогенирующего средства при пониженном давлении.

Затем продукт подвергают взаимодействию с соединением формулы (2) в инертном растворителе, например ацетонитриле, в присутствии третичного основания, например триэтиламина. Реакцию осуществляют при начальной температуре приблизительно 0ºС и затем оставляют нагревать до 20-30ºС, предпочтительно приблизительно при комнатной температуре, в течение приблизительно 12-48 часов, предпочтительно приблизительно 16 часов. Когда реакция, в основном, заканчивается, продукт формулы (3) выделяют обычным способом, например разбавлением реакционной смеси водой, фильтрованием продукта и промывкой продукта водой с последующей промывкой эфиром.

Стадия 3 - Получение соединения формулы I

Затем соединение формулы (3) превращают в соединение формулы I реакцией циклизации. Реакцию проводят в протонном растворителе, например метаноле, этаноле, пропаноле и тому подобном, предпочтительно метаноле, в присутствии основания, например гидроксида калия, гидроксида натрия, метилата натрия, этилата натрия, трет-бутилата калия, предпочтительно водного раствора гидроксида натрия, при температуре приблизительно 50-80ºС, предпочтительно приблизительно 80ºС, в течение приблизительно 1-8 часов, предпочтительно приблизительно 3 часов. Когда реакция, в основном, заканчивается, продукт формулы (3) выделяют обычным способом, например удалением растворителя при пониженном давлении, подкислением остатка водным раствором кислоты, фильтрованием продукта, затем промывкой и сушкой продукта.

Соединение формулы (1) может быть получено различными способами. Один предпочтительный способ представлен на схеме реакции II.

СХЕМА РЕАКЦИИ II

Стадия 1 - Получение соединения формулы (5)

Соединение формулы (4) является либо коммерчески доступным, либо его получают способами, хорошо известными в данной области. Его подвергают взаимодействию с этилцианоацетатом в протонном растворителе, например этаноле, в присутствии сильного основания, например этилата натрия. Реакцию осуществляют приблизительно при температуре кипения с обратным холодильником в течение приблизительно 24 часов. Когда реакция, в основном, заканчивается, соединение формулы (5), полученное таким способом, выделяют обычным методом.

Стадия 2 и 3 - Получение соединения формулы (7)

Соединение формулы (5) подвергают взаимодействию с диметилацеталем N,N-диметилформамида в полярном растворителе, например N,N-диметилформамиде. Реакцию осуществляют приблизительно при 40ºС в течение приблизительно 1 часа. Когда реакция, в основном, заканчивается, соединение формулы (6), полученное таким способом, подвергают взаимодействию с соединением формулы R1Hal, где Hal означает хлор, бром или йод, в присутствии основания, например карбоната калия. Реакцию выполняют приблизительно при 80ºС в течение приблизительно 4-24 часов. Когда реакция, в основном, заканчивается, продукт формулы (7) выделяют обычным методом, например упариванием растворителей при пониженном давлении, и остаток используют в следующей реакции без дальнейшей очистки.

Стадия 4 - Получение соединения формулы (8)

Соединение формулы (7) подвергают взаимодействию с водным раствором аммиака в полярном растворителе, например, в виде суспензии в метаноле. Реакцию осуществляют приблизительно при комнатной температуре в течение приблизительно 1-3 дней. Когда реакция, в основном, заканчивается, продукт формулы (8) выделяют обычным методом, например хроматографией на колонке с силикагелем, элюированием, например, смесью дихлорметан/метанол.

Стадия 5 - Получение соединения формулы (1)

Затем соединение формулы (8) смешивают с нитритом натрия в водном кислотном растворителе, предпочтительно в уксусной кислоте и воде, например 50% уксусная кислота/вода. Реакцию осуществляют при температуре приблизительно 50-90ºС, предпочтительно приблизительно при 70ºС, в течение приблизительно 1 часа. Когда реакция, в основном, заканчивается, продукт формулы (1) выделяют обычными методами.

Альтернативно, взаимодействие можно осуществлять в водном растворителе, например диметилформамиде и воде, и реакцию проводить в присутствии сильной кислоты, например хлористоводородной кислоты.

Соединение формулы (8) может быть получено из соединения формулы (10) при использовании подобного способа, представленного на реакционной схеме IIA.

СХЕМА РЕАКЦИИ IIA

Стадия 2 и 3 - Получение соединения формулы (7)

Соединение формулы (10) подвергают взаимодействию с диметилацеталем N,N-диметилформамида в полярном растворителе, например N,N-диметилформамиде. Реакцию осуществляют приблизительно при 40ºС в течение приблизительно 1 часа. Когда реакция, в основном, заканчивается, соединение формулы (6а), полученное таким способом, подвергают взаимодействию с соединением формулы R2Hal, где Hal означает хлор, бром или йод, в присутствии основания, например карбоната калия. Реакцию выполняют приблизительно при 80ºС в течение приблизительно 4-24 часов. Когда реакция, в основном, заканчивается, продукт формулы (7) выделяют обычным методом, например упариванием растворителей при пониженном давлении, и остаток используют в следующей реакции без дальнейшей очистки.

Стадия 4 - Получение соединения формулы (8)

Соединение формулы (7) подвергают взаимодействию с водным раствором аммиака в полярном растворителе, например, в виде суспензии в метаноле. Реакцию осуществляют приблизительно при комнатной температуре в течение приблизительно 1-3 дней. Когда реакция, в основном, заканчивается, продукт формулы (8) выделяют обычным методом, например путем хроматографии на колонке с силикагелем, элюции, например, смесью дихлорметан/метанол.

Соединение формулы (3) может быть получено различными способами. Один предпочтительный способ представлен на схеме реакции III.

СХЕМА РЕАКЦИИ III

Стадия 1 - Получение соединения формулы (10)

Коммерчески доступное соединение 6-аминоурацил вначале подвергают силилированию, например, путем реакции с избытком гексаметилдисилазана в качестве растворителя в присутствии катализатора, например сульфата аммония. Реакцию осуществляют приблизительно при температуре образования флегмы в течение приблизительно 1-10 часов. Когда реакция, в основном, заканчивается, силилированное соединение, полученное таким способом, выделяют обычным методом и затем подвергают взаимодействию с соединением формулы R1Hal, где Hal означает хлор, бром или йод, предпочтительно в отсутствие растворителя. Реакцию выполняют приблизительно при температуре образования флегмы в течение приблизительно 4-48 часов, предпочтительно приблизительно 12-16 часов. Когда реакция, в основном, заканчивается, продукт формулы (10) выделяют обычными методами.

Стадия 2 - Получение соединения формулы (11)

Затем соединение формулы (10) растворяют в водном растворе кислоты, например водном растворе уксусной кислоты, и подвергают взаимодействию с нитритом натрия. Реакцию осуществляют при температуре приблизительно 20-50ºС, предпочтительно приблизительно 30ºС, в течение приблизительно 30 минут. Когда реакция, в основном, заканчивается, продукт формулы (11) выделяют обычными методами, например фильтрацией.

Стадия 3 - Получение соединения формулы (12)

Затем соединение формулы (11) восстанавливают до диаминопроизводного. В общем, соединение формулы (11) растворяют в водном растворе аммиака и затем добавляют восстановитель, например гидросульфит натрия. Реакцию осуществляют при температуре приблизительно 70ºС. Когда реакция, в основном, заканчивается, продукт формулы (12) выделяют обычными методами, например фильтрацией охлажденной реакционной смеси.

Стадия 4 - Получение соединения формулы (13)

Затем соединение формулы (12) подвергают взаимодействию с карбоновой кислотой формулы Z-Y-X-CO2H в присутствии карбодиимида, например гидрохлорида 1-(3-диметиламинопропил)-3-этилкарбодиимида. Реакцию осуществляют при температуре приблизительно 20-30ºС в течение приблизительно 12-48 часов. Когда реакция, в основном, заканчивается, продукт формулы (13) выделяют обычными методами, например путем фильтрования охлажденной реакционной смеси.

Альтернативно, карбоновую кислоту формулы Z-Y-X-CO2H превращают в галогенидангидрид формулы Z-Y-X-C(O)L, где L означает хлор или бром, путем взаимодействия с галогенирующим средством, например тионилхлоридом или тионилбромидом; альтернативно, пентахлорид фосфора или оксихлорид фосфора могут быть использованы. Реакцию предпочтительно осуществляют в отсутствие растворителя, используя избыток галогенирующего средства, например, при температуре приблизительно 60-80ºС, предпочтительно приблизительно 70ºС, в течение приблизительно 1-8 часов, предпочтительно 4 часов. Когда реакция, в основном, заканчивается, продукт формулы Z-Y-X-C(O)L выделяют обычными методами, например путем удаления избытка галогенирующего средства при пониженном давлении.

Затем продукт формулы Z-Y-X-C(O)L подвергают взаимодействию с соединением формулы (12) в инертном растворителе, например ацетонитриле, в присутствии третичного основания, например триэтиламина. Реакцию осуществляют при начальной температуре приблизительно 0ºС и затем оставляют нагревать до 20-30ºС, предпочтительно приблизительно при комнатной температуре, в течение приблизительно 12-48 часов, предпочтительно приблизительно 16 часов. Когда реакция, в основном, заканчивается, продукт формулы (13) выделяют обычными методами, например путем разбавления реакционной смеси водой, фильтрования продукта и промывки продукта водой с последующей промывкой эфиром.

Стадия 5 -Получение соединения формулы (3)

Соединение формулы (13) подвергают взаимодействию с соединением формулы R2Hal, где Hal означает хлор, бром или йод, в присутствии основания, например карбоната калия. Реакцию выполняют приблизительно при комнатной температуре в течение приблизительно 4-24 часов, предпочтительно приблизительно 16 часов. Когда реакция, в основном, заканчивается, продукт формулы (3) выделяют обычным методом, например упариванием растворителей при пониженном давлении, и остаток может быть очищен обычным методом или может быть использован в следующей реакции без дальнейшей очистки.

Другой способ получения соединения формулы (3) представлен на схеме реакции IV.

СХЕМА РЕАКЦИИ IV

Стадия 1 - Получение соединения формулы (14)

Затем соединение формулы (5) смешивают с нитритом натрия в водном кислотном растворителе, предпочтительно уксусной кислоте и воде, например в 50% смеси уксусная кислота/вода. Реакцию осуществляют при температуре приблизительно 50-90ºС, предпочтительно приблизительно 70ºС, в течение приблизительно 1 часа. Когда реакция, в основном, заканчивается, продукт формулы (14) выделяют обычными методами.

Альтернативно, взаимодействие можно осуществлять в водном растворителе, например диметилформамиде и воде, и реакцию проводить в присутствии сильной кислоты, например хлористоводородной кислоты.

Стадия 3 - Получение соединения формулы (15)

Затем соединение формулы (14) восстанавливают до диаминопроизводного. В общем, соединение формулы (14) растворяют в водном растворе аммиака и затем добавляют восстановитель, например гидросульфит натрия. Реакцию осуществляют при температуре приблизительно 70ºС. Когда реакция, в основном, заканчивается, продукт формулы (15) выделяют обычными методами, например фильтрацией охлажденной реакционной смеси.

Стадия 4 - Получение соединения формулы (16)

Затем соединение формулы (15) подвергают взаимодействию с карбоновой кислотой формулы Z-Y-X-CO2H в присутствии карбодиимида, например гидрохлорида 1-(3-диметиламинопропил)-3-этилкарбодиимида. Реакцию осуществляют при температуре приблизительно 20-30ºС в течение приблизительно 12-48 часов в инертном растворителе, например метаноле. Когда реакция, в основном, заканчивается, продукт формулы (16) выделяют обычными методами, например путем фильтрования охлажденной реакционной смеси.

Альтернативно, карбоновую кислоту формулы Z-Y-X-CO2H превращают в галогенидангидрид формулы Z-Y-X-C(O)L, где L означает хлор или бром, путем взаимодействия с галогенирующим средством, например тионилхлоридом или тионилбромидом; с другой стороны, пентахлорид фосфора или оксихлорид фосфора могут быть использованы. Реакцию предпочтительно осуществляют в отсутствие растворителя, используя избыток галогенирующего средства, например, при температуре приблизительно 60-80ºС, предпочтительно приблизительно 70ºС, в течение приблизительно 1-8 часов, предпочтительно 4 часов. Когда реакция, в основном, заканчивается, продукт формулы Z-Y-X-C(O)L выделяют обычными методами, например путем удаления избытка галогенирующего средства при пониженном давлении.

Затем продукт формулы Z-Y-X-C(O)L подвергают взаимодействию с соединением формулы (15) в инертном растворителе, например ацетонитриле, в присутствии третичного основания, например триэтиламина. Реакцию осуществляют при начальной температуре приблизительно 0ºС и затем оставляют нагревать до 20-30ºС, предпочтительно приблизительно при комнатной температуре, в течение приблизительно 12-48 часов, предпочтительно приблизительно 16 часов. Когда реакция, в основном, заканчивается, продукт формулы (16) выделяют обычными методами, например путем разбавления реакционной смеси водой, фильтрования продукта и промывки продукта водой с последующей промывкой простым эфиром.

Стадия 5 - Получение соединения формулы (3)

Соединение формулы (16) подвергают взаимодействию с соединением формулы R1Hal, где Hal означает хлор, бром или йод, в присутствии основания, например карбоната калия. Реакцию осуществляют приблизительно при 80ºС в течение приблизительно 4-24 часов, предпочтительно приблизительно 16 часов. Когда реакция, в основном, заканчивается, продукт формулы (3) выделяют обычным методом, например упариванием растворителей при пониженном давлении, и остаток может быть очищен обычным методом или может быть использован в следующей реакции без дальнейшей очистки.

Пример синтеза соединения формулы Z-Y-X-CO2H, в которой X означает пиразол-1,4-ил, Y является метиленом и Z означает 3-трифторметилфенил, представлен на схеме реакции V.

СХЕМА РЕАКЦИИ V

Этил пиразол-4-карбоксилат подвергают взаимодействию с 1-(бромметил)-3-(трифторметил)бензолом в ацетоне в присутствии карбоната калия. Затем продукт, этил 1-{[3-(трифторметил)фенил]метил}пиразол-4-карбоксилат, гидролизуют гидроксидом калия в метаноле с получением 1-{[3-(трифторметил)фенил]метил}пиразол-4-карбоновой кислоты.

Применение, тестирование и введение

Основное применение

Способ и фармацевтические композиции согласно настоящему изобретению являются эффективными в предотвращении и лечении болезни печени, такой как фиброз печени и/или воспаление печени, у млекопитающего. Типичные случаи болезни печени включают, но не ограничиваются ими, вирусный и алкогольный гепатит, болезнь Вильсона, гемохроматоз, стеатоз и неалкогольный стеатогепатит (NASH). Болезнь печени также может быть результатом хирургического вмешательства, т.е. реплантации или репарации печени, или результатом индуцированного лекарственным средством поражения печени.

Тестирование

Тестирование активности осуществляют, как описано в тех патентах и заявках на патент, которые упомянуты выше, и в примерах, приведенных ниже, и способами, очевидными специалистам в данной области.

Введение

Соединения формулы I могут быть введены в виде однократной дозы или множества доз любым из принятых способов введения средств, имеющих подобные эффективности, например, как описано в тех патентах и заявках на патент, которые включены в описание посредством ссылки, включая буккальный способ введения, интраназальный способ, внутриартериальную инъекцию, внутривенное введение, внутрибрюшинное введение, парентеральное введение, внутримышечное введение, подкожное введение, оральное введение или введение в виде ингаляции.

Оральное введение является предпочтительным способом введения соединений формулы I. Введение может быть осуществлено посредством капсулы или таблеток с энтеросолюбильным покрытием или тому подобным. При приготовлении фармацевтических композиций, которые включают, по меньшей мере, одно соединение формулы I, активный ингредиент обычно разбавляют наполнителем и/или заключают в такой носитель, который может быть в виде капсулы, саше, бумаги или другого контейнера. В случае когда наполнитель служит в качестве разбавителя, он может быть твердым, полутвердым или жидким материалом (как выше), который действует как наполнитель, носитель или среда для активного ингредиента. Таким образом, композиции могут быть приготовлены в виде таблеток, пилюль, порошков, пастилок, саше, крахмальных облаток, эликсиров, суспензий, эмульсий, растворов, сиропов, аэрозолей (в твердом виде или в жидкой среде), мазей, содержащих, например, вплоть до 10% масс. активного соединения, мягких и твердых желатиновых капсул, стерильных инъецируемых растворов и стерильных упакованных порошков.

Некоторые примеры подходящих наполнителей включают лактозу, декстрозу, сахарозу, сорбит, маннит, крахмалы, аравийскую камедь, фосфат кальция, альгинаты, трагакант, желатин, силикат кальция, монокристаллическую целлюлозу, поливинилпирролидон, целлюлозу, стерильную воду, сироп и метилцеллюлозу. Препараты могут дополнительно включать смазывающие средства, такие как тальк, стеарат магния и минеральное масло; смачивающие средства; эмульгирующие и суспендирующие средства; консерванты, такие как метил- и пропилгидроксибензоаты; подсластители и ароматизаторы.

Композиции согласно изобретению могут быть приготовлены для быстрого, замедленного или отсроченного высвобождения активного ингредиента после введения больному путем использования методик, известных в данной области. Системы доставки лекарственного средства контролируемого высвобождения для орального введения включают системы “осмотического насоса” и системы с растворением, содержащие покрытые полимером резервуары или композиции на основе комплексов лекарственного средства и полимерной матрицы. Примеры систем с контролируемым высвобождением даны в патентах США № 3845770; 4326525; 4902514 и 5616345. В другом препарате, используемом в способах настоящего изобретения, используют устройства трансдермальной доставки (“пластыри”). Такие трансдермальные пластыри могут быть использованы для достижения постоянной или прерывистой инфузии соединений согласно настоящему изобретению в контролируемых количествах. Изготовление и использование трансдермальных пластырей для доставки фармацевтических средств хорошо известно в данной области. См., например, патенты США № 5023252, 4992445 и 5001139. Такие пластыри могут быть изготовлены для постоянной, пульсирующей или по требованию доставки фармацевтических средств.

Антагонисты рецепторов аденозина А, такие как соединения формулы I, проявляют эффективность в широком диапазоне дозировок, и их обычно вводят в фармацевтически эффективном количестве. Обычно для орального введения любая стандартная доза содержит от 1 мг до 2 г антагониста рецепторов аденозина А, по большей части от 1 до 700 мг, и для парентерального введения от 1 до 700 мг антагониста рецепторов аденозина А, по большей части приблизительно от 2 до 200 мг. Однако следует понимать, что количество антагониста рецепторов аденозина А, фактически введенного, будет определять врач, в свете существующих обстоятельств, включающих состояние, которое подвергается лечению, выбранный способ введения, действительное вводимое соединение и его относительную активность, возраст, вес и реакцию индивидуального больного, тяжесть симптомов у больного и тому подобное.

В случае приготовления твердых композиций, таких как таблетки, основной активный ингредиент смешивают с фармацевтическим наполнителем с образованием твердой предварительно полученной композиции, содержащей гомогенную смесь соединения согласно настоящему изобретению. В случае когда ссылаются на указанные предварительно полученные композиции как гомогенные, то это означает, что активный ингредиент равномерно распределен по всей композиции таким образом, что композицию можно легко разделить на равные эффективные стандартные лекарственные формы, такие как таблетки, пилюли и капсулы.

Таблетки или пилюли согласно настоящему изобретению могут быть покрыты оболочкой или иначе составлены для того, чтобы дозированная форма обладала преимущественно пролонгированным действием или защищала от кислых условий, существующих в желудке. Например, таблетка или пилюля может содержать внутренний дозированный компонент и внешний дозированный компонент, причем последний представлен в виде оболочки на предыдущем. Два компонента могут быть разделены энтеросолюбильным слоем, который служит для того, чтобы препятствовать дезинтеграции в желудке и позволить внутреннему компоненту попасть интактным в двенадцатиперстную кишку или замедлить его высвобождение. Ряд материалов может быть использован для таких энтеросолюбильных слоев или покрытий, таких материалов, включающих ряд полимерных кислот и смесей полимерных кислот с такими материалами, как шеллак, цетиловый спирт и ацетат целлюлозы.

Композиции для ингаляции или вдувания включают растворы и суспензии в фармацевтически приемлемых, водных или органических растворителях или их смесях, и порошки. Жидкие или твердые композиции могут содержать подходящие фармацевтически приемлемые наполнители, как описано выше. Предпочтительно композиции вводят оральным путем или назальным в дыхательные пути для достижения локального или системного эффекта. Композиции в предпочтительных фармацевтически приемлемых растворителях можно распылять при использовании инертных газов. Распыленные растворы могут быть доставлены прямо из распылителя, или распылитель может быть соединен с маской-палаткой или дыхательным устройством с перемежающимся положительным давлением. Композиции в виде раствора, суспензии или порошка могут быть введены предпочтительно орально или назально из устройств, которые доставляют препарат соответствующим образом.

Следующие примеры включены для того, чтобы продемонстрировать предпочтительные варианты осуществления изобретения. Специалисты в данной области должны оценить, что способы, раскрытые в примерах, которые описаны далее, представляют собой способы, описанные заявителем с целью применения этих способов на практике, и таким образом могут рассматриваться как установленные предпочтительные способы для использования их на практике. Однако специалисты в данной области в свете описания настоящего изобретения должны оценить, что многие изменения могут быть сделаны в отдельных вариантах осуществления изобретения, которые описаны, и еще можно получить идентичный или подобный результат без отклонения от сущности и объема изобретения.

ПРИМЕР 1

Получение соединения формулы (5)

А. Получение соединения формулы (5), в которой R 2 означает этил

Раствор этилата натрия приготовляли из натрия (4,8 г, 226 ммоль) и сухого этанола (150 мл). К полученному раствору добавляли амино-N-этиламид (10 г, 113 ммоль) и этилцианоацетат (12,8 г, 113 ммоль). Полученную реакционную смесь перемешивали при кипячении с обратным холодильником в течение 6 часов, охлаждали и растворитель удаляли из реакционной смеси при пониженном давлении. Остаток растворяли в воде (50 мл) и рН доводили до 7 хлористоводородной кислотой. Смесь оставляли на ночь при 0°С и осадок фильтровали, промывали водой и сушили на воздухе с получением 6-амино-1-этил-1,3-дигидропиримидин-2,4-диона, соединения формулы (5).

1H-ЯМР (ДМСО-d6) δ 10,29 (с, 1H), 6,79 (с, 2H), 4,51 (с, 1H), 3,74-3,79 (м, 2H), 1,07 (т, 3H, J=7,03 Гц); МС m/z 155,98 (М+), 177,99 (М+ + Na)

В. Получение соединения формулы (5), в которой R 2 означает метил

Аналогично, следуя способу примера 1А, но заменяя амино-N-этиламид на амино-N-метиламид, получали 6-амино-1-метил-1,3-дигидропиримидин-2,4-дион.

С. Получение соединения формулы (5) с изменяющимися R 2 -группами

Аналогично, следуя методике примера 1А, но заменяя амино-N-этиламид другими соединениями формулы (4), получали другие соединения формулы (5).

ПРИМЕР 2

Получение соединения формулы (6)

А. Получение соединения формулы (6), в которой R 2 означает этил

Суспензию 6-амино-1-этил-1,3-дигидропиримидин-2,4-диона (0,77 г, 5 ммоль) в безводном N,N-диметилацетамиде (25 мл) и диметилацетале N,N-диметилформамида (2,7 мл, 20 ммоль) нагревали при 40ºС в течение 90 минут. Затем растворитель удаляли при пониженном давлении и остаток растирали в этаноле, фильтровали и промывали этанолом с получением 6-[2-(диметиламино)-1-азавинил]-1-этил-1,3-дигидропиримидин-2,4-диона, соединения формулы (6).

1H-ЯМР (ДМСО-d6) δ 10,62 (с, 1H), 8,08 (с, 1H), 4,99 (с, 1H), 3,88-3,95 (м, 2H), 3,13 (с, 3H), 2,99 (с, 3H), 1,07 (т, 3H, J=7,03 Гц); МС m/z 210,86 (М+), 232,87 (М+ + Na)

В. Получение соединения формулы (6), в которой R 2 означает метил

Аналогично, следуя методике примера 2А, но заменяя 6-амино-1-этил-1,3-дигидропиримидин-2,4-дион на 6-амино-1-метил-1,3-дигидропиримидин-2,4-дион, получали 6-[2-(диметиламино)-1-азавинил]-1-метил-1,3-дигидропиримидин-2,4-дион.

С. Получение соединения формулы (6) с изменяющимися R 2 -группами

Аналогично, следуя методике примера 2А, но заменяя 6-амино-1-этил-1,3-дигидропиримидин-2,4-дион другими соединениями формулы (5), получали другие соединения формулы (6).

ПРИМЕР 3

Получение соединения формулы (7)

А. Получение соединения формулы (7), в которой R 1 означает н-пропил и R 2 означает этил

Смесь раствора 6-[2-(диметиламино)-1-азавинил]-1-этил-1,3-дигидропиримидин-2,4-диона (1,5 г, 7,1 ммоль) в диметилформамиде (25 мл), карбоната калия (1,5 г, 11 ммоль) и н-пропилйодида (1,54 г, 11 ммоль) перемешивали при 80ºС в течение 5 часов. Реакционную смесь охлаждали до комнатной температуры, фильтровали, растворители упаривали и продукт формулы (7), 6-[2-(диметиламино)-1-азавинил]-1-этил-3-пропил-1,3-дигидропиримидин-2,4-дион, использовали как таковой в следующей реакции.

В. Получение соединения формулы (7) с изменяющимися R 1 - и R 2 -группами

Аналогично, следуя методике примера 3А, но заменяя 6-[2-(диметиламино)-1-азавинил]-1-этил-1,3-дигидропиримидин-2,4-дион на другие соединения формулы (6), получали следующие соединения формулы (7):

6-[2-(диметиламино)-1-азавинил]-1-метил-3-пропил-1,3-дигидропиримидин-2,4-дион;

6-[2-(диметиламино)-1-азавинил]-1-метил-3-циклопропилметил-1,3-дигидропиримидин-2,4-дион;

6-[2-(диметиламино)-1-азавинил]-1-этил-3-циклопропилметил-1,3-дигидропиримидин-2,4-дион;

6-[2-(диметиламино)-1-азавинил]-1-метил-3-(2-метилпропил)-1,3-дигидропиримидин-2,4-дион и

6-[2-(диметиламино)-1-азавинил]-1-этил-3-(2-метилпропил)-1,3-дигидропиримидин-2,4-дион.

С. Получение соединения формулы (7) с изменяющимися R 1 - и R 2 -группами

Аналогично, следуя методике примера 3А, но заменяя 6-[2-(диметиламино)-1-азавинил]-1-этил-1,3-дигидропиримидин-2,4-дион на другие соединения формулы (6), получали другие соединения формулы (7).

ПРИМЕР 4

Получение соединения формулы (8)

А. Получение соединения формулы (8), в которой R 1 означает н-пропил и R 2 означает этил

Раствор 6-[2-(диметиламино)-1-азавинил]-1-метил-3-пропил-1,3-дигидропиримидин-2,4-диона (2,1 г) растворяли в смеси метанола (10 мл) и 28% водного раствора аммиака (20 мл) и перемешивали в течение 72 часов при комнатной температуре. Затем растворитель удаляли при пониженном давлении и остаток очищали хроматографией на колонке с силикагелем, элюируя смесью дихлорметан/метанол (15/1) с получением 6-амино-1-этил-3-пропил-1,3-дигидропиримидин-2,4-диона, соединения формулы (8).

1H-ЯМР (ДМСО-d6) δ 6,80 (с, 2H), 4,64 (с, 1H), 3,79-3,84 (м, 2H), 3,63-3,67 (м, 2H), 1,41-1,51 (м, 2H), 1,09 (т, 3H, J=7,03 Гц), 0,80 (т, 3H, J=7,42 Гц); МС m/z 197,82 (М+)

В. Получение соединения формулы (8) с изменяющимися R 1 - и R 2 -группами

Аналогично, следуя методике примера 4А, но заменяя 6-[2-(диметиламино)-1-азавинил]-1-этил-3-пропил-1,3-дигидропиримидин-2,4-дион на другие соединения формулы (7), получали следующие соединения формулы (8):

6-амино-1-метил-3-пропил-1,3-дигидропиримидин-2,4-дион;

6-амино-1-метил-3-циклопропилметил-1,3-дигидропиримидин-2,4-дион;

6-амино-1-этил-3-циклопропилметил-1,3-дигидропиримидин-2,4-дион;

6-амино-1-метил-3-(2-метилпропил)-1,3-дигидропиримидин-2,4-дион и

6-амино-1-этил-3-(2-метилпропил)-1,3-дигидропиримидин-2,4-дион.

С. Получение соединения формулы (8) с изменяющимися R 1 - и R 2 -группами

Аналогично, следуя методике примера 4А, но заменяя 6-[2-(диметиламино)-1-азавинил]-1-этил-3-пропил-1,3-дигидропиримидин-2,4-дион на другие соединения формулы (7), получали другие соединения формулы (8).

ПРИМЕР 5

Получение соединения формулы (1)

А. Получение соединения формулы (1), в которой R 1 означает н-пропил и R 2 означает этил

К раствору 6-амино-1-этил-3-пропил-1,3-дигидропиримидин-2,4-диона (1,4 г, 7,1 ммоль) в смеси 50% уксусная кислота/вода (35 мл) добавляли нитрит натрия (2 г, 28,4 ммоль) порциями в течение 10 минут. Смесь перемешивали при 70ºС в течение 1 часа, затем реакционную смесь концентрировали до небольшого объема при пониженном давлении. Твердое вещество фильтровали и промывали водой с получением 6-амино-1-этил-5-нитрозо-3-пропил-1,3-дигидропиримидин-2,4-диона, соединения формулы (1).

МС m/z 227,05 (М+), 249,08 (М+ + Na)

В. Получение соединения формулы (1) с изменяющимися R 1 - и R 2 -группами

Аналогично, следуя методике примера 5А, но заменяя 6-амино-1-этил-3-пропил-1,3-дигидропиримидин-2,4-дион на другие соединения формулы (8), получали следующие соединения формулы (1):

6-амино-1-метил-5-нитрозо-3-пропил-1,3-дигидропиримидин-2,4-дион;

6-амино-1-метил-3-циклопропилметил-5-нитрозо-1,3-дигидропиримидин-2,4-дион;

6-амино-1-этил-3-циклопропилметил-5-нитрозо-1,3-дигидропиримидин-2,4-дион;

6-амино-1-метил-3-(2-метилпропил)-5-нитрозо-1,3-дигидропиримидин-2,4-дион и

6-амино-1-этил-3-(2-метилпропил)-5-нитрозо-1,3-дигидропиримидин-2,4-дион.

С. Получение соединения формулы (1) с изменяющимися R 1 - и R 2 -группами

Аналогично, следуя методике примера 5А, но заменяя 6-амино-1-этил-3-пропил-1,3-дигидропиримидин-2,4-дион на другие соединения формулы (8), получали другие соединения формулы (1).

ПРИМЕР 6

Получение соединения формулы (2)

А. Получение соединения формулы (2), в которой R 1 означает н-пропил и R 2 означает этил

К раствору 6-амино-1-этил-5-нитрозо-3-пропил-1,3-дигидропиримидин-2,4-диона (300 мг) в метаноле (10 мл) добавляли катализатор 10% палладий-на-угле (50 мг) и смесь подвергали гидрированию в атмосфере водорода при давлении 30 фунт/кв.дюйм в течение 2 часов. Смесь фильтровали через целит и растворитель удаляли из фильтрата при пониженном давлении с получением 5,6-диамино-1-этил-3-пропил-1,3-дигидропиримидин-2,4-диона, соединения формулы (2).

МС m/z 213,03 (М+), 235,06 (М+ + Na)

В. Получение соединения формулы (2) с изменяющимися R 1 - и R 2 -группами

Аналогично, следуя методике примера 6А, но заменяя 6-амино-1-этил-5-нитрозо-3-пропил-1,3-дигидропиримидин-2,4-дион на другие соединения формулы (1), получали следующие соединения формулы (2):

5,6-диамино-1-метил-3-пропил-1,3-дигидропиримидин-2,4-дион;

5,6-диамино-1-метил-3-циклопропилметил-1,3-дигидропиримидин-2,4-дион;

5,6-диамино-1-этил-3-циклопропилметил-1,3-дигидропиримидин-2,4-дион;

5,6-диамино-1-метил-3-(2-метилпропил)-1,3-дигидропиримидин-2,4-дион и

5,6-диамино-1-этил-3-(2-метилпропил)-1,3-дигидропиримидин-2,4-дион.

С. Получение соединения формулы (2) с изменяющимися R 1 - и R 2 -группами

Аналогично, следуя методике примера 6А, но заменяя 6-амино-1-этил-5-нитрозо-3-пропил-1,3-дигидропиримидин-2,4-дион на другие соединения формулы (1), получали другие соединения формулы (2).

ПРИМЕР 7

Получение соединения формулы (3)

А. Получение соединения формулы (3), в которой R 1 означает н-пропил, R 2 означает этил, X является 1,4-пиразолилом, Y означает метилен и Z означает 3-трифторметилфенил

К смеси 5,6-диамино-1-этил-3-пропил-1,3-дигидропиримидин-2,4-диона (100 мг, 0,47 ммоль) и 1-{[3-(трифторметил)фенил]метил}пиразол-4-карбоновой кислоты (0,151 г, 0,56 ммоль) в метаноле (10 мл) добавляли гидрохлорид 1-(3-диметиламинопропил)-3-этилкарбодиимида (0,135 г, 0,7 ммоль) и реакционную смесь перемешивали в течение ночи при комнатной температуре. Растворитель удаляли при пониженном давлении и остаток очищали, используя Bistag и элюируя 10% смесью метанол/метиленхлорид, с получением N-(6-амино-1-этил-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)карбоксамида.

1H-ЯМР (ДМСО-d6) δ 8,59 (с, 1H), 8,02 (с, 1H), 7,59-7,71 (м, 4H), 6,71 (с, 2H), 5,51 (с, 2H), 3,91-3,96 (м, 2H), 3,70-3,75 (м, 2H), 1,47-1,55 (м, 2H), 1,14 (т, 3H, J=7,03 Гц), 0,85 (т, 3H, J=7,42 Гц).

В. Получение соединения формулы (3) с изменяющимися группами R 1 , R 2 , X, Y и Z

Аналогично, следуя методике примера 7А или 7В, но необязательно заменяя 5,6-диамино-1-этил-3-пропил-1,3-дигидропиримидин-2,4-дион на другие соединения формулы (2) и необязательно заменяя 1-{[3-(трифторметил)фенил]метил}пиразол-4-карбоновую кислоту на другие соединения формулы Z-Y-X-CO2H, получали следующие соединения формулы (3):

N-(6-амино-1-метил-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3- (трифторметил)фенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-1-метил-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-1-этил-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[3-трифторметил)фенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-1-метил-2,4-диоксо-3-этил-(1,3-дигидропиримидин-5-ил))(1-{[3-фторфенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-1-метил-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[3-фторфенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-1-этил-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[3-фторфенил]метил}пиразол-4-ил)карбоксамид;

N-[6-амино-3-(циклопропилметил)-1-метил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)][1-бензилпиразол-4-ил]карбоксамид;

N-(6-амино-1-метил-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[3-цианофенил]метил}пиразол-4-ил)карбоксамид;

[1-(2-(1H-1,2,3,4-тетразол-5-ил)этил)пиразол-4-ил]-N-[6-амино-3-(циклопропилметил)-1-метил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)]карбоксамид;

N-[6-амино-3-(циклопропилметил)-1-этил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)](1-{[6-(трифторметил)(3-пиридил)]метил}пиразол-4-ил)карбоксамид;

N-[6-амино-3-пропил)-1-этил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)](1-{(2-пиридил)]метил}пиразол-4-ил)карбоксамид;

N-[6-амино-3-(2-метилпропил)-1-метил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)][1-бензилпиразол-4-ил]карбоксамид;

N-[6-амино-3-(2-метилпропил)-1-метил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)][1-{[3-фторфенил]метил}пиразол-4-ил]карбоксамид;

N-[6-амино-3-(2-метилпропил)-1-этил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)][1-{[3-фторфенил]метил}пиразол-4-ил]карбоксамид;

N-[6-амино-3-(2-метилпропил)-1-метил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)][1-{[3-(трифторметил)фенил]метил}пиразол-4-ил]карбоксамид и

N-[6-амино-3-(2-метилпропил)-1-этил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)](1-{[6-(трифторметил)(3-пиридил)метил}пиразол-4-ил)карбоксамид.

C. Получение соединения формулы (3) с изменяющимися группами R 1 и R 2

Аналогично, следуя процедуре примера 7А, но необязательно заменяя 5,6-диамино-1-этил-3-пропил-1,3-дигидропиримидин-2,4-дион на другие соединения формулы (2) и необязательно заменяя 1-{[3-(трифторметил)фенил]метил}пиразол-4-карбоновую кислоту на другие соединения формулы Z-Y-X-CO2H, получали другие соединения формулы (3).

ПРИМЕР 8

Получение соединения формулы I

А. Получение соединения формулы I, в которой R 1 означает н-пропил, R 2 означает этил, X означает 1,4-пиразол, Y является метиленом и Z означает 3-трифторметилфенил

Смесь N-(6-амино-1-этил-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-3-ил)карбоксамида (80 мг, 0,17 ммоль), 10% водного раствора гидроксида натрия (5 мл) и метанола (5 мл) перемешивали при 100ºС в течение 2 часов. Смесь охлаждали, метанол удаляли при пониженном давлении и остаток разбавляли водой и подкисляли хлористоводородной кислотой. Осадок фильтровали, промывали водой, затем метанолом с получением 3-этил-1-пропил-8-(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-диона, соединения формулы I.

1H-ЯМР (ДМСО-d6) δ 8,57 (с, 1H), 8,15 (с, 1H), 7,60-7,75 (м, 4H), 5,54 (с, 2H), 4,05-4,50 (м, 2H), 3,87-3,91 (м, 2H), 1,55-1,64 (м, 2H), 1,25 (т, 3H, J=7,03 Гц), 0,90 (т, 3H, J=7,42 Гц); МС m/z 447,2 (М+).

В. Получение соединения формулы I с изменяющимися группами R 1 , R 2 , X, Y и Z

Аналогично, следуя процедуре примера 8А, но заменяя N-(6-амино-1-этил-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-3-ил)карбоксамид на другие соединения формулы (3), получали следующие соединения формулы I:

1-циклопропилметил-3-метил-8-[1-(фенилметил)пиразол-4-ил]-1,3,7-тригидропурин-2,6-дион;

1-циклопропилметил-3-метил-8-{1-[(3-трифторметилфенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

1-циклопропилметил-3-этил-8-{1-[(3-трифторметилфенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

1-циклопропилметил-3-метил-8-{1-[(3-фторфенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

1-циклопропилметил-3-этил-8-{1-[(3-фторфенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

1-циклопропилметил-3-этил-8-(1-{[6-(трифторметил)(3- пиридил)]метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион;

3-({4-[1-(циклопропилметил)-3-метил-2,6-диоксо-1,3,7-тригидропурин-8-ил]пиразолил}метил)бензолкарбонитрил;

8-[1-(2-(1H-1,2,3,4-тетразол-5-ил)этил)пиразол-4-ил]-3-метил-1-циклопропилметил-1,3,7-тригидропурин-2,6-дион;

1-(2-метилпропил)-3-метил-8-[1-бензилпиразол-4-ил]-1,3,7-тригидропурин-2,6-дион;

1-(2-метилпропил)-3-этил-8-{1-[(3-фторфенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

1-(2-метилпропил)-3-метил-8-{1-[(3-трифторметилфенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

1-(2-метилпропил)-3-метил-8-{1-[(3-фторфенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион;

3-этил-1-(2-метилпропил)-8-(1-{[6-(трифторметил)(3- пиридил)]метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион;

1-этил-3-метил-8-{1-[(3-фторфенил)метил]пиразол-4-ил}-1,3,7-тригидропурин-2,6-дион и

3-этил-1-пропил-8-[1-(2-пиридилметил)пиразол-4-ил]-1,3,7-тригидропурин-2,6-дион.

С. Получение соединения формулы I с изменяющимися группами R 1 , R 2 , X, Y и Z

Аналогично, следуя процедуре примера 8А, но заменяя N-(6-амино-1-этил-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-3-ил)карбоксамид на другие соединения формулы (3), получали другие соединения формулы I.

ПРИМЕР 9

Получение соединения формулы (10)

А. Получение соединения формулы (10), в которой R 1 означает н-пропил

Смесь 6-аминоурацила (5,08 г, 40 ммоль), гексаметилдисилазана (50 мл) и сульфата аммония (260 мг, 1,96 ммоль) кипятили с обратным холодильником в течение 12 часов. После охлаждения твердое вещество отфильтровывали и растворитель удаляли из фильтрата при пониженном давлении с получением триметилсилилированных производных 6-аминоурацила.

Продукт растворяли в толуоле (1,5 мл) и йодпропане (7,8 мл, 80 ммоль) и нагревали на масляной бане при 120ºС в течение 2 часов. Затем реакционную смесь охлаждали до 0ºС и медленно добавляли насыщенный водный раствор бикарбоната натрия. Образовавшийся осадок фильтровали и последовательно промывали водой, толуолом и эфиром с получением 6-амино-3-пропил-1,3-дигидропиримидин-2,4-диона, соединения формулы (10), которое использовали в следующей реакции без дальнейшей очистки.

1H-ЯМР (ДМСО-d6) δ 10,34 (с, 1H), 6,16 (с, 2H), 4,54 (с, 1H), 3,57-3,62 (м, 2H), 1,41-1,51 (м, 2H), 0,80 (т, 3H, J=7,43 Гц).

В. Получение соединения формулы (10) с изменяющейся группой R 1

Аналогично, следуя процедуре примера 9А, но заменяя йодпропан другими галогенидными алкилами формулы R1Hal, получали другие соединения формулы (10), включая

6-амино-3-циклопропилметил-1,3-дигидропиримидин-2,4-дион

и

6-амино-3-(2-метилпропил)-1,3-дигидропиримидин-2,4-дион.

ПРИМЕР 10

Получение соединения формулы (11)

А. Получение соединения формулы (11), в которой R 1 означает н-пропил

К раствору 6-амино-3-пропил-1,3-дигидропиримидин-2,4-диона (5,6 г) в смеси 50% уксусная кислота/вода (160 мл) при 70ºС добавляли нитрит натрия (4,5 г) порциями в течение 15 минут. Смесь перемешивали при 70ºС в течение 45 минут, затем реакционную смесь концентрировали до небольшого объема при пониженном давлении. Твердое вещество фильтровали и промывали водой с получением 6-амино-5-нитрозо-3-пропил-1,3-дигидропиримидин-2,4-диона, соединения формулы (11).

1H-ЯМР (ДМСО-d6) δ 11,42 (с, 1H), 7,98 (с, 1H), 3,77-3,81 (м, 2H), 3,33 (с, 1H), 1,55-1,64 (м, 2H), 0,89 (т, 3H, J=7,43 Гц); МС m/z 198,78 (М+), 220,78 (M+ + Na)

В. Получение соединения формулы (11) с изменяющейся группой R 1

Аналогично, следуя процедуре примера 10А, но заменяя 6-амино-3-пропил-1,3-дигидропиримидин-2,4-дион на другие соединения формулы (10), получали другие соединения формулы (11), включая

6-амино-5-нитрозо-3-циклопропилметил-1,3-дигидропиримидин-2,4-дион и

6-амино-5-нитрозо-3-(2-метилпропил)-1,3-дигидропиримидин-2,4-дион.

ПРИМЕР 11

Получение соединения формулы (12)

А. Получение соединения формулы (12), в которой R 1 означает н-пропил

К раствору 6-амино-5-нитрозо-3-пропил-1,3-дигидропиримидин-2,4-диона (5,4 г, 27 ммоль) в 12,5% водном растворе аммиака (135 мл) при 70ºС добавляли дитионит натрия (Na2S2O4, 9,45 г, 54 ммоль) порциями в течение 15 минут и смесь перемешивали в течение 20 минут. Раствор концентрировали при пониженном давлении, охлаждали до 5ºС, осадок фильтровали и промывали холодной водой с получением 5,6-диамино-3-пропил-1,3-дигидропиримидин-2,4-диона, соединения формулы (12).

1H-ЯМР (ДМСО-d6) δ 0,81 (т, 3H, J=7,43 Гц), 1,43-1,52 (м, 2H), 3,63-3,67 (м, 2H), 5,56 (с, 2H); МС m/z 184,95 (М+), 206,96 (M+ + Na)

В. Получение соединения формулы (12) с изменяющейся группой R 1

Аналогично процедуре примера 11А, но заменяя 6-амино-3-пропил-1,3-дигидропиримидин-2,4-дион на другие соединения формулы (11), получали другие соединения формулы (12), включая

5,6-диамино-3-циклопропилметил-1,3-дигидропиримидин-2,4-дион и

5,6-диамино-3-(2-метилпропил)-1,3-дигидропиримидин-2,4-дион.

ПРИМЕР 12

Получение соединения формулы (13)

А. Получение соединения формулы (13), в которой R 1 означает n-пропил, Х является 1,4-пиразолилом, Y означает метилен и Z означает 3-трифторметилфенил

К смеси 5,6-диамино-3-пропил-1,3-дигидропиримидин-2,4-диона (2,3 г, 126 ммоль) и 1-{[3-(трифторметил)фенил]метил}пиразол-4-карбоновой кислоты (3,79 г, 14 ммоль) в метаноле (50 мл) добавляли хлоргидрат 1-(3-диметиламинопропил)-3-этилкарбодиимида (2,67 г, 14 ммоль) и реакционную смесь перемешивали в течение 3 дней при комнатной температуре (хотя допустимо меньшее время). Осадок фильтровали и промывали последовательно водой и метанолом. Продукт сушили в вакууме с получением N-(6-амино-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифоторметил)фенил]метил}пиразол-4-ил)карбоксамида, соединения формулы (13).

1H-ЯМР (ДМСО-d6) δ 10,44 (с, 1H), 8,56 (с, 1H), 8,37 (с, 1H), 8,00 (с, 1H), 7,56-7,71 (м, 3H), 6,02 (с, 1H), 5,49 (с, 2H), 3,62-3,66 (м, 2H), 1,44-1,53 (м, 2H), 0,82 (т, 3H, J=7,43 Гц); МС m/z 458,92 (M+ + Na)

В. Альтернативное получение соединения формулы (13), в которой R 1 означает н-пропил, Х является 1,4-пиразолилом, Y означает метилен и Z означает 3-трифторметилфенил

Раствор 1-{[3-(трифторметил)фенил]метил}пиразол-4-карбоновой кислоты (1 г, 3,7 ммоль) в тионилхлориде (1 мл) нагревали при 70ºС в течение 4 часов. Избыток тионилхлорида отгоняли и остаток обрабатывали смесью метиленхлорид/гексаны. Растворитель удаляли при пониженном давлении и остаток растворяли в ацетонитриле. Полученный раствор добавляли к суспензии 5,6-диамино-3-пропил-1,3-дигидропиримидин-2,4-диона (2,3 г, 126 ммоль) и триэтиламина (1 мл) в ацетонитриле (20 мл) при 0ºС и перемешивали в течение 16 часов. Реакционную смесь гасили водой (5 мл), подкисляли хлористоводородной кислотой, перемешивали в течение 30 минут и осадок фильтровали. Продукт промывали эфиром с получением N-(6-амино-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифоторметил)фенил]метил}пиразол-4-ил)карбоксамида, соединения формулы (13).

С. Получение соединения формулы (13) с изменяющимися группами R 1 , X, Y и Z

Аналогично, следуя процедуре примера 12А или 12В, но необязательно заменяя 6-амино-3-пропил-1,3-дигидропиримидин-2,4-дион на другие соединения формулы (12) и необязательно заменяя 1-{[3-(трифторметил)фенил]метил}пиразол-4-карбоновую кислоту на другие соединения формулы Z-Y-X-CO2H, получали другие соединения формулы (13), включая

N-(6-амино-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[3- (трифторметил)фенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-2,4-диоксо-3-(2-метилпропил)-(1,3-дигидропиримидин-5-ил))(1-{[3- (трифторметил)фенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-фторфенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[3-фторфенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-2,4-диоксо-3-(2-метилпропил)-(1,3-дигидропиримидин-5-ил))(1-{[3-фторфенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-[1-бензил]пиразол-4-ил)карбоксамид;

N-(6-амино-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-[1-бензил]пиразол-4-ил)карбоксамид;

N-(6-амино-2,4-диоксо-3-(2-метилпропил)-(1,3-дигидропиримидин-5-ил))(1-[1-бензил]пиразол-4-ил)карбоксамид;

N-(6-амино-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-цианофенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[3-цианофенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-2,4-диоксо-3-(2-метилпропил)-(1,3-дигидропиримидин-5-ил))(1-{[3-цианофенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[1-(2-(1H-1,2,3,4-тетразол-5-ил)этил)пиразол-4-ил}карбоксамид;

N-(6-амино-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[1-(2-(1H-1,2,3,4-тетразол-5-ил)этил)пиразол-4-ил)карбоксамид;

N-(6-амино-2,4-диоксо-3-(2-метилпропил)-(1,3-дигидропиримидин-5-ил))(1-{[1-(2-(1H-1,2,3,4-тетразол-5-ил)этил)пиразол-4-ил)карбоксамид;

N-(6-амино-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[6-(трифторметил)(3-пиридил)]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[6-(трифторметил)(3-пиридил)]метил}пиразол-4-ил)карбоксамид и

N-(6-амино-2,4-диоксо-3-(2-метилпропил)-(1,3-дигидропиримидин-5-ил))(1-{[6-(трифторметил)(3-пиридил)]метил}пиразол-4-ил)карбоксамид.

ПРИМЕР 13

Получение соединения формулы (3)

А. Получение соединения формулы (3), в которой R 1 означает н-пропил, R 2 является этилом, X означает 1,4-пиразолил, Y является метиленом и Z означает 3-трифторметилфенил

Смесь раствора N-(6-амино-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-3-ил)карбоксамида (872 мг, 2 ммоль) в диметилформамиде (10 мл), карбоната калия (552 мг, 4 ммоль) и этилйодида (0,24 мл, 3 ммоль) перемешивали при комнатной температуре в течение ночи. Реакционную смесь фильтровали и растворитель упаривали из фильтрата при пониженном давлении. Остаток перемешивали с водой в течение двух часов при комнатной температуре и осадок фильтровали, промывали водой и затем растворяли в метаноле. Затем растворитель удаляли при пониженном давлении с получением N-(6-амино-1-этил-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)карбоксамида, соединения формулы (3).

1H-ЯМР (ДМСО-d6): δ 8,58 (с, 1H), 8,39 (с, 1H), 8,01 (с, 1H), 7,72-7,50 (м, 4H), 6,71 (с, 2H), 5,51 (с, 2H), 4,0-3,82 (м, 2H), 3,77-3,65 (м, 2H), 1,60-1,50 (м, 2H), 1,13 (т, 3H, J=6,8 Гц), 0,84 (т, 3H, J=7,2 Гц); МС m/z 462,9 (М-)

В. Получение соединения формулы (3) с изменяющимися группами R 1 , X, Y и Z

Аналогично, следуя процедуре примера 13А, но заменяя N-(6-амино-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-3-ил)карбоксамид на другие соединения формулы (13), получали другие соединения формулы (3), включая

N-(6-амино-1-метил-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-1-метил-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-1-этил-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-1-метил-2,4-диоксо-3-этил-(1,3-дигидропиримидин-5-ил))(1-{[3-фторфенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-1-метил-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[3-фторфенил]метил}пиразол-4-ил)карбоксамид;

N-(6-амино-1-этил-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[3-фторфенил]метил}пиразол-4-ил)карбоксамид;

N-[6-амино-3-(циклопропилметил)-1-метил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)][1-бензилпиразол-4-ил]карбоксамид;

N-(6-амино-1-метил-2,4-диоксо-3-циклопропилметил-(1,3-дигидропиримидин-5-ил))(1-{[3-цианофенил]метил}пиразол-4-ил)карбоксамид;

[1-(2-(1H-1,2,3,4-тетразол-5-ил)этил)пиразол-4-ил]-N-[6-амино-3-(циклопропилметил)-1-метил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)]карбоксамид;

N-[6-амино-3-(циклопропилметил)-1-этил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)](1-{[6-(трифторметил)(3-пиридил)]метил}пиразол-4-ил)карбоксамид;

N-[6-амино-3-пропил)-1-этил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)](1-{(2-пиридил)метил}пиразол-4-ил)карбоксамид;

N-[6-амино-3-(2-метилпропил)-1-метил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)][1-бензилпиразол-4-ил]карбоксамид;

N-[6-амино-3-(2-метилпропил)-1-метил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)][1-{[3-фторфенил]метил}пиразол-4-ил]карбоксамид;

N-[6-амино-3-(2-метилпропил)-1-этил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)][1-{[3-фторфенил]метил}пиразол-4-ил]карбоксамид;

N-[6-амино-3-(2-метилпропил)-1-метил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)][1-{[3-(трифторметил)фенил]метил}пиразол-4-ил]карбоксамид; и

N-[6-амино-3-(2-метилпропил)-1-этил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)](1-{[6-(трифторметил)(3-пиридил)]метил}пиразол-4-ил)карбоксамид.

ПРИМЕР 14

Получение соединения формулы I

А. Получение соединения формулы I, в которой R 1 означает н-пропил, R 2 означает этил, X является 1,4-пиразолилом, Y означает метилен и Z означает 3-трифторметилфенил

Смесь N-(6-амино-1-этил-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-3-ил)карбоксамида (850 мг, 2,34 ммоль), 10% водного раствора гидроксида натрия (10 мл) и метанола (10 мл) перемешивали при 100ºС в течение 18 часов. Смесь охлаждали, метанол удаляли при пониженном давлении и остаток смеси подкисляли хлористоводородной кислотой до рН 2. Осадок фильтровали, промывали смесью вода/метанол с получением 3-этил-1-пропил-8-(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-диона, соединения формулы I.

1H-ЯМР (ДМСО-d6) δ 8,57 (с, 1H), 8,15 (с, 1H), 7,60-7,75 (м, 4H), 5,54 (с, 2H), 4,05-4,50 (м, 2H), 3,87-3,91 (м, 2H), 1,55-1,64 (м, 2H), 1,25 (т, 3H, J=7,03 Гц), 0,90 (т, 3H, J=7,42 Гц); МС m/z 447,2 (М+)

В. Получение соединения формулы I с изменяющимися группами R 1 , R 2 , X, Y и Z

Аналогично, следуя процедуре примера 14А, но заменяя N-(6-амино-1-этил-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-3-ил)карбоксамид на другие соединения формулы (13), получали другие соединения формулы I, включая соединения, перечисленные в примере 8.

ПРИМЕР 15

Получение соединения формулы (14)

А. Получение соединения формулы (14), в которой R 2 означает этил

К раствору 6-амино-1-этил-1,3-дигидропиримидин-2,4-диона (5,0 г, 32,3 ммоль) в 50% смеси уксусная кислота/вода (50 мл) при 70ºС добавляли нитрит натрия (4,45 г, 64,5 ммоль) порциями в течение 30 минут. Смесь перемешивали при 70ºС в течение еще 30 минут. Реакционную смесь охлаждали и осадок фильтровали и промывали водой, затем метанолом с получением 6-амино-1-этил-5-нитрозо-1,3-дигидропиримидин-2,4-диона, соединения формулы (14).

1H-ЯМР (ДМСО-d6): δ 11,52 (с, 1H), 9,16 (с, 1H), 3,83 (кв., 2H, J=7,0 Гц), 1,11 (т, 3H, J=7,0 Гц). МС m/z 184,8 (М+), 206,80 (M+ + Na)

В. Получение соединения формулы (14) с изменяющейся группой R 2

Аналогично, следуя процедуре примера 15А, но заменяя 6-амино-1-этил-1,3-дигидропиримидин-2,4-дион на 6-амино-1-метил-1,3-дигидропиримидин-2,4-дион, 6-амино-1-метил-5-нитрозо-1,3-дигидропиримидин-2,4-дион был получен.

С. Получение соединения формулы (14) с изменяющейся группой R 2

Аналогично, следуя процедуре примера 15А, но заменяя 6-амино-1-этил-1,3-дигидропиримидин-2,4-дион другими соединениями формулы (5), получали другие соединения формулы (14).

ПРИМЕР 16

Получение соединения формулы (15)

А. Получение соединения формулы (15), в которой R 2 означает этил

К раствору 6-амино-1-этил-5-нитрозо-1,3-дигидропиримидин-2,4-диона (3,9 г, 21,2 ммоль) в 14,5% водном растворе аммиака (50 мл) при 50ºС добавляли дитионит натрия (Na2S2O4, 7,37 г, 42,4 ммоль) порциями в течение 15 минут и смесь перемешивали в течение 20 минут. Раствор концентрировали при пониженном давлении до объема 30 мл, охлаждали до 5ºС, осадок фильтровали и промывали холодной водой с получением 5,6-диамино-1-этил-1,3-дигидропиримидин-2,4-диона, соединения формулы (15).

1H-ЯМР (ДМСО-d6): δ 10,58 (с, 1H), 6,18 (с, 2H), 3,83 (кв., 2H, J=7,2 Гц), 2,82 (с, 2H), 1,10 (т, 3H, J=7,2 Гц).

В. Получение соединения формулы (15) с изменяющейся группой R 2

Аналогично, следуя процедуре примера 16А, но заменяя 6-амино-1-этил-5-нитрозо-1,3-дигидропиримидин-2,4-дион на 6-амино-1-метил-5-нитрозо-1,3-дигидропиримидин-2,4-дион, 5,6-диамино-1-метил-1,3-дигидропиримидин-2,4-дион был получен.

С. Получение соединения формулы (15) с изменяющейся группой R 2

Аналогично, следуя процедуре примера 16А, но заменяя 6-амино-1-этил-5-нитрозо-1,3-дигидропиримидин-2,4-дион другими соединениями формулы (14), другие соединения формулы (15) были получены.

ПРИМЕР 17

Получение соединения формулы (16)

А. Получение соединения формулы (16), в которой R 2 означает этил, Х является 1,4-пиразолилом, Y означает метилен и Z означает 3-трифторметилфенил

К смеси 5,6-диамино-1-этил-1,3-дигидропиримидин-2,4-диона (2 г, 11,76 ммоль) и 1-{[3-(трифторметил)фенил]метил}пиразол-4-карбоновой кислоты (3,5 г, 12,94 ммоль) в метаноле (50 мл) добавляли хлоргидрат 1-(3-диметиламинопропил)-3-этилкарбодиимида (2,47 г, 12,94 ммоль) и реакционную смесь перемешивали в течение 16 часов при комнатной температуре. Растворитель удаляли при пониженном давлении и остаток промывали водой и метанолом. Продукт сушили в вакууме с получением N-(6-амино-1-этил-2,4-диоксо-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)карбоксамида, соединения формулы (16).

1H-ЯМР (ДМСО-d6): δ 10,60 (с, 1H), 8,50 (с, 1H), 8,39 (с, 1H), 8,01 (с, 1H), 7,72-7,50 (м, 4H), 6,69 (с, 2H), 5,50 (с, 2H), 3,87 (кв., 2H, J=7,2 Гц), 1,11 (т, 3H, 7,2 Гц); МС m/z 421 (M+)

В. Получение соединения формулы (16) с изменяющимися группами R 2 , X, Y и Z

Аналогично, следуя процедуре примера 17А, но заменяя 5,6-диамино-1-этил-1,3-дигидропиримидин-2,4-дион на 5,6-диамино-1-метил-1,3-дигидропиримидин-2,4-дион, был получен N-(6-амино-1-метил-2,4-диоксо-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)карбоксамид.

С. Получение соединения формулы (16) с изменяющимися группами R 2 , X, Y и Z

Аналогично, следуя процедуре примера 17А, но заменяя 5,6-диамино-1-этил-1,3-дигидропиримидин-2,4-дион на другие соединения формулы (14), получали другие соединения формулы (16).

ПРИМЕР 18

Получение соединения формулы (3)

А. Получение соединения формулы (3), в которой R 1 означает н-пропил, R 2 означает этил, Х является 1,4-пиразолилом, Y означает метилен и Z означает 3-трифторметилфенил

Смесь раствора N-(6-амино-1-этил-2,4-диоксо-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-3-ил)карбоксамида (1,5 г, 3,55 ммоль) в диметилформамиде (30 мл), карбоната калия (980 мг, 7,1 ммоль) и пропилиодида (724 мг, 4,26 ммоль) перемешивали при комнатной температуре в течение ночи. Добавляли воду и образовавшийся осадок фильтровали с получением N-(6-амино-1-этил-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)карбоксамида, соединения формулы (3), которое использовали в следующей реакции без очистки.

1H-ЯМР (ДМСО-d6): δ 8,58 (с, 1H), 8,39 (с, 1H), 8,01 (с, 1H), 7,72-7,50 (м, 4H), 6,71 (с, 2H), 5,51 (с, 2H), 4,0-3,82 (м, 2H), 3,77-3,65 (м, 2H), 1,60-1,50 (м, 2H), 1,13 (т, 3H, J=6,8 Гц), 0,84 (т, 3H, J=7,2 Гц); МС m/z 462,9 (M-)

В. Получение соединения формулы (3) с изменяющимися группами R 1 , R 2 , X, Y и Z

Аналогично, следуя процедуре примера 18А, но заменяя N-(6-амино-1-этил-2,4-диоксо-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-3-ил)карбоксамид на N-(6-амино-1-метил-2,4-диоксо-(1,3-дигидропиримидин-5-ил)), получали N-(6-амино-1-метил-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)карбоксамид.

С. Получение соединения формулы (3) с изменяющимися группами R 1 , R 2 , X, Y и Z

Аналогично, следуя процедуре примера 18А, но необязательно заменяя N-(6-амино-1-этил-2,4-диоксо-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-3-ил)карбоксамид на другие соединения формулы (15) и необязательно заменяя пропилиодид другими соединениями формулы R1Hal, получали другие соединения формулы (3).

ПРИМЕР 19

Получение соединения формулы I

А. Получение соединения формулы I, в которой R 1 означает н-пропил, R 2 означает этил, Х является 1,4-пиразолилом, Y означает метилен и Z означает 3-трифторметилфенил

Смесь N-(6-амино-1-этил-2,4-диоксо-3-пропил-(1,3-дигидропиримидин-5-ил))(1-{[3-(трифторметил)фенил]метил}пиразол-3-ил)карбоксамида (300 мг, 464 ммоль), 20% водного раствора гидроксида натрия (5 мл) и метанола (10 мл) перемешивали при 80ºС в течение 3 часов. Смесь охлаждали, метанол удаляли при пониженном давлении и остаток смеси подкисляли хлористоводородной кислотой до рН 2. Осадок фильтровали, промывали водой и метанолом с получением 3-этил-1-пропил-8-(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-диона, соединения формулы I.

1H-ЯМР (ДМСО-d6) δ 8,57 (с, 1H), 8,15 (с, 1H), 7,60-7,75 (м, 4H), 5,54 (с, 2H), 4,05-4,50 (м, 2H), 3,87-3,91 (м, 2H), 1,55-1,64 (м, 2H), 1,25 (т, 3H, J=7,03 Гц), 0,90 (т, 3H, J=7,42 Гц); МС m/z 447,2 (M+)

ПРИМЕР 20

ХАРАКТЕРИСТИКА АНТАГОНИСТОВ РЕЦЕПТОРОВ А

Связывание радиолиганда с рецепторами аденозина А

кДНК (cDNA) рецепторов аденозина А человека стабильно переносили в клетки HEK-293 (названные как HEK-A2B-клетки). Монослои клеток НЕК-А2В промывали буфером PBS один раз и собирали в буфер, содержащий 10 мМ HEPES (рН 7,4), 10 мМ ЭДТА (EDTA) и ингибиторы протеаз. Указанные клетки гомогенизировали в устройстве Polytron в течение 1 минуты при положении 4 и центрифугировали при 29000 g в течение 15 минут при 4ºС. Клеточные осадки промывали один раз буфером, содержащим 10 мМ HEPES (pH 7,4), 1 мМ ЭДТА и ингибиторы протеаз, и ресуспендировали в таком же буфере, снабженном 10% сахарозой. Замороженные аликвоты держали при -80ºС.

Конкурентный анализ начинали путем смешивания 10 нМ 3Н-ZM241385 (Tocris Cookson) с различными концентрациями испытуемых соединений и 50 мкг мембранных белков в ТЕ-буфере (50 мМ Трис и 1 мМ ЭДТА), снабженном аденозиндезаминазой 1 ед./мл. Пробы инкубировали в течение 90 минут, реакцию останавливали путем фильтрации, используя Packard Harvester, и смесь промывали четыре раза охлажденным льдом ТМ-буфером (10 мМ Трис, 1 мМ MgCl2, pH 7,4). Неспецифическое связывание определяли в присутствии 10 мкМ ZM241385. Сродство соединений (т.е. величины Ki) рассчитывали, используя программу GraphPad.

Связывание радиолиганда с другими рецепторами аденозина

кДНК рецепторов аденозина А1, А, А3 стабильно переносили в клетки либо СНО, либо НЕК-293 (называемые как СНО-А1, НЕК-А, СНО-А3). Мембраны выделяли из указанных клеток, используя такой же протокол, как описанный выше. Конкурентный анализ начинали путем смешивания 0,5 нМ 3Н-СРХ (для СНО-А1), 2 нМ 3Н-ZM214385 (HEK-A2A) или 0,1 нМ 125I-AB-MECA (CHO-A3) с различными концентрациями испытуемых соединений и перспективными мембранами в ТЕ-буфере (50 мМ Трис и 1 мМ ЭДТА для СНО-А1 и НЕК-А) или ТЕМ-буфере (50 мМ Трис, 1 мМ ЭДТА и 10 мМ MgCl2 для СНО-А3), снабженном аденозиндезаминазой 1 ед./мл. Пробы инкубировали в течение 90 минут, реакцию останавливали путем фильтрации, используя Packard Harvester, и смесь промывали четыре раза охлажденным льдом ТМ-буфером (10 мМ Трис, 1 мМ MgCl2, pH 7,4). Неспецифическое связывание определяли в присутствии 1 мкМ СРХ (СНО-А1), 1 мкМ ZM241385 (HEK-A2A) и 1 мкМ IB-MECA (СНО-А3). Сродство соединений (т.е. величины Ki) рассчитывали, используя программу GraphPadТМ.

Количественное определение сАМР

Монослой трансфицированных клеток собирали в буфере PBS, содержащем 5 мМ ЭДТА. Клетки промывали один раз средой DMEM и ресуспендировали в среде DMEM, содержащей аденозиндезаминазу 1 ед./мл при плотности 100000-500000 клеток/мл. 100 мкл клеточной суспензии смешивали с 25 мкл, содержащими различные агонисты и/или антагонисты, и реакцию проводили при 37ºС в течение 15 минут. По завершении 15 минут 125 мкл 0,2 N HCl добавляли для остановки реакции. Клетки центрифугировали в течение 10 минут при 1000 об/мин. 100 мкл супернатанта отбирали и подвергали ацетилированию. Концентрацию сАМР в супернатантах измеряли, используя прямой анализ сАМР от Assay Design. Рецепторы аденозина А и А связываются с Gs-белками, и таким образом агонисты рецепторов аденозина А (такие, как CGS21680) или рецепторов аденозина А (такие, как NECA) увеличивают накопление сАМР, в то время как антагонисты указанных рецепторов препятствуют увеличению накопления сАМР, индуцированного агонистами. Рецепторы аденозина А1 и А3 связываются с Gi-белками, и таким образом агонисты рецепторов аденозина А1 (такие, как СРА) или рецепторов аденозина А3 (такие, как IB-MECA) ингибируют увеличение накопления сАМР, индуцированного форсколином. Антагонисты рецепторов А1 и А3 препятствуют ингибированию накопления сАМР.

Анализ RT-PCR в режиме реального времени выполняли для определения уровней экспрессии подтипов рецепторов аденозина (AdoR) на первичных культурах звездчатых клеток печени человека (HHSC). Наряду с четырьмя подтипами AdoR рецепторы АAdoR экспрессировали при высоком уровне. Кроме того, используя концентрацию сАМР в клетке как функциональный показатель, результаты авторов изобретения показали, что рецепторы A AdoR функционально экспрессировали на HHSC, в то время как A1, A2A или A3 AdoR не экспрессировали. Влияние аденозина или NECA, стабильного аналога аденозина, на экспрессию воспалительных цитокинов определяли, используя метод ELISA. Аденозин и NECA повышали высвобождение IL-6 зависимым от концентрации способом с максимальным увеличением в 11,9±3,1 раз над фоновым уровнем. Кроме того, агонист NECA повышал экспрессию α-актина гладких мышц и α-1 проколлагена и продуцирование коллагена из HHSC. Эффекты NECA полностью уничтожались антагонистом АAdoR и частично блокировались нейтрализующим антителом против IL-6.

ПРИМЕР 21

ВЛИЯНИЕ АНТАГОНИСТА А НА ЗВЕЗДЧАТЫЕ КЛЕТКИ ПЕЧЕНИ ЧЕЛОВЕКА

Сокращения

Ab антитело
AdoR рецептор аденозина
ADA аденозиндезаминаза
ANOVA дисперсионный анализ
AST аспартатаминотрансфераза
CPA N-6-циклопентиладенозин
DMEM модифицированная по способу Дульбекко среда Игла
DMSO диметилсульфоксид
DNase дезоксирибонуклеаза
HEPES 4-(2-гидроксиэтил)-1-пиперазинэтансульфокислота
HHSC звездчатые клетки печени человека
NECA 5'-(N-этилкарбоксамидо)аденозин

Материалы и методы

Материалы

Избирательные антагонисты рецептора А (8-(1-{[5-(4-хлорфенил)-(1,2,4-оксадиазол-3-ил)]метил}пиразол-4-ил)-1-пропил-1,3,7-тригидропурин-2,6-дион (соединение (1)) и 3-этил-1-пропил-8-(1-{[3-(трифторметил)фенил]метил}пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион (соединение (2)) были синтезированы отделением биоорганической химии при CV Therapeutics Inc. (Palo Alto, CA), и синтез был описан в ранней публикации авторов изобретения Zhong et al. (2004) Am. J. Respir. Cell. Mol. Biol., 30(1): 118-125. Все другие реагенты, такие как ролипрам, форсколин, NECA и аденозиндезаминаза (ADA) и т.д., были приобретены у фирмы Sigma (St. Louis, MO), если не указано иное.

Культура клеток

Первичные культуры звездчатых клеток нормальной печени человека (HHSC) получали из ScienCell Research Laboratories (San Diego, CA) и культивировали, используя среду для роста звездчатых клеток (ScienCell Research Laboratories). Клетки HHSC выращивали, как положено, во влажной камере с 5% СО2 при 37ºС и пересевали, когда клетки достигали приблизительно 80-90% конфлюэнтности. Каждый повторный пересев называют пассажем. Клетки от 2-5 пассажей использовали в следующих исследованиях.

Стимуляция HHSC

Клетки HHSC засевали в 12-луночные планшеты для культуры ткани при плотности 1×105 клеток/лунка в среде для роста звездчатых клеток и оставляли для прилипания клеток в течение ночи и достижения конфлюентности ~90%. Клетки дважды промывали в забуференном HEPES физиологическом растворе и культивировали в среде DMEM, содержащей различные агонисты и антагонисты AdoR, в течение 1 или 24 часов.

Экстракция РНК и метод RT-PCR в режиме реального времени

Тотальную РНК экстрагировали из клеток HHSC, используя набор реагентов РНКTM RT-PCR Miniprep Kit от компании Stratagene, с последующей обработкой ДНКазой для исключения потенциальной нежелательной примеси геномной ДНК. Метод RT-PCR в режиме реального времени для рецепторов аденозина осуществляли, как описано ранее в публикации Zhong et al. (2004) Am. J. Respir. Cell. Mol. Biol., 30(1): 118-125.

Используемыми специфическими праймерами для α-актина гладких мышц были

прямой: 5' TGGGAATGGGACAAAAAGACA3' (SEQ ID NO: 1) и

обратный: 5' CGGGTACTTCAGGGTCAGGT3' (SEQ ID NO: 2),

в то время как праймерами для α-1 проколлагена были

прямой: 5' CACCAATCACCTGCGTACAGA3' (SEQ ID NO: 3)

обратный: 5' CAGATCACGTCATCGCACAAC3' (SEQ ID NO: 4),

и каждый из указанных праймеров был разработан при использовании Primer Express 2.0 (Applied Biosystems), следуя рекомендованным указаниям, основанным на последовательностях из банка генов Genbank. В конце цикла PCR кривая диссоциации была построена для доказательства амплификации единичного продукта и время порогового цикла (величина Ct) для каждого гена было определено. Относительные уровни мРНК рассчитывали на основании величин Ct, стандартизировали к β-актину в одном и том же образце и представляли в виде процентов мРНК β-актина.

Измерение уровня накопления сАМР

Клетки собирали, используя 0,0025% трипсин и 2 мМ ЭДТА в PBS, промывали и ресуспендировали в свободной от фенола среде DMEM до концентрации 1×106 клеток/мл и затем инкубировали с ADA 1 ед./мл в течение 30 мин при комнатной температуре. Затем клетки обрабатывали агонистами, антагонистами AdoR и форсколином в присутствии 50 мкМ ингибитора фосфодиэстеразы IV, ролипрама. После инкубации в течение 15 мин при 37ºС клетки подвергали лизису и концентрации сАМР определяли, используя систему cAMP-Screen DirectTM System (Аpplied Biosystems), согласно инструкциям производителя.

Количественное определение IL-6, коллагена и аспартатаминотрансферазы (AST)

Концентрацию IL-6 в клеточной среде определяли, используя наборы для анализа ELISA, полученные от компании Biosource (Camarillo, CA), согласно инструкциям производителя. Минимальные уровни IL-6, обнаруживаемые с помощью указанных наборов, составили 2 пг/мл. Концентрацию растворимого коллагена в клеточной среде измеряли с помощью Sirco1-пробы на коллаген (Biocolor Ltd., Belfast N. Ireland), согласно инструкциям производителя. Активность AST в плазме мышей определяли, используя InfinityТМ AST-анализ (Thermo Electron Corporation, Waltham, MA).

Мыши

Мышей с недостаточностью аденозиндезаминазы (ADA) выращивали и генотипировали, как описано в публикации Blackburn et al. (1998), J. Biol. Chem., 273(9): 5093-5100. Мышей, гомозиготных по нуль-аллелю Ada, обозначали как ADA-дефицитные (ADA -/- ), в то время как мышей, гетерозиготных по нуль-аллелю Ada, обозначали как ADA-контрольные мыши (ADA + ). Всех мышей поддерживали на смешанном генетическом фоне 129sv/C57BL/6J, и все фенотипические сравнения были выполнены среди однопометных животных. Уход за животными был обеспечен в соответствии с институтскими рекомендациями и указаниями NIH. Мышей содержали в вентилируемых клетках, снабженных крышками для микроизоляторов, и соблюдали условия жесткого ограничения в опытах по генной инженерии. Свидетельств бактериального, паразитарного или грибкового заражения не было обнаружено, и серологические исследования на однопометных животных в клетках показали отрицательный результат относительно 12 из самых общих мышиных вирусов.

Обработка антагонистами

ADA -/--мышей идентифицировали при рождении путем проверки ферментативной активности ADA в крови, как описано в публикации Young et al. (2004) J. Immunol., 173(2): 1380-1389. ADA -/--мышей поддерживали на терапии ферментом ADA от 2-го дня после рождения до 21 дня после рождения, как описано в публикации Young et al. (2004). На этой стадии начинали обработки соединением (2) (1 мг/кг на инъекцию) или наполнителем (кукурузное масло/этанол/ДМСО). Обработки заключались во внутрибрюшинной инъекции i.p. утром и вечером в течение 17 дней. Обрабатываемые группы включали ADA -/-- или ADA +-мышей, получающих соединение (2), наполнитель или без обработки. Все мыши были однопометные, и как самцы, так и самки были включены в данные эксперименты.

Статистический анализ

Данные были представлены как средние величины ± SEM, по меньшей мере, из трех отдельных экспериментов. Статистический анализ осуществляли, используя двухсторонний t-тест Стьюдента, или дисперсионный анализ ANOVA, затем тест Newman-Keuls для многочисленных сравнений. Величина р<0,05 считается значимой.

РЕЗУЛЬТАТЫ

Экспрессия подтипов AdoR в HHSC

Метод RT-PCR в режиме реального времени осуществляли для количественной оценки уровней транскриптов рецепторов AdoR. Наряду с четырьмя подтипами рецептор А имел самый высокий уровень транскрипта (фигура 1). Более низкие уровни транскриптов рецепторов А1 и А также были определены, в то время как транскрипт рецепторов А3 был ниже предела обнаружения. В результате порядок данных уровней мРНК AdoR был А>>А1>>А3.

Во многих типах клеток активация рецепторов А или А приводит к повышению накопления сАМР в клетке, в то время как активация рецепторов А1 или А3 уменьшает накопление сАМР в клетке, вызванное активатором аденилатциклазы, форсколином. Для того чтобы идентифицировать подтип(ы) рецепторов AdoR, который является функционально экспрессированным в HHSC, влияние неизбирательного агониста NECA и некоторых других избирательных агонистов на клеточное накопление сАМР определяли. NECA является стабильным аналогом аденозина, и он активирует все четыре подтипа AdoR, включая рецепторы А. Как показано на фигуре 2А, NECA повышает клеточное накопление сАМР зависимым от концентрации образом. В противоположность избирательный агонист А, CGS-21680 (≤10 мкМ), не вызывает существенного увеличения концентрации сАМР в клетке. Кроме того, избирательный агонист А1, СРА (1 мкМ), и избирательный агонист А3, IB-MECA (1 мкМ), не ингибируют накопление сАМР в клетке, вызванное форсколином (10 мкМ, фигура 2В).

Поскольку не существует избирательного агониста рецепторов А, определяли влияние избирательного антагониста рецепторов А, соединения (1), на NECA-индуцированное клеточное накопление сАМР. Соединение (1) имеет самое высокое сродство к рецептору Аi=7 нМ) и очень низкое сродство относительно трех других подтипов AdoR (величины Ki составляют более чем 5 мкМ для рецепторов А1, А и А3) (Zhong et al. (2004) и Zhong et al. (2005) Am. J. Respir. Cell. Mol. Biol., 32(1): 2-8). Как показано на фигуре 2А, соединение (1) (1 мкМ) значительно уменьшает NECA-индуцированное клеточное накопление сАМР. Таким образом, используя концентрацию сАМР в клетке в качестве показателя функциональной экспрессии AdoR, было показано, что рецепторы А являются функционально экспрессированными в HHSC, в то время как рецепторы А1, А или А3 не являются таковыми.

Активация рецептора А повышала высвобождение IL-6 из HHSC

Концентрации IL-6 в культуральной среде клеток, обработанных аденозином и NECA, оценивали, используя метод ELISA. Как показано на фигуре 3, как аденозин, так и NECA увеличивали степень высвобождения IL-6 зависимым от концентрации образом. NECA (100 мкМ) вызывал 11,9±3,1-кратное увеличение степени высвобождения IL-6 по сравнению с обработанными наполнителем клетками. Для того чтобы оценить роль рецепторов А в продуцировании IL-6, индуцированном NECA, клетки инкубировали с соединением (1) (1 мкМ) вместе с NECA (10 мкМ). Антагонист рецептора А, соединение (1) (1 мкМ), снижал NECA-повышенное высвобождение IL-6 на 90,7±0,1% (фигура 3В). Полученные результаты подтвердили, что NECA-индуцированное высвобождение IL-6 опосредуется подтипом рецептора А.

Влияние NECA на экспрессию α-актина гладких мышц и α-1 проколлагена

Активация HHSC с накоплением интерстициальных коллагенов является признаком фиброза печени. α-Актин гладких мышц является маркером для миофибробласта, и, следовательно, повышенная экспрессия α-актина гладких мышц является показателем дифференцировки HHSC в миофибробласт. Влияние NECA на экспрессию α-актина гладких мышц и α-1 проколлагена определяли, используя метод RТ-PCR в режиме реального времени. Как показано на фигуре 4, NECA значительно повышал экспрессию как α-актина гладких мышц (фигура 4А), так и α-1 проколлагена (фигура 4В). На основании полученных результатов было сделано предположение, что NECA может стимулировать активацию HHSC и продуцирование коллагена.

Повышенное продуцирование коллагена при активации рецептора A 2B частично опосредуется IL-6

Для того чтобы подтвердить роль NECA в продуцировании коллагена, оценивали концентрации растворимого коллагена в культуральной среде клеток, обработанных NECA. NECA вызывал значительное повышение секреции коллагена (фигура 5). Полученный эффект NECA отменялся при действии антагониста рецептора А, соединения (1). Для того чтобы установить, зависит ли действие NECA на продуцирование коллагена от высвобождения IL-6, к клеточной среде добавляли нейтрализующее антитело Ab против IL-6 в течение обработки NECA. Было показано, что нейтрализующее антитело Ab против IL-6 частично или значительно снижало эффект NECA. Полученные результаты показали, что активация рецептора А приводит к повышению продуцирования коллагена, и данный эффект частично опосредуется высвобожденным IL-6 из HHSC.

Влияние антагонизма рецептора А на уровни AST у ADA-дефицитных мышей

ADA метаболизирует аденозин; поэтому повышенные уровни аденозина часто наблюдаются среди тканей, включая печень, у ADA-дефицитных мышей, см. Blackburn et al. (1998), J. Biol. Chem. 273(9): 5093-5100. Уровни AST в плазме исследовали у ADA +- и ADA -/--мышей, обработанных наполнителем или соединением (2). Уровни AST повышались у ADA -/--мышей по сравнению с ADA +-мышами. Обработка ADA -/--мышей соединением (2) приводила к значительному снижению уровней AST (фигура 6). На основании полученных результатов было сделано предположение, что антагонизм рецептора А может препятствовать повышению уровня AST у ADA -/--мышей.

1. Способ лечения или предотвращения фиброза печени путем введения нуждающемуся в этом млекопитающему терапевтически эффективного количества антагониста рецептора аденозина А2B, представляющего собой 3-этил-1-пропил-8-(1-{[3-(трифторметил)фенил]метил} пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион.

2. Способ по п.1, где болезнь печени является следствием хирургического вмешательства.

3. Способ по п.1, где болезнь печени является следствием гепатотоксического лечения.

4. Способ по п.3, где гепатотоксическое лечение заключается во введении гепатотоксического лекарственного средства.

5. Способ по п.4, где гепатотоксическое лекарственное средство является дозозависимым гепатотоксическим лекарственным средством.

6. Способ по п.4, где гепатотоксическое лекарственное средство выбирают из группы, состоящей из ацебутолола; ацетаминофена; актиномицина d; адренокортикальных стероидов; адриамицина; аллопуринола; амоксициллина/клавуланата; анаболических стероидов; противовоспалительных лекарственных средств; антитироидных лекарственных средств; аспирина; атенолола; азатиоприна; каптоприла; карбамазепина; карбимазола; кармустина; цефалоспоринов; хлордиазепоксида; хлорпромазина; хлорпропамида; циметидина; клоксациллина флекаинида; циклофосфамида; циклофосфамида/циклоспорина; циклоспорина; дакарбазина; даназола; дантролена; диазепама; диклофенака; дилтиазема; дизопирамида; эналаприла; энфлюрана; эритромицина; этамбутола; этионамида; флуразепама; флутамида; глибурида; золота; гризеофульвина; галоперидола; галотана; гидралазина; ибупрофена; имипрамина; индометацина; изониазида; кетоконазола; лабеталола; мапротилина; меркаптопурина; метотрексата; метилдопы; метилтестостерона; метопролола; миансерина; митомицина; напроксена; никотиновой кислоты; нифедипина; нитрофурантоина; нестероидных средств; норэтандролона; оральных контрацептивов; оксациллина; пара-аминосалициловой кислоты; пеницилламина; пенициллина; пенициллинов; фенелзина; фениндиона; фенобарбитала; фенотиазинов; фенилбутазона; фенитоина; фенитоина тролеандомицина; пироксикама; пробенецида; прокаинамида; пропоксифена; пиразинамида; хинидина; хинина; ранитидина; салицилатов; сульфонамидов; сулиндака; тамоксифена; тербинафина НСl (ламизила, споранокса); тестостерона; тетрациклинов; тиабендазола; тиогуанина; торотраста; толбутамида; трициклических антидепрессантов; вальпроевой кислоты; верапамила; винкристина; витамина А и их комбинаций.

7. Способ по п.3, где гепатотоксическое лечение включает лучевую терапию.

8. Способ по п.1, где антагонист рецептора аденозина A2B вводят перорально.

9. Способ по п.1, где млекопитающим является человек.

10. Способ снижения гепатотоксических побочных эффектов химиотерапии или лучевой терапии путем введения млекопитающему, подвергающемуся такому лечению, терапевтически эффективного количества антагониста рецептора аденозина А2B, представляющего собой 3-этил-1-пропил-8-(1-{[3-(трифторметил)фенил]метил} пиразол-4-ил)-1,3,7-тригидропурин-2,6-дион.

11. Способ по п.10, где антагонист рецептора аденозина А2B вводят до начала химиотерапевтического лечения или лучевой терапии.

12. Способ по п.10, где антагонист рецептора аденозина А2B вводят одновременно с введением химиотерапевтического средства.

13. Способ по п.10, где антагонист рецептора аденозина А2B вводят перорально.

14. Способ по п.10, где млекопитающим является человек.



 

Похожие патенты:
Изобретение относится к области фармацевтики. .

Изобретение относится к медицине, а именно к экспериментальной хирургии, и может быть использовано для профилактики и лечения последствий ишемического воздействия на печень в условиях временного ее выключения из кровообращения.

Изобретение относится к медицине, а именно - к физиотерапии, гастроэнтерологии. .
Изобретение относится к медицине, а именно к хирургии и гепатологии, и касается стимуляции регенерации печени при фиброзных изменениях различного генеза. .

Изобретение относится к новым пиперазинамидным производным формулы (I), где Х представляет собой N или СН; Y представляет собой N или СН; R1 представляет собой низший алкил, фенил, фенил-низший алкил, где фенил необязательно может быть замещен 1-2 заместителями, независимо выбранными из группы, состоящей из галогена, низшего алкила; R2 представляет собой низший алкил, фенил, нафтил или гетероарил, выбранный из диметилизоксазолила, хинолинила, тиофенила или пиридинила, где фенил или гетероарил необязательно могут быть замещены 1 заместителем, независимо выбранным из группы, состоящей из галогена, низшей алкоксигруппы, фтор-низшего алкила, низшего алкокси-карбонила и фенила; R 3 представляет собой фенил, пиридинил или пиразинил, где фенил, пиридинил или пиразинил замещены 1-2 заместителями, независимо выбранными из группы, состоящей из галогена, низшего алкила и фтор-низшего алкила; R4, R5, R6 , R7, R8, R9, R10 и R11 независимо друг от друга представляют собой водород, а также к их физиологически приемлемым солям.

Изобретение относится к медицине и фармакологии и касается гепатопротективного средства, полученного из маакии амурской. .
Изобретение относится к медицине, а именно к терапии, физиотерапии. .

Изобретение относится к области органической химии, к производным 4-хинолонов, а именно к неизвестным ранее 1H-пирроло[3,4-b]хинолин-3,9(2H, 4H)-дионам общей формулы 1, которые могут найти применение в медицине в качестве противотуберкулезных средств, а также к способу их получения.
Изобретение относится к медицине, кардиологии, и может быть использовано для прогнозирования спазма коронарных артерий у больных ишемической болезнью сердца во время чрескожного коронарного вмешательства.

Изобретение относится к химико-фармацевтической промышленности и касается способа получения лекарственного средства, содержащего восковые матричные гранулы, в том числе содержащие лекарственное средство восковые матричные гранулы, имеющие средний диаметр частицы гранул в интервале от 40 до 200 мкм.

Изобретение относится к медицине, а именно к травматологии и ортопедии, и может быть использовано для лечения дегеративно-дистрофических заболеваний опорно-двигательного аппарата и посттравматических спаечных процессов.

Изобретение относится к медицине, а именно к дерматологии, и может быть использовано для лечения атопического дерматита у детей, проживающих в условиях воздействия техногенных химических факторов при повышенной контаминации биосред организма.

Изобретение относится к новым кристаллическим формам дигидрохлорида (6R)-L-эритро-тетрагидробиоптерина, их гидратам и/или сольватам (вариантам), приведены данные характеристические рентгенограммы дифракционных полос на порошке с излучением Cu K 1 с характеристическими пиками, выраженными в значениях d ( ).
Изобретение относится к химико-фармацевтической промышленности и представляет собой фармацевтическую композицию, обладающую противовирусной активностью, содержащую терапевтически эффективное количество ацикловира (или его соли, или эфира), в качестве вспомогательных веществ гидрофобный компонент, пропиленгликоль, эмульгатор и воду, отличающуюся тем, что дополнительно содержит УФ-фильтр Escalol 567, кремнийорганический эластомер DC 9045, циклометикон DC 345, кератолитик мочевину, трометамол, консервант
Наверх