Способ диагностики биоматериалов на наличие в них агробактерий



Способ диагностики биоматериалов на наличие в них агробактерий
Способ диагностики биоматериалов на наличие в них агробактерий
Способ диагностики биоматериалов на наличие в них агробактерий
Способ диагностики биоматериалов на наличие в них агробактерий
Способ диагностики биоматериалов на наличие в них агробактерий
Способ диагностики биоматериалов на наличие в них агробактерий
Способ диагностики биоматериалов на наличие в них агробактерий

 


Владельцы патента RU 2458142:

Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования Санкт-Петербургский государственный университет (RU)

Изобретение относится к области биотехнологии, а именно к способу диагностики биоматериалов на наличие в них агробактерий. Способ включает выделение из биоматериала ДНК и проведение на ней полимеразной цепной реакции в режиме реального времени с зондами, меченными флуоресцентными красителями и гасителями флуоресценции. Составляют две реакционные смеси, одна из которых содержит праймеры atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc и зонд FAM-cgttcggctc ggcatctcga tattccc-BHQ1, а вторая содержит праймеры ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca и зонд Joe-gtatccggct atgcgccgag tttgg BHQ1. Полимеразную цепную реакцию проводят в режиме реального времени с температурой отжига праймеров 55-62°С при 30-45 циклах, при этом осуществляют непрерывный контроль флуоресценции и по экспоненциальному ее нарастанию в одной или обеих реакционных смесях диагностируют наличие в образцах агробактерий. Предложенное изобретение позволяет расширить диапазон генотипов диагностируемых агробактерий. 4 з.п. ф-лы, 7 ил., 6 пр.

 

Изобретение относится к биотехнологии сельскохозяйственных растений и может найти применение для нужд сельского хозяйства и растениеводства при диагностике инфицирования растений (таких, например, как виноград, яблоня, слива, вишня, малина, смородина и др.) агробактериями. Кроме этого изобретение может быть использовано при анализе результатов агробактериальной трансформации, при анализе различных субстратов (почва, вода), в ветеринарии и медицине, поскольку некоторые штаммы агробактерий условно патогенны.

Известен способ определения бактерий (в том числе агробактерий) [1], сущность которого состоит в анализе морфофизиологических симптомов заражения растения. Однако этот способ является недостаточно точным, поскольку опухоли на растениях индуцируют не только агробактерий, но и некоторые вирусы, насекомые, нематоды. Кроме того, данным способом можно выявить патогена уже в тот момент, когда болезнь получила достаточно сильное развитие. В результате может быть упущено время для проведения эффективных защитных мероприятий.

Известен способ диагностики растений [1] на наличие бактериального заражения, основанный на микроскопическом исследовании пораженных тканей. Он применяется для определения вида возбудителя или установления патогена в тканях растения в ходе обнаружения характерных признаков, присущих патогену (цвет, размер спор и т.д.). По совокупности обнаруженных признаков с помощью определителя устанавливают систематическое положение и вид возбудителя. Однако этот способ также применим только в случае существенного заражения растения, требует высокой квалификации исследователя и трудоемок.

Известен способ определения бактерий [1] на основе описания их культуральных признаков (скорость роста на питательных средах, размер, цвет, форма колоний и т.д.). Однако этот метод является достаточно длительным и трудоемким.

Для ДНК-диагностики различных патогенов используют классический вариант полимеразной цепной реакции (ПЦР) с последующим разделением фрагментов в агарозном геле. Этот способ является простым в исполнении и дешевым, однако он имеет один большой недостаток: высокая вероятность ложных положительных ответов вследствие контаминации исследуемого образца ДНК продуктом ПЦР. Тем не менее в настоящее время диагностические наборы, основанные на классических вариантах ПЦР, являются очень распространенными.

Появление новой модификации метода (ПЦР) в режиме реального времени явилось новым шагом в развитии данной технологии, поскольку позволяет контролировать увеличение количества синтезируемого продукта в ходе реакции и не требует проведения электрофореза на последующих стадиях. Это стало возможным благодаря добавлению в реакционную среду красителей, обеспечивающих флуоресценцию, прямо пропорциональную количеству синтезированного ПЦР-продукта, - репортерную флуоресценцию.

ПЦР в режиме реального времени существует в двух основных модификациях, различающихся по способам генерации репортерной флуоресценции. Первая из них связана с применением интеркалирующих флуоресцентных агентов, свечение которых значительно возрастает при связывании с двуцепочечной ДНК, вторая связана с использованием меченных флуоресцентными агентами олигонуклеотидных проб, комплементарных участку PCR-продукта. Вторая модификация ПЦР является более предпочтительной для диагностических целей, поскольку дает дополнительную возможность контроля специфичности реакции.

Использование ПЦР в реальном времени позволяет свести к минимуму проблему контаминации продуктом реакции, ускорить процедуру анализа за счет отсутствия необходимости проведения электрофореза, позволяет получать количественные характеристики присутствия интересующей ДНК в пробе.

На настоящий момент на основе ПЦР технологии разработано огромное количество диагностических систем различного назначения, в том числе для нужд сельского хозяйства и растениеводства.

Известны аналогичные изобретения «Способ и набор для обнаружения ДНК бактерии заболевания лаймского боррелиоза - borrelia burgdorferi» [2] и «Набор реагентов для определения ДНК пародонто-патогенных микробов Prevotella intermedia sensu stricto, Bacteroides forsythus, Treponema denticola, Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis при помощи мультиплексной полимеразной цепной реакции» [3]. Набор синтетических олигонуклеотидов для выявления ДНК возбудителя болезней овощных культур - грамотрицательной бактерии Xanthomonas campestris pv vesicaroria методом полимеразной цепной реакции [4].

Однако аналогичные наборы, а также реакционные ПЦР смеси, праймеры и способы обнаружения ДНК агробактерий из литературных и других источников информации не известны.

Заявителю известно, что работа над созданием праймеров, которые используются в подобных наборах, строится обычно следующим образом.

1) С помощью открытых и коммерческих баз данных нуклеотидных последовательностей геномов микроорганизмов либо в результате самостоятельного определения нуклеотидной последовательности изучаемого микроорганизма выбирается участок генома, уникальный для данного вида микроорганизмов (или группы видов).

2) На основании выбранного участка генома с помощью специального программного обеспечения подбирается последовательность олигонуклеотидов, используемых для проведения ПНР-реакции (часто 2 праймера и проба).

На данном этапе работа заключается в создании выравнивания многих геномных последовательностей и выборе участка последовательности, где число мутаций соответствует требуемому расположению праймеров.

Выравнивание геномных последовательностей означает сравнение последовательностей многих организмов друг с другом, поиск уникальных для нужного микроорганизма участков, не имеющих аналогов у других микроорганизмов.

Поиск соответствия между числом мутаций и расположением праймеров означает, что мутации, возможные в данном микроорганизме (естественно, те, данные о которых уже есть в базах или уже самостоятельно получены), не должны затрагивать выбранный для праймеров участок генома, так как замены в геномной последовательности (мутации) могут негативно сказаться на работе праймеров.

3) Изготовление праймеров.

4) С помощью практических экспериментов доказывается пригодность подобранных последовательностей для конкретных целей (например, для определения наличия/отсутствия данного микроорганизма в биоматериале).

Наиболее близким способом по достигаемому техническому результату является способ определения бактерий [4], принятый в качестве прототипа. Сущность его состоит в выявлении фитопатогена Xanthomonas campestris. Это другой вид фитопатогенных бактерий по отношению к заявленному способу (и объекту нашего исследования). Кроме того, недостатком известного способа, принятого в качестве прототипа, является достаточно узкий диапазон определяемых генотипов диагностируемых бактерий.

Заявляемое изобретение свободно от этих недостатков.

Технический результат предлагаемого изобретения состоит в удешевлении способа и расширении диапазона генотипов диагностируемых агробактерий.

Указанный технический результат достигается тем, что в способе диагностики биоматериалов на наличие в них агробактерий, заключающемся в выделении из биоматериала ДНК и проведении на ней полимеразной цепной реакции в режиме реального времени зондами, меченными флуоресцентными красителями и гасителями флуоресценции, в соответствии с заявленным изобретением после выделения из образцов ДНК в концентрации 0,1-100 нг/мкл на ее основе составляют две реакционные смеси, одна из которых содержит праймеры atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc и зонд FAM-cgttcggctc ggcatctcga tattccc-BHQ1, а вторая содержит праймеры ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca и зонд Joe-gtatccggct atgcgccgag tttgg BHQ1, праймеры в составе реакционных смесей имеют концентрацию 0,2-2 mM, a зонды 0,1-1 mM, реакционные смеси содержат буфер для полимеразы, катионы Mg 2+ в концентрации 0,1-0,3 mM, нуклеотиды в концентрации 2-10 мкМ, термостабильную полимеразу 0,1-0,3 единиц активности на микролитр смеси, полимеразную цепную реакцию проводят в режиме реального времени с температурой отжига праймеров 55-62°С при 30-45 циклах, при этом осуществляют непрерывный контроль флуоресценции и по экспоненциальному ее нарастанию в одной или обеих реакционных смесях диагностируют наличие в образцах агробактерий.

Кроме этого указанный технический результат достигается тем, что в качестве термостабильной полимеразы с активностью 0,1-0,3 ед. на микролитр смеси берут Taq.

Помимо этого указанный технический результат достигается тем, что в качестве термостабильной полимеразы с активностью 0,1-0,3 ед. на микролитр смеси берут Pfu.

Кроме того, указанный технический результат достигается тем, что в качестве термостабильной полимеразы с активностью 0,1-0,3 ед. на микролитр смеси берут Vent.

Вместе с тем, указанный технический результат достигается тем, что в качестве термостабильной полимеразы с активностью 0,1-0,3 ед. на микролитр смеси берут Tth.

Сущность заявленного изобретения состоит в том, что для диагностики наличия в образце агробактерий проводят ПЦР в реальном времени с праймерами и зондами к эволюционно консервативным участкам генов, характерных для агробактерий.

Например, при сравнении уровня техники:

По патенту РФ №2378383 (RU):

) НАБОР СИНТЕТИЧЕСКИХ ОЛИГОНУКЛЕОТИДОВ ДЛЯ ВЫЯВЛЕНИЯ ДНК ВОЗБУДИТЕЛЯ БОЛЕЗНЕЙ ОВОЩНЫХ КУЛЬТУР - ГРАМОТРИЦАТЕЛЬНОЙ БАКТЕРИИ PSEUDOMONAS SYRINGAE PV LACHRYMANS МЕТОДОМ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ,

По патенту РФ №2378382 (RU):

) НАБОР СИНТЕТИЧЕСКИХ ОЛИГОНУКЛЕОТИДОВ ДЛЯ ВЫЯВЛЕНИЯ ДНК ВОЗБУДИТЕЛЯ БОЛЕЗНЕЙ ОВОЩНЫХ КУЛЬТУР - ГРАМОТРИЦАТЕЛЬНОЙ БАКТЕРИИ XANTHOMONAS CAMPESTRIS PV VESICARORIA МЕТОДОМ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ.

При казалось бы схожей технологии детекции известные и другие подобные патенты описывают детекцию других возбудителей, для детекции агробактерий с использованием ПЦР в режиме реального времени диагностических систем авторами не найдено.

Альтернативой предлагаемому подходу может служить комплекс традиционных микробиологических методов, связанных с высевом патогенов на питательные среды, анализ выросших микроорганизмов методами микроскопии - методы на порядок более трудоемкие и продолжительные.

Существенными признаками изобретения являются:

из анализируемого образца выделяют ДНК чистоты, достаточной для проведения ферментативных реакций, после этого составляют 2 реакционные смеси, содержащие, по меньшей мере:

первая реакционная смесь - буфер для полимеразы, катионы Mg 2+ в концентрации 0,1-0,3 mM, нуклеотиды в концентрации 2-10 мкМ, Taq полимеразу (или другую термостабильную полимеразу, обладающую 5' экзонуклеазной активностью), 0,1-0,3 ед. активности на микролитр смеси, ДНК матрицу исследуемого образца 0,1-100 нг/мкл, праймеры, следующего состава: atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc в концентрации 0,2-2 mM зонд: FAM-cgttcggctc ggcatctcga tattccc-BHQ1 в концентрации 0,1-1 mM, зонд может содержать и другие флуоресцентные красители или гасители флуоресценции;

вторая реакционная смесь - буфер для полимеразы, катионы Mg 2+ в концентрации 0,1-0,3 mM, нуклеотиды в концентрации 2-10 мкМ, Taq полимеразу (или другую термостабильную полимеразу, обладающую 5' экзонуклеазной активностью) 0,1-0,3 ед. активности на микролитр смеси, ДНК матрицу исследуемого образца 0,1-100 нг/мкл, праймеры, следующего состава:

ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca в концентрации 0,2-2 mM и зонд, следующего состава: Joe-gtatccggct atgcgccgag tttgg-BHQ1 в концентрации 0,1-1 mM, зонд может содержать и другие флуоресцентные красители или гасители флуоресценции.

Реакцию проводят в амплификаторе (термоциклире) при температуре отжига 55-62°С в течение 30-45 циклов термоциклирования. Реакцию можно проводить в амплификаторе, обладающем возможностью детектировать изменение флуоресценции в режиме реального времени или в обычном амплификаторе без детектора (в этом случае о прохождении реакции судят по изменению уровня флуоресценции, измеренной перед началом реакции и после ее прохождением)

В случае если прохождение реакции в виде увеличения уровня флуоресценции образца будет детектировано хотя бы в одной из реакционных смесей, делается вывод о наличии агробактерий в анализируемом образце.

Реализация заявленного способа.

Для обнаружения описываемым методом агробактерий в образце требуется:

1. Выделить ДНК из образца СТАБ-методом. Для этого нужно гомогенезировать образец в СТАВ-буфере (NaCl 1.4М, Трис HCl (рН 8) 0,1М, ЭДТА (рН 8) 20 мМ, СТАВ 2% m/v) (в случае анализа образца воды предварительно сконцентрировать образец, например центрифугировать 10 минут при 3-10 тыс. оборотов в минуту, затем слить надосадочную жидкость), инкубировать полученную смесь 1 час при 56°С, 40-60 минут экстрагировать хлороформом, разделить фракции центрифугированием, верхнюю (водную), содержащую ДНК фракцию переосадить этанолом, ДНК растворить в воде. В случае выделения ДНК из почвы заплавить раствор ДНК, полученный на последнем этапе, в легкоплавкую агарозу (конечная концентрация агарозы - 1%), элюитовать буфером ТЕ в течение суток, далее слить буфер. Перед использованием образец нагреть до 80°С.

2. Приготовить 2 реакционные смеси для ПЦР. Первая смесь должна содержать 1х буфер для полимеразы, катионы Mg 2+ в концентрации 0,1-0,3 mM, нуклеотиды в концентрации 2-10 мкМ, Taq полимеразу (или другую термостабильную полимеразу, обладающую 5' экзонуклеазной активностью), 0,1-0,3 ед. активности на микролитр смеси, ДНК матрицу исследуемого образца 0,1-100 нг/мкл, праймеры, следующего состава: atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc в концентрации 0,2-2 mM, зонд: FAM-cgttcggctc ggcatctcga tattccc-BHQ1 в концентрации 0,1-1 mM, зонд может содержать и другие флуоресцентные красители или гасители флуоресценции, во второй реакционной смеси - буфер для полимеразы, катионы Mg 2+ в концентрации 0,1-0,3 mM,

нуклеотиды в концентрации 2-10 мкМ, Taq полимеразу (или другую термостабильную полимеразу, обладающую 5' экзонуклеазной активностью) 0,1-0,3 ед. активности на микролитр смеси, ДНК матрицу исследуемого образца 0,1-100 нг/мкл, праймеры, следующего состава:

ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca в концентрации 0,2-2 mM и, зонд, следующего состава: Joe-gtatccggct atgcgccgag tttgg-BHQ1 в концентрации 0,1-1 mM.

3. Провести полимеразную цепную реакцию в режиме реального времени с температурой отжига праймеров 55-62°С при 30-45 циклах. Пример программы:

95°С - 5 минут, 40 циклов (95°С - 18 сек, 55°С - 30 сек, 72°С - 30 сек).

Прохождение реакции контролируют посредством прибора для измерения уровня флуоресценции в ходе реакции, при прохождении реакции хотя бы в одной из реакционных смесей, наблюдается повышение уровня флуоресценции, делается вывод о наличии агробактерий в исследуемом образце.

Заявленный способ апробирован в реальном времени на лабораторной базе Санкт-Петербургского государственного университета и поясняется конкретными примерами.

Примеры конкретной реализации.

Для обнаружения описываемым методом агробактерий в образце требуется:

1. Выделить ДНК из образца СТАБ-методом (подготовительный этап).

2. Провести ПЦР в реальном времени (собственно анализ)

Пример 1.

Выделение ДНК из образца почвы.

Гомогенезировать образец в СТАВ-буфере (NaCl 1.4M, Трис HCl (рН 8) 0,1М, ЭДТА (рН 8) 20 мМ, СТАВ 2% m/v), инкубировать полученную смесь 1 час при 56°С, 40-60 минут экстрагировать хлороформом, разделить фракции центрифугированием, верхнюю (водную), содержащую ДНК фракцию переосадить этанолом, ДНК растворить в воде. Приготовить 2% раствор легкоплавкой агарозы в буфере ТЕ, расплавить агарозу и смешать в равном соотношении с препаратом ДНК. После полимеризации агарозы экстрагировать из геля гуминовые кислоты пассивной элюцией 1 мл буфера ТЕ в течение ночи. Слить буфер. Перед постановкой ферментативных реакций агарозу расплавить.

Пример 2.

Выделение ДНК из образца воды.

Образец воды поместить в центрифужный стакан и центрифугировать в течение 10 минут при 3-5 тыс. оборотов в минуту. Супернатант слить, осадок гомогенизировать в СТАВ-буфере, инкубировать полученную смесь 1 час при 56°С, 40-60 минут экстрагировать хлороформом, разделить фракции центрифугированием, верхнюю (водную), содержащую ДНК фракцию переосадить этанолом, ДНК растворить в воде.

Пример 3.

Выделение ДНК из растительного материала.

Ткани растения перетереть в ступке в СТАВ-буфере, инкубировать полученную смесь 1 час при 56°С, 40-60 минут экстрагировать хлороформом, разделить фракции центрифугированием, верхнюю (водную), содержащую ДНК фракцию переосадить этанолом, ДНК растворить в воде.

После выделения ДНК ее концентрацию определяли спектрофотометрически.

ПОСТАНОВКА ПЦР

Пример 4.

Функционирование диагностической системы при различных температурных условиях реакции.

В ходе работы были приготовлены 2 реакционные смеси для ПЦР. Первая смесь содержала 1х буфер для полимеразы, катионы Mg 2+ в концентрации 0,1-0,3 mМ, нуклеотиды в концентрации 2-10 мкМ, Taq полимеразу, 0,2 ед. активности на микролитр смеси, ДНК матрицу исследуемого образца 100 нг/мкл, праймеры, следующего состава: atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc в концентрации 2 mM зонд: FAM-cgttcggctc ggcatctcga tattccc-BHQ1 в концентрации 1 mM, во второй реакционной смеси - буфер для полимеразы, катионы Mg 2+ в концентрации 0,2 mM, нуклеотиды в концентрации 2-10 мкМ, Taq полимеразу 0,2 ед. активности на микролитр смеси, ДНК матрицу исследуемого образца 100 нг/мкл, праймеры, следующего состава:

ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca в концентрации 0,2-2 mM и зонд, следующего состава: Joe-gtatccggct atgcgccgag tttgg-BHQ1 в концентрации 0,1-1 mM,

полимеразную цепную реакцию в режиме реального времени проводили с температурой отжига праймеров 50-62°С при 40 циклах, пример программы:

95°С - 5 минут, 40 циклов (95°С - 18 сек, х °С - 30 сек, 72°С - 30 сек), где Х варьировала от 50 до 62 градусов.

Прохождение реакции контролировали посредством прибора для измерения уровня флуоресценции в ходе реакции, например амплификатор АНК32 (испытания проводились на лабораторной базе Института Аналитического приборостроения РАН).

Результаты реакции при температуре отжига 60 градусов представлены в качестве примера в виде сырых данных для каждого из красителей (Фиг.1).

На Фиг.1 показан рост флуоресценции по каналам FAM и R6G (Joe) в ходе ПЦР на ДНК, содержащей последовательности vir генов агробактерий.

На Фиг.2-5 представлены данные роста флуоресценции после математической обработки, проведенной с использованием программного обеспечения к амплификатору АНК 32. Каждый рисунок соответствует различным температурам отжига праймеров. В качестве матрицы использована ДНК агробактерий.

На Фиг.2 показан рост флуоресценции в ходе ПЦР с температурой отжига праймеров 50°С.

Из Фиг.2 видно, что в образце номер 1 присутствует ДНК агробактерий в высокой концентрации (о чем свидетельствует раннее начало роста флуоресценции).

На следующем рисунке (Фиг.3) показан рост флуоресценции в ходе ПЦР с температурой отжига праймеров 55°С.

Из Фиг.3 видно, что в образцах номер 2 и 3 присутствует ДНК агробактерий в высокой концентрации (о чем свидетельствует раннее начало роста флуоресценции).

На Фиг.4 показан рост флуоресценции в ходе ПЦР с температурой отжига праймеров 60°С. Из графика видно, что в образцах номер 2 и 3 присутствует ДНК агробактерий в высокой концентрации (о чем свидетельствует раннее начало роста флуоресценции).

На Фиг.5 представлен рост флуоресценции в ходе ПЦР с температурой отжига праймеров 62°С.

Из графика видно, что в образце номер 1 присутствует ДНК агробактерий в высокой концентрации (о чем свидетельствует раннее начало роста флуоресценции).

Таким образом, при всех проанализированных температурных условиях наблюдается прохождение реакции, свидетельствующей о работе диагностической системы в исследованных температурных условиях реакции.

Пример 5.

Использование ДНК из различного биологического материала при оценке образцов на присутствие агробактерий.

В ходе работы были приготовлены 2 реакционные смеси для ПЦР. Первая смесь содержала 1х буфер для полимеразы, катионы Mg 2+ в концентрации 0,1-0,3 mM, нуклеотиды в концентрации 2-10 мкМ, Taq полимеразу, 0,2 ед. активности на микролитр смеси, ДНК матрицу исследуемого образца 100 нг/мкл, праймеры, следующего состава: atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc в концентрации 2 mM зонд: FAM-cgttcggctc ggcatctcga tattccc-BHQ1 в концентрации 1 mM, во второй реакционной смеси - буфер для полимеразы, катионы Mg 2+ в концентрации 0,2 mM, нуклеотиды в концентрации 2-10 мкМ, Taq полимеразу 0,2 ед. активности на микролитр смеси, ДНК матрицу исследуемого образца 100 нг/мкл, праймеры, следующего состава:

ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca в концентрации 0,2-2 mM и зонд, следующего состава: Joe-gtatccggct atgcgccgag tttgg-BHQ1 в концентрации 0,1-1 mM,

полимеразную цепную реакцию в режиме реального времени проводили по программе: 95°С - 5 минут, 40 циклов (95°С - 18 сек, 60°С - 30 сек, 72°С - 30 сек).

Прохождение реакции контролировали посредством прибора для измерения уровня флуоресценции в ходе реакции, АНК32 (испытания проводились на базе Института Аналитического приборостроения РАН).

Результаты реакции представлены на Фиг.6, где изображены кривые роста флуоресценции, соответствующие образцам ДНК, выделенной из растительных остатков с сильным агробактериальным заражением (1), почвы (2), воды (3).

Полученные данные подтверждают возможность применения системы для анализа различного биологического материала.

Пример 6.

Исследование биологического материала (растения, сильно зараженного агробактериями) на присутствие агробактерий при постановке реакции на различных концентрациях ДНК.

В ходе работы были приготовлены 2 реакционные смеси для ПНР. Первая смесь содержала 1х буфер для полимеразы, катионы Mg 2+ в концентрации 0,2 mM, нуклеотиды в концентрации 2-10 мкМ, Taq полимеразу, 0,2 ед. активности на микролитр смеси, ДНК матрицу исследуемого образца 0,1; 1 и 100 нг/мкл, праймеры, следующего состава: atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc в концентрации 2 mM зонд: FAM-cgttcggctc ggcatctcga tattccc-BHQ1 в концентрации 1 mM, во второй реакционной смеси - буфер для полимеразы, катионы Mg 2+ в концентрации 0,2 mM, нуклеотиды в концентрации 2 мкМ, Taq полимеразу 0,2 ед. активности на микролитр смеси, ДНК матрицу исследуемого образца 0,1; 1 и 100 нг/мкл, праймеры, следующего состава:

ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca в концентрации 0,2-2 mM и зонд, следующего состава: Joe-gtatccggct atgcgccgag tttgg-BHQ1 в концентрации 0,1-1 mM,

полимеразную цепную реакцию в режиме реального времени проводили с температурой отжига праймеров 60°С при 40 циклах. Пример программы:

95°С - 5 минут, 40 циклов (95°С - 18 сек, 60°С - 30 сек, 72°С - 30 сек). Прохождение реакции контролировали посредством прибора для измерения уровня флуоресценции в ходе реакции, например амплификатор АНК32 (испытания проводились также на лабораторной базе Института Аналитического приборостроения РАН).

В ходе данного эксперимента по схеме, описанной выше, реакцию ставили с ДНК в концентрациях: 0,1; 1 и 100 нг/мкл по программе 95°С - 5 минут, 40 циклов (95°С - 18 сек, 60°С - 30 сек, 72°С - 30 сек).

Результаты реакции представлены на Фиг.7, где показаны кривые роста флуоресценции, соответствующие образцам с различными концентрациями ДНК: 100 нг/мкл, 1 нг/мкл, 0,1 нг/мкл (соответственно слева направо).

При прохождении реакции наблюдается повышение уровня флуоресценции. В представленном случае уровень флуоресценции растет во всех содержащих ДНК образцах. Значения пороговых циклов составляют 17, 22 и 25. Более раннее начало роста относится с наиболее концентрированной ДНК, самое позднее - к самой разведенной.

Таким образом, можно сделать вывод об успешной работе диагностической системы при использовании ДНК заявленных концентраций.

Технико-экономическая эффективность заявленного изобретения состоит в том, что предлагаемый новый способ диагностики биоматериалов на наличие в них агробактерий направлен на решение проблемы быстрой диагностики любого биологического материала (соскобы, фрагменты зараженных растений, ткани трансгенных растений), т.е. на эффективное и оперативное выявление наличия в исследуемых биоматериалах агробактерий. Заявленный способ по достигаемому техническому результату отличается от известных в данной области аналогов:

1. позволяет существенного сократить время диагностирования в сроки до одного рабочего дня;

2. является высокочувствительным и позволяет обнаруживать даже одиночные агробактерии в пробе;

3. существенно дешевле, поскольку не требует использования питательных сред, а также разделения продуктов реакции на геле;

4. более высокопроизводительный, дешевый и достоверный, новый способ позволяет одному исследователю осуществлять параллельно анализ сотни испытуемых образцов. Заявленная технология экологически чистая и может быть реализована для разных нужд сельского хозяйства и растениеводства при диагностике инфицирования растений.

Список использованной литературы

1. Семенкова И.Г., Соколова Э.С. Фитопатология. - М., 2003.

2. Патент RU по заявке №2004105688 А, 10.08.2005.

3. Патент RU по заявке №2005136997 А, 10.06.2007.

4. Патент RU 2378382 С1 (прототип).

1. Способ диагностики биоматериалов на наличие в них агробактерий, заключающийся в выделении из биоматериала ДНК и проведении на ней полимеразной цепной реакции в режиме реального времени зондами, меченными флуоресцентными красителями и гасителями флуоресценции, отличающийся тем, что после выделения из образцов ДНК в концентрации 0,1-100 нг/мкл на основе ее составляют две реакционные смеси, одна из которых содержит праймеры atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc и зонд FAM-cgttcggctc ggcatctcga tattccc-BHQ1, а вторая содержит праймеры ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca и зонд Joe-gtatccggct atgcgccgag tttgg BHQ1, праймеры в составе реакционных смесей имеют концентрацию 0,2-2 mM, а зонды 0,1-1 mМ, реакционные смеси содержат буфер для полимеразы, катионы Mg 2+ в концентрации 0,1-0,3 mM, нуклеотиды в концентрации 2-10 мкМ, термостабильную полимеразу 0,1-0,3 ед. активности на микролитр смеси, полимеразную цепную реакцию проводят в режиме реального времени с температурой отжига праймеров 55-62°С при 30-45 циклах, при этом осуществляют непрерывный контроль флуоресценции и по экспоненциальному ее нарастанию в одной или обеих реакционных смесях диагностируют наличие в образцах агробактерий.

2. Способ по п.1, отличающийся тем, что в качестве термостабильной полимеразы с активностью 0,1-0,3 ед. на микролитр смеси берут Taq.

3. Способ по п.1, отличающийся тем, что в качестве термостабильной полимеразы с активностью 0,1-0,3 ед. на микролитр смеси берут Pfu.

4. Способ по п.1, отличающийся тем, что в качестве термостабильной полимеразы с активностью 0,1-0,3 ед. на микролитр смеси берут Vent.

5. Способ по п.1, отличающийся тем, что в качестве термостабильной полимеразы с активностью 0,1-0,3 ед. на микролитр смеси берут Tth.



 

Похожие патенты:

Изобретение относится к области медицинской биотехнологии и может быть использовано для получения основного протективного антигена холерного вибриона В-субъединицы холерного токсина, применяемого в дальнейшем для получения антитоксических сывороток, высокоспецифических иммуноглобулинов и диагностических тест-систем, а также в качестве компонента, добавляемого к вакцинным препаратам.

Изобретение относится к области биотехнологии, а именно к способу идентификации микобактерий с помощью полимеразной цепной реакции. .
Изобретение относится к медицине, а именно к медицинской микробиологии, и может быть использовано для культивирования дифтерийных микробов в искусственных питательных средах при бактериологической диагностике дифтерии.

Изобретение относится к области биотехнологии, конкретно к получению белков, обладающих нейромодуляторным действием по отношению к никотиновым ацетилхолиновым рецепторам человека, и может быть использовано в медицине.
Изобретение относится к сельскохозяйственной микробиологии и может быть использовано для получения биоинсектицида для борьбы с большой восковой молью. .

Изобретение относится к области промышленной микробиологии, а именно к способам получения биомассы туляремийного микроба, и может быть использован для выделения антигенных компонентов как из клеток, так и из культуральной жидкости для создания диагностических препаратов против возбудителя туляремии.
Изобретение относится к биотехнологии и зоотехнии и может быть использовано при промышленном производстве симбиотического препарата из штамма Escherichia coli VL-613. .

Изобретение относится к области микробиологии. .

Изобретение относится к области медицинской микробиологии, в частности к идентификации токсигенных штаммов Vibrio cholerae O1, определению их биовара (классического или эльтор) и дифференциации V.

Изобретение относится к микробиологии и молекулярной генетике микроорганизмов и касается способов выявления экспрессирующихся генетических детерминант патогенных микроорганизмов рода Burkholderia с использованием реакций обратной транскрипции и сопряженной амплификации (ОТ-ПЦР) для их последующего структурно-функционального анализа, что, в свою очередь, позволит оценить влияние адаптационных изменений клеток при изменении условий внешней среды на выраженность важнейших биологических характеристик микроорганизмов, в частности вирулентности и устойчивости к антимикробным препаратам.

Изобретение относится к области молекулярной биологии и может быть использовано в медицине, в частности при диагностике наследственных нарушений обмена, приводящих к развитию неонатальной гипербилирубинемии.

Изобретение относится к области медицинской диагностики, может быть использовано для прогнозирования нарушения маточно-плодово-плацентарного кровотока. .
Изобретение относится к медицине, конкретно к диагностике в кардиологии, и касается способа прогнозирования риска возникновения гипертонической болезни у мужчин. .

Изобретение относится к области медицинской диагностики, может быть использовано для прогнозирования почечной выживаемости у больных хроническим гломерулонефритом.
Изобретение относится к области медицинской микробиологии и, в частности, к детекции антибиотикоустойчивых штаммов возбудителя чумы. .

Изобретение относится к области биотехнологии, а именно к способу идентификации микобактерий с помощью полимеразной цепной реакции. .
Наверх