Набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для видоспецифичной экспресс-идентификации вируса марбург методом полимеразной цепной реакции


 


Владельцы патента RU 2458143:

Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") (RU)

Изобретение относится к биотехнологии, в частности к генетической инженерии. Техническим результатом заявляемого изобретения является создание более специфичного набора олигонуклеотидных праймеров и зондов. Набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для видоспецифичной экспресс-идентификации вируса Марбург методом полимеразной цепной реакции в реальном времени включает последовательности, видоспецифичные для вируса Марбург. Изобретение может быть использовано в медицине для выявления генетического материала (РНК) вируса Марбург. 1 ил., 3 табл., 2 пр.

 

Изобретение относится к биотехнологии, в частности к генетической инженерии, и может быть использовано в медицине для выявления генетического материала (РНК) вирусов Марбург и Эбола в клинических или секционных пробах, в образцах внешней среды с целью постановки диагноза или коррекции лечения, а также для решения научно-исследовательских задач по изучению свойств филовирусов, созданию диагностических, профилактических или лечебных препаратов против филовирусов. При помощи набора диагностических праймеров возможно одновременное выявление генетического материала (РНК) вирусов Марбург, Эбола-Заир и Эбола-Судан в исследуемом образце.

Вирусы Марбург и Эбола входят в семейство филовирусов (Filoviridae). Семейство Filoviridae, в соответствии с последними решениями Международного Таксономического Комитета, включает в себя два рода: Marburgvirus и Ebolavirus (http://www.ncbi.nlm.nih.gov/ICTVdb/Ictv/index.htm).

Род Marburgvirus (MARV) включает в себя единственный вид марбургвирус Озера Виктория (Lake Victoria marburgvirus).

Род Ebolavirus включает в себя 4 вида:

- Эболавирус Рестон (Reston ebolavirus - REBOV);

- Эболавирус Судан (Sudan ebolavirus - SEBOV);

- Эболавирус леса Тай (Tai Forest ebolavirus - TFEBOV);

- Эболавирус Заир (Zaire ebolavirus - ZEBOV).

Заболевания, вызванные вирусом Марбург и вирусом Эбола, протекают с одинаковыми клиническими проявлениями. Необходимость диагностировать филовирусы друг от друга вызвана как минимум двумя причинами. Во-первых, дифференциация геморрагической лихорадки Марбург от геморрагической лихорадки Эбола необходима, потому что для лечения этих заболеваний может использоваться специфический иммуноглобулин. Антигенного перекреста между вирусом Марбург и вирусом Эбола нет, и иммуноглобулины от одного заболевания не помогут при лечении другого. Вторая причина необходимости идентификации вида филовируса связана с тем, что правильное молекулярно-эпидемиологическое заключение необходимо для проведения адекватных и своевременных мероприятий санитарно-эпидемиологического надзора.

Известны праймеры (аналог) для определения генетического материала вирусов Марбург и Эбола [Zhai J., Palacios G., Towner J.S. et al. Rapid Molecular Strategy for Filovirus Detection and Characterization // J. Clin. Microbiol., 2007, 45(1): 224-6].

Однако накопление данных по геномному разнообразию филовирусов и детальный анализ этих данных показали, что и этот набор праймеров в ряде случаев может не обеспечить надежной идентификации филовирусов, поскольку были выявлены геноварианты вируса, для которых вышеназванные наборы праймеров не обладают достаточной специфичностью, чтобы обеспечить надежный синтез целевых фрагментов ДНК. Для ПЦР использованы не меченые флюорофором праймеры, и это не позволяет определить количество РНК вируса в анализируемой пробе. Кроме этого, с помощью предложенных праймеров можно провести только один раунд ПЦР, а по данным литературы [Towner J.S., Rollin P.E., Bausch D.G. et al. Rapid Diagnosis of Ebola Hemorrhagic Fever by Reverse Transcription-PCR in an Outbreak Setting and Assessment of Patient Viral Load as a Predictor of Outcome // J. Virol., 2004, 78(8): 4330-41] чувствительность тест-систем, использующих однораундовый ПЦР, составляет 100-1000 РНК вируса. Однораундовая тест-система, ввиду низкой чувствительности, может не определить наличие РНК вируса, как например это было в случае туристки из Колорадо (2008 год), у которой после возвращения из Уганды на 10 сут после появления клинических признаков заболевания РНК вируса Марбург определена не была. При перестановке этого же образца двураундовым ПЦР уже через 6 мес. (когда ИФА тест показал нарастание антител к вирусу Марбург) РНК вируса Марбург была обнаружена [Fujita N., Miller A., Gershman K. et al. Imported Case of Marburg Hemorrhagic Fever, Colorado, 2008 // JAMA, 2010, 303 (5): 413-5 (Reprinted MMWR. 2009; 58:1377-1381)].

Наиболее близким аналогом (прототипом) являются семейство-специфичные олигонуклеотидные праймеры, которые позволяют выявить наличие в образце одного из представителей семейства филовирусов методом ПЦР [Grolla A., Lucht А., Dick D., Strong J. E., Feldmann H. Laboratory diagnosis of Ebola and Marburg hemorrhagic fever // Bull Soc Pathol Exot, 2005, 98(3): 205-209].

Однако для проведения ПЦР используются семейство-специфичные праймеры, которые позволяют выявить наличие в образце одного из представителей семейства филовирусов и не позволяют идентифицировать вид вируса. При лечении больного сывороткой или плазмой важно знать, к какому виду относится вирус, вызвавший заболевание, в противном случае эффективность лечения будет существенно снижена. Кроме этого, определение вида филовируса очень важно и для организации противоэпидемических мероприятий.

Техническим результатом заявляемого изобретения является создание более специфичного набора олигонуклеотидных праймеров и зондов для идентификации генетического материала вирусов Марбург, Эбола-Заир и Эбола-Судан в клинических образцах и биологических жидкостях, образцах внешней среды и других вируссодержащих пробах (культуральная вируссодержащая жидкость и т.д) методом мультиплексного ПЦР в режиме реального времени.

Указанный технический результат достигается путем сконструированного набора олигонуклеотидных праймеров и флуоресцентно-меченых зондов (на консервативную область L-гена, кодирующего РНК полимеразу вирусов Марбург, Эбола-Заир и Эбола-Судан) для видоспецифичной экспресс-идентификации вирусов Марбург и Эбола методом полимеразной цепной реакции в реальном времени, включающий:

- последовательности, видоспецифичные для вируса Марбург:

внешние:

5'→3' 5' CCTCTTTTYTCWACWAAAATWATAAGTGA 3'

3'←5' 5' TTCTCAAGATCAGTAACRAAACTHGCACC 3'

внутренние:

5'→3' 5' TGGGACAGYGTTTTYGATAG 3'

3'←5' 5' ACAACCATCATRTTRCTAGGGAATGCYT 3'

зонд:

FAM-GTGTCAGAAATGTCCAAACACTYGCAGAAGC-BHQ1

- последовательности, видоспецифичные для вируса Эбола-Судан:

внешние:

5'→3' 5' CCGTTATTCTCYACRAAGRTSATTAGTGA 3'

3΄←5΄ 5΄ TTCTCTAGGTCTGTGACAAAACTACTCCC 3΄

внутренние:

5'→3' 5' TGGGATGCAGTHTTYGARCC 3'

3'←5' 5' ACAACCATCATRTTGCTTGGAAAGGCTT 3'

зонд:

FAM-TATTGCCCCAGAATCGAAATTTTTCTTTTTCATTGAA-BHQ1

- последовательности, видоспецифичные для вируса Эбола-Заир:

внешние:

5'→3' 5' CCACTTTTCTCAACCAAAATTATTAGTGA 3΄

3'←5' 5' TTCTCTAAATCAGTTACAAARCTACTCCC 3'

внутренние:

5'→3' 5' TGGGATGCAGTHTTYGARCC 3'

3'←5' 5' ACTACCATCATATTGCTAGGAAATGCTT 3'

зонд:

FAM-TACTACCACAATATCGGAACTTTTCTTTCTCATTGAA-BHQ1

На начальном этапе для каждого из вирусов были подобраны и синтезированы пары специфических олигонуклеотидных праймеров и зонды для гибридизационно-флуоресцентной детекции продуктов ПЦР.

Таблица 1
Праймеры и зонды для детекции вирусов Марбург и Эбола
Вирус Праймеры и зонды Структура олигонуклеотидной последовательности Т отжига (°С) Размер ампликона
Мар
бург
F12981 CCTCTTTTYTCWACWAAAATWATAAGTGA 56 504
R13485 TTCTCAAGATCAGTAACRAAACTHGCACC 56
F13060 TGGGACAGYGTTTTYGATAG 55 307
R13367 ACAACCATCATRTTRCTAGGGAATGCYT 56
Z13288 Кр*-GTGTCAGAAATGTCCAAACACTYGCAGAAGC-BHQ1 64 -
Эбола-Судан F12981 CCGTTATTCTCYACRAAGRTSATTAGTGA 56 504
R13485 TTCTCTAGGTCTGTGACAAAACTACTCCC 56
F13060 TGGGATGCAGTHTTYGARCC 55 307
R13367 ACAACCATCATRTTGCTTGGAAAGGCTT 56
Z13201 Кр*-TATTGCCCCAGAATCGAAATTTTTCTTTTTCATTGAA-BHQ1 64 -
Эбола-Заир F12981 CCACTTTTCTCAACCAAAATTATTAGTGA 56 504
R13485 TTCTCTAAATCAGTTACAAARCTACTCCC 56
F13060 TGGGATGCAGTHTTYGARCC 55 307
R13367 ACTACCATCATATTGCTAGGAAATGCTT 56
Z13201 Кр*-TACTACCACAATATCGGAACTTTTCTTTCTCATTGAA-BHQ1 64 -
Примечание: Кр* - краситель (FAM)

Для этого в базе данных NCBI Mega BLAST (http://www.ncbi.nlm.nih.gov/) были выбраны наиболее консервативные участки геномов вирусов Марбург, Эбола-Заир и Эбола-Судан. Были проанализированы все имеющиеся в литературе последовательности каждого из вирусов. Для всех филовирусов участки-мишени генома соответствовали L-гену, кодирующему основной компонент РНК-полимеразы. Последовательности праймеров и зондов, температуры их отжига и размеры продуктов амплификации представлены в таблице 1.

Подбор и анализ свойств олигонуклеотидных праймеров и зондов проводился с использованием программного обеспечения Vector NTI 9.0.0 (InforMax).

Пример 1. Проверка аналитической чувствительности набора праймеров и зондов.

Для контроля амплификации были получены положительные контрольные образцы, представляющие собой рекомбинантные плазмиды, несущие вирусспецифические вставки, являющиеся матрицей для амплификации вирусспецефических ДНК-фрагментов.

Для проведения ПЦР в режиме реального времени в качестве анализируемых образцов использовали рекомбинантную плазмидную ДНК, включающую вставку ДНК, соответствующую детектируемым участкам геномов вирусов Марбург, Эбола-Заир и Эбола-Судан.

Условия проведения амплификации оптимизировались по следующим параметрам: концентрация ионов магния в реакционной смеси; концентрация праймеров и зондов в реакционной смеси; температура отжига праймеров.

Для определения чувствительности набора из концентрированного раствора плазмидной ДНК были приготовлены последовательные 10-кратные разведения. Определение концентрации ДНК в разведениях при исследовании чувствительности праймеров осуществляли при помощи флуориметра QUBIT (Invitrogen, США) и наборов реагентов производителя.

ПЦР в режиме реального времени и регистрацию результатов проводили в приборе Rotor Gene 6000 (Corbett Research, Австралия) по каналам Green (470 нм /510 нм) и Yellow (530 нм /555 нм).

В результате выполненных экспериментов было определено минимальное количество рекомбинантной плазмидной ДНК, содержащей фрагмент генома вирусов Марбург, Эбола-Заир и Эбола-Судан. При использовании внешних праймеров к геному вируса Марбург чувствительность составила 2.3 пг рекомбинантной плазмидной ДНК, несущей специфический участок, на 30 мкл реакционной смеси, для вирусов Эбола-Судан и Эбола-Заир - 0.48 и 0.03 плазмидной ДНК соответственно.

Для определения аналитической чувствительности моновариантов систем «праймеры-зонд» для детекции каждого вируса из концентрированных растворов положительных контрольных образцов были приготовлены последовательные 10-кратные разведения. Определение концентрации ДНК в разведениях при исследовании чувствительности праймеров осуществляли при помощи коммерческого набора «Quant-iT dsDNA, HS» («Invitrogen», США) и флуориметра QUBIT («Invitrogen», США). Минимальное количество ДНК-матриц, детектируемое с применением заявляемых праймеров и зондов после оптимизации условий проведения реакции, выраженное в ГЭ (геномных эквивалентах) в 30 мкл реакционной смеси, представлено в таблице 2.

Таблица 2
Аналитическая чувствительность моновариантов систем «праймеры-зонд»
Название вируса Аналитическая чувствительность (ГЭ)
Марбург 5.5×105
Эбола-Заир 7.0×103
Эбола-Судан 1.0×105

Пример 2. Определение РНК вирусов Марбург и Эбола в вируссодержащих образцах.

Оценку эффективности выявления генетического материала вирусов проводили на штамме Рорр вируса Марбург, штамме Mayinga вируса Эбола-Заир и штамме Boniface вируса Эбола-Судан. Вирусом Марбург заражали 10 морских свинок, а каждым штаммом вируса Эбола заражали 10 мышей линии BALB/с. На 5 сут у животных забирали кровь и определяли наличие специфической вирусной РНК.

Предварительную инактивацию образцов и выделение РНК проводили в условиях, регламентированных Методическими указаниями МУ 1.3. 2569-09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности».

Процедуру выделения РНК из исследуемого материала проводили с использованием набора «Комплект реагентов для выделения ДНК/РНК из сыворотки или плазмы крови» (НПФ Литех, Россия) в соответствии с инструкцией по применению.

ПЦР в режиме реального времени проводили с праймерами F13060 и R13367, фланкирующими участок ДНК в 307 п.н., в реакционной смеси следующего состава (на 1 исследование):

кДНК 5 мкл
10 × Taq буфер без Mg2+ 3 мкл
100 мM раствор MgCl2 0,7 мкл
5 мM раствор dNTP 1 мкл
Смесь праймеров 2 мкл
(концентрация каждого 10-15 мкмоль/л)
Зонд (концентрация 5-10 мкмоль/л) 1 мкл
SmartTaq ДНК-полимераза 0,3 мкл
Вода для ПЦР 17 мкл
Общий объем 30 мкл

Реакцию обратной транскрипции проводили с использованием набора реагентов «Реверта-L» (ЦНИИЭ, Россия) в соответствии с инструкцией по применению.

В качестве отрицательного контрольного образца в реакционную смесь добавляли ТЕ-буфер.

ПЦР в режиме реального времени и регистрацию результатов проводили в приборе Rotor Gene 6000 (Corbett Research, Австралия) по следующей программе, приведенной в таблице 3.

Таблица 3
Режимы проведения ПЦР
Температура (°С) Время (минуты:секунды) Количество циклов
95 05:00 1
95 00:15 45
55 00:15
72 00:30

Детекцию сигнала флуоресценции осуществляли при шаге циклирования 55°С на канале Yellow (530 нм / 555 нм) для вируса Марбург и на канале Green (470 нм / 510 нм) для вирусов Эбола-Заир и Эбола-Судан.

Результаты интерпретировали на основании наличия (или отсутствия) пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией, что соответствует наличию (или отсутствию) значения порогового цикла Ct в соответствующей графе в таблице результатов. Результат считали положительным в случае, если кривая накопления флуоресценции для соответствующего образца имела характерную «сигмовидную» форму и пересекала пороговую линию. При этом значение Ct для данного образца было не больше 40 (фиг.1).

На фиг.1 приведены кривые флуоресценции на трех оптических каналах амплификатора Rotor Gene 6000 (Corbett Research, Австралия). Флуоресценция в образцах, содержащих генетический материал: вируса Марбург (MARV) - 2 образца на канале Yellow, вирусов Эбола-Заир и Эбола-Судан (EBOV) - 4 образца на канале Green.

Таким образом, из вышеприведенных примеров 1 и 2 видно достижение заявляемого технического результата: создан видоспецифичный набор олигонуклеотидных праймеров и зондов для идентификации генетического материала вирусов Марбург, Эбола-Заир и Эбола-Судан в клинических образцах и биологических жидкостях, образцах внешней среды и других вируссодержащих пробах (культуральная вируссодержащая жидкость и т.д) методом мультиплексного ПЦР в режиме реального времени.

Набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для видоспецифичной экспресс-идентификации вирусов Марбург и Эбола методом полимеразной цепной реакции в реальном времени, включающий:
- последовательности, видоспецифичные для вируса Марбург:
внешние:
5'→3' 5' CCTCTTTTYTCWACWAAAATWATAAGTGA 3'
3'←5' 5” TTCTCAAGATCAGTAACRAAACTHGCACC 3'
внутренние:
5'→3' 5'TGGGACAGYGTTTTYGATAG 3'
3'←5' 5' ACAACCATCATRTTRCTAGGGAATGCYT 3'
зонд:
FAM-GTGTCAGAAATGTCCAAACACTYGCAGAAGC-BHQ1.



 

Похожие патенты:

Изобретение относится к медицине, а именно к оториноларингологии, и касается иммунотерапии гнойного риносинусита. .
Изобретение относится к медицине и предназначено для диагностики поражения слизистой оболочки желудка и двенадцатиперстной кишки в остром и раннем периодах позвоночно-спинномозговой травмы.
Изобретение относится к медицине, а именно к травматологии, и может быть использовано для оценки состояния скелетных мышц у пациентов с закрытыми переломами костей конечностей.
Изобретение относится к области медицины, а именно к ортопедии и медицинской генетике. .

Изобретение относится к области медицины, в частности к онкогематологии. .
Изобретение относится к области медицины и касается способа диагностики смешанной герпесвирусной и бактериальной инфекции у детей. .
Изобретение относится к медицине, а именно к неврологии, и касается способа прогнозирования развития смешанной клещевой энцефалит-боррелиозной инфекции. .
Изобретение относится к медицине, а именно к диагностике, и может быть использовано для определения степени тяжести бронхолегочных заболеваний. .

Изобретение относится к биологии и токсикологической химии и может быть использовано в практике санэпидстанций, химико-токсикологических, экспертно-криминалистических и ветеринарных лабораторий.

Изобретение относится к области биотехнологии, а именно к способу диагностики биоматериалов на наличие в них агробактерий. .

Изобретение относится к области медицинской микробиологии, в частности к идентификации токсигенных штаммов Vibrio cholerae O1, определению их биовара (классического или эльтор) и дифференциации V.

Изобретение относится к микробиологии и молекулярной генетике микроорганизмов и касается способов выявления экспрессирующихся генетических детерминант патогенных микроорганизмов рода Burkholderia с использованием реакций обратной транскрипции и сопряженной амплификации (ОТ-ПЦР) для их последующего структурно-функционального анализа, что, в свою очередь, позволит оценить влияние адаптационных изменений клеток при изменении условий внешней среды на выраженность важнейших биологических характеристик микроорганизмов, в частности вирулентности и устойчивости к антимикробным препаратам.

Изобретение относится к области молекулярной биологии и может быть использовано в медицине, в частности при диагностике наследственных нарушений обмена, приводящих к развитию неонатальной гипербилирубинемии.

Изобретение относится к области медицинской диагностики, может быть использовано для прогнозирования нарушения маточно-плодово-плацентарного кровотока. .
Изобретение относится к медицине, конкретно к диагностике в кардиологии, и касается способа прогнозирования риска возникновения гипертонической болезни у мужчин. .

Изобретение относится к области медицинской диагностики, может быть использовано для прогнозирования почечной выживаемости у больных хроническим гломерулонефритом.
Изобретение относится к области медицинской микробиологии и, в частности, к детекции антибиотикоустойчивых штаммов возбудителя чумы. .
Наверх