Способ прогнозирования интенсивности и резистентности болевого синдрома после операции видеолапароскопической холецистэктомии у больных хроническим калькулезным холециститом

Изобретение относится к области медицины и касается способа прогнозирования интенсивности и резистентности болевого синдрома после операции видеолапароскопической холецистэктомии у больных хроническим калькулезным холециститом. Сущность способа заключается в том, что выделяют ДНК из периферической венозной крови, проводят анализ полиморфизма -308 G/A гена фактора некроза опухоли α. При выявлении генотипов -308 АА и -308 AG TNFα. прогнозируют наибольшую выраженность и стойкость болевого синдрома и рекомендуют проведение мультимодальной послеоперационной анальгезии. При выявлении генотипа -308 GG TNFα прогнозируют более слабый болевой синдром и рекомендуют мономодальную послеоперационную анальгезию. Использование способа позволяет прогнозирования интенсивности и резистентности болевого синдрома после операции видеолапароскопической холецистэктомии у больных хроническим калькулезным холециститом. 3 табл.

 

Изобретение относится к области медицинской диагностики, может быть использовано для прогнозирования интенсивности послеоперационного болевого синдрома в баллах у пациентов с хроническим калькулезным холециститом (ХКХ) после операции видеолапароскопической холецистэктомии (ВЛХЭ).

Хронический калькулезный холецистит - обменно-воспалительное заболевание билиарной системы, характеризующееся образованием конкрементов в просвете желчного пузыря [1]. Среди болезней органов пищеварения ХКХ встречается достаточно часто: он составляет до 90% всех случаев желчно-каменной болезни (ЖКБ), заболеваемость которой в мире достигает 10% [2, 3, 4]. В России холецистэктомии по поводу ХКХ занимают второе место среди всех операций, ежегодно выполняемых населению. Соотношение заболеваемости мужчин и женщин составляет в среднем 1:5. При этом значительную долю заболевших составляет трудоспособное население [5].

Изучение факторов, определяющих формирование ХКХ, его клиническое течение, эффективность терапии является одной из важных задач для отечественных и зарубежных ученых.

Видеолапароскопическая холецистэктомия (ВЛХЭ) является широко используемым методом хирургического лечения ХКХ [6]. Данный вид оперативного вмешательства, являясь малоинвазивным, расширил показания для выполнения холецистэктомии, в том числе и у пациентов с тяжелой сопутствующей патологией (такой как ишемическая болезнь сердца, гипертоническая болезнь, сахарный диабет), сокращая сроки пребывания пациентов в стационаре и уменьшая выраженность послеоперационного болевого синдрома благодаря меньшей степени травматизации тканей. Тем не менее, следует отметить, что от выраженного болевого синдрома в послеоперационном периоде страдают от 30 до 75% пациентов [7].

Поэтому проблема анестезиологического обеспечения подобных операций и послеоперационного обезболивания имеет важное значение несмотря на малоинвазивный характер вмешательства при ВЛХЭ.

Боль сопровождается гиперактивацией симпатической нервной системы, что клинически проявляется тахикардией, гипертензией, повышением общего периферического сопротивления сосудов. На этом фоне у пациентов высокого риска значительно возрастает вероятность резкого увеличения потребности миокарда в кислороде с развитием острого инфаркта миокарда (чаще всего на 3-4 сутки после операции). Адекватное лечение болевого синдрома и торможение симпатической активности в интра- и послеоперационном периоде являются важными факторами профилактики кардиальных осложнений [7, 8].

Некоторые авторы [9, 10] указывают на роль цитокинов и, в частности, центральную роль фактора некроза опухоли α (TNFα) в остром воспалительном ответе, вызванном травматизацией тканей. TNFα оказывает локальные и системные эффекты, которые регулируют воспаление, и, являясь алгогеном, взаимодействует со своими рецепторами, активирует процессы возбуждения в сенсорных нейронах [11]. Следовательно, TNFα играет роль в формировании болевой чувствительности при хирургической агрессии. При операциях на брюшной полости в отношении интенсивности болевого синдрома группой авторов приводятся данные о генетическом полиморфизме мю-опиоидного рецептора, которые, однако, не выявили влияния данного гена на интенсивность послеоперационной боли (использовалась визуально- аналоговая шкала) [12]. Тем не менее, роль полиморфных маркеров фактора некроза опухоли, их влияния на продукцию TNFα и интенсивность болевого синдрома в работах исследователей не показана.

TNFα - гликопротеин с молекулярной массой 17 кДа, является продуктом моноцитов/макрофагов, эндотелиальных, тучных и миелоидных клеток, клеток нейроглии, в особых случаях - активированных Т-лимфоцитов [13]. Ген TNFα расположен на шестой хромосоме человека (6р21.3) в локусе, кодирующем молекулы главного комплекса гистосовместимости первого (HLA-A, В, С) и второго классов (HLA-DP, DQ, DR), между генами Ltα и Ltβ.

Замена гуанина на аденин в позиции 308 TNFα обусловливает усиление активности промоторной области, при этом происходит 6-7-кратное повышение индуцируемого уровня транскрипции гена TNFα. При этом возможно существование трех различных генотипов: -308 АА TNFα, -308 GA TNFα (высокопродуктивных) и -308 GG TNFα (низкопродуктивного) [14, 15, 16]. Исследования роли полиморфных маркеров гена фактора некроза опухоли в отношении интенсивности болевого синдрома после операции ВЛХЭ у больных ХКХ до сих пор не проведены.

Известен способ по патенту РФ №2067768 СПОСОБ ПРОГНОЗИРОВАНИЯ ТЕЧЕНИЯ ПОСЛЕОПЕРАЦИОННОГО ПЕРИОДА У ХИРУРГИЧЕСКИХ БОЛЬНЫХ (опубл., 10.10.1996), в котором для повышения точности прогнозирования течения послеоперационного периода в ранние сроки у хирургических больных до операции и в первые 4-5 суток после нее в крови исследуют содержание миоглобина и по результатам 2-3 исследований прогнозируют развитие послеоперационного осложнения.

Недостатком является необходимость неоднократных заборов крови и то, что способ решает задачу прогноза послеоперационных осложнений, а не прогнозирования послеоперационного болевого синдрома после ВЛХЭ до проведения операции.

Задачей изобретения является разработка способа прогнозирования интенсивности болевого синдрома после ВЛХЭ у пациентов с ХКХ на основе данных о полиморфизме гена рецептора фактора некроза опухоли α (-308 G/A TNFα).

Технический результат использования изобретения - прогнозирование интенсивности послеоперационного болевого синдрома, что позволяет в кратчайшие сроки определить тактику ведения больных с ХКХ: при прогностически низкой интенсивности болевых ощущений осуществлять мономодальную анальгезию, при прогнозировании высокоинтенсивного болевого синдрома - проведение мультимодальной послеоперационной анальгезии.

В соответствии с поставленной задачей был разработан способ прогнозирования интенсивности болевого синдрома после ВЛХЭ, включающий:

- выделение ДНК из периферической венозной крови;

- анализ полиморфизма -308 G/A гена рецептора фактора некроза опухоли α;

- прогнозирование интенсивности послеоперационного болевого синдрома на основе анализ полиморфизма -308 G/A гена рецептора фактора некроза опухоли α: при выявлении генотипов -308 АА и -308 AG TNFα прогнозируют наибольшую выраженность и стойкость болевого синдрома и рекомендуют проведение мультимодальной послеоперационной анальгезии, при выявлении генотипа -308 GG TNFα прогнозируют более слабый болевой синдром и рекомендуют мономодальную послеоперационную анальгезию.

Новизна и изобретательский уровень заключается в том, что из уровня техники не известна возможность определения интенсивности болевого синдрома после ВЛХЭ у больных ХКХ по наличию генотипов локуса -308 G/A TNFα.

Основная задача молекулярно-генетического типирования гена фактора некроза опухоли α - это определение единичной нуклеотидной замены в гене, которая вызывает изменение уровня продукции фактора некроза опухоли α и влияет на интенсивность и резистентность болевого синдрома после операции ВЛХЭ.

На первом этапе к 4 мл крови добавляли 25 мл лизирующего буфера, содержащего 320 мМ сахарозы, 1% тритон Х-100, 5 мМ MgCl2, 10 мМ трис-НСl (рН=7,6). Полученную смесь перемешивали и центрифугировали при 4°С, 4000 об/мин в течение 20 минут. После центрифугирования надосадочную жидкость сливали, к осадку добавляли 4 мл раствора, содержащего 25 мМ ЭДТА (рН=8,0) и 75 мМ NaCl, ресуспензировали. Затем прибавляли 0,4 мл 10% SDS, 35 мкл протеиназы К (10 мг/мл) и инкубировали образец при 37°С в течение 16 часов.

На втором этапе из полученного лизата последовательно проводили экстракцию ДНК равными объемами фенола, фенол-хлороформа (1:1) и хлороформа с центрифугированием при 4000 об/мин в течение 10 минут. После каждого центрифугирования производили отбор водной фазы. ДНК осаждали из раствора двумя объемами охлажденного 96% этанола. Сформированную ДНК растворяли в бидистиллированной, деионизованной воде и хранили при -20°С.

Анализ локуса -308G/A TNFα осуществлялся методом полимеразной цепной реакции (ПЦР) синтеза ДНК, которая проводилась на амплификаторе «Терцик-МС4» производства компании «ДНК-технология», с использованием ДНК-полимеразы Thermus aquations производства фирмы «Силекс-М» и олигонуклеотидных праймеров и зондов, синтезированных фирмой «Синтол» (табл.1) с последующим генотипированием фактора некроза опухоли TNFα.

Таблица 1
Структура праймеров и ферменты рестрикции, используемые для геиотииироваиия ДНК-маркеров методами ПЦР, сайт рестрикции
Ген Полиморфизм и его локализация в гене Структура праймеров Фермент рестрикции
TNFα -308G/A (промотор) F: 5'-AGGCAATAGGTTTTGAGGGCCAT-3' R: 5'-TCCTCCCTGCTCCGATTCGG-3' Bsp19 I
Сиквенс
TNFα -308G/A (промотор) 5'-AGGCAATAGGTTTTGAGGGCATGG GGACGGGGTTCAGCCTCCAGGGTCCTAC ACACAAATCAGTCAGTGGCCCAGAAGAC CCCCCTCGGAATCGGAGCAGGGAGGA-3'
- сайт рестрикции

Анализ локуса -308G/A TNFα осуществлялся с использованием стандартных олигонуклеотидных праймеров (табл.1) по методике, указанной в работе [17]. Реакция проводилась в 12,5 мкл общего объема смеси, содержащей 33,5 мМ трис-НСl (рН=8,8), 1,25 тмМ MgCl2, 0,5 мкг геномной ДНК, по 5 пМ каждого праймера, по 100 мкМ dATP, dGTP, dCTP, dTTP и 1 единицу активной Taq-полимеразы. После денатурации (4 мин при 94°С) выполняли 35 циклов амплификации по схеме: денатурация - 1 мин при 94°С; отжиг праймеров - 1 мин при 60°С; элонгация - 1 мин при 72°С. Затем пробы выдерживали 10 мин при 72°С и охлаждали.

После ПДРФ-анализа продукты рестрикции (табл.1) разделяли в 3% агарозном геле, предварительно окрашенном бромистым этидием, в течение 40 мин при 160V. В качестве электрофорезного буфера использовали 1×TAE (трис-ацетатный буфер). Результаты анализировали в проходящем ультрафиолетовом свете. Фрагменты длиной 107 п.н. соответствовали генотипу -308 АА TNFα, 87 и 20 п.н. - генотипу -308 GG TNFα, а 107, 87 и 20 п.н. выявлены у гетерозигот -308 GA TNFα.

Формирование базы данных и статистические расчеты осуществлялись с использованием программы «STATISTICA 6.0». Сравнивалась степень поражения матки миоматозными узлами у женщин с различными генотипами по анализируемому гену.

В качестве конкретного примера проведен анализ результатов наблюдений 253 пациентов с ХКХ. Пациенты включались в группу обследования только после установления диагноза заболевания, подтвержденного с помощью клинических и лабораторно-инструментальных методов обследования.

Проведено изучение интенсивности болевого синдрома в зависимости от генетического полиморфизма -308 G/A фактора некроза опухоли α.

Характер распределения изучаемых количественных признаков (интенсивность болевого синдрома в баллах) в исследуемой группе пациентов не соответствует закону нормального распределения, о чем свидетельствует значение критерия Шапиро-Уилка W=0,82-0,93 с уровнем их статистической значимости р<0,001. Поэтому для сравнительного анализа интенсивности послеоперационного болевого синдрома у пациентов с разными генотипами по изучаемым молекулярно-генетическим маркерам, мы использовали медиану (Me), интерквартильный размах (Q25-Q75), непараметрические методы статистики (критерий Манна-Уитни).

В табл.2 указаны параметры распределения интенсивности болевого синдрома у пациентов с ХКХ после ВЛХЭ.

Для выявления характера болевого синдрома использовались визуально-аналоговые (цифровые) шкалы боли [8]. Интенсивность болевых ощущений пациентов оценивалась в баллах (от 0 - слабая боль, до 10 - невыносимая боль) после ВЛХЭ при движении через каждые 4 часа в первые сутки и после сна на вторые сутки также через каждые 4 часа.

Следует отметить, что источником болевых ощущений у пациентов после операции являются травмированное ложе желчного пузыря, кожные раны, раздраженная остаточным давлением диоксида углерода париетальная брюшина.

Таблица 2
Параметры распределения показателей, характеризующих послеоперационный болевой синдром у больных хроническим калькулезным холециститом после ВЛХЭ
Характеристики болевого синдрома N Me Q25 Q75 W p
Интенсивность болевого синдрома в течение первого часа первых суток, баллы 253 7 6 8 0,9349 <0,001
Интенсивность болевого синдрома через 4 часа первых суток, баллы 253 6 5 7 0,9356 <0,001
Интенсивность болевого синдрома через 8 часов первых суток, баллы 253 5 4 6 0,9338 <0,001
Интенсивность болевого синдрома через 18 часов вторых суток, баллы 253 3 2 4 0,9037 <0,001
Интенсивность болевого синдрома через 24 часа вторых суток, баллы 253 2 2 3 0,8629 <0,001
Интенсивность болевого синдрома через 28 часов вторых суток, баллы 253 2 1 2 0,8258 <0,001
Примечание: указаны число обследованных больных (N), медиана (Me), интерквартильный размах - 25-й и 75-й процентили (Q25 и Q75), критерий Шапиро-Уилка (W) и уровень его значимости (р).

При анализе взаимосвязей полиморфизма -308G/A гена фактора некроза опухоли α с интенсивностью болевого синдрома в послеоперационном периоде получены следующие результаты (табл.3). Исследование болевой чувствительности проводилось в раннем послеоперационном периоде от момента поступления пациентов в палату с определенными временными интервалами.

Установлено, что у пациентов, с генотипами -308 АА и -308 AG TNFα в течение первого часа наблюдения часов первых суток после операции наблюдается значительно более выраженный (на 33-100%) послеоперационный болевой синдром по сравнению с больными с генотипом -308 GG TNFα. При этом следует отметить, что если у пациентов с генотипом GG интенсивность болевого синдрома в течение суток после операции снизилась в 4 раза, то у индивидуумов с генотипами АА и GG - лишь в 2,7 раза (р<0,001).

В следующем измерении (через 4 часа после перевода в палату) у пациентов, имеющих генотипы -308 АА и -308 AG TNFα, медиана величины боли в баллах была также равна 8, и это достоверно больше на 60% (р<0,001) аналогичного показателя у обследуемых с генотипом -308 GG TNFα, где медиана составила 5 баллов. Анализ измерений через 8, 18, 24 и 28 часов от перевода больного в палату показал, что у пациентов с генотипами АА и AG медианы интенсивности боли составляют 7, 5, 4 и 3 балла соответственно, что достоверно на 50-100% больше аналогичных показателей у больных с генотипом GG: 4, 3, 2 и 2 балла, соответственно (р<0,001).

Таблица 3
Значимые ассоциации генетического полиморфизма -308 G/A TNFα с интенсивностью болевого синдрома (в баллах) у пациентов после ВЛХЭ, Me (Q25-Q75)
Интервалы измерений интенсивности боли Генотипы p
АА и AG (n=75) GG (n=178)
1-й час 8,00 (8,00-8,00) 6,00 (6,00-7,00) 0,000002
4-й час 8,00(7,00-8,00) 5,00 (5,00-6,00) 0,000001
8-й час 7,00 (6,00-7,00) 4,00 (3,00-5,00) 0,000001
18-й час 5,00 (4,00-5,00) 3,00 (2,00-3,00) 0,000002
24-й час 4,00 (3,00-4,00) 2,00 (2,00-2,00) 0,000001
28-й час 3,00 (2,00-3,00) 2,00(1,00-2,00) 0,000002

Приведенные примеры подтверждают, что поставленная задача - разработка способа прогнозирования интенсивности послеоперационного болевого синдрома после ВЛХЭ у больных ХКХ на основе данных о полиморфизме гена рецептора фактора некроза опухоли α - решена. У пациентов с генотипами -308 АА и -308 GA TNFα можно предсказать повышенную интенсивность и резистентность болевого синдрома после ВЛХЭ, следовательно, необходимо проведение мультимодальной послеоперационной анальгезии. При выявлении генотипа -308 GG TNFα прогнозируют более слабый болевой синдром и рекомендуют мономодальную послеоперационную анальгезию.

Литература

1. Григорьев П.Я. Желчнокаменная болезнь и последствия холецистэктомии: диагностика, лечение и профилактика. / П.Я.Григорьев, И.П.Солуянова, А.В.Яковенко // Лечащий врач. - 2002. - №6. - С.26-32.

2. Ивашкин В.Т. Болезни печени и желчевыводящих путей: руководство для врачей. / под ред. В.Т.Ивашкина. - М.: Изд. дом «Вести», 2002. - 416 с.

3. Полунина Т.Е. Желчнокаменная болезнь. / Т.Е.Полунина // Лечащий врач. - 2005. - №2. - С.27-32.

4. Shaffer E.A. Gallstone disease: Epidemiology of gallbladder stone disease. / E.A.Shaffer // Best Pract Res Clin Gastroenterol. - 2006. - V.20. - N.6. - P.981-996.

5. Желчно-каменная болезнь. / С.А.Дадвани с. - М.: Видар-М; 2000. - 315 с.

6. Майстренко Н.А. Гепатобилиарная хирургия. Руководство для врачей. / под ред. Н.А.Майстренко, А.И.Нечая. - СПб.: Специальная литература, 2002. - 508 с.

7. Полушин Ю.С. Анестезиология и реаниматология. / Под общ. ред. Ю.С.Полушина. - СПб.: Элби-СПб. - 2004. - 720 с.

8. Корячкин В.А. Анестезия и интенсивная терапия: справочник. / В.А.Корячкин, В.И.Страшнов. - Спб.: Санкт-Петербургское медицинское издательство. - 2004. - 480 с.

9. Dray A. Inflammatory mediators of pain. / A.Dray // British Journal of Anaesthesia. - 1995. - V.75. - P.125-131.

10. Sheeran P. Cytokines in anaesthesia. / P. Sheeran, G.M. Hall // British Journal of Anaesthesia. - 1997. - V.78. - P.201-219.

11. Ksontini R. Revisiting the role of tumor necrosis factor alpha and the response to surgical injury and inflammation. / R.Ksontini, S.L.MacKay, L.L.Moldawer // Arch Surg. - 1998. - V.133. - P.558-567.

12. Janicki P.A. Genetic association study of the functional A118G polymorphism of the human µ-opioid receptors gene in patients with acute and chronic pain. / Janicki P.A. [et al.] // Anesth Analg. - 2006. - N.103. - P.1011-1017.

13. Hollegaard M.V. Cytokine gene polymorphism in human disease: on-line databases, Supplement 3. / M.V.Hollegaard, J.L.Bidwell // Genes Immun. - 2006. - V.7. - N.4. - P.269-276.

14. Trajkov D. Association of cytokine gene polymorphisms with bronchial asthma in Macedonians. / D.Trajkov [et al.] // Iran J Allergy Asthma Immunol, - 2008. - N.7. - P.143-156.

15. Симбирцев А.С. Роль полиморфизма генов цитокинов в регуляции воспаления и иммунитета. / Симбирцев А.С., Громова А.Ю., Рыдловская А.В. // Медицинский академический журнал. - 2006. - т.6, №1. - С.144-149.

16. Abraham L.J. Impact of the -308 TNF promoter polymorphism on the transcriptional regulation of the TNF gene: relevance to disease. / L.J.Abraham, K.M.Kroeger // J Leukoc Biol. - 1999. - N.66. - P.562-566.

17. Hulkkonen J. Inflammatory Cytokines and Cytokine Gene Polymorphisms in Chronic Lymphocytic Leukaemia, in Primary Sjogren's Syndrome and in Healthy Subjects. / J.Hulkkonen // Academic dissertation University of Tampere, Medical School Tampere University Hospital Finland. - 2002.

Способ прогнозирования интенсивности и резистентности болевого синдрома после операции видеолапароскопической холецистэктомии у больных хроническим калькулезным холециститом, включающий выделение ДНК из периферической венозной крови, анализ полиморфизма - 308 G/A гена фактора некроза опухоли α, прогнозирование интенсивности и резистентности болевого синдрома после ВЛХЭ: при выявлении генотипов - 308 АА и - 308 AG TNFα - прогнозируют наибольшую выраженность и стойкость болевого синдрома и рекомендуют проведение мультимодальной послеоперационной анальгезии, при выявлении генотипа - 308 GG TNFα - прогнозируют более слабый болевой синдром и рекомендуют мономодальную послеоперационную анальгезию.



 

Похожие патенты:

Изобретение относится к медицине, и может быть использовано для определения степени выраженности сердечно-сосудистой патологии у пациентов с различными сосудистыми заболеваниями.
Изобретение относится к медицине, а именно к педиатрии, и может быть использовано для диагностики стадий атопического дерматита у детей. .
Изобретение относится к области ветеринарной медицины. .

Изобретение относится к области медицины, в частности к медицинской физиологии и лабораторной диагностике, и может использоваться для оценки возможности студента формировать патологические реакции (дистресс) в ответ на психоэмоциональный экзаменационный стресс.
Изобретение относится к офтальмологии, а именно к офтальмоэндокринологии, и предназначено для прогнозирования клинического течения эндокринной офтальмопатии у пациентов с болезнью Грейвса.
Изобретение относится к медицине, конкретно к дерматологии, и касается способа диагностики атопического дерматита у детей. .
Изобретение относится к медицине, а именно к психиатрии, и может быть использовано для прогнозирования эффективности терапии ладастеном органических астенических расстройств.
Изобретение относится к медицине, а именно к аллергологии, и касается способа прогноза количества обострений у больных бронхиальной астмой. .

Изобретение относится к области биотехнологии, а именно к зонду для детекции и набору (варианты) для детекции целевой нуклеиновой кислоты, спейсеру, подходящему для присоединения к специфической к мишени последовательности зонда и способу детекции любого взаимодействия между заявленным зондом и целевой нуклеиновой кислотой.

Изобретение относится к медицине, а именно к офтальмологии, и касается способа прогнозирования риска развития диабетической ретинопатии при сахарном диабете типа 2 у якуток.

Изобретение относится к области биотехнологии, а именно к способу гомогенной детекции со сниженным разбросом данных по меньшей мере одного продукта одноцепочечной амплификации.

Изобретение относится к области молекулярной биологии и биохимии и может быть использовано в молекулярной диагностике, связанной с выявлением РНК-мишеней. .

Изобретение относится к области биотехнологии, а именно к набору олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченного зонда для идентификации РНК энтеровирусов.
Изобретение относится к медицине, а именно к клинической лабораторной диагностике, и может быть использовано для выявления и дифференциальной диагностики манифестной и асимтпомной форм уретрита, обусловленного условно-патогенными микроорганизмами, у мужчин репродуктивного возраста.

Изобретение относится к области молекулярной биологии и может быть использовано в медицине при определении наследственной предрасположенности к развитию заболеваний, ассоциированных с носительством полиморфных вариантов гена тиоредоксинредуктазы-1.

Изобретение относится к области молекулярной биологии и может быть использовано в медицине при определении наследственной предрасположенности к развитию заболеваний, ассоциированных с носительством полиморфных вариантов гена пероксиредоксина-1.
Изобретение относится к области медицинской диагностики, а именно к кардиологии и медицинской генетике. .

Изобретение относится к области медицины и касается способа прогнозирования интенсивности и резистентности болевого синдрома после операции видеолапароскопической холецистэктомии у больных хроническим калькулезным холециститом

Наверх