Способ выявления предрасположенности к длительным физическим нагрузкам



Способ выявления предрасположенности к длительным физическим нагрузкам
Способ выявления предрасположенности к длительным физическим нагрузкам
Способ выявления предрасположенности к длительным физическим нагрузкам

 


Владельцы патента RU 2468086:

Федеральное государственное автономное образовательное учреждение высшего профессионального образования "Южный федеральный университет" (RU)

Изобретение относится к генетике и спортивной медицине. Предложен способ выявления предрасположенности к длительным физическим нагрузкам. Способ основан на генотипировании полиморфизма rs2070744 (С786Т) гена NOS3 и полиморфизма rs5370 (G925T) гена EDN1 методом полимеразной цепной реакции. При выявлении генотипа ТТ (rs2070744) и GG (rs5370) диагностируют генетическую предрасположенность к длительным физическим нагрузкам. Техническим результатом настоящего изобретения является увеличение эффективности, точности и достоверности диагностики предрасположенности к длительным физическим нагрузкам. Изобретение может быть использовано с целью диагностики предрасположенности к различным видам физической нагрузки, определения особенностей тренировочного процесса. 4 пр.

 

Область техники, к которой относится изобретение

Изобретение относится к медицине, в частности к молекулярно-генетическим исследованиям, а именно к области диагностики генетической предрасположенности к различным видам физических нагрузок и о и определению возможности выбора занятий различными видами спорта или профессий, связанных с высокой физической активностью.

Уровень техники

Генетические факторы имеют большое влияние на такие признаки «спортивного фенотипа» как, например, сила, мощность, выносливость, состав и размеры мышечных волокон, гибкость и др. Соответственно, «спортивный фенотип» обнаруживает высокую степень наследуемости: примерно на 66% он генетически детерминирован. Остальные вариации обусловлены действием факторов внешней среды (Ahmetov, Rogozkin, 2009) /1/. Поиски специфических генов, ответственных за развитие двигательной функции человека и отдельных физических качеств (выносливость, сила), проводятся с использованием методов ДНК-диагностики, что в дальнейшем может внести существенные изменения в систему отбора и подготовки спортсменов. Прямая ДНК-диагностика заключается в обнаружении полиморфизма или мутаций в известном гене. Ее преимуществом является высокая точность, что позволяет идентифицировать ген, полиморфизм которого связан с двигательной функцией человека. В подавляющем большинстве случаев полиморфизмы обладают нейтральным эффектом. Существуют также полиморфизмы, способные повлиять на степень экспрессии генов, активность функциональных продуктов (белков, РНК) и структуру белков. Функциональная значимость данных полиморфизмов связана с тем, что они расположены в кодирующих (экзоны, гены микроРНК и некоторые интроны, содержащие в себе гены микроРНК) и регуляторных (промоторы, энхансеры) регионах ДНК. Именно эти, наименее представленные типы полиморфизмов, являются предметом ассоциативных исследований спортивных генетиков (Ахметов, 2007) /2/. В 2009 году было проведено первое полногеномное исследование (GWAS - Genome-Wide Association Studies) полиморфизмов, ассоциированных с развитием «спортивного фенотипа». Американскими учеными было исследовано 1.6 миллионов полиморфизмов, ассоциированных с уровнем физической активности. Главное преимущество полногеномных исследований заключается в том, что они охватывают весь геном и, соответственно не ограничиваются какой-либо предварительной гипотезой как в случае исследований кандидатных генов. В настоящее время, однако, является сложным повторение подобных исследований в других лабораториях (Rankinen et al., 2010) /3/.

К настоящему моменту известны свыше 230 генов, полиморфизмы которых ассоциированы с развитием и проявлением физических качеств человека, а также морфофункциональными признаками и биохимическими показателями, изменяющимися под воздействием физических нагрузок различной направленности. Среди них 214 аутосомных генов, 7 генов, расположенных в Х-хромосоме и 18 митохондриальных генов (Bray et al., 2009) /4/.

В настоящее время еще ни по одному из этих направлений не удалось получить убедительных доказательств существования специфических генов, кодирующих регуляцию двигательной функции человека.

Данные, полученные в ходе молекулярно-генетических исследований, открывают новые возможности в разработке и применении диагностических комплексов, направленных на решение проблем медико-генетического отбора в спорте, а также на оптимизацию и индивидуализацию тренировочного процесса.

Известен способ выявления предрасположенности человека к выполнению длительной физической работы (патент RU 2194982, 20.12.2002) /5/, в котором из промывной жидкости ротовой полости обследуемого выделяют геномную ДНК, в выделенной ДНК эпителиальных клеток посредством ПЦР определяют полиморфизм гена анпеотензин - превращающего фермента (АПФ), проводят разделение обследуемых на три генотипа ИИ, ИД и ДД и по наличию И-аллеля АПФ выявляют генетическую предрасположенность человека к выполнению длительной физической работы.

В данном способе учитывается влияние только одного гена АПФ, тогда как на физическую выносливость оказывают влияние и другие гены, в частности, как было показано авторами настоящего изобретения, гены NOS3 и EDN1.

Для оценки физической работоспособности на основе определения значения гена ACTN3 используют способ, который заключается в том, что анализ мутации гена ACTN3 (R577X) проводят методом ПЦР-амплификации искомого фрагмента гена, с его последующим расщеплением соответствующей эндонуклеазой рестрикции, в дальнейшем результат регистрируют методом гель-электрофореза. Полученные результаты статистически обрабатывают и делают вывод о значимости влияния генотипа гена ACTN3 на физическую работоспособность человека (North Kathryn Nance (AU) // ACTN3 genotype screen for athletic performance // Australian Provisional Patent Application 2002951411 // 25.03.2004) /6/.

Однако проведение анализа данным способом является трудоемким, происходит рассмотрение и изучение значения только одного гена, ассоциированного с физической работоспособностью, а также согласно вышеуказанному способу невозможно одновременно и быстро диагностировать большое количество мутаций для одного или разных генов.

Описано исследование, выполненное на образцах геномной ДНК 97 учащихся ГУСПО СПбУОР №2, специализирующихся в пяти скоростно-силовых видах спорта: дзюдо, вольной борьбе, греко-римской борьбе, боксе, тяжелой атлетике, а также конькобежцев-спринтеров и гребцов на короткие дистанции (В.А.Рогозкин, И.В.Астратенкова, А.М.Дружевская, О.Н.Федоровская // Гены-маркеры предрасположенности к скоростно-силовым видам спорта // Теория и практика физической культуры 2005, с.5-8) /7/. ДНК выделяли из клеток букального эпителия ротовой полости. Полученную ДНК использовали в качестве матрицы в полимеразной цепной реакции (ПЦР) в присутствии двух-трех праймеров. После амплификации генов продукты ПЦР подвергали расщеплению эндонуклеазами рестрикции. Затем проводили разделение фрагментов ДНК с использованием вертикального электрофореза в полиакриламидном геле в присутствии маркерных красителей. Для визуализации полученных фрагментов ДНК после электрофореза их окрашивали флюоресцентным красителем - бромистым этидием и просматривали в ультрафиолетовом свете в трансиллюминаторе. Регистрацию полученных результатов проводили после фотографирования фрагментов ДНК. При наличии С-аллели гена ACTN3 считают, что индивидууму целесообразней заниматься скоростно-силовыми видами спорта, а при наличии Т-аллели предпочтительнее виды спорта на выносливость. Наличие С-аллели гена AMPD1 указывает на предрасположенность к скоростно-силовым видам спорта, а Т-аллели - к видам на выносливость. При наличии I-аллели гена АСЕ считают, что индивидууму целесообразней заниматься видами спорта на выносливость, а при наличии D-аллели предпочтительнее скоростно-силовые виды спорта.

Особенностями данного метода являются трудоемкость проведения анализа и дороговизна вследствие повышенного использование расходного материала, в связи с тем, что каждый из генов исследуется отдельно, а также разноплановость функционального значения продуктов исследуемых генов без последующей интерпретации и рекомендаций с учетом полученных результатов.

Известен способ оценки генетического риска сердечно-сосудистых заболеваний у спортсменов (патент RU 2322193, 20.04.2008) /8/, включающий определение полиморфных маркеров генов-кандидатов, в котором выполняют генетическое исследование крови спортсмена, определяют предрасполагающие и защищающие аллели и генотипы полиморфных маркеров генов-кандидатов: для ишемической болезни сердца маркер Т174М гена AGT предрасполагающая аллель М и защищающая аллель Т, маркер А(-153)G гена AT2R1 предрасполагающие генотипы AG, GG и аллель G и защищающие генотип АА и аллель А, маркер А1298С гена MTHFR предрасполагающие генотип СС и аллель С и защищающая аллель А, маркер С825Т гена GNB3 предрасполагающий генотип СС, маркер Ala(-9) Val гена SOD2 предрасполагающие генотип АА и аллель А и защищающие генотип W и аллель V, маркер Т(-262)С гена CAT предрасполагающий генотип СС, маркер Cys311Ser гена PON2 предрасполагающий генотип Ser/Ser и защищающий генотип Cys/Ser, маркер I/D гена АроВ предрасполагающие генотип I/I и аллель I и защищающие генотипы ID и DD и аллель D; для гипертонической болезни маркер Ser447Ter гена LPL предрасполагающая аллель Ser и защищающая аллель Теr, маркер Рго12А1а гена PPARG2 предрасполагающая аллель Аlа и защищающие генотип Pro/Pro и аллель Pro, маркер А1298С гена MTHFR предрасполагающая аллель С и защищающие генотип АА и аллель А, маркер Т(9282) гена CAT предрасполагающий генотип ТС и защищающий генотип СС, маркер Lys198Asn гена END1 предрасполагающий генотип Lys/Lys; для гипертонического сердца маркер 4а/4b гена NOS3 предрасполагающие генотип 4b/4а и аллель 4а и защищающие генотип 4b/4b и аллель 4b, маркер A(-153)G гена AT2R1 предрасполагающие генотип AG и аллель G и защищающие генотип АА и аллель А, маркер А1298С гена MTHFR предрасполагающие генотип СС и аллель С и защищающая аллель А, маркер G7831A генаАСЕ предрасполагающие генотипы GA и АА и аллель А и защищающие генотип GG и аллель G и делают заключение о предрасположенности при количественном преобладании предрасполагающих генотипов и аллелей, а о генетической защите от развития патологии при равном значении предрасполагающих и защищающих генотипов и аллелей или количественном преобладании защищающих.

Однако данный способ не учитывает полиморфизм С-786Т (rs2070744) гена NOS3, данный полиморфизм, в отличие от исследуемого в описанном способе, расположен в промоторном участке гена, и при изменении значительно понижает уровень экспрессии, что и обосновывает его важное значение для оценки физического потенциала организма. Так же следует указать, что известный способ направлен на выявление предрасположенности к заболеваниям сердечно-сосудистой системы, и только косвенно оценивает физическую выносливость спортсмена.

Наиболее близким аналогом настоящего изобретения является способ определения физической работоспособности человека посредством анализа полиморфизма (мутаций) генов методом мультиплексной полимеразной цепной реакции (патент RU 2414511, 20.03.2011) /9/, осуществляемой путем смешивания компонент и добавления олигопраймеров, с последующим анализом полиморфизма длин рестрикционных фрагментов и визуализацией электрофореграммы в полиакриламидном геле, который принимается авторами настоящего изобретения за прототип. В данном способе генетическую предрасположенность определяют путем анализа полиморфизма генов ACTN3 (R577X), CNB (5I/5D), AMPD1 (С34Т) методом мультиплексной полимеразной цепной реакции с использованием набора праймеров, при этом для гена ACTN3 (R577X) используют праймеры 5'-ACTGCTGCCCTTTCTGTTGCCT-3' и 5'-CTGCAGGTGGCACTGACCATA-3', для гена CNB (5I/5D) используют праймеры 5'-GGAGTTTAAAAGCCAGCCAGTCATACTA-3' и 5'-TGGAAGATCACACCATTTGATTAGCAGT-3', для гена AMPD1 (С34Т) используют праймеры 5'-GCAATCTACATGTGTCTACCCCAAAG-3' и 5'-CACTGCTGAAAAATAGCCATGTTTCTG-3', при этом в одну пробирку объединяют 3 пары праймеров, подобранных со средней температурой плавления 58-59°С при стандартных условиях, продукт мультиплексной полимеразной цепной реакции подвергают гидролизу эндонуклеазами рестрикции BstDEl (ген ACTN3) (CCCGAGGCTGACTGAGAGCGAG), Vspl (ген CNB) GTTAATTGTACACTTAAATTAATAGCAACTGTATACT), Tail (ген AMPD1) (TACAGCTGAAGAGAAACGTGAGTATTGCATT) и на основании результата анализа электрофореграммы составляют клиническую интерпретацию, включающую в себя рекомендации по особенностям тренировочного процесса и интенсивности физических тренировок, а при составлении рекомендаций наличие генотипа С/С по гену ACTN3 интерпретируют как предрасположенность к скоростно-силовым видам спорта, генотипа С/Т - как предрасположенность к силовым видам спорта, но требующим выносливости, и генотипа Т/Т - как предрасположенность к видам спорта, требующим выносливости, наличие генотипов I/I или I/D по гену CNB интерпретируют как предрасположенность к занятию любым видом спорта без ограничений по времени и интенсивности нагрузок, и генотипа D/D - как предрасположенность к риску развития гипертрофии, и носителю этого генотипа рекомендуют ограничение тренировок по времени и интенсивности, наличие генотипов С/С и С/Т по гену AMPD1 интерпретируют как предрасположенность к занятию любым видом спорта без ограничений по времени и интенсивности нагрузок, а генотипа Т/Т - как возможность занятия спортом с ограничением тренировок по времени и интенсивности. В качестве клинического образца преимущественно используют образцы ДНК, выделенные из лимфоцитов периферической крови, и других материалов, полученных от обследуемого индивидуума, например буккального эпителия или слюны.

В вышеупомянутом способе-прототипе не учитывается влияние генов NOS3 и EDN1, что не позволяет дать объективную оценку физической выносливости, тогда как в настоящем изобретении была показана значимость полиморфных различий этих генов для способности выносить повышенные физические нагрузки.

Раскрытие изобретения

Техническим результатом настоящего изобретения является увеличение эффективности, точности и достоверности выявления генетической предрасположенности человека к длительной физической работе и выполнению длительных физических тренировок на развитие выносливости, за счет определения полиморфизма генов NOS3 и EDN1.

Достижение технического результата обеспечивается тем, что в способе диагностики предрасположенности к длительным физическим нагрузкам, включающем выявление генотипов аллелей генов, у исследуемых пациентов методом ПЦР проводят генотипирование полиморфизма rs2070744 (C786T) гена NOS3 и полиморфизма rs5370 (G925T) гена EDN1 и при выявлении генотипа ТТ (rs2070744) и GG (rs5370) диагностируют генетическую предрасположенность к длительным физическим нагрузкам.

Предлагаемый способ технически прост, обеспечивает существенное снижение времени и материальных затрат на проведение анализа. Интерпретация полученных результатов может быть использована с целью диагностики предрасположенности к различным видам физической нагрузки, определения особенностей тренировочного процесса.

Способ диагностики наличия или отсутствия у человека предрасположенности к способности выносить длительную физическую нагрузку, основанный на молекулярной диагностике, позволяет перейти от эмпирических способов определения развития двигательной функции человека к выявлению его генетической предрасположенности выполнять длительную физическую работу на основе точных и однозначно интерпретируемых исследований.

Учитывая, что полиморфизм Т-786С ассоциирован со сниженным уровнем продукции NO (является вазодилататором, улучшает микроциркуляцию за счет расслабления гладких мышц сосудов и улучшения реологических свойств крови), авторы настоящего изобретения предположили, что генотип ТТ и нормальный аллель Т встречается в группе профессиональных спортсменов чаще, чем в контрольной группе.

Неожиданно авторами настоящего изобретения были обнаружены достоверные различия в частотах генотипов (χ2=24.76, р<0.05) и аллелей (χ2=7.55, р<0.05) по полиморфизму Т-786С между группой спортсменов и контрольной группой, следовательно полученные результаты позволяют утверждать о наличии достоверных ассоциаций полиморфного маркера Т-786С гена NOS3 с проявлением физических качеств у спортсменов.

Это особенно важно для спортсменов, у которых по данным настоящего исследования частота генотипов ТТ и нормального аллеля Т существенно выше, чем в контрольной группе. Такие результаты могут свидетельствовать об эффективности отбора в профессиональный спорт, в процессе которого произошло «отсеивание» лиц с генотипом СС, несущих 2 полиморфных аллеля гена NOS3 и соответственно характеризующихся сниженным уровнем продукции NO, что негативно сказывается на кровоснабжении работающих мышц.

Приведенные данные не оставляют сомнений об участии эндотелиальной NO-синтазы в адаптации организма к мышечной деятельности. На интенсивность транскрипции гена NOS3 и активность его продукта и, следовательно, на развитие и проявление физических возможностей человека оказывают влияние полиморфные аллели гена NOS3. Активное участие NO в регуляции сосудистого тонуса, кровотока и артериального давления позволяет рассматривать функционально-значимые полиморфизмы гена NOS3 как возможные маркеры предрасположенности к выполнению физических нагрузок.

NO-синтаза - это сложно устроенный гемсодержащий фермент, представляющий собой гомодимер, то есть он состоит из двух одинаковых белковых субъединиц, к каждой из которых присоединено несколько кофакторов, определяющих каталитические свойства фермента: кальмодулин, FMN, FAD, NADPH, тетрагидробиоптерин. Активность фермента проявляется только при объединении двух его субъединиц. Связь между белковыми субъединицами происходит в области их N-конца, где с ними связаны гемовые группы. NOS обладает бифункциональной активностью: монооксигеназной и редуктазной, относится к классу дегидрогеназ (Dudzinski, 2006) /10/.

С помощью эндотелиальной NO-синтазы из L-аргинина образуется оксид азота (NO). NO участвует в регулировании физиологически важных функций сердечно-сосудистой (регулирует сокращение сердца, клеточную пролиферацию, тонус сосудов и давление крови), иммунной и нервной систем.

Основная функция NO связана с вазодилатацией и торможением процесса агрегации и адгезии тромбоцитов и выступает в качестве вещества, улучшающего микроциркуляцию за счет расслабления гладких мышц сосудов и улучшения реологических свойств крови (Невзорова, 1997) /11/.

Кроме того, наличие NO в сосудистом эндотелии является необходимым условием осуществления другими вазодилататорами (ацетилхолин, гистамин, брадикинин, серотонин, адениновые нуклеотиды) сосудорасширяющего действия. Можно считать NO локальным тканевым гормоном, который поддерживает активную вазодилятацию, регулирует кровоток и контролирует артериальное давление (Charbit, 1997) /12/.

NO, выделяемый эндотелиальными клетками в сердце через повышение внутриклеточной концентрации цГМФ, обеспечивает сократительную функцию миокарда, усиливает релаксацию желудочков и увеличивает диастолическую растяжимость (Paulus, 1994) /13/.

Физиологические концентрации NO способны участвовать в регуляции внутриклеточного метаболизма, увеличивать активность антиоксидантных ферментов и экспрессию кодирующих их генов (Ванин, 1998) /14/. Недостаток NO приводит к повреждению мембран клеток свободными радикалами, тогда как его чрезмерная продукция стимулирует апоптоз, что связано с токсическим действием избытка NO на метаболизм клетки. Значительные изменения в синтезе NO при стрессе позволяют предположить участие NO в стрессовых реакциях организма. Выдвинута гипотеза о том, что NO участвует в регуляции стресс-реакции, ограничивая ее чрезмерную активацию и повреждающие эффекты на центральном и периферическом уровнях (Меерсон, 1993) /15/.

В настоящее время можно считать доказанным стимуляцию экспрессии и синтеза NO под влиянием мышечной деятельности. При изучении влияния высокоинтенсивной физической нагрузки на продукцию NO в организме человека было установлено, что содержание оксида азота в выдыхаемом воздухе повышается (Shin, 2003) /16/. Установлено, что под влиянием регулярных физических нагрузок у лиц среднего и страшего возраста наблюдается снижение показателей кровяного давления. У носителей генотипов аа и ab гена NOS3 выявлена достоверная ассоциация с уровнем систолического кровяного давления и физической активностью (Kimura, 2003) /17/. Следует отметить, что в отличие от других изучаемых полиморфизмов гена NOS3, полиморфизм С-786Т локализован в промоторе. Нуклеотидная замена С на Т в -786 положении приводит к снижению активности промотора и, соответственно, снижению уровня синтеза фермента NO-синтазы и уровня синтеза NO (Nakayama et al., 1999) /18/.

Исследуются ассоциации данного полиморфизма с развитием различных нозологических форм сердечно-сосудистых заболеваний. Полиморфизм С-786Т ассоциирован с коронарным вазоспазмом и инфарктом миокарда у японцев, украинцев (Nakayama et al. 2000 /19/; Пархоменко и др., 2008 /20/), увеличенным риском эссенциальной гипертензии у европейцев (Hyndman et al. 2002) /21/ и сниженной функцией сердца у афроамериканцев (McNamara et al., 2009) /22/. Мало известно об ассоциациях этого полиморфизма с различными признаками «спортивного фенотипа».

Включение полиморфизма Т-786С гена NOS3 в состав диагностического комплекса для генетического тестирования спортсменов позволит повысить результативность профессиональной подготовки и сохранить здоровье спортсменов.

Авторами настоящего изобретения также изучена частота генотипов и аллелей гена эндотелина-1 (EDN1) по полиморфизму Lys198Asn. Т. к., с одной стороны, EDN1 обладает способностью запускать внутриклеточные механизмы, приводящие к усилению процессов белкового синтеза в клетках и полиморфизм Lys198Asn ассоциирован с повышенным уровнем EDN1 в крови, что влечет за собой предрасположенность к наращиванию мышечной массы и формированию «спортивного сердца», и, с другой стороны, EDN1 является эффективным вазоконстриктором, ингибирует фибринолиз и стимулирет адгезию лейкоцитов поверхности эндотелия, что обусловливает его вклад в формирование патологий сердечно-сосудистой системы.

В качестве причин влияния данного полиморфизма Lys198Asn на уровень EDN1 необходимо рассматривать возможность влияния трансверсии G>T на стабильность мРНК, а также процессинг препроэндотелина-1. Tanaka показали на культурах клеток, что полиморфизм Lys198Asn не влияет на уровень содержащегося в клеточном супернатанте EDN1 и его предшественников, но содержание пептида в крови больных гипертензией, имеющих генотип ТТ было существенно выше, чем у больных с генотипом GG (Tanaka et al., 2004) /23/.

Наряду с ассоциациями повышенного уровня эндотелина с различными патологиями сердечно-сосудистой системы было показано, что важнейшим свойством EDN1 является его способность запускать внутриклеточные механизмы, приводящие к усилению белкового синтеза и развитию гипертрофии сердечной мышцы (Крюков и др., 2010) /24/. Это означает, что повышенный уровень эндотелина-1 в крови благоприятствует формированию «спортивного фенотипа»: за счет усиления белкового синтеза происходит более быстрое формирование мышечной массы, развивается гипертрофия сердечной мышцы, формируется т.н. «спортивное сердце», что следует расценивать как проявление долговременной адаптационной реакции, обеспечивающей возможность осуществления ранее недоступной по интенсивности физической работы, что играет важную роль в профессиональном спорте. Следовательно, полиморфизмы гена EDN1 могут быть ассоциированы с формированием различных признаков, благоприятствующих занятиям профессиональным спортом.

Результаты анализа распределения генотипов по EDN1 среди спортсменов и их сравнение с контрольной группой позволяют считать данный полиморфный ген маркером проявления физических качеств человека, т.к. полиморфный аллель Т ассоциирован с предрасположенностью к наращиванию мышечной массы. Однако для повышения эффективности отбора в профессиональный спорт и решения проблемы выбора специализации спортсмена необходимо проводить генетический анализ не по одному гену, а по множеству генов, ассоциированных с физической деятельностью человека. Полиморфизмы таких генов в генотипе у разных людей образуют различные комбинации, усиливающие или ослабляющие эффект какого-либо отдельного генетического полимофизма. При анализе частот комбинаций генотипов было выявлено, что наиболее часто встречающейся комбинацией в группе профессиональных спортсменов является комбинация ТТ (NOS3) GG (EDN1), то есть сочетание нормальных гомозигот по двум исследуемым генам. Включение полиморфизмов генов NOS3 и EDN1 в программу для генетического тестирования спортсменов позволит повысить результативность профессиональной подготовки и сохранить здоровье спортсменов.

Осуществление изобретения

Использование предлагаемого способа осуществляют в процессе выполнения тренировочной программы, направленной на развитие выносливости, и тестирование проводят дважды до начала и после окончания тренировочного периода. Использование способа выявления предрасположенности человека к длительной физической работе на основе анализа полиморфизмов генов NOS3 и EDN1 предполагает проведение следующих исследований.

Выделение ДНК из периферической крови

Для выделения ДНК из периферической крови используют коммерческий набор реагентов «ДНК-Экспресс-кровь» (Литех, Москва).

Основные этапы выделения ДНК:

1. В пробирку типа «Эппендорф» с замком внести 1000 мкл цельной крови. Если кровь расслоилась в процессе хранения, то перед внесением ее необходимо перемешать переворачиванием пробирки до однородности.

2. Закрыть пробирку и центрифугировать со скоростью 3000 оборотов в минуту при комнатной температуре в течение 5 минут, после центрифугирования кровь разделится на плазму и форменные элементы. На поверхности осадка форменных элементов расположен тонкий слой лейкоцитов.

3. Аккуратно удалить пипеткой плазму, не захватив при этом лейкоциты.

4. Закрыть пробирку и выдержать ее при -20°С (в морозильной камере) до полного замораживания форменных элементов (в течение 1 часа).

5. Полностью разморозить содержимое пробирки при комнатной температуре.

6. Внести в пробирку реактив «ДНК-экспресс-кровь». Его объем должен быть равен объему оставшихся в пробирке форменных элементов и плазмы (в опыте в пробирке находилось 500 мкл форменных элементов, соответственно прибавляли 500 мкл реагента «ДНК-экспресс-кровь». Закрыть пробирку.

7. Содержимое пробирки в течение 10 секунд тщательно перемешать на вортексе (Vortex).

8. Установить пробирку в предварительно прогретый до 98°С термостат и центрифугировать со скоростью 12000 оборотов в минуту при комнатной температуре в течение 60 секунд.

Полученный таким образом супернатант используют в качестве исследуемого образца ДНК.

Анализ полиморфизма в генах. Проведение амплификации

Для выявления полиморфных аллелей гена синтазы окиси азота 3 (NOS3, С-786Т) и гена эндотелина-1 (EDN1, Lys198Asn) используют наборы реагентов SNP-экспресс (Литех, Москва). Анализ основан на одновременном проведении двух реакций амплификации с двумя парами аллель-специфичных праймеров. Одна пара праймеров комплементарна нормальному аллелю, вторая комплементарна полиморфному аллелю. Данный анализ позволяет выявлять как гетерозиготное носительство полиморфных аллелей, так и гомозиготное состояние.

Ход работы:

1. Приготовить и пронумеровать пробирки для проведения амплификации. Для каждой пробы необходимы две пробирки - N (норма) и Р (патология).

2. Приготовить рабочие смеси реагентов для амплификации из расчета на 1 пробу: 17.5 мкл разбавителя; 2.5 мкл реакционной смеси; 0.2 мкл Taq-полимеразы. Готовятся две рабочие смеси: с реакционной смесью «норма» и с реакционной смесью «патология».

3. После добавления Taq-полимеразы, которое производится в последнюю очередь, необходимо тщательно перемешать смесь пипетированием.

4. Добавить по 20 мкл соответствующей рабочей амплификационной смеси во все соответствующие пробирки для амплификации.

5. Добавить во все пробирки по 1 капле минерального масла.

6. Внести по 5 мкл образца ДНК в пробирку с рабочей амплификационной смесью «норма» и в пробирку с рабочей амплификационной смесью «патология».

7. Пробирки закрыть и центрифугировать в течение 3-5 секунд при 3000 оборотах в минуту.

1. Перенести пробирки в амплификатор для проведения реакции амплификации. Используется «горячий старт», то есть пробирки вносятся в прогретый до 94°С амплификатор.

Режим амплификации:

93°С - 1 минута

1 цикл

93°С - 10 секунд

64°С - 10 секунд

72°С - 20 секунд

35 циклов

72°С - 1 минута

1 цикл

10°С - хранение

Детекция продуктов амплификации

Разделение продуктов амплификации проводят методом горизонтального электрофореза в агарозном геле.

Ход работы:

1. Залить в аппарат для электрофореза ТАЕ-буфер, приготовленный на дистиллированной воде разбавлением 50×ТАЕ: в 50 раз (рН=8.3).

2. Приготовить 3% агарозныи гель. Добавить к 100 мл расплавленной агарозы 10 мкл 1% раствора бромистого этидия.

3. Охладить расплавленную агарозу до температуры 50-60°С и залить в планшет для заливки геля. Для получения карманов в агарозном геле установить гребенку. Объем карманов должен быть не менее 20-25 мкл. После застывания агарозы перенести планшет с гелем в камеру для проведения электрофореза.

4. Нанести в карманы геля по 10-15 мкл амплификата

5. Подключить камеру для электрофореза к источнику питания и задать напряжение 10-15 В/см геля. Оптимальное время проведения электрофореза 15-20 минут.

Анализ электрофореграмм осуществляют под ультрафиолетом (УФ) на трансиллюминаторе BioRad (длина волны УФ света 310 нм).

Далее приводятся конкретные примеры осуществления заявленного способа.

Пример 1

Мужчина 25 лет, кандидат в мастера спорта, профессионально занимается футболом 12 лет.

Проведено молекулярно-генетическое типирование и выявлен генотип TT(rs2070744) и GG (rs5370), данный генотип предрасполагает к высокой физической выносливости и способности переносить длительные физические нагрузки.

Пример 2

Мужчина 30 лет, мастер спорта, профессионально занимается футболом 15 лет.

Проведено молекулярно-генетическое типирование и выявлен генотип TT(rs2070744) и GT (rs5370), данный генотип предрасполагает к высокой физической выносливости и способности переносить длительные физические нагрузки.

Пример 3

Мужчина 24 года, профессиональным спортом не занимается.

Проведено молекулярно-генетическое типирование и выявлен генотип CC(rs2070744) и GT (rs5370), данный генотип не предрасполагает к высокой физической выносливости и способности переносить длительные физические нагрузки.

Пример 4

В качестве объекта исследования были использованы образцы периферической крови 73 профессиональных футболистов ФК «Ростов» и ФК «СКА» в возрасте от 19-35 лет (кандидаты в мастера спорта и мастера спорта, в профессиональном футболе не менее 10 лет), г.Ростов-на-Дону. Контрольную группу составили 50 лиц мужского пола, не занимающихся спортом, из города Ростова-на-Дону.

Частоты генотипов и аллелей в группе спортсменов составили: ТТ - 64.2%, ТС - 21.8%, СС - 14%, частота аллеля Т - 75.34%, С - 24.66%. Нормальных гетерозигот в группе спортсменов на 24% больше, чем в контрольной группе. Частота генотипа СС, обладатели которого имеют сниженный уровень продукции NO, в группе профессиональных спортсменов ниже на 2% по сравнению с контролем. Обнаружены достоверные различия в частотах генотипов (χ2=24.76, р<0.05) и аллелей (χ2=7.55, р<0.05) по полиморфизму Т-786С между группой спортсменов и контрольной группой, следовательно, полученные результаты позволяют утверждать о наличии достоверных ассоциаций полиморфного маркера Т-786С гена NOS3 с проявлением физических качеств у спортсменов.

При оценке соответствия данных исследуемых выборок применяли критерий χ2:

χ2=Σ(П-Е)2/Е,

где П - показатель в исследуемой группе;

Е - данные контрольной группы.

Если вычисленный критерий не превышает табличного для уровня значимости 0.05, то данные о частоте генотипов, полученные нами, соответствуют контрольным.

Для оценки достоверности результата исследования использовали Т-критерий Стьюдента.

Установлена самая часто встречающаяся комбинация генотипов у квалифицированных спортсменов - ТТ (NOS3) - GG (EDN1), частота встречаемости - 41.1%, самая часто встречающаяся комбинация генотипов в контрольной группе - ТС (NOS3) - GG (EDN1), частота встречаемости - 36%. Обнаружены достоверные различия в частотах встречаемости данных комбинаций генотипов между исследуемыми группами.

Частота комбинации ТТ (NOS3) - GT (EDN1), являющейся наиболее удачной с точки зрения предрасположенности к физическим нагрузкам, более чем в 3 раза превышает таковую в контрольной группе (20.55% против 6%).

Вышеприведенные примеры свидетельствуют о возможности использовать заявленный способ для выявления генетической предрасположенности человека к выполнению длительной физической нагрузке и использовать его при отборе в разные сферы деятельности человека с повышенной двигательной активностью (от спорта до работы в экстремальных условиях).

Использование заявляемого способа, в практической работе тренеров позволит повысить результативность профессиональной подготовки и сохранит здоровье спортсменов.

Дифференциация спортсменов по генетически обусловленным способностям создаст основу для индивидуализации педагогического подхода к их обучению, правильного подбора упражнений, выбора адекватного стиля, создания алгоритмов прогнозирования и моделирования успешности соревновательной деятельности. Использование представленных данных в практической работе тренеров повысит результативность спортивного отбора и сохранит здоровье спортсменов при реализации учебно-тренировочной программы в стрессовых ситуациях, с которыми сопряжены занятия спортом.

Способ диагностики предрасположенности к длительным физическим нагрузкам, включающий выявление генотипов аллелей генов методом полимеразной цепной реакции (ПЦР), отличающийся тем, что у исследуемых пациентов проводят методом ПЦР генотипирование полиморфизма rs2070744 (C786T) гена NOS3 и полиморфизма rs5370 (G925T) гена EDN1 и при выявлении генотипа ТТ (rs2070744) и GG (rs5370) диагностируют генетическую предрасположенность к длительным физическим нагрузкам.



 

Похожие патенты:

Изобретение относится к медицине и касается способа прогнозирования риска раннего развития профессиональных аллергических дерматозов. .

Изобретение относится к медицине и может быть использовано для прогнозирования сроков развития профессиональных аллергических дерматозов при воздействии на организм факторов раздражающего и сенсибилизирующего действия.
Изобретение относится к области вирусологии и вирусной цитопатологии. .
Изобретение относится к медицине, а именно к офтальмологии, и касается способа прогнозирования риска развития диабетической ретинопатии при сахарном диабете типа 2 у якутов.

Изобретение относится к микробиологии и клинической лабораторной диагностике. .

Изобретение относится к области микробиологии и иммунологии и касается применения клеточной модели для оценки цитотоксичности антигенов возбудителя мелиоидоза in vitro, позволяющей получить объективные данные о токсических свойствах ряда антигенов Burkholderia pseudomallei с помощью реакции цитотоксичности, выполняемой на перевиваемых монослойных клеточных линиях мышиных фибробластов L929 или клеток яичника китайского хомячка СНО-К1.

Изобретение относится к области молекулярной биологии. .

Изобретение относится к биотехнологии, молекулярно-генетической диагностике фитопатогенов леса. .

Изобретение относится к медицинской микробиологии и представляет собой оригинальный штамм возбудителя псевдотуберкулеза, содержащий хромосомный ген суперантигена Y.pseudotuberculosis YPMa/YPMc (ypmA/C), ген адгезивного «острова» патогенности иерсиний YAPI (pilPQ) и используемый как тест-штамм для дифференциации бактерий Y.pseudotuberculosis генетической группы Ia.

Изобретение относится к медицинской микробиологии и представляет собой оригинальный штамм возбудителя псевдотуберкулеза, содержащий хромосомный ген суперантигена Y.pseudotuberculosis YPMa/YPMc (ypmA/C), ген адгезивного «острова» патогенности иерсиний YAPI (pilPQ), плазмиды с мол.

Изобретение относится к области биотехнологии, конкретно к получению белков шелка различных насекомых, и может быть использовано в медицине для создания фармацевтически приемлемого носителя.

Изобретение относится к биохимии и представляет собой варианты антител, связывающих белок киназы анапластической лимфомы (ALK) человека. .

Изобретение относится к области биотехнологии и представляет собой выделенную нуклеиновую кислоту, включающую регуляторную последовательность РНК-полимеразы I собаки и содержащую (i) по меньшей мере 250, или по меньшей мере 350, или по меньшей мере 450 соприкасающихся нуклеотидов или всю нуклеотидную последовательность, представленную в виде последовательности SEQ ID NO:26, (ii) полинуклеотид, который по меньшей мере на 80% идентичен указанной выше нуклеотидной последовательности (i) или включает комплементарную или обратно комплементарную (i) или (ii) последовательность.

Изобретение относится к генной инженерии, конкретно к получению ингибиторов TGF- 1 и может быть использовано в медицине. .

Изобретение относится к области биотехнологии и касается способа получения рекомбинантных белков паутины паука-кругопряда в клетках дрожжей, слитых белков, содержащих последовательности рекомбинантных белков паутины паука-кругопряда, рекомбинантных ДНК, кодирующих слитые белки, клеток-хозяев дрожжей и векторов экспрессии, используемых для осуществления способа, а также штаммов - продуцентов рекомбинантных белков паутины паука-кругопряда.

Изобретение относится к области биотехнологии, а именно к рекомбинатной плазмидной ДНК рАР271 и линии клеток Mesocricetus auratus ВНК 21 k.13 (2H7). .

Изобретение относится к области биотехнологии, конкретно к применению изоформ фактора роста гепатоцитов (HGF), и может быть использовано в медицине. .

Изобретение относится к области биотехнологии и может быть использовано в биохимии, протеомике и фармакологии для экспрессии и получения сложных трансмембранных белков из бактериальных штаммов-продуцентов.

Изобретение относится к области биотехнологии, а именно к набору синтетических олигонуклеотидов для осуществления генетического скрининга мутаций гена BRCA1. .
Изобретение относится к области медицины, а именно к отоневрологии. .
Наверх