Способ детекции вируса герпеса в тестируемом образце



Способ детекции вируса герпеса в тестируемом образце
Способ детекции вируса герпеса в тестируемом образце
Способ детекции вируса герпеса в тестируемом образце
Способ детекции вируса герпеса в тестируемом образце
Способ детекции вируса герпеса в тестируемом образце
Способ детекции вируса герпеса в тестируемом образце
Способ детекции вируса герпеса в тестируемом образце
Способ детекции вируса герпеса в тестируемом образце
Способ детекции вируса герпеса в тестируемом образце
Способ детекции вируса герпеса в тестируемом образце
Способ детекции вируса герпеса в тестируемом образце
Способ детекции вируса герпеса в тестируемом образце
Способ детекции вируса герпеса в тестируемом образце
Способ детекции вируса герпеса в тестируемом образце

 


Владельцы патента RU 2470999:

ХЕНОМИКА С.А.У. (ES)

Изобретение относится к области биотехнологии и вирусологии. Описаны способ и набор для детекции и идентификации вирусов герпеса HSV-1 и HSV-2 и вируса ветряной оспы VZV. Тестируемый образец подвергают амплификации с комбинацией праймеров. Далее проводят денатурацию продуктов амплификации, гибридизацию денатурированных одноцепочечных олигронуклеотидов с зондами и детекцию гибридизованных олигонуклеотидов. Изобретение может быть использовано в медицине. 3 н. и 9 з.п. ф-лы, 9 ил., 2 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение имеет отношение к способу и набору для детекции и идентификации вируса герпеса в тестируемом образце, в особенности, вирусов HSV-1 и HSV-2. Необязательно, в образце может быть также определен вирус HHV-6, кроме того, в предпочтительных воплощениях способ и набор дополнительно позволяют выполнять эффективное определение вирусов VZV, CMV, EBV, энтеровируса, HHV-7 и HHV-8.

В особенности, изобретение обеспечивает предпочтительные комбинации праймеров для амплификации.

Изобретение также имеет отношение к применению способа и набора для детекции и идентификации, одного или нескольких вирусных агентов, которые выбирают из группы, включающей вирусы HSV-1, HSV-2, HHV-6, VZV, CMV, EBV, энтеровирус, HHV-7 и HHV-8, если таковые присутствуют в тестируемом образце,

Уровень техники

Существует более чем 100 известных вирусов герпеса семейства Herpesviridae. Известно, что восемь из них инфицируют людей: вирус простого герпеса 1 (HSV-1), вирус простого герпеса 2 (HSV-2), вирус ветряной оспы (VZV), вирус Эпштейна-Барра (EBV), цитомегаловирус (CMV), вирус герпеса 6 (HHV-6), вирус герпеса 7 (HHV-7) и вирус герпеса 8 (HHV-8).

Вирусы герпеса представляют собой такой тип возбудителей инфекционных заболеваний, которые после исходной острой инфекции создают скрытую инфекцию, вызывая, в определенных условиях, периодические рецидивы заболевания. Рецидив инфекционного заболевания, вызываемый вирусами герпеса, связан с неврологической патологией и воздействием на нервную систему. Наиболее часто встречаемые клинические проявления инфекционных заболеваний центральной нервной системы, связанных с этой группой вирусов, представляют собой асептический менингит, энцефалит, менингоэнцефалит и полирадикулит.

В дополнение к неврологическим инфекционным заболеваниям, вызываемым вирусами герпеса, в патенте EP 0789081 описаны другие неврологические инфекции вирусного происхождения, такие как вызываемые вирусами группы энтеровирусов. Как энтеровирусы, так и вирусы герпеса, способны вызывать неврологические синдромы, и у иммунокомпетентных, и у иммунодепрессированных пациентов. Следовательно существует серьезный интерес в создании эффективной идентификации агента, связанного с неврологическими симптомами.

Общепринятые лабораторные методики для определения вирусов включают выделение вирусов из клеточной культуры, серологические методики, а также детекцию генетического материала с помощью ПЦР. Две первые методики требуют много времени и характеризуются низкой селективностью, поэтому в последнее время усилия были сосредоточены на последней методике.

Вирусы герпеса представляют собой вирусы с оболочкой, их геном представляет собой двухцепочечную молекулу DNA, тогда как энтеровирусы представляют собой непокрытые оболочкой вирусы, их геном представлен одноцепочечной молекулой RNA положительной полярности.

Некоторые примеры анализов с помощью множественной ПЦР для детекции вируса герпеса описаны в патентах WO 93/25707, WO 2004/016219 и US 2007/0207453.

Патент WO 2004/016219 описывает способ детекции и идентификации одного или нескольких вирусов герпеса человека в образце, этот способ включает применение консенсусных праймеров для консервативной последовательности гена DNA-полимеразы вируса герпеса. Дополнительно проводят детекцию и идентификацию, применяя анализ подвижности гетеродуплекса (HMSA), дот-блот анализ или ПЦР в реальном времени.

Кроме того, патент EP 0789081 описывает способ детекции некоторых вирусов, принадлежащих к семейству Herpesviridae (вирусы HSV-1, HSV-2, VZV, CMV, HHV-6 и EBV), а также энтеровируса.

Патент EP 0789081 описывает смеси праймеров для реакции, которые применяют для энзиматической амплификации геномов вирусов, принадлежащих к семейству Herpesviridae, таких как вирусы HSV-1, HSV-2, VZV, CMV, HHV-6 или EBV, а также энтеровирус. Праймеры применяют для множественной реакции, которая приводит к амплификации фрагментов одинакового размера, посредством которых идентификация возбудителя, присутствующего в образце, может быть проведена только с помощью второй реакции амплификация с использованием продуктов, полученных при первой реакции амплификации, или иначе, с помощью гибридизации амплифицированных последовательностей со специфическими олигонуклеотидными зондами.

Патент WO 2007/056463 описывает способы и композиции для применения в количественном и одновременном анализе в образце двух или более вирусных, бактериальных патогенных факторов или патогенов простейших. Способы этого изобретения включают добавление олигонуклеотидных праймеров, специфических для каждого патогенного фактора, который предполагается обнаружить, вместе с конкурирующими молекулами нуклеиновых кислот, которые амплифицируются со специфическими к патогенам праймерами со сходной эффективностью.

Markoulatos P. et al. (2000, Journal of Clinical Laboratory Analysis, Vol.14, N0. 5, pages 214-219), описывают способ одновременной детекции вирусов HSV-1, HSV-2 и VZV в биологическом образце с помощью множественной ПЦР. Сходным образом, Shin CH et al. (2003, Yonsei Medical Journal, Vol.44, N0. 6, pages 1001-7) описывают способ одновременной детекции вирусов HSV-1, HSV-2, CMV и EBV в образце также с применением множественной ПЦР.

Патент US 2007/0141559 описывает способ детекции и различения вирусов HSV-1 и HSV-2 в образце с помощью последовательности праймеров, специфичных для вирусов HSV-1 или HSV-2, путем проведения множественных или независимых ПЦР-реакций.

Аспекты настоящего изобретения дополнительно имеют отношение к способам, позволяющим снизить детекцию неспецифической кросс-гибридизации амплифицированных специфических к целевым последовательностям последовательностей нуклеиновых кислот; в особенности, но не исключительно, при выполнении описанного выше способа детекции.

Патент WO 03/033735 описывает аналитическую систему, включающую погружаемые в раствор тест-полоски, которая включает высушенные реагенты, которые могут быть применены для обнаружения присутствия специфической последовательности нуклеиновых кислот в образце.

Патент WO 2007/032748 описывает способ детекции путем метилирования в образце DNA, способ, включающий химическое превращение неметилированных остатков цитозина в урацил, амплификацию химически преобразованной DNA с помощью праймеров, из которых верхний праймер биотинилирован, и гибридизацию меченого продукта с олигонуклеотидным зондом вместе с добавлением стрептавидина.

Патент WO 99/25867 описывает способ детекции нуклеиновых кислот в некоторых образцах, который включает, получение этих нуклеиновых кислот в образце, удаление ингибиторов амплификации, создание ПЦР-продуктов сегментов нуклеиновой кислоты, которую предполагается определять, и автоматическое определение продуктов амплификации.

Патент US 2005/0287549 описывает способ одновременной детекции числа SNP. В частности, описано применение пары праймеров, в которой один праймер биотинилирован. Продукт амплификации затем иммобилизуют с помощью реакций авидин-биотин.

Патент EP 0795612 описывает способ амплификации и детекции целевых нуклеиновых кислот в образце, включающий перед детекцией стадию инкубации после амплификации для инактивации ферментов амплификации. Биотинилированный амплифицированный продукт может затем быть обнаружен с помощью гибридизации с конъюгатом стрептавидин-фермент.

Патент WO 01/094638 описывает способ амплификации нуклеиновой кислоты, включающий описание условий проведения термоциклирования и применение меченых прямых праймеров на стадии амплификации.

Патент EP 1595960 описывает способ селективной детекции нуклеиновой кислоты в образце, который включает амплификацию нуклеиновой кислоты с двумя праймерами, один из которых биотинилирован, и гибридизацию меченого продукта с зондом захвата.

Патент KR 060015668 описывает способ детекции патогенных микроорганизмов, включающий амплификацию целевой последовательности с меченым праймером и гибридизацию меченого продукта с зондом, иммобилизованным на поверхности DNA-чипа.

Раскрытие изобретения

Задачей настоящего изобретения является обеспечение способа, который позволяет усовершенствовать детекцию вирусов HSV-1 и HSV-2 по сравнению со способами известного уровня техники.

Желательно, чтобы предусмотренный способ дополнительно позволял определять вирусы HHV-6, VZV, CMV, EBV и энтеровирус.

Это должно быть решено путем конструирования таких праймеров для амплификации, чтобы их применение в реакциях амплификации в соответствии с настоящим изобретением привело к усовершенствованию чувствительности детекции.

Эффективность применения вновь сконструированных праймеров и праймеров способов известного уровня техники сопоставима, по меньшей мере, по чувствительности уровня детекции вирусов VZV, CMV, EBV и энтеровируса.

В предпочтительном воплощении способ настоящего изобретения дополнительно включает праймеры для эффективной амплификации и детекции вирусов HHV-7 и HHV-8.

Настоящее изобретение обеспечивает пары праймеров, которые представляют собой не просто альтернативу уже известным праймерам существующего уровня техники, но которые обеспечивают более эффективный уровень амплификации.

Преимущество способа в соответствии с настоящим изобретением заключается в том, что на эффективность праймеров для амплификации не оказывает негативного влияния присутствие дополнительной пары праймеров для амплификации:

- W1S и W1AS (для амплификации вируса VZV), в случае способа амплификации вирусов HSV-1 и HSV-2, или

- CMVS и CMVAS-21 (для амплификации вируса CMV), EBVAS-23 и CMVS (для амплификации вируса EBV), HER1 и HER4 (для амплификации энтеровируса), HV7-FW и HV7-RW (для амплификации вируса HHV-7), и HV8S и HV8AS (для амплификации вируса HHV-8), в случае способа амплификации вируса HHV-6.

Сложности в разработке результативных множественных ПЦР-реакций широко признаны специалистами в этой области техники (см., например, Markoulatos et al., 2000, Journal of Clinical Laboratory Analysis, Vol.14, N0. 5, pages 214-219; or Shin et al., 2003, Yonsei Medical Journal. Vol.44, N0. 6, pages 1001-7). Следовательно, признается, что конструирование праймеров для применения в таких множественных реакциях не представляет собой рутинную процедуру.

Дополнительное преимущество настоящего изобретения заключается в том, что амплификация с праймерами для амплификации настоящего изобретения приводит к получению продуктов амплификации различных размеров, таким образом, позволяя пользователю различать различные вирусы, представляющие интерес, без необходимости проводить дополнительные стадии, такие как вторая реакция амплификации продуктов, которая является результатом первой реакции амплификации, или гибридизации амплифицированных последовательностей со специфическими олигонуклеотидными зондами.

Краткое описание чертежей

Фигура 1. Электрофорез в агарозном геле, соответствующий амплификации фрагментов примера 1.

Фигура 2. Электрофорез в агарозном геле, соответствующий амплификации фрагментов примера 2.

Фигура 3. Электрофорез в агарозном геле, соответствующий амплификации фрагментов, полученных в экспериментальных условиях примера 2.

Фигура 4. Список праймеров для амплификации.

Фигура 5. Сравнение результатов, полученных, как без селективного биотинилования праймеры, так и с селективным биотинилованием праймера, и в присутствии внутреннего контроля, для вирусов HSV-1 и HSV-2. Панель А: Без селективного биотинилования праймеров; Панель В: С селективным биотинилованием праймеров.

Фигура 6. Сравнение результатов, полученных, как без селективного биотинилования праймера, так и с селективным биотинилованием праймера, и в присутствии внутреннего контроля, для вирусов CMV и EBV. Панель А: Без селективного биотинилования праймеров; Панель В: С селективным биотинилованием праймеров.

Фигура 7. Иллюстрация к методике мечения зонда для снижения детекции кросс-гибридизации.

Осуществление изобретения

Определения. Нижеследующие термины имеют в описании указанные значения за исключением случаев, в которых специально указано, что они имеют другое значение:

- Праймеры для амплификации: Нуклеиновые кислоты, которые связываются с одной или несколькими целевыми последовательностями и позволяют проводить их амплификацию.

- Пробирка с микропанелью: Индивидуальный сосуд из набора, который имеет форму и размер, типичные для лабораторного реакционного сосуда (например, пробирка Eppendorf объемом 1,5 мл) со встроенной в него микропанелью, с помощью которой могут быть проведены тесты, основанные на применении микропанели.

- Сосуд с микропанелью: Реакционный сосуд с плоским дном, включающий микропанель. Молекулы зондов микропанели прикреплены к твердой подложке, причем эта твердая подложка может представлять собой дно сосуда с микропанелью, или другую твердую подложку, прикрепленную ко дну сосуда с микропанелью.

- Микропанель: Расположение молекулярных зондов на поверхности, при котором положение каждого зонда отдельно определено.

- Множественные ПЦР и РТ-ПЦР реакции: ПЦР и РТ-ПЦР реакции, которые позволяют проводить амплификацию двух или более последовательностей нуклеиновых кислот, если они присутствуют в образце.

- Зонды: Нуклеиновая кислота, которая способна специфически связываться с целевой последовательностью нуклеиновой кислоты. Они включают DNA, RNA, PNA и любую другую форму или модификацию.

- Чувствительность детекции: Минимальное поддающееся обнаружению число копий. Термин "усовершенствованная чувствительность" здесь означает, что существует более низкое число поддающихся обнаружению копий.

- Стрип сосудов: Набор сосудов с микропанелями, обычно 8 штук, каждый со встроенной в него микропанелью, с помощью которой могут быть проведены тесты, основанные на применении микропанели.

- Целевые последовательности: Последовательности, которые требуется детектировать.

- Специфические к целевой последовательности зонды: Зонды, которые специфически гибридизуются с целевыми последовательностями, способными к амплификации в реакциях амплификации.

Исходные праймеры для амплификации для детекции вирусов HSV-1 и HSV-2:

SEQ ID N0 1 (CGCATCATCTACGGGGACACGGA) и SEQ ID N0 2 (ATGACGCCGATGTACTTTTTCTT) (На них ссылаются в патенте EP 0789081 как на последовательности SEQ ID N0 4 и 9, соответственно; см., фигура 2 и пример 1 патента EP 0789081).

Продукт амплификации был общим для вирусов HSV-1 и HSV-2.

Для того чтобы их различить, необходимо провести амплификацию продукта амплификации так, как описано в Примере 9 патента EP 0789081.

Условия амплификации для детекции вирусов HSV-1 и HSV-2вв в соответствии с настоящим изобретением:

- Амплификация вирусов HSV-1: Вновь сконструированный праймер, имеющий последовательность SEQ ID N0 3, HSV1S-18 (CCTTCGAACAGCTCCTGG), и праймер, имеющий последовательность SEQ ID N0 2 HSV1AS (ATGACGCCGATGTACTTTTTCTT), называемый праймер SEQ ID N0 9 в патенте EP 0789081.

- Амплификация вируса HSV-2: Вновь сконструированный праймер, имеющий последовательность SEQ ID N0 4, HSV2S-20 (TCCATTTTCGTTTTGTGCCG) и праймер, имеющий последовательность SEQ ID N0 2 HSV1-AS (ATGACGCCGATGTACTTTTTCTT), называемый праймер SEQ ID N0 9 в патенте EP 0789081.

Амплификация с новой парой праймеров для амплификации приводит к более высокой чувствительности детекции при сравнении с амплификацией, проведенной с исходными праймерами, как можно видеть на Фигуре 1, относящейся к Примеру 1.

Дополнительно, амплификация с праймерами HSV1S-18 и HSV1-AS специфична для вирусов HSV-1 и обеспечивает фрагмент размером в 262 bp в случае, если в образце присутствует вирус HSV-1, тогда как амплификация с праймерами HSV2S-20 и HSV1-AS специфична для HSV-2 и обеспечивает фрагмент размером в 170 bp в случае, если в образце присутствует вирус HSV-2.

Продукты размером в 262 и 170 bp можно различить с помощью электрофореза в агарозном геле, что позволяет избежать необходимости в дополнительной амплификации продукта амплификации.

Исходные праймеры для амплификации при детекции вируса HHV-6:

SEQ ID N0 5 (GAGGTAATTTATGGTGATACGGA) и SEQ ID N0 6 (TGTCTACCAATGTATCTTTTTTT), называемые SEQ ID N0 7 и 12, соответственно, в патенте EP 0789081 (см. Фигура 2 и Пример 1 в патенте EP 0789081).

Праймеры для амплификации при детекции вируса HHV-6 в соответствии с настоящим изобретением:

Вновь сконструированный праймер HHV6A-AS (GGCGACTTGAACAGACGATC), имеющий последовательность SEQ ID N0 7, и праймер, имеющий последовательность SEQ ID N0 5, HV6S (GAGGTAATTTATGGTGATACGGA), называемый SEQ ID N0 7 в патенте EP 0789081.

Еще одно дополнительное усовершенствование достигается, если в смеси праймеров HHV6A- AS и HV6S 50% от количества праймера HHV6A-AS замещают вновь сконструированным праймером HHV6B-AS (GGCGATTTGAACAAGCGATC), имеющим последовательность SEQ ID N0 8. Причина этого различия заключается в том, что праймер HHV6A-AS специфически амплифицирует подтип А вируса HHV-6, тогда как HHV6B-AS специфически амплифицирует подтип В вируса HHV-6.

Пример 2 и соответствующая Фигура 2 демонстрируют усовершенствование чувствительности, полученной с новыми праймерами для амплификации, по сравнению с чувствительностью, полученной с исходной смесью праймеров для амплификации, имеющих последовательности SEQ ID N0 5 и SEQ ID N0 6 (называемых в патенте EP 0789081 последовательностями SEQ ID N0 7 и SEQ ID N0 12, соответственно).

Способ настоящего изобретения дополнительно обеспечивает условия амплификации, которые позволяют проводить амплификацию вирусов VZV, CMV, EBV и энтеровируса, по меньшей мере, на настолько же чувствительном уровне детекции, как и уровень детекции способов известного уровня техники. Дополнительно, способ настоящего изобретения включает праймеры для эффективной амплификации и детекции вирусов HHV-7 и HHV-8. Некоторые типичные изображения представлены на Фигурах 1-3, относящихся к Примерам 1 и 2, приведенным ниже.

В предпочтительном воплощении настоящего изобретения праймеры для амплификации соответствуют тем, что представлены на Фигуре 4.

Праймеры для амплификации энтеровируса позволяют проводить амплификацию различных типов энтеровируса: Echo-вирусов, полиовируса и Cosackie-вируса, если они присутствуют в образце.

В предпочтительном воплощении настоящего изобретения способ обнаружения вирусов HSV-1, HSV-2, вирусов HHV-6, VZV, CMV, EBV, HHV-7, HHV-8 и энтеровируса включает амплификацию вирусного генетического материала в двух независимых реакциях:

В одной, относящейся к вирусам HSV-1, HSV-2 и VZV (пробирка 1), и в другой, относящейся к вирусам HHV-6, CMV, EBV, HHV-7, HHV-8 и энтеровирусу (пробирка 2), в котором подходящие соответствующие праймеры инкубируют с интересующим образцом. В предпочтительном воплощении реакция, протекающая в пробирке 1, представляет собой ПЦР, а реакция, протекающая в пробирке 2, представляет собой РТ-ПЦР.

В предпочтительном воплощении настоящего изобретения пробирки 1 и 2 включают следующие компоненты:

Пробирка 1:

Реактивы для множественной ПЦР 1 Объем (мкл)
Образец 5
10Х Буфер для DNA-полимеразы 5
MgCl2, 25 мМ 2
dNTP, 10 мМ 1
HSV1S-18, 0,1 мкг/мкл 0,8
HSV1-АS, 0,1 мкг/мкл 1,6
HSV2S-20, 0,1 мкг/мкл 0,8
VV1S, 0,1 мкг/мкл 0,8
VV1AS, 0,1 мкг/мкл 0,8
DNA-полимераза 0,8
Вода, свободная от нуклеаз до конечного объема 50 мкл

В предпочтительном воплощении пару праймеров, применяемых для амплификации вируса HSV-1, формируют с помощью праймеров HSV1S-18 и HSV1-AS; пару праймеров для вируса HSV-2 формируют с помощью HSV2S-20 и HSV1-AS; и пара праймеров для вируса VZV представляет собой: VV1S (AAGGTTATATATGGAGATACGGA), SEQ ID N0 9 и VV1AS (ATTACCCCAATGTACTTTTTCTT), SEQ ID N0 10. (Эти последние праймеры представляют собой праймеры, имеющие последовательности SEQ ID N0 5 и 10, соответственно, приведенные на Фигуре 2 в патенте EP 0789081). Ожидаемые размеры соответствующих праймеров для амплификации равны:

Вирус Размер (bp)
HSV-1 262
HSV-2 170
VZV 193

Пробирка 2:

Реактивы для множественной РТ-ПЦР 2 Объем (мкл)
Образец 5
5x буфер для РТ-ПЦР 10
dNTP, 10 мМ 2
HV6S,0,1 мкг/мкл 0,8
HHV6A-AS + HHV6B-AS, 0,1 мкг/мкл (50% каждого) 0,8
CMVS, 0,1 мкг/мкл 1,6
CMVAS-21, 0,1 мкг/мкл 0,8
EBVAS-23, 0,1 мкг/мкл 0,8
HV7-FW, 0,1 мкг/мкл 0,8
HV7-RW, 0,1 мкг/мкл 0,8
HV8S, 0,1 мкг/мкл 0,7
HV8AS, 0,1 мкг/мкл 0,7
HER1, 20 мкМ 0,4
HER4, 40 мкМ 0,2
Вода, свободная от нуклеаз до конечного объема 50 мкл

В предпочтительном воплощении пару праймеров, применяемую для амплификации вируса HHV-6, формируют с помощью HV6S (последовательность SEQ ID N0 5, называемая SEQ ID N0 7 на Фигуре 2 патента EP 0789081) и смеси праймеров HHV6A-AS и HHV6B-AS, SEQ ID N0 7 и 8, соответственно, в соответствии с настоящим изобретением (см. выше и Фигуру 4 для соответствующих последовательностей); пару праймеров для вирусов CMV формируют с помощью SEQ ID N° 11, CMVS (относящейся к SEQ ID N0 6 Фигуры 2 патента EP 0789081) и SEQ ID N0 12, CMVAS-21 настоящего изобретения (см. Фигуру 4); пара праймеров для вируса EBV представляет собой: SEQ ID N0 13, EBVAS-23 (см. Фигуру 4) и SEQ ID N0 11, CMVS (относящейся к SEQ ID N0 6 Фигуры 2 патента ЕР 0789081); оставшиеся пары праймеров представляют собой: HV7-FW и HV7-RW, для вируса HHV-7; HV8S и HV8AS для вируса HHV-8; HER1 и HER4 для энтеровируса (см. Фигуру 4).

Ожидаемые размеры соответствующих праймеров для амплификации равны:

Вирус Размер (bp)
HHV-6 122
CMV 106
EBV 132
HHV-7 207
HHV-8 192
Энтеровирус 328

В предпочтительном воплощении ПЦР реакции в пробирках 1 и 2 проводят с помощью амплификатора, запрограммированного на следующий режим термоциклирования:

1 цикл 45°С 45 мин
1 цикл 95°С 15 мин
45 циклов 95°С 30 сек
56°С 1 мин 30 сек
72°С 1 мин
1 цикл 72°С 10 мин

Разница в размерах фрагментов позволяет различить, какой из вирусов присутствует в образце, и нет необходимости дополнительно проводить вторую реакцию амплификации.

Дополнительно, величины чувствительности, полученные с помощью способа в соответствии с настоящим изобретением, были, по меньшей мере, такими же, как величины чувствительности, полученные с парами праймеров существующего уровня техники (см. Примеры 1 и 2, а также Фигуры 1-3).

В другом предпочтительном воплощении одна или обе реакционные пробирки дополнительно включают внутренние контроли. В предпочтительном воплощении описание постановки эксперимента настоящего изобретения включает внутренний контроль на стадии экстракции нуклеиновых кислот. В другом предпочтительном воплощении описание постановки эксперимента настоящего изобретения включает внутренний контроль на стадии амплификации нуклеиновой кислоты.

Предпочтительный внутренний контроль должен представлять собой DNA-плазмиду, которая будет амплифицирована с праймерами для амплификации RTS (GCTTGGGCGTGTCTCAAAATCT, SEQ ID NO 20) и RTA (GTCGCCACGGTTGATGAGAGCT, SEQ ID NO 21). Предпочтительно, внутренний контроль должен представлять собой следующее:

Реактивы для множественной реакции Объем (мкл)
DNA для внутреннего контроля, 103 копий 5
RTS 20 мкМ 0,5
RTA 20 мкМ 0,5

В конечном реакционном объеме, равном 50 мкл.

Продукт амплификации, относящийся к DNA для внутреннего контроля, представляет собой фрагмент DNA размером в 885 bp.

Дополнительно предпочтительные внутренние контроли настоящего изобретения должны представлять собой RNA-фрагмент, который предпочтительно должен быть добавлен к тестируемому образцу перед экстракцией нуклеиновой кислоты.

Другой предпочтительный внутренний контроль должен представлять собой RNA-фрагмент, который предпочтительно следует добавить к нуклеиновым кислотам после экстракции из тестируемого образца. В более предпочтительном воплощении RNA-фрагмент должен присутствовать в сосуде, содержащем реактивы для амплификации, перед инкубацией с нуклеиновыми кислотами, полученными из тестируемого образца.

В более предпочтительном воплощении RNA-фрагмент может быть получен с помощью транскрипции RNA-плазмиды. В другом предпочтительном воплощении RNA-фрагмент может быть получен с помощью химического синтеза.

Характерная проблема множественных ПЦР реакций заключается в присутствии нескольких праймеров для одной и той же реакции амплификации, что может привести к взаимодействию между присутствующими праймерами и может помешать их гибридизации с их целевыми последовательностями и соответствующей амплификации. Эту техническую проблему преодолевают, применяя специфическую комбинацию праймеров для амплификации множественных реакций, соответствующих Пробирке 1 и Пробирке 2.

В предпочтительном воплощении типы образцов, которые могут быть проанализированы с помощью настоящего изобретения, представляют собой мазки, образцы биопсии, залитые в парафин, а также солевой раствор, плазму и спинномозговую жидкость.

В другом предпочтительном воплощении, экстракция генетического материала может быть выполнена как автоматическим способом, так и с помощью методики экстракции вручную существующего уровня техники.

В еще более предпочтительном воплощении автоматическая система экстракции, которая может быть применена для выделения образцов как DNA, так и RNA настоящего изобретения, представляет собой систему NucliSENS easyMAG компании BioMerieux (патент EP 1694813), в которой применяют магнитные частицы в комбинации с методикой BioMerieux's BOOM® для универсального выделения общих нуклеиновых кислот из образов в широком диапазоне объемов и типов.

Специалистам известны методики и способы ручной обработки образцов для экстракции DNA и других нуклеиновых кислот; может быть применен любой из подходящих способов.

В отдельном примере нуклеиновые кислоты экстрагируют из 50 мкл тестируемого образца. После стадии экстракции осадок ресуспендируют в 25 мкл свободной от RNase воды.

В предпочтительном/особом воплощении 5 мкл из 25 мкл, включающих экстрагированный из тестируемого образца генетический материал, добавляют к сосуду, содержащему реактивы для амплификации, в конечном объеме 50 мкл.

В предпочтительном воплощении настоящего изобретения продукты ПЦР, полученные с праймерами для амплификации в соответствии с настоящим изобретением, могут быть дополнительно охарактеризованы с помощью методики с применением микропанелей. Методика с применением микропанелей обеспечивает одновременную детекцию множества молекулярных маркеров для диагностического применения, а также обеспечивает контроли, необходимые для того, чтобы гарантировать достоверность результатов.

В предпочтительном воплощении настоящего изобретения в амплифицированную DNA, в ходе ее амплификации, может быть введена метка, что позволяет проводить дополнительную детекцию, предпочтительно, чтобы метка обеспечивала сигнал, который может быть зарегистрирован колориметрическими способами. В наиболее предпочтительном воплощении, метка представляет собой биотин. Однако может быть применена метка любого типа, известного в этой области техники (например, дигоксигенин). В некоторых воплощениях могут быть применены радиоактивные метки или флуорофоры. В предпочтительном воплощении мечение амплифицированных DNA может быть достигнуто путем добавления модифицированных нуклеотидов, несущих метку (например, биотинилированные или дигоксигенин производные dUTP) в смеси для амплификации. В другом еще более предпочтительном воплощении метка содержится в праймерах для амплификации.

В предпочтительном воплощении настоящего изобретения амплифицированную DNA, предварительно денатурированную, гибридизуют со специфическими к целевой последовательности зондами, для того чтобы минимизировать связанную с присутствием нескольких праймеров проблему множественных ПЦР, которая заключается в получении неспецифических амплифицированных фрагментов.

В предпочтительном воплощении денатурирование амплифицированных DNA может быть выполнено с помощью нагревания. Также могут быть применены другие способы получения одноцепочечной DNA после амплификации; например, химические способы.

Праймеры настоящего изобретения, меченные биотином, были протестированы методом электрофореза в агарозном геле с целью проверки эффективности их амплификации. Было протестировано мечение как одного, так и двух праймеров для каждой пары праймеров. Выбранные условия представлены ниже:

HSV-1 HSV-2 VZV CMV EBV HHV-6 HHV-7 HHV-8 Энтеровирус
1 меченый праймер Х Х
2 меченых праймера Х Х Х Х Х Х Х
Значком Х указано выбранное условие.

В целом, мечение одного или двух праймеров биотином не влияет на эффективность праймеров при амплификации. В большинстве случаев, выбирали мечение обоих праймеров.

Тем не менее, если продукты амплификации были денатурированы и гибридизованы с зондами, специфичными для каждого вируса, существуют проблемы кросс-гибридизации (т.е. связывания с зондами, специфичными для другого вируса): следовательно, продукт амплификации вируса HSV-1 перекрестно гибридизуется с зондом, специфичным для HSV-2; а продукт амплификации вируса EBV перекрестно гибридизуется с зондом, специфичным для CMV. Эту проблему не просто решить из-за гомологии последовательностей среди вирусов.

Проблему решают следующим путем: только один праймер из каждой пары праймеров для амплификации вирусов, которые вступают в перекрестную гибридизацию (т.е. для вирусов HSV-1 или EBV) представляет собой биотин-меченый праймер. Таким образом, цепочка нуклеиновой кислоты амплифицированных фрагментов, которые гибридизуются с зондом, специфичным для другого вируса (т.е. кросс-гибридизуются) остается немеченой, и, следовательно, она не дает никакого сигнала.

Таким путем, хотя если даже произойдет гибридизация комплементарной нити с зондом, относящимся к другому вирусу, то не будет возникать никакого сигнала.

В данном случае, не метятся ни нить вируса HSV-1, который вступает в кросс-гибридизацию с вирусом HSV-2, ни нить вируса EBV, который кросс-гибридизуется с CMV. Специфически, для амплификации вирусов HSV-1, HSV1 S-18 был немеченый, а HSV1-AS - биотин-меченый. Для амплификации вируса EBV, EBVAS-23 был немеченый и CMVS - биотин-меченый. Оба праймера для амплификации вируса HSV-2 (HSV1-AS и HV2S-20) и вируса CMV (CMVS и CMVAS-21) были биотин-мечеными.

Может быть применен любой способ мечения.

Иллюстрация примененной схемы мечения приведена на Фигуре 7.

Подходящие условия амплификации множественной ПЦР 1 и множественной РТ-ПЦР 2 реакций приведены ниже:

Реактивы для множественной ПЦР 1 Объем (мкл)
Образец 5
DNA-полимеразы 10X Буфер 5
MgCl2, 25 мМ 2
dNTP, 10 мМ 1
HSV1 S-18, 0,1 мкг/мкл 0,8
В-HSV1-AS, 0,1 мкг/мкл 1,6
В-HSV2S-20, 0,1 мкг/мкл 0,8
В-VV1S 8, 0,1 мкг/мкл 0,8
B-VV1AS, 0,1 мкг/мкл 0,8
DNA-полимеразы 0,8
Вода, свободная от нуклеаз до конечного объема 50 мкл
Реактивы для множественной РТ-ПЦР 2 Объем (мкл)
Образец 5
5x буфер РТ-ПЦР 10
dNTP, 10 мМ 2
HV6S, 0,1 мкг/мкл 0,8
В-HHV6A-AS + В-HHV6B-AS, 0,1 мкг/мкл (50% каждого) 0,8
B-CMVS, 0,1 мкг/мкл 1,6
В-CMVAS-21, 0,1 мкг/мкл 0,8
EBVAS-23, 0,1 мкг/мкл 0,8
B-HV7-FW, 0,1 мкг/мкл 0,8
В-HV7-RW, 0,1 мкг/мкл 0,8
B-HV8S, 0,1 мкг/мкл 0,7
В-HV8AS, 0,1 мкг/мкл 0,7
В-HER1, 20 мкМ 0,4
HER4, 40 мкМ 0,2
Вода, свободная от нуклеаз до конечного объема 50 мкл

Предпочтительно, чтобы одна или обе множественные реакции дополнительно включали DNA внутреннего контроля, например, в форме DNA-плазмиды, и праймеры для ее амплификации. Например:

Реактивы Объем (мкл)
DNA внутреннего контроля, 103 копий 5
RTS 20 мкМ 0,5
RTA 20 мкМ 0,5

Введение вышеуказанных компонентов в любую множественную реакцию не влияет на полученный результат.

Сравнение результатов, полученных в вышеуказанных предпочтительных условиях, как с селективным биотинилованием праймера, так и без селективного биотинилования праймера, и в присутствии вышеуказанного внутреннего контроля, для вирусов HSV-1/HSV-2 и для вирусов CMV/EBV, показано на Фигурах 5 и 6, соответственно.

Полученные амплифицированные фрагменты гибридизуют в пробирке с микропанелью с различными селективными зондами, относящимися к каждому вирусу, как указано.

В предпочтительном воплощении настоящего изобретения одноцепочечную DNA инкубируют с совокупностью специфических к целевой последовательности зондов, обеспеченных на микропанели, по меньшей мере, с одним, но, предпочтительно, более чем с одним зондом, которые способны к гибридизации с каждой целевой последовательностью, обеспеченной на микропанели. В некоторых воплощениях изобретения одноцепочечную DNA можно инкубировать со специфическими к целевой последовательности зондами, обеспеченными в растворе; однако, предпочтительно, чтобы зонды были обеспечены на твердой подложке.

В предпочтительном воплощении настоящего изобретения зонды располагаются на микропанели, которая может быть помещена на предметное стекло или может находиться в реакционном сосуде, который в этом случае называется сосуд с микропанелью. Сосуды с микропанелью могут быть представлены различными сосудами, включая индивидуальные сосуды с микропанелью, в особенности, пробирки с микропанелью, или наборы сосудов с микропанелью, организованные в стрипы или плоские пластины. Обычно, пластины состоят из наборов стрипов сосудов с микропанелью. Таким образом, микропанель настоящего изобретения может содержаться в индивидуальном сосуде с микропанелью. Альтернативно, две или несколько микропанелей могут быть помещены в стрип сосудов. В предпочтительном воплощении стрипы сосудов состоят из 8-ми сосудов. Дополнительно, три или более сосудов с микропанелью могут быть организованы в набор стрипов сосудов. В другом предпочтительном воплощении, набор стрипов сосудов представляет собой титрационный микропланшет.

В предпочтительных воплощениях, молекулы зонда микропанели могут быть прикреплены на твердой подложке, причем эта твердая подложка может представлять собой дно сосуда с микропанелью или другую твердую подложку, прикрепленную ко дну сосуда с микропанелью. Это означает, что поверхность микропанели может представлять собой плоское дно сосуда с микропанелью. Альтернативно, поверхность микропанели может представлять собой твердую подложку, прикрепленную ко дну сосуда с микропанелью.

В воплощении настоящего изобретения реакционный сосуд имеет размер, типичный для лабораторного реакционного сосуда. Типичный объем наполнения лежит в диапазоне от 100 мкл до 2,5 мл, но также может быть выше или ниже в специальных воплощениях. Особенно предпочтительный реакционный сосуд представляет собой пробирку с микропанелью, т.е. сосуд с микропанелью с нормальным объемом наполнения для стандартной пробирки Eppendorf, равным вплоть до 1,5 мл. Дополнительные предпочтительные объемы наполнения равны вплоть до 0,4 мл, вплоть до 0,5 мл, вплоть до 0,7 мл, вплоть до 1,0 мл или вплоть до 2,0 мл.

Благодаря мечению амплифицированной DNA, где бы молекулы образца ни провзаимодействовали с молекулами зонда на поверхности микропанели, реагент-репортер свяжется с меткой, и появятся видимые сигналы, которые можно зарегистрировать с помощью регистрирующего устройства. Взаимодействие молекул зонда и образца идентифицируют путем локализации сигнала на поверхности микропанели. В особом случае, когда молекулы DNA образца метят биотином, агент-репортер может представлять собой пероксидазу хрена, ковалентно связанную со стрептавидином. Последний специфически связывается с биотином, и пероксидаза инициирует преципитацию субстратов, таких как тетраметилбензидин (ТМВ). Может быть применена любая другая реакция, которая приводит к образованию преципитата на элементах микропанели, и которая может быть применена для детекции взаимодействия между целевыми молекулами и молекулами зонда в соответствии с настоящим изобретением.

Зонды настоящего изобретения могут быть получены с помощью различных способов, таких как химический синтез (например, традиционный способ с фосфотриэфиром) или генно-инженерные методики, например, с помощью молекулярного клонирования рекомбинантных плазмид, при котором соответствующие нуклеотидные последовательности могут быть вставлены, а затем получены путем переваривания с нуклеазами.

Специфические зонды могут быть сконструированы с помощью компьютерной программы выравнивания нуклеиновых кислот Oligo 6. Для всех случаев анализируют параметры Tm и отношение G/C и предупреждают образование вторичной структуры. Предпочтительные зонды настоящего изобретения представляют собой зонды с одинаковой Tm при концентрации соли, применяемой на стадии гибридизации. В предпочтительном воплощении зонды выбирают так, чтобы они связывались со своими соответствующими целевыми последовательностями в тех же условиях гибридизации. Специалистам известны другие способы, с помощью которых могут быть сконструированы специфические зонды.

В особом воплощении настоящего изобретения, зонды выбирают так, чтобы они не гибридизовались с геномной DNA, и не гибридизовались неспецифическим образом с амплифицированными фрагментами, относящимися к другим вирусам.

В предпочтительном воплощении один или несколько зондов настоящего изобретения обеспечены на твердой подложке.

В другом предпочтительном воплощении два или несколько специфических к целевой последовательности зондов для одной и той же целевой последовательности обеспечивают на твердой подложке, с целью улучшить детекцию представляющих интерес вирусных агентов.

В предпочтительном воплощении зонды настоящего изобретения имеют 30 nt в дину или менее.

Указанные зонды или смеси зондов могут быть иммобилизованы в единственном участке твердой подложки, предпочтительно на двух отдельных участках твердой подложки и более предпочтительно на трех отдельных участках твердой подложки.

В предпочтительном воплощении зонды настоящего изобретения обеспечены на твердой подложке, которая локализована в сосуде с микропанелью.

В другом воплощении зонды настоящего изобретения обеспечены на твердой подложке, которая локализована в стрипе с микропанелями.

В более предпочтительном воплощении стрип с микропанелями настоящего изобретения имеет 8 сосудов с микропанелями.

В одном из предпочтительных воплощений твердая подложка представляет собой покровное стекло с покрытием.

В другом предпочтительном воплощении твердая подложка представляет собой дно сосуда с микропанелью, этот сосуд с микропанелью представляет собой или индивидуальную пробирку с микропанелью, или компонент стрипа сосудов, или набор стрипов сосудов, такой как титрационный микропланшет.

В предпочтительном воплощении взаимодействия, происходящие между DNA, амплифицированной с парой праймеров настоящего изобретения, и соответствующими зондами детекции, происходят в индивидуальном сосуде с микропанелью, в стрипе сосудов или в наборе стрипов сосудов.

В предпочтительном воплощении визуализация таких взаимодействий состоит из следующих стадий:

- Во-первых, изображение микропанели регистрируют с помощью оптического прибора,

- Затем, изображение анализируют,

- Наконец, обеспечивают отчет, содержащий интерпретацию результата.

Предпочтительно, изображение анализируют с помощью подходящей компьютерной программы.

Может быть применено любое устройство, подходящее для этого процесса.

В особом воплощении зонды для специфической детекции внутреннего контроля, которые могут быть амплифицированы с праймерами для амплификации RTS и RTA, также присутствуют в микропанели. В особенности, могут быть применены зонды Cl 1 5' (CAGCTGGCACGACAGGTTTCCCGACTGG, SEQ ID NO 22), Cl 1 3' (TTGAAGTGGTGGCCTAACTACGG, SEQ ID NO 23) и Cl 2 5' (CGTTCCACTGAGCGTCAGACCC, SEQ ID NO 24).

Сведения, подтверждающие возможность осуществления изобретения

Обеспеченные ниже примеры только иллюстрируют изобретение и никак не лимитируют объем прилагаемой формулы изобретения.

Пример 1

Предназначенный для анализа образец, в объеме 5 мкл, добавляют к приведенным ниже реактивам для амплификации для множественной ПЦР 1 в конечном реакционном объеме, равном 50 мкл:

Реактивы для множественной ПЦР 1 Объем (мкл)
Образец 5
10X Буфер для Taq Gold DNA-полимеразы 5
MgCl2 25 мМ 2
dNTP, 10 мМ 1
HSV1S-18, 0,1 мкг/мкл 0,8
HSV1-AS, 0,1 мкг/мкл 1,6
HSV2S-20, 0,1 мкг/мкл 0,8
VV1S, 0,1 мкг/мкл 0,8
VV1AS, 0,1 мкг/мкл 0,8
DNA внутреннего контроля, 103 копий 5
RTS 20 мкМ 0,5
RTA 20 мкМ 0,5
Taq Gold DNA-полимеразы 0,8
Вода, свободная от нуклеаз до конечного объема 50 мкл

ПЦР реакции проводят в амплификаторе со следующей программой последовательности циклов:

1 цикл 45°С 45 мин
1 цикл 95°С 15 мин
45 циклов 95°С 30 сек
56°С 1 мин 30 сек
72°С 1 мин
1 цикл 72°С 10 мин

Пара праймеров, образованная вновь сконструированными праймерами, имеющими последовательности SEQ ID N0 3, HSV1 S-18 (CCTTCGAACAGCTCCTGG) и SEQ ID N0 2, HSV1-AS (ATGACGCCGATGTACTTTTTCTT), последняя именуемая последовательностью праймера SEQ ID N0 9 в патенте EP 0789081, дает фрагмент размером в 262 bp, который соответствует вирусу HSV-1 (см. Фигура 1); дополнительно, пара праймеров, образованная вновь сконструированными праймерами, имеющими последовательности SEQ ID N0 4, HSV2S-20 (TCCATTTTCGTTTTGTGCCG) и SEQ ID N0 2, HSV1-AS (ATGACGCCGATGTACTTTTTCTT), последняя именуемая последовательностью праймера SEQ ID N0 9 в патенте EP 0789081, дает фрагмент размером в 170 bp, который соответствует вирусу HSV-2.

Альтернативно, в отдельной реакции, пару праймеров, применяемую в патенте EP 0789081, образованную последовательностью SEQ ID N0 1 (CGCATCATCTACGGGGACACGGA), называемой SEQ ID N0 4 в патенте EP 0789081, и SEQ ID N0 2 (ATGACGCCGATGTACTTTTTCTT), называемый SEQ ID N0 9 в патенте ЕР0 789081, (Фигура 2 и Пример 1 патента EP 0789081), применяют в тех же условиях условия, как описано выше, вместо HSV1 S-18, HSV1-AS и HSV2S-20. Применяют 1,8 мкл раствора с концентраций каждого праймера, равной 0,1 мкг/мкл. Продукт амплификации этих праймеров характерен для вирусов HSV-1 и HSV-2.

Сравнительные результаты, полученные с разными праймерами для амплификации, представлены на Фигуре 1.

В обеих реакциях пара праймеров, применяемая для амплификации вируса VZV, имела следующий вид: SEQ ID N0 9, W1S (AAGGTTATATATGGAGATACGGA), и SEQ ID N0 10, W1AS (ATTACCCCAATGTACTTTTTCTT). Последовательности этих праймеров совпадают с приведенными на Фигуре 2 патента EP 0789081 последовательностями SEQ ID N0 5 и 10, соответственно. Ожидаемый размер соответствующего фрагмента амплификации равен 193 bp.

Как можно видеть на Фигуре 1, реакция в соответствии с настоящим изобретением приводит к усовершенствованию величин чувствительности при детекции вирусов HSV-1, HSV-2 и VZV, при сравнении с реакцией, проводимой с праймерами существующего уровня техники. В случае вирусов VZV, это может быть связано с особенно предпочтительной комбинацией праймеров реакции в соответствии с настоящим изобретением. Сравнение полученных величин чувствительности приведено ниже:

Вирус Чувствительность (HS VI S-18, HSV2S-20, HSVI-AS) Чувствительность (HSVI-AS, SEQ ID N° 4 (CGCATCATCTACGGGGACACGGA))
HSV-I 10 102
HSV-II 10 >10
VZV 10 >10

Пример 2

Предназначенный для анализа образец, в объеме 5 мкл, добавляют к приведенным ниже реактивам для амплификации для множественной ПЦР 2 в конечном реакционном объеме, равном 50 мкл:

Реактивы для множественной РТ-ПЦР 2 Объем (мкл)
Образец 5
5X буфер QIAGEN для одностадийной РТ-ПЦР 10
5x Q-раствор 10
HV6S, 0,1 мкг/мкл 0,8
HHV6A-AS + HHV6B-AS, 0,1 мкг/мкл (50% каждого) 0,8
dNTP, 10 мМ 2
CMVS, 0,1 мкг/мкл 1,6
CMVAS-21, 0,1 мкг/мкл 0,8
EBVAS-23, 0,1 мкг/мкл 0,8
HV7-FW, 0,1 мкг/мкл 0,8
HV7-RW, 0,1 мкг/мкл 0,8
HV8S, 0,1 мкг/мкл 0,7
HV8AS, 0,1 мкг/мкл 0,7
HER1, 20 мкМ 0,4
HER4, 40 мкМ 0,2
Внутренний контроль DNA, 103 копий 5
RTS 20 мкМ 0,5
RTA 20 мкМ 0,5
Смесь ферментов QUIAGEN для одностадийной РТ-ПЦР 2
Вода, свободная от нуклеаз до конечного объема 50 мкл

Условия амплификации были такими же, как для множественной ПЦР 1.

Альтернативно, в отдельной реакции, применяют пару праймеров, описанных в патенте EP 0789081 для вирусов HHV-6, CMV, EBV и энтеровируса (см. Фигура 2 и Пример 1 патента ЕР 0789081). Сравнение чувствительности, соответствующей вирусу HHV-6, показано ниже на Фигуре 2. Фигура 3 обеспечивает дополнительные фрагменты амплификации, полученные в вышеописанных экспериментальных условиях.

1. Способ детекции вирусов HSV-1, HSV-2 и VZV, включающий
a) амплификацию нуклеиновой кислоты в единственной пробирке образца, включающего вирусный генетический материал с парой праймеров:
HSV1S-18 (CCTTCGAACAGCTCCTGG) и HSV1-AS (ATGACGCCGATGTACTTTTTCTT);
HSV2S-20 (TCCATTTTCGTTTTGTGCCG) и HSV1-AS(ATGACGCCGATGTACTTTTTCTT); и
VV1S (AAGGTTATATATGGAGATACGGA) и VV1AS (ATTACCCCAATGTACTTTTTCTT),
реакцию амплификации, предназначенную для получения продуктов амплификации, включающих части генетического материала вирусов HSV-1, HSV-2 и VZV, если они присутствуют;
b) денатурирование продуктов амплификации для получения одноцепочечных олигонуклеотидов из любого продукта амплификации;
c) создание возможности для одноцепочечных олигонуклеотидов по пункту b) гибридизоваться с совокупностью специфических к целевой последовательности зондов, и
d) детекцию гибридизованных олигонуклеотидов.

2. Способ по п.1, в котором праймер HV1S-18 представляет собой немеченый праймер, и праймер HSV1-AS представляет собой меченый праймер, таким образом, что соответствующий продукт амплификации включает одну меченую амплифицированную цепь и одну немеченую амплифицированную цепь.

3. Способ по п.3, дополнительно включающий денатурацию продукта амплификации; и гибридизацию продукта амплификации с одним или несколькими зондами, которые могут быть специфическими и неспецифическими к целевой последовательности зондами; характеризуемый тем, что меченая нить, полученная из меченого праймера HSV1-AS, может гибридизоваться со специфическим к целевой последовательности зондом, а немеченая нить, полученная из немеченого праймера HV1S-18, может гибридизоваться с неспецифическим к целевой последовательности зондом, если таковые присутствуют в образце.

4. Способ по любому из пп.1-3, предназначенный для детекции и идентификации одного или нескольких вирусных агентов, которые выбирают из группы, включающей вирусы HSV-1, HSV-2 и VZV, если таковые присутствуют в тестируемом образце.

5. Набор для детекции и идентификации вирусов HSV-1, HSV-2 и VZV в тестируемом образце, включающий:
i) смесь нуклеиновых кислот для амплификации, включающую пару праймеров для амплификации HSV1 S-18 и HSV1-AS, HSV2S-20 и HSV1-AS и VV1S и VV1AS,
ii) сосуд с микропанелью или набор сосудов с микропанелью, каждый, включающий микропанель, в которой обеспечены специфические к целевой последовательности зонды,
iii) реагенты для применения при визуально регистрируемой гибридизации нуклеиновых кислот с зондами микропанели.

6. Набор по п.5, в котором пара праймеров, составленная из HSV1S-18 и HSV1-AS, включает немеченый праймер HSV1S-18 и меченый праймер HSV1-AS.

7. Набор по п.5, в котором сосуд с микропанелью представляет собой пробирку с микропанелью.

8. Набор по п.5, в котором набор сосудов с микропанелью представляет собой стрип с микропанелями.

9. Набор по п.5, в котором молекулы зонда микропанели прикреплены к твердой подложке, твердая подложка, представляющая собой дно сосуда с микропанелью.

10. Набор по п.5, в котором молекулы зонда микропанели прикреплены к твердой подложке, твердая подложка прикреплена ко дну сосуда с микропанелью.

11. Набор по любому из пп.5, 9 и 10, в котором микропанель включает зонды, которые связываются со своими соответствующими целевыми последовательностями в таких же условиях гибридизации.

12. Применение набора по любому из пп.5-11 для детекции и идентификации одного или нескольких вирусных агентов, которые выбирают из группы, включающей вирусы HSV-1, HSV-2 и VZV, если таковые присутствуют в тестируемом образце.



 

Похожие патенты:

Изобретение относится к лабораторной диагностике заболевания иерсиниозом, вызываемым Yersinia enterocolitica. .

Изобретение относится к области биотехнологии, вирусологии и ветеринарии. .

Изобретение относится к области биотехнологии, в частности к набору праймеров для амплификации гена L1 папилломавируса человека (HPV), набору для детектирования генотипа папилломавируса человека (HPV) и к способам детектирования генотипов папилломавируса человека (HPV).
Изобретение относится к биотехнологии и может быть использовано для прогнозирования возможности эпидемий. .
Изобретение относится к области биотехнологии

Изобретение относится к области медицины, в частности к применению молекулярных маркеров ВПЧ ВКР и их качественных и количественных характеристик для прогнозирования течения гиперпролиферативных заболеваний ШМ. Способ осуществляется поэтапно: 1) из соскобов из цервикального канала и биоптатов ШМ выделяют ДНК ВПЧ; 2) определяют генотип вируса; 3) отбирают пациенток с ВПЧ16-позитивной CIN; 4) методом ПНР в реальном времени определяют число копий ДНК вируса и степень интеграции ее в хозяйский геном (физический статус); 5) устанавливают пороговый уровень вирусной нагрузки с учетом физического статуса вируса (6,5 lg копий ДНК ВПЧ 16 на клетку); 6) классифицируют пациенток в зависимости от установленного порогового уровня вирусной нагрузки и физического статуса вируса (эписомальная или интегрированная форма); 7) выявляют пациенток с неблагоприятным прогнозом, имеющих высокую вирусную нагрузку (>6.5 lg копий ДНК на клетку) при эписомальной форме вируса или низкую нагрузку (<6.5 lg копий ДНК на клетку) при интегрированной форме вируса. Способ позволяет провести раннее прогнозирование неблагоприятного течения цервикальных интраэпителиальных неоплазий и возможного перехода их в рак ШМ. 2 з.п. ф-лы, 2 ил., 1 табл., 4 пр.

Представленные решения касаются способа генерирования заквасочной культуры, заквасочной культуры и способа ферментации с использованием такой заквасочной культуры. Представленный способ генерирования заквасочной культуры включает воздействие на материнский бактериальный штамм, содержащий, по меньшей мере, часть локуса CRISPR, бактериофагом для получения смеси бактерий, содержащей устойчивый к бактериофагам вариантный штамм, содержащий модифицированный локус CRISPR, содержащий, по меньшей мере, один дополнительный спейсер в указанном модифицированном локусе CRISPR; независимое воздействие на тот же материнский бактериальный штамм тем же бактериофагом для получения смеси бактерий, содержащей другой устойчивый к бактериофагам вариантный штамм, содержащий модифицированный локус CRISPR, содержащий, по меньшей мере, один дополнительный спейсер в указанном модифицированном локусе CRISPR, отличный от дополнительного спейсера в первом устойчивом к бактериофагам вариантном штамме; отбор указанных устойчивых к бактериофагам вариантных штаммов из смесей бактерий и их выделение. Представленные изобретения позволяют получать устойчивые к бактериофагам культуры и могут быть использованы в пищевой промышленности при изготовлении подвергнутых брожению продуктов. 3 н. и 26 з.п. ф-лы, 23 ил., 20 табл., 23 пр.

Способ относится к микробиологии и может применяться для определения чувствительности микроорганизмов к бактериофагам. Способ количественной оценки литической активности бактериофагов предусматривает приготовление бактериальной суспензии суточной культуры микроорганизма, выращенной при заданных условиях и соединенной с мясо-пептонным бульоном и специфическим бактериофагом. Оценку литической активности бактериофага осуществляют по среднему значению многократных измерений оптической плотности с вычетом оптической плотности фона реакции взаимодействия компонентов. При полученном значении показателя не более 0,045±0,025 испытуемый микроорганизм оценивают как чувствительный к бактериофагу. При полученном значении показателя литической активности выше указанного микроорганизм считают устойчивым к исследуемому бактериофагу. Изобретение позволяет повысить достоверность результата. 4 табл., 2 пр.
Наверх