Рекомбинантная плазмида psm-zsgreen, кодирующая белки sox2 и с-myc человека и флуоресцентный белок zsgreen, предназначенная для получения индуцированных плюрипотентных стволовых клеток человека


 

C12N15 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2477314:

Федеральное государственное бюджетное учреждение "Новосибирский научно-исследовательский институт патологии кровообращения имени академика Е.Н. Мешалкина" Минздравсоцразвития РФ, (ФГБУ "ННИИПК им. акад. Е.Н. Мешалкина" Минздравсоцразвития России) (RU)
Учреждение Российской академии наук Институт химической биологии и фундаментальной медицины Сибирского отделения РАН (RU)
Учреждение Российской академии наук Институт цитологии и генетики Сибирского отделения РАН (RU)

Изобретение относится к области генной инженерии, молекулярной и клеточной биологии и биотехнологии. Предложена рекомбинантная плазмида pSM-ZsGreen, кодирующая белки SOX2 и C-MYC человека и флуоресцентный белок ZsGreen, предназначенная для временной или постоянной экспрессии генов SOX2, C-MYC и ZsGreen в культивируемых клетках человека и обеспечивающая стабильную экспрессию введенного гена. Рекомбинантная плазмида может использоваться в качестве вектора для получения индуцированных плюрипотентных стволовых клеток человека. 1 ил., 1 табл.

 

Изобретение относится к области генной инженерии, молекулярной и клеточной биологии, биотехнологии и может быть использовано для получения индуцированных плюрипотентных стволовых клеток человека.

Индуцированные плюрипотентные стволовые клетки (ИПСК) - это тип стволовых клеток, которые могут быть получены из соматических клеток животных и человека в результате повышенной экспрессии набора определенных генов [1-3]. Для получения ИПСК человека и животных успешно используется сверхэкспрессия таких генов как OCT4, SOX2, KLF4 и c-MYC [2].

Известно, что для получения большинства новых линий ИПСК в настоящий момент используют генетические конструкции, полученные на основе ретро- и лентивирусных векторов. Этот метод характеризуется тем, что происходит случайное встраивание ДНК-копий геномов ретро- или лентивирусов в геномы клеток, что в свою очередь может приводить к нарушению функционирования генов [4].

Для полномасштабного применения индуцированных плюрипотентных стволовых клеток в фундаментальных и прикладных исследованиях, таких как скрининг новых лекарственных веществ, исследования в области токсикологии и регенеративной медицины, необходимо решение ряда проблем. Во-первых, необходима разработка методов получения ИПСК без генетической модификации их геномов. Во-вторых, способ получения ИПСК должен быть достаточно эффективным.

Известно, что плазмидные векторы (плазмиды) могут временно существовать в ядрах клеток, обеспечивая стабильную транскрипцию нуклеотидных последовательностей, находящихся под контролем конститутивных промоторов. Кроме того, известен метод, основанный на использовании специфических последовательностей - 2А-пептидов, позволяющий получать генетические конструкции, обеспечивающие трансляцию нескольких полипептидов (белков) с одной молекулы матричной РНК [5].

Задачей данного изобретения является конструирование полицистронной неинтегрирующейся плазмидной конструкции, кодирующей белки SOX2 и C-MYC человека и флуоресцентный белок ZsGreen, обеспечивающей одновременную трансляцию данных белков и являющейся вектором при получении индуцированных плюрипотентных стволовых клеток. Белки SOX2 и C-MYC необходимы для запуска репрограммирования клеток, а флуоресцентный белок ZsGreen служит маркером трансфекции клеток и последующей элиминации плазмидной ДНК.

Реализация изобретения осуществляется следующим образом.

Конструирование рекомбинантной плазмидной ДНК выполняют на основе плазмиды pIRES (Clontech) и включает следующие стадии:

1. Выделяют РНК из клеток известной линии эмбриональных стволовых клеток человека HUES9 [6], и производят синтез кДНК с помощью олиго-(dT) праймеров. Полученную кДНК используют в качестве матрицы для синтеза фрагментов, кодирующих белки;

2. Синтез фрагмента кДНК гена SOX2 -позиции в мРНК 428-1379- (Homo sapiens SRY (sex determining region Y)-box 2) человека, (регистрационный номер в GeneBank NM_003106.2), размером 1023 пар нуклеотидов, содержащего на 3'-конце последовательность P2A-пептида (SOX2-P2A). Синтез проводят с помощью полимеразной цепной реакции с праймерами: hSOX2 5' XbaI 5'-TTTAGTGTCTAGAATGTACAACATGATGGAGACGGAGCTG-3' (прямой праймер, содержит искусственно введенный сайт эндонуклеазы рестрикции Xba I) и hSOX2 P2A 3'5'-TTCTCTTCGACATCCCCTGCTTGTTTCAACAGGGAGAAGTTAGTGGCTCCGCTTCCGGACATGTGTGAGAGGGGCAGTGTGCCGTTAATG-3' (обратный праймер, содержащий нуклеотидную последовательность кодирующую пептид P2A);

3. Синтез фрагмента кДНК гена c-MYC -позиции в мРНК 571-1891- (Homo sapiens v-myc myelocytomatosis viral oncogene homolog (avian)) (регистрационный номер в GeneBank NM_002467.4) размером 1397 пар нуклеотидов, содержащего на 5'-конце последовательность P2A-пептида (P2A-c-MYC). Синтез проводят с помощью полимеразной цепной реакции с праймерами: hcMYC P2A 5' 5'- GCCACTAACTTCTCCCTGTTGAAACAAGCAGGGGATGTCGAAGAGAATCCCGGGCCAATGCCCCTCAACGTTAGCTTCACCAACAGGAAC-3' (прямой праймер, содержащий нуклеотидную последовательность кодирующую пептид P2A) и hcMYC 3' SalI 5'- TTTAGCAGTGGTACGTCGACTTACGCACAAGAGTTCCGTAGCTGTTC-3' (прямой праймер, содержит искусственно введенный сайт эндонуклеазы рестрикции Sal I);

4. Объединение фрагментов SOX2-P2A и P2A-c-MYC осуществляют методом полимеразной цепной реакции с использованием в качестве матриц перекрывающихся фрагментов SOX2-P2A и P2A-c-MYC, а также праймеров hSOX2 5'XbaI и hcMYC 3' SalI. В результате получают фрагмент SOX2-P2A-c-MYC, размером 2373 пар нуклеотидов;

5. Фрагмент ДНК, кодирующий белок ZsGreen, вырезают из плазмиды pZsGreen (Clontech) эндонуклеазой рестрикции Xba I и клонируют в сайт Xba I, находящийся в полилинкере B плазмиды pIRES (Clontech). В результате получена плазмида pIRES-ZsGreen.

6.Фрагмент ДНК SOX2-P2A-c-MYC клонируют с помощью набора реагентов pGEM-T Easy Vector Systems (Promega) и штамма E.coli XL-10 Gold;

7. Клоны плазмиды pGEM-T Easy со встройками pGEM-SOX2-P2A-c-MYC последовательности выделяют стандартным методом щелочного лизиса (Maniatis, Т., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: a Laboratory Manual, Cold Sping Harbor Laboratory Press);

8. Фрагмент SOX2-P2A-c-MYC вырезают из плазмиды pGEM-SOX2-P2A-c-MYC с помощью эндонуклеаз рестрикции Spe I и EcoR I и лигируют с плазмидой pIRES-ZsGreen, гидролизованной эндонуклеазами рестрикции Nhe I и EcoR I, сайты которых расположены в полилинкере А - эндонуклеазы рестрикции Spe I и Nhe I имеют совместимые липкие концы.

В результате получена плазмида pSM-ZsGreen размером 9204 п.н. (SM= SOX2, c-MYC).

На чертеже изображена карта плазмидной генетической конструкции pSM-ZsGreen. Фрагмент ДНК, кодирующий белки SOX2 и C-MYC, встроен между сайтами Nhe I и EcoR I в полилинкер А плазмиды pIRES, а ДНК, кодирующая ZsGreen, встроена в сайт Xba I полилинкера В плазмиды pIRES.

Описание и позиции в нуклеотидной последовательности (п.н., пара нуклеотидов) функциональных элементов генетической плазмидной конструкции pSM-ZsGreen представлены в таблице 1.

Таблица 1
Элемент плазмидной генетической конструкции Позиции в последовательности конструкции, п.н.
p CMV IE - энхансер/промотор цитомегаловируса 1-750
IVS - интрон 890-1022
Промотор РНК-полимеразы T7 1067-1085
Фрагмент ДНК SOX2-P2A-c-MYC 1085-3445
IRES - внутренний сайт посадки рибосом 3474-4055
ZsGreen - кДНК гена ZsGreen 4078-4822
Промотор РНК-полимеразы T3 4968-4890
SV40 poly A - фрагмент, содержащий сигнал полиаденилирования мРНК вируса SV40 4967-5189
Ориджин репликации f1 5285-5741
p SV40 - энхансер/ранний промотор вируса SV40 5806-6224
SV40 ori - ориджин репликации вируса SV40 6122-6188
Neo-r - ген устойчивости к неомицину 6269-7064
Синтетический сигнал полиаденилирования 7129-7178
Amp-r - ген устойчивости к ампициллину 7590-8451

Полученная плазмидная генетическая конструкция pSM-ZsGreen построена на основе плазмидного вектора pIRES (Clontech), в который помещены фрагменты кДНК генов SOX2 и c-MYC человека, соединенные нуклеотидной последовательностью, кодирующей P2A-пептид и кДНК гена, кодирующего флуоресцентный белок ZsGreen.

Транскрипция единой мРНК SOX2-P2A-c-MYC-IRES-ZsGreen осуществляется с конститутивного промотора p CMV IE, обеспечивающего высокий уровень наработки мРНК. Наличие последовательностей P2A и IRES позволяет одновременно транслировать белки SOX2, C-MYC и ZsGreen с одной молекулы мРНК.

Фрагмент ДНК, кодирующий флуоресцентный белок ZsGreen, является маркером трансфекции клеток и последующей элиминации плазмидной ДНК.

Плазмидная генетическая конструкция pSM-ZsGreen предназначена для временной или постоянной экспрессии генов SOX2, C-MYC и ZsGreen в культивируемых клетках человека и обеспечивает стабильную экспрессию введенного гена.

Рекомбинантная плазмида pSM-ZsGreen может использоваться в качестве вектора для получения индуцированных плюрипотентных стволовых клеток человека.

Список использованной литературы

1. Takahashi, K. and S. Yamanaka, Induction of pluripotent stem cells from mouse embryonic

and adult fibroblast cultures by defined factors. Cell, 2006. 126(4): p. 663-76.

2. Takahashi, K., et al., Induction of pluripotent stem cells from adult human fibroblasts by

defined factors. Cell, 2007. 131(5): p. 861-72.

3. Yu, J., et al., Induced pluripotent stem cell lines derived from human somatic cells. Science, 2007. 318(5858): p. 1917-20.

4. Okita, K., et al., Generation of mouse induced pluripotent stem cells without viral vectors.

Science, 2008. 322(5903): p. 949-53.

5. Szymczak, A.L. and Vignali, D.A., Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther, 2005. 5(5): p. 627-38.

6. Cowan, C.A., et al., Derivation of embryonic stem-cell lines from human blastocysts. N Engl J Med, 2004. 350(13): p. 1353-6.

1. Рекомбинантная плазмида pSM-ZsGreen, кодирующая белки SOX2 и С-MYC человека и флуоресцентный белок ZsGreen, предназначенная для получения индуцированных плюрипотентных стволовых клеток человека, представляющая собой генетическую конструкцию на основе плазмиды pIRES, содержащая следующие конструктивные элементы: фрагмент ДНК, кодирующий белки SOX2 и C-MYC человека, включающий последовательность, кодирующую Р2А, расположенную между последовательностями SOX2 и C-MYC, встроен между сайтами рестрикции NheI и EcoRI в полилинкер А плазмиды pIRES, размер встройки 2360 пар нуклеотидов, и фрагмент ДНК, кодирующий флуоресцентный белок ZsGreen, встроенный в сайт Xba I полилинкера В плазмиды pIRES; транскрипция полицистронной мРНК SOX2-P2A-C-MYC-IRES- ZsGreen осуществляется с конструктивного промотора pCMV IE.

2. Рекомбинантная плазмида pSM-ZsGreen по п.1, где разделение последовательностей элементами Р2А и IRES позволяет экспрессировать три белка с одной плазмиды одновременно.

3. Рекомбинантная плазмида pSM-ZsGreen по п.1, где фрагмент ДНК, кодирующий белки SOX2 и C-MYC человека, запускает репрограммирование клеток для получения индуцированных плюрипотентных стволовых клеток человека, а фрагмент ДНК, кодирующий флуоресцентный белок ZsGreen, является маркером трансфекции клеток и последующей элиминации плазмидной ДНК.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к получению модифицированных белков IGF-1, и может быть использовано в медицине. .

Изобретение относится к области биотехнологии, конкретно к получению модифицированных белков IGF-1, и может быть использовано в медицине. .

Изобретение относится к области биохимии. .

Изобретение относится к биотехнологии, в частности генной инженерии, и может быть использовано для лечения новообразований различной природы. .

Изобретение относится к области биотехнологии. .

Изобретение относится к области биотехнологии. .

Изобретение относится к области биотехнологии. .

Изобретение относится к области иммунологии. .

Изобретение относится к медицине, а именно к офтальмологии, и может быть использовано для лечения, стабилизации и/или профилактики дегенерации желтого пятна. .

Изобретение относится к области биотехнологии, конкретно к получению миелоподобных клеток, и может быть использовано в медицине. .

Изобретение относится к области молекулярной биологии и биотехнологии и может быть использовано в медицине и в фармацевтической промышленности. .

Изобретение относится к генной инженерии, биохимии, биотехнологии и иммунологии. .

Изобретение относится к медицине и может быть использовано для введения противосвертывающей системы субъекту, где система включает аптамер, который связывает фактор IX/IXa, и антидот, который связывает аптамер.

Изобретение относится к области биотехнологии
Наверх