Способ выявления патогенных штаммов и изолятов бактерии pasteurella multocida


 


Владельцы патента RU 2477321:

Государственное научное учреждение Институт экспериментальной ветеринарии Сибири и Дальнего Востока Российской академии сельскохозяйственных наук (ГНУ ИЭВСиДВ Россельхозакадемии) (RU)

Изобретение относится к ветеринарной микробиологии и биотехнологии, а именно к генетической инженерии. Предложен способ выявления патогенных штаммов и изолятов бактерии Pasteurella multocida при помощи ПЦР. Способ может быть использован в ветеринарной микробиологии для диагностики пастереллеза сельскохозяйственных животных. Способ включает выделение культур микроорганизмов из патологического материала на искусственных питательных средах, проведение ПЦР с синтетическими олигонуклеотидными праймерами SEQ ID NO: 1 - 5' atgatgtcggcatgaatttctcagc 3' и SEQ ID NO: 2 - 5' aacatagccagcgccagcaatgt 3'. Переносят продукт амплификации на гель и оценивают проведенную реакцию. Для постановки ПЦР используют взвесь микроорганизмов на стерильной дистиллированной воде без выделения ДНК. ПЦР проводят в 1 раунд. В случае положительной реакции синтезируется фрагмент, соответствующий размеру 534 п.н. Предложенное изобретение позволяет эффективно выявлять патогенные штаммы и изоляты бактерии Pasteurella multocida. 3 табл., 4 пр.

 

Изобретение относится к ветеринарной микробиологии и биотехнологии, а именно к генетической инженерии, и может быть использовано для диагностики пастереллеза сельскохозяйственных животных.

Pasteurella multocida - условно-патогенная грамотрицательная бактерия, постоянно обитающая на слизистой оболочке верхних дыхательных путей животных. Бактерия обладает несколькими факторами вирулентности (капсула, дермонекротический токсин, адгезины, протектины, гиалуронидаза, железотранспортирующие протеины), обуславливающими ее патогенность для крупного рогатого скота (Dabo S.M. Pasteurella multocida and bovine respiratory disease / S.M.Dabo, J.D.Taylor, A.W.Confer // Animal Health Research Reviews. - 2008. - Vol.8 (2). - P.129-150). Комбинация факторов вирулентности у штаммов и изолятов бактерии Pasteurella multocida может быть разной, но во всех случаях обеспечивает проявление их патогенности.

Одновременно с патогенными изолятами бактерии Pasteurella multocida от больных животных могут выделяться и непатогенные, что затрудняет диагностику и требует определения патогенности выделенных культур.

До настоящего времени основным способом определения патогенности выделенных культур Р. multocida является трудоемкая процедура постановки биологической пробы на белых мышах массой 16-18 грамм. При этом наблюдение за зараженными животными проводят в течение 7 суток. Культуру считают патогенной, а биологическую пробу положительной при гибели через 24-72 часа хотя бы одного из зараженных животных и выделении от него исходной культуры бактерии (Методические указания по лабораторной диагностике пастереллезов животных и птиц, утвержденные Главным управлением ветеринарии министерства сельского хозяйства Российской Федерации №22-7/82 от 20.08.1992 г.).

К недостаткам данного способа относятся необходимость выделения и идентифицирования культуры бактерий по биохимическим и культурально-морфологическим свойствам, а также постановки биологической пробы на чувствительных лабораторных животных, что обуславливает его длительность, трудоемкость и дороговизну.

Наиболее приемлемым, с точки зрения описанных недостатков и принятым за прототип, является способ, основанный на выявлении гена tox А, отвечающего за синтез дермонекротического токсина Р. multocida в полимеразной цепной реакции, включающий выделение ДНК возбудителя из культур микроорганизмов, синтез специфических олигонуклеотидных праймеров 5′CTYAGATGAGCGACAAGG3′ и 5′AATGCCACACCTCTATAG3, амплификацию ДНК возбудителя в гнездовой ПЦР, специфическую идентификацию продукта ПЦР размером 846 п.н. с помощью электрофореза в 2% агарозном геле (Lichtensteiger C.A. Direct PCR analysis for toxigenic Pasteurella multocida / C.A.Lichtensteiger, S.M.Steenbergen, R.M. et al. // J. Clin. Microbiol. - 1996. - №34. - P.3035-3039).

К недостаткам данного способа можно отнести то, что он требует выделения ДНК из культуры бактерий, выявляет только штаммы и изоляты бактерии Pasteurella multocida, продуцирующие дермонекротический токсин.

Технической задачей предлагаемого решения является разработка нового эффективного способа выявления патогенных штаммов и изолятов бактерии Pasteurella multocida при помощи синтетических олигонуклеотидных праймеров.

Поставленная задача решается тем, что известный способ выявления патогенных штаммов и изолятов бактерии Pasteurella multocida, включающий получение и подготовку культурального материала и проведение ПЦР с олигонуклеотидными праймерами, отличается тем, что ПЦР проводят непосредственно с бактериальной культурой, выделенной из патологического материала, используют олигонуклеотидные праймеры SEQ ID NO:1 - 5′ atgatgtcggcatgaatttctcagc 3′, SEQ ID NO:2 - 5′ aacatagccagcgccagcaatgt 3′, ПЦР проводят в 1 раунд, при получении фрагмента, соответствующего размеру 534 п.н., диагностируют патогенные штаммы и изоляты бактерии Pasteurella multocida.

Изобретение иллюстрируется следующими примерами.

Пример 1. Получение синтетических олигонуклеотидных праймеров

Поиск новых синтетических олигонуклеотидных праймеров осуществляют на основе полного генома штамма Pasteurella multocida «PM70», представленного в базе данных GenBank (http://www.ncbi.nlm.nih.gov/GenBank/GenBankSearch.html), при помощи пакета программного обеспечения «Lasergen». Полученные последовательности нескольких пар праймеров дополнительно тестируют на специфичность с помощью моделирования ПЦР в программе "Vector NTI Suite" с последовательностями геномов представителей семейства Pasteurellaceae и Enterobacteriaceae, представленных в базе данных GenBank.

Окончательный выбор праймеров основывают на следующих критериях: высокий индекс сходства фрагмента и ДНК различных штаммов Pasteurella multocida, высокая температура отжига (GC-метод), большая длина консенсусов, отсутствие гетеродуплексов.

Химический синтез праймеров осуществляют амидофосфитным методом на автоматическом синтезаторе ASM-102U. Концентрацию синтетических олигонуклеотидных праймеров в маточном растворе определяют спектрометрическим методом.

Таким образом, были выбраны синтетические олигонуклеотидные праймеры, комплементарные высококонсервативной области генома Pasteurella multocida участка гена КМТ-1, отвечающего за синтез мембранного протеина:

SEQ ID NO:1 - 5′ atgatgtcggcatgaatttctcagc 3′,

SEQ ID NO:2 - 5′ aacatagccagcgccagcaatgt 3′

Пример 2. Способ выявления патогенных вариантов бактерии Pasteurella multocida с помощью синтетических олигонуклеотидных праймеров в полимеразной цепной реакции (ПЦР)

Способ осуществляется в несколько этапов.

Этап 1. Выделение Pasteurella multocida из проб биологического материала

Для исследования отбирают пробы внутренних органов (при легочном пастереллезе: кусочки размером 1,5×1,5 см легких на границе нормального и измененного участка, бронхиальных, средостенных и заглоточных лимфатических узлов; при подозрении на геморрагическую септицемию: кусочки сердца с кровью, селезенки, печени, трубчатую кость) не позднее 3-5 часов после гибели животного, не подвергавшегося лечению антибактериальными препаратами.

Из полученных проб делают посев на мясопептонный агар или агар Хоттингера с добавлением 5% сыворотки крови лошади и 5% дефибрированной крови барана. Инкубируют в термостате при температуре 37°С в атмосфере 5% СО2.

Через 24-48 часов инкубации просматривают чашки Петри с агаром на наличие типичных для пастерелл колоний (прозрачных, диаметром до 3 мм, округлых с ровными краями, слизистой консистенции, серого цвета).

5-10 типичных колоний, не смешивая, снимают с поверхности агара, переносят в отдельные стерильные стеклянные пробирки, содержащие 200 мкл стерильной дистиллированной воды, перемешивают на вортексе. Взвесь бактерий разводят стерильной дистиллированной водой до концентрации 109 КОЕ/мл.

Для постановки реакции взвесь бактерий в количестве 5 мкл вносят непосредственно в ПЦР-смесь, минуя стадию выделения ДНК.

Этап 2. Амплификация участка ДНК Pasteurella multocida, кодирующего участок гена КМТ-1

Полимеразная цепная реакция. Состав реакционной смеси: ПЦР-буфер (60 mM Tris-HCl [рН 8.5], 1,5 мМ MgCl2, 25 mM KCl, 10 мМ 2-меркаптэтанола, 0,1% Тритон Х-100), 0,2 мМ dNTP, по 0,2 мкг каждого праймера, 1.25 е.а. Taq-ДНК-полимеразы, 5 мкл взвеси бактерий.

Температурный режим проведения ПЦР: 95°С - 5 мин - 1 цикл; 95°С - 60 с, 60°С - 60 с, 72°С - 90 с - 35 циклов; 72°С - 5 мин.

Этап 3. Определение размера продуктов диагностической ПЦР

Продукты ПЦР анализируют методом электрофореза в 2%-ном агарозном геле в стандартном трис-боратном буфере (рН 8,0) по стандартной методике.

Результаты электрофореза учитывают, просматривая гель в ультрафиолетовом свете с длиной волны 254 нм на приборе «Трансиллюминатор».

Используют маркер молекулярного веса 100 bp. Результат ПЦР считают положительным, если продукт ПЦР соответствует размеру фрагмента в 534 нуклеотидную пару.

Таким образом, предлагаемый способ позволяет эффективно выявлять патогенные штаммы и изоляты бактерий вида Pasteurella multocida в пробах биологического материала от больных животных.

Пример 3. Определение чувствительности и специфичности ПЦР с использованием праймеров на ген КМТ1 и ПЦР на ген tox A

Для определения чувствительности метода по заявленному способу в сравнении с прототипом суточную культуру контрольного штамма Pasteurella multocida «W13Ф», выращенную на кровяном агаре, переносят в бактериологическую пробирку, содержащую 1000 мкл стерильной дистиллированной воды или физиологического раствора, разводят до концентрации 1011 КОЕ/мл, титруют методом 10-кратных разведений до разведения 101 КОЕ/мл, каждое разведение подвергают исследованию в ПЦР. Чувствительность разработанной ПЦР составляет 105 КОЕ/мл.

Результаты опытов по определению чувствительности реакции представлены в таблице 1.

Таблица 1
Концентрация Pasteurella multocida в пробе, КОЕ/мл Результаты ПЦР по заявленному способу Результаты ПЦР по способу, взятому за прототип
107 + +
106 + +
105 + -
104 - -
103 - -
102 - -

Результаты опытов по определению специфичности реакции представлены в таблице 2.

Таблица 2
Вирус (штамм, изолят) Результаты ПЦР по заявленному способу Результаты ПЦР по способу, взятому за прототип
Pasteurella multocida (штамм «W130») + +
Pasteurella multocida (изолят, патогенный для белых мышей) + +
Pasteurella multocida (изолят, патогенный для белых мышей) + -
Pasteurella multocida (изолят, непатогенный для белых мышей) - -
Pasteurella multocida (изолят, непатогенный для белых мышей) - -
Salmonella typhimurium - -
Е.coli - -
Примечание: «+»- положительный результат;
«-» - отрицательный результат.

Таким образом, предлагаемый способ обладает высокой чувствительностью и специфичностью при выявлении ДНК патогенных штаммов и изолятов бактерии Pasteurella multocida, в то время как способ, принятый за прототип, обладает более низкой чувствительностью и не выявляет все патогенные изоляты Pasteurella multocida.

Пример 4. Сравнение эффективности разработанного метода перед стандартной методикой определения патогенности выделенных культур

Преимущества разработанного метода перед стандартной методикой представлены в таблице 3.

Таблица 3
Показатели Стандартная методика Метод ПЦР по заявленному способу
Длительность (дни) 10 суток 2 суток
Время исследования одной пробы биоматериала 10 суток 2 суток
Себестоимость исследования одной пробы (руб.) 360 рублей 80 рублей
Трудозатраты (чел.) 2 1
Необходимость получения чистой культуры + -
Необходимость постановки биологической пробы на лабораторных животных +

Таким образом, предлагаемый нами способ позволяет проводить эффективное выявление патогенных штаммов и изолятов бактерий вида Pasteurella multocida на ранних стадиях культивирования, а также сократить сроки проведения исследований до двух суток, снизить себестоимость диагностики в 4,5 раза, трудозатраты в 2 раза, исключить необходимость выделения чистой культуры и проведения постановки биологической пробы белых мышах.

Перечень последовательностей

<110> Institute of experimental veterinary science of Sibiria and the Far East
<120> Способ выявления патогенных штаммов и изолятов бактерии Pasteurella multocida
<130>
<160> 3
<210> 1
<211> 22
<212> DNA
<213> Pasteurella multocida
<400> 1
atgatgtcgg catgaatttc tcagc 25
<210> 2
<211> 25
<212> DNA
<213> Pasteurella multocida
<400>
aacatagcca gcgccagcaa tgt 22
<210> 3
<400> 3
000

Способ выявления патогенных штаммов и изолятов бактерии Pasteurella multocida, включающий получение и подготовку культурального материала и проведение ПЦР с олигонуклеотидными праймерами, отличающийся тем, что ПЦР проводят непосредственно с бактериальной культурой, выделенной из патологического материала, используют олигонуклеотидные праймеры SEQ ID NO: 1 - 5' atgatgtcggcatgaatttctcagc 3', SEQ ID NO: 2 - 5' aacatagccagcgccagcaatgt 3', ПЦР проводят в 1 раунд, при получении фрагмента, соответствующего размеру 534 п.н., диагностируют патогенные штаммы и изоляты бактерии Pasteurella multocida.



 

Похожие патенты:
Изобретение относится к биотехнологии. .
Изобретение относится к биотехнологии и молочной промышленности. .
Изобретение относится к биотехнологии и молочной промышленности. .
Изобретение относится к биотехнологии и молочной промышленности. .
Изобретение относится к биотехнологии и молочной промышленности. .

Изобретение относится к области биохимии. .

Изобретение относится к биотехнологии и может быть использовано для выделения каротиноидов, в частности деиноксантина, который применяется для разработки новых антиоксидантных и радиопротекторных препаратов для повышения адаптационных возможностей человека и животных, профилактики и лечения заболеваний.
Изобретение относится к области микробиологии и генной инженерии. .
Изобретение относится к микробиологии, в частности к консервированию молочнокислых бактерий Lactobacillus delbrueckii. .

Изобретение относится к способу обнаружения и подсчета жизнеспособных микроорганизмов вида Legionella pneumophila в образце. .

Изобретение относится к способу измерения относительных уровней кариесогенных и аргинолитических бактерий в ротовой полости, например, как части режима стоматологического обслуживания, путем применения композиции, включающей основную аминокислоту в форме свободного соединения или соли.

Изобретение относится к области биотехнологии, молекулярной биологии. .

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для генотипирования В.mallei. .

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для генотипирования В.mallei. .

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для генотипирования В.mallei. .

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для генотипирования B.mallei. .

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для генотипирования В.mallei. .

Изобретение относится к области биотехнологии, молекулярной биологии, молекулярной эпидемиологии
Наверх