Иммуностимулирующие олигонуклеотиды



Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды
Иммуностимулирующие олигонуклеотиды

 

C12N15/117 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2477753:

Коули Фармасьютикал Груп, Инк. (US)

Изобретение относится к области иммунологии. Предложен иммуностимулирующий олигонуклеотид 5' TCGTCGTTTTTCGGTGCTTTT 3'. Описаны варианты применения олигонуклеотида для получения иммуностимулирующего олигонуклеотида с такой же иммуностимулирующей активностью с по меньшей мере одним липофильным замещенным нуклеотидным аналогом или в качестве адъюванта в вакцине для индукции антиген-специфического иммунного ответа. Использование изобретения обеспечивает иммуностимулирующие олигонуклеотид, который вызывает в популяции CD4+ Т-клеток выработку большего количества Т-клеток, секретирующих IFN-гамма и больше полифункциональных Т-клеток, чем ODN 5' TCGTCGTTTTTCGGTCGTTTT 3', что может найти применение в медицине. 3 н. и 22 з.п. ф-лы, 21 ил., 3 табл., 4 пр.

 

ОБЛАСТЬ ИЗОБРЕТЕНИЯ

Изобретение относится к иммуностимулирующим олигонуклеотидам и способам применения иммуностимулирующих олигонуклеотидов для индукции антиген-специфического иммунного ответа.

ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ

Бактериальная ДНК, в отличие от ДНК позвоночных, оказывает иммуностимулирующие эффекты для активации В-клеток и естественных клеток-киллеров (Tokunaga, Т., et al., 1988. Jpn. J. Cancer Res. 79:682-686; Tokunaga, Т., et al., 1984, JNCI 72:955-962; Messina, J.P., et al., 1991, J.Immunol. 147:1759-1764; и обзор в Krieg, 1998, In: Applied Oligonucleotide Technology, C.A.Stein and A.M.Krieg, (Eds.), John Wiley and Sons, Inc., New York, N.Y., pp.431-448). В настоящее время понятно, что такие иммуностимулирующие эффекты бактериальной ДНК являются результатом присутствия неметилированных CpG-динуклеотидов в окружении конкретных оснований (CpG-мотивов), обычных в бактериальной ДНК, но метилированных и редко присутствующих в ДНК позвоночных (Krieg et al, 1995 Nature 374:546-549; Krieg, 1999 Biochim. Biophys. Acta 1489:107-116). Иммуностимулирующие эффекты бактериальной ДНК можно имитировать синтетическими олигодезоксинуклеотидами (ODN), содержащими эти CpG-мотивы. Такие CpG ODN оказывают сильные стимулирующие эффекты на человеческие и мышиные лейкоциты, включая пролиферацию В-клеток; секрецию цитокинов и иммуноглобулинов;

цитолитическую активность естественных клеток-киллеров (NK) и секрецию интерферона-гамма (IFN-гамма); и активацию дендритных клеток (DC) и других антиген-представляющих клеток для экспрессии костимулирующих молекул и секреции цитокинов, особенно цитокинов Th1-типа, которые важны для стимуляции развития Т-клеточных ответов ТМ-типа. Эти иммуностимулирующие эффекты нативного фосфодиэфирного скелета CpG ODN высоко специфичны в отношении CpG, поскольку данные эффекты значительно уменьшаются, если CpG-мотив метилирован, заменен на GpC, или иным образом удален или изменен (Krieg et al., 1995 Nature 374:546-549; Hartmann et al., 1999 Proc. Natl. Acad. Sci. USA 96:9305-10).

Ранее сообщалось о том, что иммуностимулирующая активность CpG-олигонуклеотидов зависит от количества CpG-мотивов, последовательностей, фланкирующих CG-динуклеотид, расположения CpG-мотива(ов) и расстояния между CpG-мотивами (Ballas et al., 1996, J. Immunol. 157(5): 1840-5; Hartmann et al., 2000, J. Immunol., 164(3): 1617-24; Klinman et al., 2003, Clin. Exp. Immunol., 133(2): 227-32). В данной заявке описан иммуностимулирующий олигонуклеотид, в котором удален 3' CpG-мотив и который неожиданно сохраняет свою иммуностимулирующую активность. Также описана вакцина, содержащая иммуностимулирующий олигонуклеотид и антиген, и способы применения такой вакцины.

КРАТКОЕ ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

В аспектах изобретения предложен иммуностимулирующий олигонуклеотид, содержащий нуклеотидную последовательность 5' TCGTCGTTTTTCGGTGCTTTT 3' (SEQ ID NO:1). В некоторых воплощениях иммуностимулирующий олигонуклеотид содержит одну или более модифицированных связей. В некоторых воплощениях иммуностимулирующий олигонуклеотид содержит одну или более фосфоротиоатных связей. В некоторых воплощениях все межнуклетидные связи в олигонуклеотиде представляют собой фосфоротиоатные связи. В некоторых воплощениях иммуностимулирующий олигонуклеотид содержит по меньшей мере один липофильный замещенный нуклеотидный аналог и пиримидин-пуриновый динуклеотид.

В аспектах изобретения предложена вакцина, содержащая антиген и иммуностимулирующий олигонуклеотид, содержащий нуклеотидную последовательность SEQ ID NO:1, дополнительно содержащая фармацевтически приемлемый носитель. В некоторых воплощениях иммуностимулирующий олигонуклеотид присутствует в количестве, эффективном для индукции антиген-специфического иммунного ответа. В других воплощениях индуцируемый антиген-специфический иммунный ответ представляет собой Th1-иммунный ответ. В некоторых воплощениях антиген представляет собой микробный антиген, аутоантиген или вещество, вызывающее привыкание. В других воплощениях бактериальный антиген ассоциирован с Staphylococcus aureus, или бактериальный антиген ассоциирован с бактерией, вызывающей кариес зубов. В других воплощениях бактерия представляет собой Streptococcus mutans, Streptococcus sobrinus, Streptococcus sanguis, Lactobacillus acidophilis или Actinomyces viscosus. В других воплощениях бактериальный антиген ассоциирован с бактерией, вызывающей периодонтальное заболевание. В других воплощениях бактерия представляет собой Porphyromonas gingivalis или Actinobacillus actinomycetemcomitans. В некоторых воплощениях вирусный антиген ассоциирован с респираторно-синцитиальным вирусом (RSV), вирусом простого герпеса 1, вирусом простого герпеса 2, вирусом иммунодефицита человека-1 (HIV-1) или HIV-2. В других воплощениях паразитарный антиген ассоциирован с паразитом, вызывающим малярию. В некоторых воплощениях аутоантиген представляет собой опухолевый антиген, антиген, ассоциированный с болезнью Альцгеймера, антиген против человеческого антитела, или антиген, который экспрессируется из человеческих эндогенных ретровирусных элементов. В других воплощениях опухолевый антиген представляет собой HER2 (рецептор человеческого эпидермального фактора роста 2), MAGE (антиген, ассоциированный с меланомой), NY-ESO (раково-тестикулярный антиген), PSA (простатспецифический антиген), СЕА (карциноэмбриональный антиген) или вариант EGFR (рецептор эпидермального фактора роста). В других воплощениях, где антиген ассоциирован с болезнью Альцгеймера, антиген представляет собой tau или β-амилоид. В некоторых воплощениях антиген представляет собой IgE. В некоторых воплощениях антиген представляет собой никотиновый гаптен, конъюгированный с носителем. В других воплощениях носитель, с которым конъюгирован никотиновый гаптен, представляет собой дифтерийный токсин (DT). В других воплощениях антиген представляет собой пептид, рекомбинантный белок, очищенный белок, цельный убитый патоген, живой ослабленный вирус или вирусный вектор, живую ослабленную бактерию или бактериальный вектор, полисахарид, гаптен или кодируется плазмидной ДНК.

В некоторых воплощениях антиген конъюгирован с носителем. В других воплощениях носитель представляет собой дифтерийный токсин (DT). В других воплощениях носитель представляет собой вирусоподобную частицу. В других воплощениях вирусоподобная частица представляет собой РНК-фаг Q-β, поверхностный антиген гепатита В (HBsAg) или коровый антиген гепатита В (HBcAg). В некоторых воплощениях вакцина дополнительно содержит один или более адъювантов. В других воплощениях адъювант представляет собой агонист Toll-подобного рецептора (TLR), который не является TLR9. В других воплощениях агонист представляет собой агонист TLR3. В других воплощениях агонист TLR3 представляет собой стабилизированную poly I:C (полиинозиновая-полицитидиловая кислота). В некоторых воплощениях агонист представляет собой агонист TLR4. В других воплощениях агонист TLR4 представляет собой производное липополисахарида (LPS). В других воплощениях производное LPS представляет собой MPL (монофосфориллипид А) или GLA (гамма-линоленовая кислота). В других воплощениях агонист представляет собой агонист TLR5. В других воплощениях агонист TLR5 педставляет собой флагеллин. В некоторых воплощениях агонист представляет собой агонист TLR7 или 8. В других воплощениях агонист TLR7 или 8 представляет собой небольшую молекулу имидазохинолинового семейства. В других воплощениях адъювант представляет собой соль алюминия. В других воплощениях соль алюминия представляет собой гидрат окиси алюминия. В некоторых воплощениях адъювант представляет собой иммуностимулирующий комплекс (ISCOM). В других воплощениях адъювант представляет собой эмульсию масло-в-воде или вода-в-масле. В некоторых воплощениях адъювант представляет собой липосому. В других воплощениях адъювант представляет собой систему доставки. В других воплощениях система доставки представляет собой наночастицу или микрочастицу.

В некоторых воплощениях иммуностимулирующий олигонуклеотид содержит одну или более модифицированных связей. В других воплощениях иммуностимулирующий олигонуклеотид содержит одну или более фосфоротиоатных связей. В некоторых воплощениях все междуклеотидные связи в олигонуклеотиде представляют собой фосфоротиоатные связи. В других воплощениях иммуностимулирующий олигонуклеотид содержит по меньшей мере один липофильный замещенный нуклеотидный аналог и пиримидин-пуриновый динуклеотид. В некоторых воплощениях вакцина приготовлена для введения. В других воплощениях вакцина приготовлена для введения парентеральным путем, где парентеральный путь представляет собой внутримышечный, подкожный, интрадермальный, внутривенный или интраперитонеальный путь. В дополнительных воплощениях вакцина приготовлена для введения местным путем, где местный путь представляет собой кожный, трансдермальный пути или путь через поверхность слизистой оболочки. В других воплощениях путь через поверхность слизистой оболочки представляет собой пероральный, интраназальный, интравагинальный, интраректальный, интрабуккальный или внутриглазной путь.

В некоторых аспектах изобретения способ индукции антиген-специфического иммунного ответа у субъекта, нуждающемся в этом, включает введение субъекту антигена и иммуностимулирующего олигонуклеотида, содержащего нуклеотидную последовательность SEQ ID NO:1 в количестве, эффективном для индукции у указанного субъекта антиген-специфического иммунного ответа. В некоторых воплощениях антиген представляет собой микробный антиген, аутоантиген или вещество, вызывающее привыкание. В других воплощениях микробный антиген представляет собой бактериальный антиген, вирусный антиген или паразитарный антиген. В других воплощениях бактериальный антиген ассоциирован с Staphylococcus aureus, или бактериальный антиген ассоциирован с бактерией, вызывающей кариес зубов. В других воплощениях бактерия представляет собой Streptococcus mutans, Streptococcus sobrinus, Streptococcus sanguis, Lactobacillus acidophilis или Actinomyces viscosus. В других воплощениях бактериальный антиген ассоциирован с бактерией, вызывающей периодонтальное заболевание. В других воплощениях бактерия представляет собой Porphyromonas gingivalis или Actinobacillus actinomycetemcomitans. В некоторых воплощениях вирусный антиген ассоциирован с респираторно-синцитиальным вирусом (RSV), вирусом простого герпеса 1, вирусом простого герпеса 2, вирусом иммунодефицита человека-1 (HIV-1) или HIV-2. В других воплощениях паразитарный антиген ассоциирован с паразитом, вызывающим малярию. В некоторых воплощениях аутоантиген представляет собой опухолевый антиген, антиген, ассоциированный с болезнью Альцгеймера, антиген против человеческого антитела или антиген, который экспрессируется из человеческих эндогенных ретровирусных элементов. В других воплощениях опухолевый антиген представляет собой HER2, MAGE, NY-ESO, PSA, СЕА или вариант EGFR. В других воплощениях, где антиген ассоциирован с болезнью Альцгеймера, антиген представляет собой tau или β-амилоид. В некоторых воплощениях антиген представляет собой IgE. В некоторых воплощениях антиген представляет собой никотиновый гаптен, конъюгированный с носителем. В других воплощениях носитель, с которым конъюгирован никотиновый гаптен, представляет собой дифтерийный токсин (DT). В других воплощениях антиген представляет собой пептид, рекомбинантный белок, очищенный белок, цельный убитый патоген, живой ослабленный вирус или вирусный вектор, живую ослабленную бактерию или бактериальный вектор, полисахарид, гаптен или кодируется плазмидной ДНК.

В некоторых воплощениях антиген конъюгирован с носителем. В других воплощениях носитель представляет собой дифтерийный токсин (DT). В других воплощениях носитель представляет собой вирусоподобную частицу. В других воплощениях вирусоподобная частица представляет собой РНК-фаг Q-β, поверхностный антиген гепатита В (HBsAg) или коровый антиген гепатита В (HBcAg). В некоторых воплощениях вакцина дополнительно содержит один или более адъювантов. В других воплощениях адъювант представляет собой агонист Toll-подобного рецептора (TLR), который не является TLR9. В других воплощениях агонист представляет собой агонист TLR3. В других воплощениях агонист TLR3 представляет собой стабилизированную poly I:C. В некоторых воплощениях агонист представляет собой агонист TLR4. В других воплощениях агонист TLR4 представляет собой производное липополисахарида (LPS). В дополнительных воплощениях производное LPS представляет собой MPL или GLA. В других воплощениях агонист представляет собой агонист TLR5. В других воплощениях агонист TLR5 представляет собой флагеллин. В некоторых воплощениях агонист представляет собой агонист TLR7 или 8. В других воплощениях агонист TLR7 или 8 представляет собой небольшую молекулу имидазохинолинового семейства. В других воплощениях адъювант представляет собой соль алюминия. В других воплощениях соль алюминия представляет собой гидрат окиси алюминия. В некоторых воплощениях адъювант представляет собой иммуностимулирующий комплекс (ISCOM). В других воплощениях адъювант представляет собой эмульсию масло-в-воде или вода-в-масле. В некоторых воплощениях адъювант представляет собой липосому. В других воплощениях адъювант представляет собой систему доставки. В других воплощениях система доставки представляет собой наночастицу или микрочастицу.

В некоторых воплощениях иммуностимулирующий олигонуклеотид содержит одну или более модифицированных связей. В других воплощениях иммуностимулирующий олигонуклеотид содержит одну или более фосфоротиоатных связей. В некоторых воплощениях все межнуклетидные связи в олигонуклеотиде представляют собой фосфоротиоатные связи. В других воплощениях иммуностимулирующий олигонуклеотид содержит по меньшей мере один липофильный замещенный нуклеотидный аналог и пиримидин-пуриновый динуклеотид. В некоторых воплощениях антиген и/или иммуностимулирующий олигонуклеотид готовят для введения. В других воплощениях антиген и/или иммуностимулирующий олигонуклеотид готовят для введения парентеральным путем, где парентеральный путь представляет собой внутримышечный, подкожный, интрадермальный, внутривенный или интраперитонеальный путь. В дополнительных воплощениях антиген и/или иммуностимулирующий олигонуклеотид готовят для введения местным путем, где местный путь представляет собой кожный, трансдермальный пути или путь через поверхность слизистой оболочки. В других воплощениях путь через поверхность слизистой оболочки представляет собой пероральный, интраназальный, интравагинальный, интраректальный, интрабуккальный или внутриглазной путь. В некоторых воплощениях антиген и иммуностимулирующий олигонуклеотид вводят таким же, похожим или другим путем. В других воплощениях антиген и иммуностимулирующий олигонуклеотид вводят вместе, одновременно или раздельно. В других воплощениях антиген и иммуностимулирующий олигонуклеотид вводят в течение 24 часов относительно друг друга. В некоторых воплощениях субъект представляет собой вид, которого лечит ветеринарный врач. В других воплощениях субъект представляет собой субъекта, отличного от грызуна. В некоторых воплощениях субъект представляет собой человека.

ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

Фиг.1: Усиление гуморальных иммунных ответов у мышей. Взрослых (6-8 недель; n=10/группу) мышей иммунизировали 1 мкг HBsAg (левая панель) или 20 мкг OVA (овальбумин) (правая панель) без адъюванта или в комбинации с CPG 24555, 10103 или 7909 (10 мкг) или не-CpG контрольным ODN 2137 (10 мкг; только с OVA). Плазму через 2 недели (для HBsAg) или 1 неделю (для OVA) после последней иммунизации анализировали в отношении антиген-специфических общих уровней IgG, IgG1 и IgG2a/c (антитела против HBs или антитела против OVA). Каждая горизонтальная черта представляет среднее геометрическое (±SEM (стандартная ошибка среднего)) титров общего IgG. Титры определяли как наибольшее разведение, дающее в результате значение абсорбции, вдвое превышающее абсорбцию для неиммунизированной плазмы с величиной отсечения 0,05. Числа, указанные над каждой горизонтальной чертой, представляют отношение антиген-специфический IgG2a(или 2c)/IgG1.

Фиг.2: Природа гуморального иммунного ответа, индуцируемого у мышей. Взрослых (6-8 недель; n=10/группу) мышей иммунизировали 1 мкг HBsAg (левая панель) или 20 мкг OVA (правая панель без адъюванта или в комбинации с CPG 24555, 10103 или 7909 (10 мкг) или не-CpG контрольным ODN 2137 (10 мкг; только с OVA). Плазму через 2 недели (для HBsAg) или 1 неделю (для OVA) после последней иммунизации анализировали в отношении уровней IgG1 (неокрашенные столбики) и IgG2a или IgG2c (черные столбики) против HBsAg (антитела против HBs) или OVA (антитела против OVA). Каждая горизонтальная черта представляет среднее геометрическое (±SEM) титра разведения для конечной точки согласно ELISA (иммуноферментный анализ) для всей группы (n=10). Титры определяли как наибольшее разведение, дающее в результате значение абсорбции, вдвое превышающее абсорбцию для неиммунизированной плазмы с величиной отсечения 0,05.

Фиг.3: Цитотоксические Т-лимфоцитарные ответы, индуцированные у мышей. Взрослых (6-8 недель; n=5/группу) мышей иммунизировали 1 мкг HBsAg (левая панель) или 20 мкг OVA (правая панель без адъюванта или в комбинации с CPG 24555, 10103 или 7909 (10 мкг) или не-CpG контрольным ODN 2137 (10 мкг; только с OVA). Спленоциты через 2 недели (для HBsAg) или 1 неделю (для OVA) после последней иммунизации анализировали в отношении антиген-специфических CTL ответов с использованием стандартного анализа высвобождения 51Cr.

Фиг.4: Отсутствие CpG-опосредованного усиления CTL ответов у мышей, дефектных по TLR9. Дефектных по TLR9 взрослых (6-8 недель; n=5 группу) мышей иммунизировали 20 мкг OVA без адъюванта или в комбинации с CPG 24555, 10103 или 7909 (10 мкг), или не-CpG контрольным ODN 2137 (10 мкг). Спленоциты через 1 неделю после последней иммунизации анализировали в отношении OVA-специфических CTL ответов с использованием стандартного анализа высвобождения 51Cr.

Фиг.5: OVA-специфические CD8 Т-клетки у дикого типа по сравнению с дефектными по TLR9 мышами. Взрослых (6-8 недель; n=5/группу) мышей дикого типа и дефектных по TLR9 иммунизировали 20 мкг OVA без адъюванта или в комбинации с CPG 24555, 10103 или 7909 (10 мкг) или не-CpG контрольным ODN 2137 (10 мкг). Спленоциты через 1 неделю после последней иммунизации анализировали в отношении OVA-специфических CD8 Т-клеток с использованием тетрамеров МНС класс I Н-2 т.п.н. - SIINFEKL.

Фиг.6: Антиген-специфическая секреция IFN-g у мышей. Взрослых (6-8 недель; n=5/группу) мышей иммунизировали 1 мкг HBsAg (левая панель) или 20 мкг OVA (правая панель без адъюванта или в комбинации с CPG 24555, 10103 или 7909 (10 мкг), или не-CpG контрольным ODN 2137 (10 мкг; только с OVA). Спленоциты через 2 недели (для HBsAg) или 1 неделю (для OVA) после последней иммунизации стимулировали соответствующим антигеном, как представлено на чертежах, в течение 72 ч, и культуральные супернатанты анализировали в отношении IFN-γ с помощью ELISA.

Фиг.7: Отсутствие CpG-опосредованного увеличения антиген-специфической секреции IFN-g у дефектных по TLR9 мышей. Дефектных по TLR9 взрослых (6-8 недель; n=5/группу) мышей иммунизировали 20 мкг OVA без адъюванта или в комбинации с CPG 24555, 10103 или 7909 (10 мкг), или не-CpG контрольным ODN 2137 (10 мкг). Спленоциты через 1 неделю после последней иммунизации стимулировали OVA в концентрациях 0, 0,5 и 1 мг/мл в течение 72 ч, и культуральные супернатанты анализировали в отношении IFN-γ с помощью ELISA.

Фиг.8: Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов, у мышей. Взрослых (6-8 недель; n=5/группу) мышей иммунизировали 1 мкг HBsAg только с антигеном или в комбинации с CPG 24555, 10103 или 7909 (10 мкг). Спленоциты через 2 недели после иммунизации повторно стимулировали антигеном HBsAg (для CD4) или пептидом HBs класса I (для CD8), и CD4 (панель А) и CD8 (панель В) Т-клеточные популяции, секретирующие IFN-γ, TNF-α и/или IL-2, количественно оценивали с использованием проточной цитометрии.

Фиг.9: Врожденный иммунитет у человеческих РВМС (мононуклеарные клетки периферической крови). Человеческие РВМС (5×106/мл) инкубировали с различными концентрациями CPG 10103, CPG 24555 или не-CpG контрольным ODN 22881 в течение 24 или 48 ч. Клеточные супернатанты собирали и анализировали в отношении секреции цитокинов/хемокинов с использованием имеющегося в продаже набора для ELISA. На Фиг.9А представлена секреция IFN-α, МСР-1 и IP-10. На Фиг.9В представлена секреция IL-6, IL-10 и IL-2R.

Фиг.10: Врожденный иммунитет in vivo у мышей BALB/c. Мышам BALB/c (n=5/группу) подкожно инъецировали PBS (забуференный фосфатами физиологический раствор) (контроль плацебо), CPG 24555, CPG 10103 или не-CpG контрольный ODN 2137 в дозе 100 мкг. У животных брали кровь через 3 часа после инъекции и плазму анализировали в отношении IP-10 (Фиг.10А) и IL-12 (Фиг.10В) или IL-6 (Фиг.10С) с использованием имеющегося в продаже ELISA.

Фиг.11: Гуморальный иммунитет in vivo у мышей BALB/c. Мышей BALB/c иммунизировали внутримышечно HBsAg (1 мкг) ±CPG 24555 или 10103 (10 мкг), OVA (20 мкг)±CPG 24555 или 10103 (10 мкг), или НА вируса гриппа А Texas 1/77, H3N2 (1 мкг) ± квасцы (Alum) (25 мкг Al3+), ±CPG 24555 или 10103 (10 мкг). Мышей иммунизировали на 0 и 14 сутки (HBsAg), на 0, 7 и 21 сутки (OVA) или только на 0 сутки (НА). На Фиг.11А представлены HBsAg-специфические общие титры IgG через 2 недели после иммунизации, измеренные с помощью ELISA в конечной точке. На Фиг.11В представлены OVA-специфические общие титры IgG через 1 неделю после последней иммунизации. На Фиг.11С представлена кинетика НА-специфического общего IgG в различные моменты времени после иммунизации, измеренные с помощью ELISA в конечной точке.

Фиг.12: Т-клеточные ответы у мышей BALB/c. Мышам BALB/c инъецировали внутримышечно HBsAg (1 мкг) с CPG ODN 2455, CPG 10103 или не-CpG контрольным ODN 2137 в дозе 10 мкг или без них. Мышей инъецировали на 0 и 14 сутки. На Фиг.12А продемонстрированы HBsAg-специфические CTL, измеренные по высвобождению 51Cr через 2 недели после иммунизации. Мышам C57bl/6 инъецировали внутримышечно OVA (20 мкг) с CPG ODN 2455, CPG 10103 или не-CpG контрольным ODN 2137 в дозе 10 мкг или без них. Мышей инъецировали на 0, 7 и 21 сутки. На Фиг.12В представлены OVA-специфические CTL, измеренные по высвобождению 51Cr через 1 неделю после последней иммунизации.

Фиг.13: Т-клеточные ответы у мышей BALB/c. Мышам BALB/c инъецировали внутримышечно HBsAg (1 мкг) с CPG ODN 2455, CPG 10103 или не-CpG контрольным ODN 2137 в дозе 10 мкг или без них. Мышей инъецировали на 0 и 14 сутки. Спленоциты, собранные через 2 недели после последней иммунизации, инкубировали с соответствующим антигеном в течение 72 часов, и культуральные супернатанты тестировали в отношении IFN-γ с помощью ELISA (Фиг.13А). Мышам C57bl/6 инъецировали внутримышечно OVA (20 мкг) с CPG ODN 2455, CPG 10103 или не-CpG контрольным ODN 2137 в дозе 10 мкг или без них. Мышей инъецировали на 0,7 и 21 сутки. Спленоциты через 1 неделю после последней иммунизации инкубировали с соответствующим антигеном в течение 72 часов, и культуральные супернатанты тестировали в отношении IFN-γ с помощью ELISA (Фиг.13В).

Фиг.14: Антитела против HA через 6 недель после иммунизации. Самок мышей BALB/c иммунизировали НА (1 мкг) ± CpG или контрольным ODN (10 мкг) ± квасцы (25 мкг Al3+) в общем объеме 50 мкл. Количество анти-НА измеряли через 6 недель после иммунизации.

Фиг.15: Титры ингибирования гемагглютинации (HIA) через 4 недели после иммунизации. Функциональную активность антител оценивали с использованием анализа ингибирования гемагглютинации (HIA). Измеряли способность увеличивать титры только HIA или в комбинации с квасцами.

Фиг.16: HA-специфическая секреция IFN-γ. Самок мышей BALB/c иммунизировали НА (1 мкг) ± CpG или контрольным ODN (10 мкг) ± квасцы (25 мкг Al3+) в общем объеме 50 мкл. Спленоциты, собранные через 6 недель после иммунизации, использовали для анализа антиген-специфической секреции IFN-γ.

Фиг.17: Гуморальные ответы у приматов, отличных от человека. Яванских макак (Cynomolgus monkeys) (возраст 3-5 лет; n=5 на группу) иммунизировали только Engerix-B (10 мкг HBsAg; 250 мкг Al3+) или в комбинации с 0,5 мг CPG 7909 или CPG 24555 посредством внутримышечной инъекции на 0, 4 и 8 неделю. У животных брали кровь через регулярные интервалы времени и титр HBsAg-специфического антитела измеряли с использованием имеющихся в продаже наборов (MONOLIS™ анти-HBs).

Фиг.18: Гуморальные ответы у приматов, отличных от человека. Яванских макак (возраст 3-5 лет; n=5 на группу) иммунизировали только Engerix-B (10 мкг HBsAg; 250 мкг Al3) или в комбинации с 0,5 мг CPG 7909 или CPG 24555 посредством внутримышечной инъекции на 0, 4 и 8 неделю. Плазму через 4 недели после 2-й иммунизации и 2 недели после 3-й иммунизации анализировали в отношении авидности антитела с использованием способа вытеснения тиоцианата натрия.

Фиг.19: Т-клеточные ответы у приматов, отличных от человека: Яванских макак (возраст 3-5 лет; n=5 на группу) иммунизировали только Engerix-B (10 мкг HBsAg; 250 мкг Al3) или в комбинации с 0,5 мг CPG 7909 или CPG 24555 посредством внутримышечной инъекции на 0, 4 и 8 неделю. Мононуклеарные клетки периферической крови (РВМС) до вакцинации и в некоторые временные точки после вакцинации тестировали в отношении HBsAg-специфической, опосредованной CD4 Т-клетками внутриклеточной секреции цитокинов с помощью проточной цитометрии. На Фиг.19А представлена секреция IFN-γ. На Фиг.19В представлена секреция IL-2. На Фиг.19С представлена секреция TNF-α.

Фиг.20: Т-клеточные ответы: Полифункциональные CD4 Т-клетки; Количественный анализ. Яванских макак (возраст 3-5 лет; n=5 на группу) иммунизировали только Engerix-B (10 мкг HBsAg; 250 мкг Al3) или в комбинации с 0,5 мг CPG 7909 или CPG 24555 посредством внутримышечной инъекции на 0, 4 и 8 неделю. Мононуклеарные клетки периферической крови (РВМС) через 2 недели после 3-й иммунизации тестировали в отношении HBsAg-специфических CD4 Т-клеток, секретирующих один, два или три цитокина, с помощью проточной цитометрии. На Фиг.20А представлено количество HBsAg-специфических CD4 Т-клеток, секретирующих один, два или три цитокина на один миллион проанализированных CD4 Т-клеток. На Фиг.20В представлена доля Т-клеток, продуцирующих один, два или три цитокина, в общей популяции HBsAg-специфических CD4 Т-клеток.

Фиг.21: Т-клеточные ответы: полифункциональные CD4 Т-клетки; Количественный анализ. Измеряли количество клеток, секретирующих IL-2, IFN-γ и TNF-α, или комбинации этих цитокинов. Яванских макак (возраст 3-5 лет; n=5 на группу) иммунизировали только Engerix-B (10 мкг HBsAg; 250 мкг Al3+) или в комбинации с 0,5 мг CPG 7909 или CPG 24555 посредством внутримышечной инъекции на 0, 4 и 8 неделю. Мононуклеарные клетки периферической крови (РВМС) через 2 недели после 3-й иммунизации тестировали в отношении количества HBsAg-специфических CD4 Т-клеток, секретирующих IL-2, IFN-γ и TNF-α или комбинации этих цитокинов, с помощью проточной цитометрии.

ОПИСАНИЕ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

SEQ ID NO:1 - Нуклеотидная последовательность иммуностимулирующего олигонуклеотида ODN CPG 24555.

SEQ ID NO:2 - Нуклеотидная последовательность иммуностимулирующего олигонуклеотида CPG 10103.

SEQ ID NO:3 - Нуклеотидная последовательность иммуностимулирующего олигонуклеотида CPG 7909.

SEQ ID NO:4 - Нуклеотидная последовательность не-CpG олигонуклеотида 22881.

SEQ ID NO:5 - Нуклеотидная последовательность не-CpG олигонуклеотида 2137.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

Аспекты изобретения основаны частично на неожиданном обнаружении того, что удаление CpG-мотива из иммуностимулирующего олигонуклеотида не оказывало отрицательного влияния на способность иммуностимулирующего олигонуклеотида усиливать антиген-специфические иммунные ответы. Также неожиданно обнаружили, что удаление указанного CpG-мотива обеспечивает продукцию популяции антиген-специфических Т-клеток, которая отличается. В частности, было обнаружено, что указанная популяция антиген-специфических Т-клеток содержит больше Т-клеток, секретирующих IFN-гамма, и больше полифункциональных Т-клеток.

В аспектах изобретения иммуностимулирующий олигонуклеотид имеет последовательность нуклеиновой кислоты 5' TCGTCGTTTTTCGGTGCTTTT 3' (ODN CPG 24555; SEQ ID NO:1). Последовательность нуклеиновой кислоты иммуностимулирующего олигонуклеотида SEQ ID NO:1 отличается от ранее приведенной последовательности 5' TCGTCGTTTTTCGGTCGTTTT 3' (SEQ ID NO:2) иммуностимулирующего олигонуклеотида (ODN 10103) путем обращения 3'-ближайшего CG-динуклеотида. Сходство активности между двумя иммуностимулирующими олигонуклеотидами является неожиданным, поскольку ранее сообщалось о том, что иммуностимулирующая активность CpG-олигонуклеотидов зависит от количества CpG-мотивов, последовательностей, фланкирующих CG-динуклеотид, расположения CpG-мотива(ов) и расстояния между мотивами CpG (Ballas et al., 1996,, J. Immunol. 157(5): 1840-5; Hartmann et al., 2000, J. Immunol., 164(3): 1617-24; Klinman et al., 2003, Clin. Exp.Immunol., 133(2): 227-32). Удаление 3'-ближайшего CG-динуклеотида из иммуностимулирующего олигонуклеотида CPG ODN 24555 (SEQ ID NO:1) не приводило к отрицательному эффекту на способность этого иммуностимулирующего олигонуклеотида усиливать антиген-специфические иммунные ответы, как можно было бы ожидать из предшествующего описания. CPG ODN 24555 демонстрировал сходную и в некоторых случаях повышенную иммуностимулирующую активность по сравнению с CPG ODN 10103.

Кроме того, было обнаружено, что CPG ODN 24555 индуцирует другую популяцию антиген-специфических Т-клеток по сравнению с CPG ODN 10103 (см. Фиг.8, таблица 1 и таблица 2). В частности, неожиданно обнаружили, что популяция антиген-специфических Т-клеток (в частности, популяция антиген-специфических CD4+ Т-клеток), полученная с использованием CPG ODN 24555 в качестве адъюванта, содержит больше Т-клеток, секретирующих IFN-гамма, и больше полифункциональных Т-клеток по сравнению с популяцией антиген-специфических Т-клеток, полученной с использованием CPG ODN 10103 или CPG ODN 7909.

Например, получали более высокую долю антиген-специфических CD4+ Т-клеток, продуцирующих IFN-γ, по сравнению с популяцией антиген-специфических CD4+ Т-клеток, полученной с CpG ODN 10103. Кроме того, получали более высокую долю полифункциональных антиген-специфических CD4+ Т-клеток, продуцирующих IFN-γ и TNF-α, как IFN-γ, так и IL-2, или как TNF-α, так и IL-2, или даже тройных продуцентов, секретирующих IFN-γ, TNF-α и IL-2, по сравнению с популяцией антиген-специфических CD4+ Т-клеток, полученной с CPG ODN 10103 или CPG ODN 7909. Кроме того, получали более высокую долю антиген-специфических CD8+ Т-клеток, продуцирующих TNF-α, по сравнению с популяцией антиген-специфических CD8+ Т-клеток, полученной с CPG ODN 10103. Также получали более высокую долю антиген-специфических CD8+ Т-клеток, продуцирующих как IFN-γ, так и IL-2, как TNF-α, так и IL-2, или даже тройных продуцентов IFN-γ, TNF-α и IL-2, по сравнению с популяцией антиген-специфических CD8+ Т-клеток, полученной с CPG ODN 10103 или CPG ODN 7909.

Недавно продемонстрировали важность полифункциональности Т-клеток для иммуногенности. В частности, полифункциональность антиген-специфических Т-клеток в отношении продукции хемокинов (таких как IFN-γ, TNF-α и IL-2) коррелирует в некоторых случаях с их защитным потенциалом (см., например, Harari A, et al., Immunol Rev. 2006:211:236-54, Makedonas G and Betts MR. Springer Semin Immunopathol. 2006; 28(3):209-19, Precopio ML et al., J Exp Med. 2007 204(6):1405-16, Xu R et al. Vaccine. 2008; 26(37):4819-29), как полагают, благодаря их более хорошей эффекторной функции по сравнению с Т-клетками, которые секретируют только один цитокин.

CPG ODN 24555 преимущественно обеспечивает продукцию популяций полифункциональных антиген-специфических Т-клеток при использовании в качестве адъюванта, что может быть важным при назначении вакцины.

Иммуностимулирующие нуклеиновые кислоты могут быть двухцепочечными или одноцепочечными. Как правило, двухцепочечные молекулы являются более стабильными in vivo, тогда как одноцепочечные молекулы обладают повышенной иммунной активностью. В некоторых аспектах изобретения предпочтительно, чтобы нуклеиновая кислота была одноцепочечной, а в других аспектах предпочтительно, чтобы нуклеиновая кислота была двухцепочечной.

Термины "нуклеиновая кислота" и "олигонуклеотид" используются в данной заявке взаимозаменяемо для обозначения множества нуклеотидов (т.е. молекул, содержащих сахар (например, рибозу или дезоксирибозу), связанный с фосфатной группой и с заменяемым органическим основанием, представляющим собой либо замещенный пиримидин (например, цитозин (С), тимидин (Т) или урацил (U)), либо замещенный пурин (например, аденин (А) или гуанин (G)). Используемые в данной заявке термины относятся к олигодезоксирибонуклеотидам, олигорибонуклеотидам (т.е. полинуклеотид минус фосфат) и любому другому органическому основанию, содержащему полимер. Молекулы нуклеиновой кислоты могут быть получены из существующих источников нуклеиновой кислоты (например, геномной или кДНК), но предпочтительно являются синтетическими (например, получены путем синтеза нуклеиновой кислоты).

В аспектах изобретения иммуностимулирующие олигонуклеотиды могут охватывать различные химические модификации и замены по сравнению с природными РНК и ДНК, включающие фосфодиэфирный межнуклеозидный мостик, β-D-рибозную единицу и/или природное нуклеозидное основание (аденин, гуанин, цитозин, тимин, урацил). Примеры химических модификаций известны специалистам в данной области техники и описаны, например, в Uhlmann E. et al. (1990), Chem. Rev. 90:543; "Protocols for Oligonucleotides and Analogs" Synthesis and Properties & Synthesis and Analytical Techniques, S. Agrawal, Ed., Humana Press, Totowa, USA 1993; Crooke, S.T. et al. (1996) Annu. Rev. Pharmacol. Toxicol. 36:107-129; и Hunziker J. et al., (1995), Mod. Synth. Methods 7:331-417. Олигонуклеотид по изобретению может иметь одну или более модификаций, где каждая модификация располагается по конкретному фосфодиэфирному межнуклеозидному мостику и/или по конкретной β-D-рибозной единице, и/или по конкретному положению природного нуклеозидного основания по сравнению с олигонуклеотидом с такой же последовательностью, которая состоит из природной ДНК или РНК.

В аспектах изобретения олигонуклеотиды могут содержать одну или более модификаций. Такие модификации могут быть выбраны из: а) замены фосфодиэфирного межнуклеозидного мостика, расположенного на 3'- и/или 5'-конце нуклеозида, на модифицированный межнуклеозидный мостик, б) замены фосфодиэфирного мостика, расположенного на 3'- и/или 5'-конце нуклеозида, на дефосфомостик, в) замены сахарной фосфатной единицы из сахарофосфатного скелета на другую единицу, г) замены β-D-рибозной единицы на модифицированную сахарную единицу, и д) замены природного нуклеозидного основания.

Нуклеиновые кислоты также включают замещенные пурины и пиримидины, такие как С-5 пропинпиримидин и 7-деаза-7-замещенные пурин-модифицированные основания (Wagner et al., 1996, Nat. Biotechnol. 14:840-4). Пурины и пиримидины включают, но не ограничиваются этим, аденин, цитозин, гуанин, тимидин, 5-метилцитозин, 2-аминопурин, 2-амино-6-хлорпурин, 2,6-диаминоаурин, гипоксантин и другие природные и неприродные нуклеозидные основания, замещенные и незамещенные ароматические группировки. Другие такие модификации хорошо известны специалистам в данной области техники.

Модифицированное основание представляет собой любое основание, которое химически отличается от встречающихся в природе оснований, обычно обнаруживаемых в ДНК и РНК, таких как Т, С, G, А и U, но которое имеет общие химические структуры с этими встречающимися в природе основаниями. Модифицированное нуклеозидное основание может быть выбрано, например, из гипоксантина, дигидроурацила, псевдоурацила, 2-тиоурацила, 4-тиоурацила, 5-аминоурацила, 5-(С16)-алкилурацила, 5-(С26)-алкенилурацила, 5-(С26)-алкинилурацила, 5-(гидроксиметил)урацила, 5-хлорурацила, 5-фторурацила, 5-бромурацила, 5-гидроксицитозина, 5-(С16)-алкилцитозина, 5-(С36)-алкенилцитозина, 5-(С26)-алкинилцитозина, 5-хлорцитозина, 5-фторцитозина, 5-бромцитозина, N2-диметилгуанина, 2,4-диаминопурина, 8-азапурина, замещенного 7-деазапурина, предпочтительно 7-деаза-7-замещенного и/или 7-деаза-8-замещенного пурина, 5-гидроксиметилцитозина, N4-алкилцитозина (например, N4-этилцитозина), 5-гидроксидезоксицитидина, 5-гидроксиметилдезоксицитидина, N4-алкилдезоксицитидина (например, N4-этилдезоксицитидина), 6-тиодезоксигуанозина, дезоксирибонуклеозидов нитропиррола, С5-пропинилпиримизина, диаминопурина (например, 2,6-диаминопурина), инозина, 5-метилцитозина, 2-аминопурина, 2-амино-6-хлорпурина, гипоксантина или других модификаций природного нуклеозидного основания. Подразумевается, что этот перечень является примерным, и его не следует интерпретировать как ограничивающий объем изобретения.

В некоторых аспектах изобретения CpG-динуклеотид описанных в данной заявке иммуностимулирующих олигонуклеотидов предпочтительно неметилирован. Неметилированный CpG-мотив представляет собой неметилированную цитозин-гуаниновую динуклеотидную последовательность (т.е. неметилированный 5'-цитозин с последующим 3'-гуанозином и связанные фосфатной связью). В других аспектах CpG-мотив метилирован. Метилированный CpG-мотив представляет собой метилированную цитозин-гуаниновую динуклеотидную последовательность (т.е. метилированный 5'-цитозин, затем 3'-гуанозин, и связанные фосфатной связью).

В некоторых аспектах изобретения иммуностимулирующий олигонуклеотид может содержать модифицированный цитозин. Модифицированный цитозин представляет собой встречающийся в природе или не встречающийся в природе аналог пиримидинового основания цитозина, который может заменять это основание, не нарушая иммуностимулирующую активность олигонуклеотида. Модифицированные цитозины включают, но не ограничиваются этим, 5-замещенные цитозины (например, 5-метил-цитозин, 5-фтор-цитозин, 5-хлор-цитозин, 5-бром-цитозин, 5-йод-цитозин, 5-гидроксицитозин, 5-гидроксиметил-цитозин, 5-дифторметил-цитозин и незамещенный или замещенный 5-алкинил-цитозин), 6-замещенные цитозины, N4-замещенные цитозины (например, N4-этил-цитозин), 5-аза-цитозин, 2-меркаптоцитозин, изоцитозин, псевдоизоцитозин, аналоги цитозина с конденсированными кольцевыми системами (например, N,N'-пропиленцитозин или феноксазин). Некоторые из предпочтительных цитозинов включают 5-метил-цитозин, 5-фтор-цитозин, 5-гидроксицитозин, 5-гидроксиметил-цитозин и N4-этил-цитозин. В еще одном воплощении изобретения цитозиновое основание замещено универсальным основанием (например, 3-нитропиррол, Р-основание), ароматической кольцевой системой (например, фторбензолом или дифторбензолом) или атомом водорода (d-спейсер). В некоторых аспектах иммуностимулирующий олигонуклеотид может содержать урацил и/или его производные (например, 5-фтор-урацил, 5-бром-урацил, 5-бромвинил-урацил, 4-тиоурацил, 5-гидроксиурацил, 5-пропинил-урацил).

В некоторых аспектах изобретения иммуностимулирующий олигонуклеотид может содержать модифицированный гуанин. Модифицированный гуанин представляет собой встречающийся или не встречающийся в природе аналог пуринового основания гуанина, который может заменять это основание, не оказывая влияния на иммуностимулирующую активность олигонуклеотида. Модифицированные гуанины включают, но не ограничиваются этим, 7-деазагуанин, 7-деаза-7-замещенный гуанин, гипоксантин, N2-замещенные гуанины (например, N2-метил-гуанин), 5-амино-3-метил-3Н,6Н-тиазоло[4,5-d]пиримидин-2,7-дион, 2,6-диаминопурин, 2-аминопурин, пурин, индол, аденин, замещенные аденины (например, N6-метил-аденин, 8-оксоаденин), 8-замещенный гуанин (например, 8-гидроксигуанин или 8-бромгуанин) и 6-тиогуанин. В еще одном воплощении изобретения гуаниновое основание заменено на универсальное основание (например, 4-метил-индол, 5-нитро-индол или K-основание), ароматическую кольцевую систему (например, бензимидазол или дихлор-бензимидазол, амид 1-метил-1Н-[1,2,4]триазол-3-карбоновой кислоты) или атом водорода (d-спейсер).

В некоторых аспектах олигонуклеотиды могут включать модифицированные межнуклеотидные связи. Эти модифицированные связи могут быть частично устойчивы к деградации (например, стабилизированы). "Стабилизированная молекула нуклеиновой кислоты" означает молекулу нуклеиновой кислоты, которая относительно устойчива к деградации in vivo (например, под действием экзо- или эндонуклеазы). Стабилизация может зависеть от длины или вторичной структуры. Нуклеиновые кислоты, которые имеют длину от десяти до сотен т.п.н., относительно устойчивы к деградации in vivo. Для более коротких нуклеиновых кислот вторичная структура может стабилизировать и увеличивать их эффект. Образование структуры стебель-петля может стабилизировать молекулу нуклеиновой кислоты. Например, если 3'-конец нуклеиновой кислоты самокомплементарен вышележащей области, так что он может сворачиваться назад и образовывать структуру стебель-петля, то нуклеиновая кислота может стабилизироваться и демонстрировать большую активность.

Стабилизация нуклеиновой кислоты также может быть осуществлена с помощью модификации фосфатного скелета. Олигонуклеотиды, имеющие фосфоротиоатные связи, в некоторых воплощениях могут обеспечивать максимальную активность и защищать олигонуклеотид от деградации внутриклеточными экзо- и эндонуклеазами.

Для применения in vivo нуклеиновые кислоты предпочтительно относительно устойчивы к деградации (например, эндо- и экзонуклеазами). Продемонстрировано, что модификация скелета нуклеиновой кислоты приводит к повышенной активности нуклеиновых кислот при введении in vivo. Вторичные структуры, такие как "стебель-петли", могут стабилизировать нуклеиновые кислоты против деградации. Альтернативно, стабилизация нуклеиновых кислот может быть осуществлена посредством модификаций фосфатного скелета. Предпочтительная стабилизированная нуклеиновая кислота имеет по меньшей мере частичный фосфоротиоатный модифицированный скелет. Фосфоротиоаты могут быть синтезированы с использованием автоматизированных методов с использованием либо фосфорамидатной, либо Н-фосфонатной химии. Арил- и алкилфосфонаты могут быть получены, например, как описано в патенте США №4469863; и алкилфосфотриэфиры (в которых заряженная кислородная группировка алкилирована, как описано в патенте США №5023243 и Европейском патенте №092574) могут быть получены с помощью автоматизированного твердофазного синтеза с использованием имеющихся в продаже реагентов. Способы осуществления других модификаций и замен в скелете ДНК описаны (Uhlmann, E. and Peyman, A. (1990) Chem. Rev. 90:544; Goodchild, J. (1990) Bioconjugate Chem. 1:165). 2'-O-метилнуклеиновые кислоты с CpG-мотивами также вызывают активацию иммунной системы, как и этокси-модифицированные CpG-нуклеиновые кислоты. Фактически, не было обнаружено никаких модификаций скелета, которые бы полностью отменяли эффект CpG, хотя он значительно уменьшается при замене С на 5-метил-С. Конструкции, имеющие фосфоротиоатные связи, обеспечивают максимальную активность и защищают нуклеиновую кислоту от деградации внутриклеточными экзо- и эндонуклеазами. Другие модифицированные нуклеиновые кислоты включают фосфодиэфир-модифицированные нуклеиновые кислоты, комбинации фосфодиэфир- и фосфоротиоат-модифицированных нуклеиновых кислот, метилфосфонат, метилфосфоротиоат, фосфордитиоат, пара-этокси и их комбинации. Каждая из этих комбинаций и их конкретные эффекты на клетки иммунной системы более подробно обсуждаются в отношении CpG-нуклеиновых кислот в РСТ опубликованных патентных заявках PCT/US95/01570 (WO 96/02555) и PCT/US97/19791 (WO 98/18810) и в патенте США №6194388 В1, опубликованном 27 февраля 2001 г., и патенте США №6239116 В1, опубликованном 29 мая 2001 г. Полагают, что эти модифицированные нуклеиновые кислоты могут демонстрировать большую стимулирующую активность благодаря повышенной устойчивости к нуклеазам, повышенному захвату клетками, повышенному белковому связыванию и/или измененной внутриклеточной локализации.

Для введения in vivo нуклеиновые кислоты могут быть связаны с молекулой, которая приводит к более высокой аффинности связывания с поверхностью клетки-мишени (например, В-клетки, моноцита или естественного киллера (NK)) и/или увеличению поглощения клетками-мишенями с образованием "комплекса для доставки нуклеиновой кислоты". Нуклеиновые кислоты могут быть связаны ионными или ковалентными связями с соответствующими молекулами с использованием методов, которые хорошо известны в данной области техники. Может быть использовано множество связывающих или сшивающих агентов, таких как белок А, карбодиимид или N- сукцинимидил-3-(2-пиридилдитио)пропионат (SPDP). Альтернативно, нуклеиновые кислоты могут быть инкапсулированы в липосомах или виросомах с использованием хорошо известных способов.

Другие стабилизированные нуклеиновые кислоты включают, но не ограничиваются этим, неионные аналоги ДНК, такие как алкил- и арилфосфаты (в которых заряженный кислород фосфоната заменен алкильной или арильной группой), фосфодиэфир и алкилфосфотриэфиры, в которых заряженная кислородная группировка алкилирована. Также было показано, что нуклеиновые кислоты, которые содержат диол, такой как тетраэтиленгликоль или гексаэтиленгликоль, по любому из концов или обоим концам в значительной степени устойчивы у деградации нуклеазой. В некоторых воплощениях иммуностимулирующий олигонуклеотид по изобретению может включать по меньшей мере один липофильный замещенный нуклеотидный аналог и/или пиримидин-пуриновый динуклеотид.

Олигонуклеотиды могут иметь один или два доступных 5'-конца. Могут быть созданы модифицированные олигонуклеотиды, имеющие два таких 5'-конца, например, путем присоединения двух олигонуклеотидов посредством связи 3'-3' с образованием олигонуклеотида, имеющего два доступных 5'-конца. Связь 3'3' может представлять собой фосфодиэфирный, фосфоротиоатный или любой другой модифицированный межнуклеозидный мостик. Способы создания таких связей известны в данной области техники. Например, такие связи описаны в Seliger H et al. (1991) Oligonucleotide analogs with terminal 3'-3'- and 5'-5'-internucleotidic linkages as antisense inhibitors of viral gene expression, Nucleosides & Nucleotides 10: 469-77 и Jiang, etal., Pseudo-cyclic oligonucleotides: in vitro and in vivo properties, Bioorganic & Medicinal Chemistry (1999), 7(12), 2727-2735.

Кроме того, 3'-3'-связанные олигонуклеотиды, где связь между 3'-концевыми нуклеотидами не является фосфодиэфирным, фосфоротиоатным или другим модифицированным мостиком, могут быть получены с использованием дополнительного спейсера, такого как три- или тетраэтиленгликольфосфатная группировка (Durand, M. et al., Triple-helix formation by an Oligonucleotide containing one (dA) 12 and two (dT) 12 sequences bridged by two hexaethylene glycol chains, (1992), 31(38), 9197-204, патент США №5658738 и патент США №5668265). Альтернативно, ненуклеотидный линкер может быть получен из этандиола, пропандиола или из дезоксирибозного звена, лишенного азотистого основания (d-спейсера) (Fontanel, Marie Laurence et al., Sterical Recognition by T4 polynucleotide kinase of non-nucleosidic moieties 5'-attached to oligonucleotides, Nucleic Acids Research (1994), 22(11), 2022-7) с использованием обычной фосфорамидитной химии. Ненуклеотидные линкеры можно вводить один или несколько раз или сочетать друг с другом, обеспечивая любое желаемое расстояние между 3'-концами двух подлежащих связыванию олигонуклеотидов.

Фосфодиэфирный межнуклеозидный мостик, расположенный на 3'- и/или 5'-конце нуклеозида, можно заменить модифицированным межнуклеозидным мостиком, где указанный модифицированный межнуклеозидный мостик выбран, например, из фосфоротиоата, фосфородитиоата, NR1R2-фосфорамидата, боранофосфата, α-гидроксибензилфосфоната, фосфат-(С121)-О-алкилового сложного эфира, фосфат-[(С612)арил-(С121)-O-алкил]сложного эфира, (C18)-алкилфосфонатного и/или (С612)-арилфосфонатного мостиков, (С712)-α-гидроксиметиларила (например, описанного в WO 95/01363), где (С612)арил, (С620)арил и (С614)арил возможно замещены галогеном, алкилом, алкокси, нитро, циано, и где R1 и R2 независимо друг от друга представляют собой водород, (С118-алкил, (С620)-арил, (С614)-арил, (С18)-алкил, предпочтительно водород, (С18)-алкил, предпочтительно (С14)-алкил и/или метоксиэтил, или R1 и R2 вместе с несущим их атомом азота образуют 5-6-членное гетероциклическое кольцо, которое может дополнительно содержать дополнительный гетероатом, выбранный из группы О, S или N.

Замена фосфодиэфирного мостика, расположенного на 3'- и/или 5'-конце нуклеозида, дефосфомостиком (дефосфомостики описаны, например, в Uhlmann E. and Peyman А. в "Methods in Molecular Biology", Vol.20, "Protocols for Oligonucleotides and Analogs", S.Agrawal, Ed., Humana Press, Totowa 1993, Chapter 16, pp.355 ff), где дефосфомостик, например, выбран из дефосфомостиков формацетальной, 3-тиоформацетальной, метилгидроксиламиновой, оксимной, метилендиметилгидразо, диметиленсульфоновой и/или силильной групп.

Иммуностимулирующие олигонуклеотиды по изобретению могут возможно иметь химерные скелеты. Химерный скелет представляет собой скелет, который содержит более чем один тип связи. В одном из воплощений химерный скелет может быть представлен формулой: 5' Y1N1ZN2Y2 3'. Y1 и Y2 представляют собой молекулы нуклеиновой кислоты, имеющие от 1 до 10 нуклеотидов. Каждая из Y1 и Y2 включает по меньшей мере одну модифицированную межнуклеотидную связь. Поскольку по меньшей мере 2 нуклеотида из химерных олигонуклеотидов включают модификации скелета, эти нуклеиновые кислоты являются примером одного из типов стабилизированных иммуностимулирующих нуклеиновых кислот.

Что касается химерных олигонуклеотидов, то Y1 и Y2 считают независимыми друг от друга. Это означает, что каждая из Y1 и Y2 может иметь или может не иметь отличающиеся друг от друга последовательности и связи в скелете в одной и той же молекуле. В некоторых воплощениях Y1 и/или Y2 имеют от 3 до 8 нуклеотидов. N1 и N2 представляют собой молекулы нуклеиновой кислоты, имеющие от 0 до 5 нуклеотидов, поскольку N1ZN2 имеет в общей сложности по меньшей мере 6 нуклеотидов. Нуклеотиды в N1ZN2 имеют фосфодиэфирный скелет и не включают нуклеиновые кислоты, имеющие модифицированный скелет. Z представляет собой иммуностимулирующий нуклеиновокислотный мотив, предпочтительно выбранный из перечисленных в данной заявке иммуностимулирующих олигонуклеотидов.

Центральные нуклеотиды (N1ZN2) формулы Y1N1ZN2Y2 имеют фосфодиэфирные межнуклетидные связи, и Y1 и Y2 имеют по меньшей мере одну, но могут иметь более чем одну, или даже могут иметь все модифицированные межнуклеотидные связи. В предпочтительных воплощениях Y1 и/или Y2 имеют по меньшей мере две или от двух до пяти модифицированных межнуклеотидных связей, или Y1 имеет пять модифицированных межнуклеотидных связей, и Y2 имеет две модифицированные межнуклеотидные связи. Модифицированная межнуклеотидная связь в некоторых воплощениях представляет собой фосфоротиоатную модифицированную связь, фосфородитионатную связь или пара-этокси-модифицированную связь.

Нуклеиновые кислоты также включают нуклеиновые кислоты, имеющие скелетные сахара, которые ковалентно присоединены к низкомолекулярным органическим группам, отличным от гидроксильной группы в положении 2' и отличным от фосфатной группы в положении 5'. Таким образом, модифицированные нуклеиновые кислоты могут включать 2'-O-алкилированную рибозную группу. Кроме того, модифицированные нуклеиновые кислоты могут включать сахара, такие как арабинозу или 2'-фторарабинозу вместо рибозы. Таким образом, нуклеиновые кислоты могут быть гетерогенными по скелетному составу, включая при этом любую возможную комбинацию полимерных единиц, связанных вместе, таких как пептид-нуклеиновые кислоты (имеющие аминокислотный скелет с основаниями нуклеиновых кислот). В некоторых воплощениях нуклеиновые кислоты однородны по скелетному составу.

Сахарофосфатное звено (например, β-D-рибозу и фосфодиэфирный межнуклеозидный мостик, вместе образующие сахарофосфатное звено) из сахарофосфатного скелета (т.е. сахарофосфатный скелет состоит из сахарофосфатных звеньев) можно заменить другим звеном, где другое звено является, например, подходящим для построения "морфолинопроизводного" олигомера (как описано, например, в Stirchak E.P. et al. (1989) Nucleic Acids Res 17:6129-41), то есть, например, замена морфолинопроизводным; или для построения полиамидной нуклеиновой кислоты ("PNA"; как описано, например, в Nielsen РЕ et al. (1994) Bioconjug Chem 5:3-7), то есть, например, замена PNA-скелетным звеном, например, 2-аминоэтилглицином. Олидонуклеотид может иметь другие модификации и замены в углеводном скелете, такие как пептидные нуклеиновые кислоты с фосфатными группами (PHONA), замкнутые нуклеиновые кислоты (LNA) и олигонуклеотиды с участками скелета с алкильными линкерами или аминолинкерами. Алкильный линкер может быть разветвленным или неразветвленным, замещенным или незамещенным, и хирально чистым, или представлять собой рацемическую смесь.

β-Рибозное звено или β-D-2'-дезоксирибозное звено может быть заменено модифицированным сахарным звеном, где указанное модифицированное сахарное звено, например, выбрано из β-D-рибозы, α-D-2'-дезоксирибозы, L-2'-дезоксирибозы, 2'-F-2'-дезоксирибозы, 2'-F-арабинозы, 2'-O-(С16)-алкилрибозы, предпочтительно 2'-O-(С16)-алкилрибоза представляет собой 2'-O-метилрибозу, 2'-O-(С16)-алкенилрибозы, 2'-[О-(C16)алкил-O-(С16)алкил]рибозы, 2'-NH2-2'-дезоксирибозы, β-D-ксилофуранозы, α-арабинофуранозы, 2,4-дидезокси-β-D-эритрогексопиранозы и карбоциклических аналогов сахаров (описанных, например, в Froehler (1992) Am. Chem. Soc. 114:8320) и/или сахаров с открытой цепью (описанных, например, в Vandendriessche et al. (1993) Tetpahedron 49:7223), и/или бициклосахарных аналогов (описанных, например, в Tarkoy M. et al. (1993) Helv. Chim. Acta. 76:481).

В некоторых воплощениях сахар представляет собой 2'-O-метилрибозу, в частности, для одного или обоих нуклеотидов, связанных фосфодиэфирной или фосфодиэфирподобной межнуклеозидной связью.

Олигонуклеотиды по изобретению могут быть синтезированы de novo с использованием любого количества способов, хорошо известных в данной области техники. Например, β-цианоэтилфосфорамидитный способ (Beaucage, S.L., and Caruthers, M.H., (1981) Tet. Let. 22:1859); нуклеозид Н-фосфонатный способ (Garegg et al., (1986) Tet. Let. 27:4051-4054; Froehler et al., (1986) Nucl. Acid Res. 14:5399-5407; Garegg et al., (1986) 27:4055-4058; Gaffney et al., (1988) Tet. Let. 29:2619-2622). Эти химические реакции могут быть осуществлены с помощью различных имеющихся в продаже автоматизированных синтезаторов нуклеиновых кислот. Эти олигонуклеотиды называются синтетическими олигонуклеотидами. Альтернативно, Т-богатые и/или TG-динуклеотиды могут быть получены в большом масштабе в плазмидах (см. Sambrook Т. et al., "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor laboratory Press, New York, 1989) и разделены на меньшие фрагменты или введены в виде целых плазмид. Нуклеиновые кислоты могут быть получены из существующих последовательностей нуклеиновых кислот (например, геномной или кДНК) с использованием известных способов, таких как способы с использованием рестриктаз, экзонуклеаз или эндонуклеаз.

В воплощении изобретения все межнуклеотидные связи иммуностимулирующего олигонуклеотида представляют собой фосфоротиоатные связи.

Модифицированные скелеты, такие как фосфоротиоаты, могут быть синтезированы с использованием автоматизированных способов с использованием либо фосфорамидатных, либо Н-фосфонатных химических способов. Арил- или алкилфосфонаты могут быть получены, например, как описано в патенте США №4469863; и алкилфосфотриэфиры (в которых заряженная кислородная группировка алкилирована, как описано в патенте США №5023243) могут быть получены с помощью автоматизированного твердофазного синтеза с использованием имеющихся в продаже реагентов. Были описаны способы осуществления других модификаций и замещений в скелете ДНК (например, Uhlmann, E. and Peyman, A., Chem. Rev. 90:544, 1990; Goodchild, J., Bioconjugate Chem. 1:165, 1990).

Нуклеиновые кислоты, полученные таким образом, называются выделенными нуклеиновыми кислотами. "Выделенная нуклеиновая кислота" обычно относится к нуклеиновой кислоте, которая отделена от компонентов, с которыми она выделяется из клетки, из ядра, из митохондрий или из хроматина, и любых других компонентов, которые можно рассматривать в качестве примесей.

В одном из воплощений иммуностимулирующий олигонуклеотид по изобретению состоит из:

5' T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3', где * означает фосфоротиоатную связь.

В одном из воплощений иммуностимулирующий олигонуклеотид по изобретению индуцирует высокую долю антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ. В одном из воплощений иммуностимулирующий олигонуклеотид по изобретению способен индуцировать по меньшей мере 40%, предпочтительно по меньшей мере 45%, еще более предпочтительно по меньшей мере 50%, еще более предпочтительно примерно 53% антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ в популяции антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ, TNF-α и/или IL-2. В одном из воплощений указанную долю антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ, определяют с помощью полихроматической проточной цитометрии. Пример такого определения раскрыт в примере 1 настоящего документа (см. главу 'Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов').

В одном из воплощений иммуностимулирующий олигонуклеотид по изобретению способен индуцировать по меньшей мере 10%, предпочтительно по меньшей мере 15%, еще более предпочтительно по меньшей мере 20%, еще более предпочтительно примерно 22% антиген-специфических CD4+ Т-клеток, секретирующих как IFN-γ, так и TNF-α, в популяции антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ, TNF-α и/или IL-2. В одном из воплощений указанную долю полифункциональных антиген-специфических CD4+ Т-клеток, секретирующих как IFN-γ, так и TNF-α, определяют с помощью полихроматической проточной цитометрии. Пример такого определения раскрыт в примере 1 настоящего документа (см. главу 'Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов').

В одном из воплощений иммуностимулирующий олигонуклеотид по изобретению способен индуцировать по меньшей мере 30%, предпочтительно по меньшей мере 40%, еще более предпочтительно по меньшей мере 45%, еще более предпочтительно примерно 47% антиген-специфических CD8+ Т-клеток, секретирующих как IFN-γ, так и TNF-α, в популяции антиген-специфических CD8+ Т-клеток, секретирующих IFN-γ, TNF-α и/или IL-2. В одном из воплощений указанную долю полифункциональных антиген-специфических CD8+ Т-клеток, секретирующих как IFN-γ, так и TNF-α, определяют с помощью полихроматической проточной цитометрии. Пример такого определения раскрыт в примере 1 настоящего документа (см. главу 'Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов').

Нуклеиновые кислоты по изобретению могут быть использованы в виде автономных способов терапии. Автономная терапия представляет собой терапию, при которой профилактически или терапевтически благоприятный результат может быть достигнут в результате введения одного агента или композиции. Соответственно, раскрытые в данной заявке нуклеиновые кислоты могут быть использованы сами по себе для предупреждения или лечения инфекционного заболевания, поскольку нуклеиновые кислоты способны индуцировать иммунные ответы, которые благоприятны для терапевтического исхода этих заболеваний. Некоторые из способов, на которые ссылаются в данной заявке, относятся к применению нуклеиновых кислот в комбинации с другими терапевтическими агентами.

Нуклеиновые кислоты по изобретению могут быть использованы в вакцине. При использовании в вакцине нуклеиновую кислоту можно вводить с антигеном. Предпочтительно, антиген специфичен в отношении расстройства, которое предполагается предупреждать или лечить. Например, если расстройство представляет собой инфекционное заболевание, то антиген предпочтительно происходит из инфекционного организма (например, бактерии, вируса, паразита, гриба и т.д.), если расстройство вовлекает аутоантиген (например, опухоль, нейродегенеративное расстройство, такое как болезнь Альцгеймера, антиген против человеческого антитела, или антиген, который экспрессируется из человеческих эндогенных ретровирусных элементов), то антиген предпочтительно происходит из конкретного расстройства, ассоциированного с антигеном. Если расстройство включает вещество, вызывающее зависимость, то антиген предпочтительно происходит из конкретного вещества, вызывающего зависимость, ассоциированного с антигеном (например, никотиновым гаптеном).

Используемые в данной заявке термины "расстройство" и "заболевание" используют взаимозаменяемо.

В одном из воплощений изобретение относится к иммуностимулирующему олигонуклеотиду по изобретению для применения в качестве адъюванта в вакцине для лечения или предупреждения заболевания, где указанная вакцина содержит по меньшей мере один антиген, и где указанное заболевание облегчается в результате образования полифункциональных антиген-специфических Т-клеток.

Обнаружено, что CPG ODN 24555 индуцирует более высокую долю антиген-специфических CD4+ Т-клеток, продуцирующих IFN-γ, по сравнению с популяцией антиген-специфических CD4+ Т-клеток, полученной при использовании CPG ODN 10103. Также получали более высокую долю полифункциональных антиген-специфических CD4+ Т-клеток, продуцирующих как IFN-γ, так и TNF-α, как IFN-γ, так и IL-2, как TNF-α, так и IL-2, или даже тройных продуцентов IFN-γ, TNF-α и IL-2, по сравнению с популяцией антиген-специфических CD4+ Т-клеток, полученной с CPG ODN 10103 или CPG ODN 7909. Также получали более высокую долю полифункциональных антиген-специфических CD8+ Т-клеток, продуцирующих как IFN-γ, так и IL-2, как TNF-α, так и IL-2, или даже тройных продуцентов IFN-γ, TNF-α и IL-2, по сравнению с популяцией антиген-специфических CD8+ Т-клеток, полученной с CPG ODN 10103 или CPG ODN 7909.

IFN-γ, TNF-α и IL-2 вовлечены в различные заболевания. Например, TNF-α вовлечен в рак, а IFN-γ вовлечен в инфекционные заболевания, такие как вирусные инфекции. Поэтому в одном из воплощений изобретение относится к иммуностимулирующему олигонуклеотиду по изобретению для применения в качестве адъюванта в вакцине для лечения или предупреждения рака. В одном из воплощений изобретение относится к иммуностимулирующему олигонуклеотиду по изобретению для применения в качестве адъюванта в вакцине для лечения или предупреждения рака, где указанная вакцина содержит по меньшей мере один опухолевый антиген, предпочтительно любой из описанных в данной заявке опухолевых антигенов.

В одном из воплощений изобретение относится к иммуностимулирующему олигонуклеотиду по изобретению для применения в качестве адъюванта в вакцине для лечения или предупреждения инфекционного заболевания. В одном из воплощений изобретение относится к иммуностимулирующему олигонуклеотиду по изобретению для применения в качестве адъюванта в вакцине для лечения или предупреждения инфекционного заболевания, где указанная вакцина содержит по меньшей мере один микробный антиген, предпочтительно любой из описанных в данной заявке микробных антигенов.

Иммуностимулирующие олигонуклеотиды полезны в некоторых аспектах изобретения в качестве профилактической вакцины для предупреждения инфекции (т.е. инфекционного заболевания), расстройства, ассоциированного с аутоантигеном, или расстройства, ассоциированного с веществом, вызывающим привыкание. Предпочтительно, профилактическую вакцинацию используют у субъектов, у которых не диагностировано состояние, для которого предназначена вакцина, и более предпочтительно субъектов, которых рассматривают в качестве субъектов с повышенным риском развития одного из этих состояний. Например, субъект может представлять собой субъекта, который имеет повышенный риск развития инфекции вследствие контакта с инфекционным организмом, или восприимчив к расстройству, ассоциированному с аутоантигеном, или восприимчив к расстройству, ассоциированному с веществом, вызывающим привыкание.

Используемый в данной заявке термин "субъект с повышенным риском" представляет собой субъекта, который имеет какой-либо риск воздействия патогена, взывающего инфекцию, развития расстройства, ассоциированного с аутоантигеном, или расстройства, ассоциированного с веществом, вызывающим привыкание. Субъект с повышенным риском также включает субъектов, которые имеют предрасположенность к развитию таких расстройств. Некоторые предрасположенности могут быть генетическими (и поэтому могут быть идентифицированы с помощью либо генетического анализа, либо семейного анамнеза). Некоторые предрасположенности связаны с окружающей средой (например, перед воздействием инфекционных агентов, аутоантигенов или веществ, вызывающих привыкание). Что касается субъекта с повышенным риском развития инфекции, то примером такого субъекта является субъект, живущий в области, где обнаружен конкретный тип инфекционного агента, или планирующий поехать в область, где обнаружен конкретный тип инфекционного агента, или он может представлять собой субъекта, который вследствие своего образа жизни или медицинских процедур прямо или опосредованно будет подвергаться воздействию организма посредством контакта с жидкостями организма, которые могут содержать инфекционные организмы. Субъекты с повышенным риском развития инфекции также включают население в целом, для которого медицинское агентство рекомендует вакцинацию против конкретного инфекционного организма.

Субъект представляет собой субъекта, которого лечат ветеринары, грызуна или субъекта, отличного от грызуна. Субъекты, отличные от грызунов, включают, но не ограничиваются этим, человека или позвоночное животное, такое как собака, кошка, лошадь, корова, свинья, овца, коза, курица, примат (например, обезьяна) и рыба (вид аквакультуры, например, лосось). Виды грызунов включают, но не ограничиваются этим, крыс и мышей. В некоторых воплощениях субъект представляет собой человека.

Иммуностимулирующие олигонуклеотиды также можно вводить субъекту без антигена в течение более короткого периода защиты от инфекции. В этом случае повторные дозы будут обеспечивать более долговременную защиту.

Субъект, имеющий инфекцию, представляет собой субъекта, который подвергался воздействию инфекционного патогена и имеет острые или хронические обнаружимые уровни патогена в организме или в экскрементах организма. При терапевтическом применении иммуностимулирующие олигонуклеотиды могут быть использованы автономно или в комбинации с другим терапевтическим агентом. Например, иммуностимулирующие олигонуклеотиды могут быть использованы терапевтически с антигеном для повышения антиген-специфического системного или мукозального иммунного ответа, который способен уменьшать уровень или уничтожать инфекционный патоген.

Используемый в данной заявке термин "инфекционное заболевание" представляет собой заболевание, возникающее в результате присутствия в организме чужеродного микроорганизма. Особенно важно разрабатывать эффективные стратегии вакцинации и лечения для защиты слизистых поверхностей организма, которые представляют собой первичный участок для проникновения патогена.

Расстройство, ассоциированное с аутоантигеном, представляет собой любое расстройство, которое вызывается антигеном клеток самого же субъекта или клеточных продуктов, который вызывает иммунный ответ у указанного субъекта. Например, в некоторых воплощениях аутоантиген представляет собой опухолевый антиген, антиген, ассоциированный с болезнью Альцгеймера, антиген против антитела или антиген, который экспрессируется из человеческих эндогенных ретровирусных элементов. Опухолевый антиген может представлять собой HER2, MAGE, NYESO-1, PSA, СЕА или вариант EGFR. Антиген, ассоциированный с болезнью Альцгеймера, может представлять собой tau или р-амилоид. Антиген против антитела может представлять собой антиген против человеческого антитела, например, в некоторых воплощениях антиген представляет собой IgE.

В некоторых воплощениях опухолевый антиген представляет собой MAGE А1, MAGE А2, MAGE A3, MAGE A4, MAGE A6, MAGE A10, MAGE A12, HAGE (CT13), BAGE, BORIS, SSX-2, LAGE-1, CAMEL (рамка считывания alt LAGE-1), GAGE 1,2,3, TRAG-3, NY-ESO-1, Melan-A/MART-1, тирозиназу, tyrp1 (gp75), tyrp2, gp100/pmel17, PAP, PSA, СЕА, Ep-CAM, PSMA, MUC1, MUC2, HER-2, AFP, EphA2, FGF-5, htert, iCE, Livin (ML-IAP), RAGE, RU2, сурвивин, сурвивин 2B, WT1, антиген Томсена-Фриденрейха (TF), 5T4, PSCA, STEAP, TGR, адипофилин, AIM-2, G250, OGT, TGFaRII, CO-95 (KIAA1416), СО-94 (seb4D), СО-9 (HDAC 5), СО-61 (HIP1R), СО-58 (KNSL6), СО-45, СО-42 (TRIP4), СО-41 (MBD2), Ren-32 (ламин С), TNKL (ВС-203), СО-26 (MNK 1), SDCCAG3, GA733-2, STn, CA125, EGFRvIII, BCR-abl, высокоаффинный фолатный рецептор, мезотелин, hCG, FAP альфа, циклин 1, топоизомеразу, серпин В5/маспин, легумаин, CDK4, PRAME, ADAM 17, EDDR1, CDC2, белок репликации A, CDK2, GM2, Globo H, TF(c), Ley, Tn(c), STn(c), GD2, GD3 или GD3L.

Расстройство, ассоциированное с веществом, вызывающим привыкание, представляет собой любое расстройство, которое вовлекает химическое или биологическое вещество, которое вызывает у субъекта развитие привыкания к веществу, вызывающему привыкание. Например, в некоторых воплощениях вещество, вызывающее привыкание, может представлять собой никотин или кокаин. В некоторых воплощениях никотиновый антиген может представлять собой никотиновый гаптен, конъюгированный с носителем. В некоторых воплощениях носитель, с которым конъюгирован никотиновый гаптен, представляет собой дифтерийный токсин.

Как использовано в данной заявке, термин "лечить", "которого лечат" или "лечение", при использовании в отношении инфекционного заболевания относится к профилактическому лечению, которое увеличивает устойчивость субъекта (субъекта с повышенным риском инфекции) к инфицированию патогеном или, другими словами, уменьшает вероятность того, что субъект будет инфицирован патогеном, а также к лечению после того, как субъект (субъект, который был инфицирован) стал инфицированным, для борьбы с инфекцией, например, для уменьшения или устранения инфекции или предупреждения ухудшения состояния.

Термин "лечить", "которого лечат" или "лечение" при использовании в данной заявке в отношении расстройства, ассоциированного с аутоантигеном, относится к профилактическому лечению, которое увеличивает устойчивость субъекта (субъекта с повышенным риском возникновения расстройства, ассоциированного с аутоантигеном) к развитию такого расстройства или уменьшает вероятность развития у субъекта расстройства, ассоциированного с аутоантигеном, а также к лечению после того, как у субъекта (субъекта с повышенным риском возникновения расстройства, ассоциированного с аутоантигеном) развилось такое расстройство или начали развиваться признаки или симптомы развития такого расстройства, для уменьшения эффекта расстройства, например уменьшения или устранения признаков или симптомов, ассоциированных с расстройством, или предупреждения ухудшения состояния субъекта.

Термин "лечить", "которого лечат" или "лечение" при использовании в данной заявке в отношении расстройства, ассоциированного с веществом, вызывающим привыкание, относится к профилактическому лечению, которое увеличивает устойчивость субъекта (субъекта с повышенным риском возникновения расстройства, ассоциированного с веществом, вызывающим привыкание) к развитию такого расстройства или уменьшает вероятность развития у субъекта расстройства, ассоциированного с веществом, вызывающим привыкание, а также к лечению после того, как у субъекта (субъекта с повышенным риском возникновения расстройства, ассоциированного с веществом, вызывающим привыкание) развилось такое расстройство или начали развиваться признаки или симптомы развития такого расстройства, для уменьшения эффекта расстройства, например уменьшения или устранения признаков или симптомов, ассоциированных с расстройством, или предупреждения ухудшения состояния субъекта.

Лечение субъекта описанным в данной заявке иммуностимулирующим олигонуклеотидом приводит к уменьшению инфекции или полному устранению инфекции, уменьшению признаков/симптомов, ассоциированных с расстройством, ассоциированным с аутоантигеном, или полному устранению расстройства, или уменьшению признаков/симптомов, ассоциированных с расстройством, ассоциированным с веществом, вызывающим привыкание, или полному устранению расстройства. Субъекта можно рассматривать как подвергавшегося лечению в том случае, если такие симптомы, связанные с инфекционным заболеванием, расстройством, ассоциированным с аутоантигеном, или расстройством, ассоциированным с веществом, вызывающим привыкание, уменьшаются, контролируются или устраняются в результате такого лечения. Что касается инфекционного заболевания, такое лечение также охватывает уменьшение количества инфекционного агента, представленного у субъекта (например, такие количества могут быть измерены с использованием стандартных анализов, таких как ELISA (иммуноферментный анализ), известных среднему специалисту в данной области техники). Что касается расстройства, ассоциированного с аутоантигеном, такое лечение также охватывает уменьшение количества аутоантигена, присутствующего у субъекта, или уменьшение иммунного ответа, индуцированного аутоантигеном. Что касается расстройства, ассоциированного с веществом, вызывающим привыкание, такое лечение также охватывает уменьшение признаков/симптомов, ассоциированных с веществом, вызывающим привыкание.

Используемый в данной заявке термин "антиген" представляет собой молекулу, способную провоцировать иммунный ответ. Антигены включают, но не ограничиваются этим, клетки, клеточные экстракты, белки, рекомбинантные белки, очищенные белки, полипептиды, пептиды, полисахариды, полисахаридные конъюгаты, пептидные и непептидные миметики полисахаридов и других молекул, кодируемые плазмидной ДНК, гаптены, малые молекулы, липиды, гликолипиды, углеводы, вирусы и вирусные экстракты, живой ослабленный вирус или вирусный вектор, живую ослабленную бактерию или бактериальный вектор, и многоклеточные организмы, такие как паразиты и аллергены. Термин "антиген" в широком смысле включает любой тип молекулы, которая распознается иммунной системой хозяина как чужеродная. Антигены включают, но не ограничиваются этим, микробные антигены, аутоантигены и вещества, вызывающие привыкание.

В некоторых аспектах антиген конъюгирован с носителем. В некоторых воплощениях носитель представляет собой дифтерийный токсин или вирусоподобную частицу. В некоторых воплощениях вирусоподобная частица состоит из РНК-фага Q-β, поверхностного антигена гепатита В (HBsAg) или коревого антигена гепатита В (HBcAg).

Используемый в данной заявке "микробный антиген" представляет собой антиген микроорганизма и включает, но не ограничивается этим, вирус, бактерию, паразиты и грибы. В некоторых воплощениях бактериальный антиген представляет собой антиген, ассоциированный с бактерией Staphylococcus aureus. В других воплощениях бактериальный антиген представляет собой антиген, ассоциированный с бактерией, вызывающей кариес зубов, например Streptococcus mutans, Streptococcus sobrinus, Streptococcus sanguis, Lactobcaillus acidophilis или Actinomyces viscosus. В некоторых воплощениях бактериальный антиген представляет собой антиген, ассоциированный с бактерией, вызывающей периодонтальное заболевание, например Porphyromonas gingivalis или Actinobacillus actinomycetemcomitans. В некоторых воплощениях вирусный антиген представляет собой антиген, ассоциированный с респираторно-синцитиальным вирусом (RSV), вирусом простого герпеса 1 (HSV1), вирусом простого герпеса 2 (HSV2) или вирусом иммунодефицита человека-1 (HIV-1) или HIV-2. В некоторых воплощениях паразитарный антиген представляет собой антиген, ассоциированный с паразитом, вызывающим малярию.

Такие антигены включают интактный микроорганизм, а также природные изоляты и их фрагменты или производные, а также синтетические соединения, которые идентичны или сходны с природными антигенами микроорганизма и индуцируют иммунный ответ, специфический для данного микроорганизма.

Соединение сходно с природным антигеном микроорганизма в том случае, если оно индуцирует иммунный ответ (гуморальный и/или клеточный) на природный антиген микроорганизма. Такие антигены рутинно используются в данной области техники и хорошо известны специалистам в данной области техники.

В некоторых аспектах изобретения субъект "подвергается воздействию" антигена. Используемый в данной заявке термин "подвергается воздействию" относится либо к активной стадии приведения субъекта в контакт с антигеном, либо к пассивному контакту субъекта с антигеном in vivo. Способы активного приведения субъекта в контакт с антигеном хорошо известны в данной области техники. Как правило, антиген вводят непосредственно субъекту любыми способами, такими как внутривенное, внутримышечное, пероральное, трансдермальное, через слизистую оболочку, интраназальное, интратрахеальное или подкожное введение. Антиген можно вводить локально или системно. Способы введения антигена и иммуностимулирующего олигонуклеотида более подробно описаны ниже. Субъект пассивно подвергается воздействию антигена в том случае, если антиген становится доступным для воздействия на иммунные клетки в организме.

Способы, в которых субъект пассивно подвергается воздействию антигена, в частности, могут зависеть от режима введения иммуностимулирующего олигонуклеотида. Например, субъекту с повышенным риском развития инфекционного заболевания можно вводить иммуностимулирующий олигонуклеотид регулярно, когда риск является наибольшим. Кроме того, иммуностимулирующий олигонуклеотид можно вводить путешественникам перед их поездкой в зарубежные страны, где они подвержены риску воздействия инфекционных агентов. Иммуностимулирующий олигонуклеотид также можно вводить солдатам или гражданскому населению при риске воздействия биологического оружия для индукции системного или мукозального иммунного ответа на антиген, когда и если субъект подвергается его воздействию.

Примеры вирусов, которые были обнаружены у человека, включают, но не ограничиваются этим: Retroviridae (например, вирусы иммунодефицита человека, такие как HIV-1 (также называемые как HTLV-III, LAV или HTLV-III/LAV или HIV-III; и другие изоляты, такие как HIV-LP); Picornaviridae (например, полиовирусы, вирус гепатита А; энтеровирусы, вирусы Коксаки человека, риновирусы, эховирусы); Calciviridae (например, штаммы, вызывающие гастроэнтерит); Togaviridae (например, вирус конского энцефалита, вирусы краснухи); Flaviviridae (например, вирусы лихорадки Денге, вирусы энцефалита, вирусы желтой лихорадки); Coronaviridae (например, коронавирусы); Rhabdoviridae (например, вирусы везикулярного стоматита, вирусы бешенства); Filoviridae (например, вирусы Эбола); Paramyxoviridae (например, вирусы парагриппа, вирус свинки, вирус кори, респираторно-синцитиальный вирус); Orthomyxoviridae (например, вирусы гриппа); Bunyaviridae (например, вирусы Хантаан, буньявирусы, флебовирусы и найровирусы); Arena viridae (вирусы геморрагической лихорадки); Reoviridae (например, реовирусы, орбивирусы и ротавирусы); Birnaviridae; Hepadnaviridae (вирус гепатита В); Parvoviridae (парвовирусы); Papovaviridae (вирусы папилломы, вирусы полиомы); Adenoviridae (большинство аденовирусов); Herpesviridae (вирус простого герпеса (HSV) 1 и 2, вирус ветряной оспы, цитомегаловирус (CMV), вирус герпеса); Poxviridae (вирусы натуральной оспы, вирусы коровьей оспы, поксвирусы); и Iridoviridae (например, вирус африканской лихорадки свиней) и неклассифицированные вирусы (например, этиологические возбудители губчатых энцефалопатий, возбудитель гепатита дельта (считающийся дефектным сателлитом вируса гепатита В), возбудители не-А, не-В гепатита (класс 1 = передающийся интернально; класс 2 = передающийся парентерально (т.е. гепатит С); Норволк и родственные вирусы и астровирусы). В некоторых воплощениях вирусы представляют собой респираторно-синцитиальный вирус (RSV), вирус простого герпеса 1 (HSV1), вирус простого герпеса 2 (HSV2), вирус иммунодефицита человека-1 (HIV1) или HIV2.

Хотя множество из описанных в данной заявке микробных антигенов относится к расстройствам у человека, изобретение также полезно для лечения других позвоночных животных, отличных от человека. У позвоночных животных, отличных от человека, также могут развиваться инфекции, которые можно предупреждать или лечить с помощью раскрытых в данной заявке иммуностимулирующих нуклеиновых кислот. Например, дополнительно к лечению инфекционных заболеваний человека, способы по изобретению полезны для лечения инфекций животных.

Как грамположительные, так и грамотрицательные бактерии служат антигенами для позвоночных животных. Такие грамположительные бактерии включают, но не ограничиваются этим, виды Pasteurella, виды Staphylococci и виды Streptococcus. Грамотрицательные бактерии включают, но не ограничиваются этим, Escherichia coli, виды Pseudomonas и виды Salmonella. Конкретные примеры инфекционных бактерий включают Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps. (например, М. tuberculosis, М. avium, М. intracellulare, М. kansaii, М. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Streptococcus группы A), Streptococcus agalactiae (Streptococcus группы В), Streptococcus (группы viridans), Streptococcus faecalis, Streptococcus bovis, Streptococcus (анаэробные виды), Streptococcus pneumoniae, патогенные Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus antracis, Corynebacterium diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidium, Treponema pertenue, Leptospira, Rickettsia, и Actinomyces israelli. В некоторых воплощениях бактерия представляет собой бактерию, вызывающую кариес зубов, например Streptococcus mutans, Streptococcus sobrinus, Streptococcus sanguis, Lactobacillus acidophilis или Actinomyces viscosus. В других воплощениях бактерия представляет собой бактерию, вызывающую периодонтальное заболевание, например Porphyromonas gingivalis или Actinobacillus actinomycetemcomitans.

Полипептиды бактериальных патогенов включают, но не ограничиваются этим, железорегулируемый белок наружной мембраны (IROMP), белок наружной мембраны (ОМР) и А-белок Aeromonis salmonicida, вызывающий фурункулы, белок р57 Renibacterium salmoninarum, вызывающий бактериальное заболевание почек (BKD), главный поверхностно-ассоциированный антиген (msa), экспрессирующийся на поверхности цитотоксин (mpr), экспрессирующийся на поверхности гемолизин (ish) и флагеллярный антиген Yersiniosis; внеклеточный белок (ЕСР), IROMP и структурный белок Pasteurellosis; ОМР и флагеллярный белок Vibrosis anguillarum и V. ordalii; флагеллярный белок, белок ОМР, агоА и purA Edwardsiellosis ictaluri и Е.tarda; и поверхностный антиген Ichthyophthirius; и структурный и регуляторный белок Cytophaga columnari; и структурный и регуляторный белок Rickettsia.

Примеры грибов включают Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans. Другие инфекционные организмы (т.е простейшие) включают Plasmodium spp, такие как Plasmodium falciparum, Plasmodium malariae, Plasmodium ovate, Plasmodium vivax и Toxoplasma gondii. Переносимые с кровью и/или тканевые паразиты включают Plasmodium spp., Babesia microti, Babesia divergens, Leishmania tropica, Leishmania spp., Leishmania braziliensis, Leishmania donovani, Trypanosoma gambiense и Trypanosoma rhodesiense (сонная болезнь, африканский трипаносомоз), Trypanosoma cruzi (болезнь Чагаса) и Toxoplasma gondii. В некоторых воплощениях паразит представляет собой паразита, ассоциированного с малярией. Другие значимые с медицинской точки зрения микроорганизмы широко описаны в литературе, например, см. C.G.A Thomas, Medical Microbiology, Bailliere Tindall, Great Britain 1983.

Множество вакцин для лечения позвоночных, отличных от человека, описано в Bennett, K., Compendium of Veterinary Products, 3rd ed. North American Compendiums, Inc., 1995. Как обсуждалось выше, антигены включают инфекционные микробы, такие как вирусы, паразиты, бактерии и грибы, и их фрагменты, происходящие из природных источников или полученные синтетическим путем. Инфекционные вирусы человека и позвоночных, отличных от человека, включают ретровирусы, РНК-вирусы и ДНК-вирусы. Эта группа ретровирусов включает как простые ретровирусы, так и сложные ретровирусы. Простые ретровирусы включают подгруппы ретровирусов В-типа, С-типа и D-типа. Пример ретровируса В-типа представляет собой вирус опухоли молочной железы мышей (MMTV). Ретровирусы С-типа включают подгруппы группы А С-типа (включающие вирус саркомы Рауса (RSV), вирус лейкоза птиц (ALV) и вирус миелобластоза птиц (AMV)) и группу В С-типа (включающую вирус лейкоза кошек (FeLV), вирус лейкоза гиббонов (GALV), вирус некроза селезенки (SNV), вирус ретикулоэндотелиоза (RV) и вирус саркомы обезьян (SSV)). Ретровирусы D-типа включают вирус обезьян Мэйзона-Пфейзера (Mason-Pfizer) (MPMV) и обезьяний ретровирус 1 типа (SRV-1). Сложные ретровирусы включают подгруппы лентивирусов, вирусов Т-клеточного лейкоза и пенящие вирусы. Лентивирусы включают HIV-1, а также включают HIV-2, SIV, вирус Висна, вирус иммунодефицита кошек (FIV) и вирус инфекционной анемии лошадей (EIAV). Вирусы Т-клеточного лейкоза включают HTLV-1, HTLV-II, вирус Т-клеточного лейкоза обезьян (STLV) и вирус лейкоза крупного рогатого скота (BLV). Пенящие вирусы включают человеческие пенящие вирусы (HFV), пенящий вирус обезьян (SFV) и пенящие вирусы крупного рогатого скота (BFV).

Примеры других РНК-вирусов, представляющих собой антигены для позвоночных животных, включают, но не ограничиваются этим, члены семейства Reoviridae, включая род Orthoreovirus (многочисленные серотипы ретровирусов как млекопитающих, так и птиц), род Orbivirus (вирус катаральной лихорадки овец, вирус Eugenangee, вирус Кемерово, вирус африканской болезни лошадей и вирус колорадской клещевой лихорадки), род Rotavirus (человеческий ротавирус, вирус диареи телят Небраски, ротавирус обезьян, ротавирус крупного рогатого скота или овец, ротавирус птиц); семейства Picornaviridae, включая род Enterovirus (полиовирус, вирус Коксаки А и В, кишечные цитопатические человеческие вирусы-"сироты" (ECHO), вирус гепатита А, энтеровирусы обезьян, вирусы энцефаломиелита мышей (ME), Poliovirus muris, энтеровирусы крупного рогатого скота, энтеровирусы свиней, род Cardiovirus (вирус энцефаломиокардита (ЕМС), менговирус), род Rhinovirus (человеческие риновирусы, включающие по меньшей мере 113 подтипов; другие риновирусы), род Apthovirus (ящур (FMDV)); семейства Calciviridae, включая вирус везикулярной экзантемы свиней, вирус Сан-Мигель морских львов, пикорнавирус кошек и норовирус (Norwalk virus); семейства Togaviridae, включая род Alphavirus (вирус восточного энцефалита лошадей, вирус леса Семлики, вирус Синдбис, вирус лихорадки Чикунгунья, вирус о'Нъонг-Нъонг, вирус реки Росс, вирус венесуэльского энцефалита лошадей, вирус западного энцефалита лошадей), род Flavirius (передаваемый комарами вирус желтой лихорадки, вирус денге, вирус японского энцефалита, вирус энцефалита Сент-Луис, вирус энцефалита долины Муррея, вирус Западного Нила, вирус Kunjin, вирус центрально-европейского клещевого энцефалита, вирус дальневосточного клещевого энцефалита, вирус болезни Кьясанурского леса, вирус шотландского энцефаломиелита овец, вирус Повассан, вирус омской геморрагической лихорадки), род Rubivirus (вирус краснухи), род Pestivirus (вирусная диарея, вирус холеры свиней, вирус пограничной болезни овец); семейства Bunyavindae, включая род Bunyvirus (Bunyamwera и родственные вирусы, вирусы группы калифорнийского энцефалита), род Phlebovirus (вирус сицилийской флеботомной лихорадки, вирус лихорадки долины Рифт), род Nairovirus (вирус Конго-Крымской геморрагической лихорадки, вирус болезни овец Найроби), и род Uukuvirus (Uukuniemi и родственные вирусы); семейства Orthomyxoviridae, включая род вируса гриппа (вирус гриппа типа А, многочисленные человеческие подтипы); вирус свиного гриппа, и вирусы гриппа птиц и лошадей; вирус гриппа типа В (многочисленные человеческие подтипы), и вирус гриппа С (возможно отдельный род); семейства Paramyxoviridae, включая род Paramyxovirus (вирус парагриппа типа 1, вирус Сендай, вирус гемадсорбции, вирусы парагриппа типов 2-5, вирус болезни Ньюкасла (псевдочумы птиц), вирус эпидемического паротита), род Morbillivirus (вирус кори, вирус подострого склерозирующего панэнцефалита, вирус чумы плотоядных, вирус чумы рогатого скота), род Pneumovirus (респираторно-синцитильный вирус (RSV), респираторно-синцитиальный вирус крупного рогатого скота и вирус пневмонии); семейства Rhabdoviridae, включая род Vesiculovirus (VSV), вирус Chandipura, вирус Фландерс-Харт Парк), род Lyssavirus (вирус бешенства), рабдовирусы рыб и два вероятных рабдовируса (вирус Марбурга и вирус Эбола); семейства Arena viridae, включая вирус лимфоцитарного хориоменингита (LCM), вирус комплекса Такарибе и вирус Ласса; семейства Coronoaviridae, включая вирус инфекционного бронхита (IBV), вирус гепатита, человеческий кишечный коронавирус и вирус инфекционного перитонита кошек (коронавирус кошек).

Иллюстративные ДНК-вирусы, представляющие собой антигены позвоночных животных, включают, но не ограничиваются этим, семейство Poxviridae, включая род Orthopoxvirus (Variola major, Variola minor, вирус оспы обезьян, вирус коровьей оспы, вирус оспы буйволов, вирус оспы кроликов, вирус оспы мышей), род Leporipoxvirus (вирус миксомы, вирус фибромы), род Avipoxvirus (вирус оспы птиц, другой поксвирус птиц), род Capripoxvirus (вирус оспы овец, вирус оспы коз), род Suipoxvirus (вирус оспы свиней), род Parapoxvirus (вирус контагиозного постулярного дерматита, вирус псевдооспы крупного рогатого скота, вирус папулезного стоматита крупного рогатого скота); семейство Iridoviridae (вирус африканской лихорадки свиней, вирусы Frog 2 и 3, вирус лимфоцистоза рыб); семейство Herpesviridae, включая альфа-герпесвирусы (вирусы простого герпеса типов 1 и 2, вирус ветряной оспы, вирус аборта лошадей, герпесвирус лошадей 2 и 3, вирус псевдобешенства, вирус инфекционного кератоконъюнктивита крупного рогатого скота, вирус инфекционного ринотрахеита крупного рогатого скота, вирус ринотрахеита кошек, вирус инфекционного ларинготрахеита), бета-герпесвирусы (человеческий цитомегаловирус и цитомегаловирус свиней и обезьян); гамма-герпесвирусы (вирус Эпштейна-Барра (EBV), вирус болезни Марека, Herpes saimili, Herpesvirus ateles, Herpesvirus sylvilagus, вирус герпеса морских свинок, вирус опухоли Люке); семейство Adenoviridae, включая род Mastadenovirus (человеческий вирус подгрупп A, B, C, D, E и несгруппированные; аденовирусы обезьян (по меньшей мере 23 серотипа), вирус инфекционного гепатита собак и аденовирусы крупного рогатого скота, свиней, овец, лягушек и многих других видов, род Aviadenovirus (аденовирусы птиц); и некультивируемые аденовирусы; семейство Papoviridae, включая род Papillomavirus (вирусы папилломы человека, вирусы папилломы крупного рогатого скота, вирус папилломы Шоупа (Shope) и различные патогенные папилломавирусы других видов), род Polyomavirus (полиомавирус, вакуолизирующий агент обезьян (SV-40), вакуолизирующий агент кроликов (RKV), K-вирус, BK-вирус, JC-вирус и другие полиомавирусы приматов, такие как лимфотропный папилломавирус); семейство Parvoviridae, включая род аденоассоциированных вирусов, род Parvovirus (вирус панлейкопении кошек, парвовирус крупного рогатого скота, парвовирус собак, вирус Алеутской болезни норок и т.п.). Кроме того, ДНК-вирусы могут включать вирусы, которые не вошли в вышеуказанные семейства, такие как вирусы Куру и болезни Крейтцфельдта-Якоба и хронические инфекционные нейропатические агенты (вирус CHINA).

В одном из воплощений изобретение относится к способу индукции антиген-специфического иммунного ответа, включающему введение антигена и иммуностимулирующего олигонуклеотида по изобретению, где по меньшей мере 40%, предпочтительно по меньшей мере 45%, еще более предпочтительно по меньшей мере 50%, еще более предпочтительно примерно 53% индуцированных антиген-специфических CD4+ Т-клеток секретируют IFN-γ в популяции антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ, TNF-а и/или IL-2. В одном из воплощений указанную долю антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ, определяют с помощью полихроматической проточной цитометрии. Пример такого определения раскрыт в примере 1 настоящего документа (см. главу 'Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов'). В одном из воплощений антиген и иммуностимулирующий олигонуклеотид вводят в количестве, эффективном для индукции антиген-специфического иммунного ответа у указанного субъекта. В одном из воплощений антиген представляет собой любой из описанных в данной заявке антигенов.

В одном из воплощений изобретение относится к способу индукции антиген-специфического иммунного ответа, включающему введение антигена и иммуностимулирующего олигонуклеотида по изобретению, где по меньшей мере 10%, предпочтительно по меньшей мере 15%, еще более предпочтительно по меньшей мере 20%, еще более предпочтительно примерно 22% индуцированных антиген-специфических CD4+ Т-клеток представляют собой двойные продуценты цитокинов, предпочтительно секретирующие как IFN-γ, так и TNF-α, в популяции антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ, TNF-α и/или IL-2. В одном из воплощений указанную долю антиген-специфических CD4+ Т-клеток, секретирующих как IFN-γ, так и TNF-α, определяют с помощью полихроматической проточной цитометрии. Пример такого определения раскрыт в примере 1 настоящего документа (см. главу 'Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов'). В одном из воплощений антиген и иммуностимулирующий олигонуклеотид вводят в количестве, эффективном для индукции антиген-специфического иммунного ответа у указанного субъекта. В одном из воплощений антиген представляет собой любой из описанных в данной заявке антигенов.

В одном из воплощений изобретение относится к способу индукции антиген-специфического иммунного ответа, включающему введение антигена и иммуностимулирующего олигонуклеотида по изобретению, где по меньшей мере 30%, предпочтительно по меньшей мере 40%, еще более предпочтительно по меньшей мере 45%, еще более предпочтительно примерно 47% индуцированных антиген-специфических CD8+ Т-клеток представляют собой двойные продуценты цитокинов, предпочтительно секретирующие как IFN-γ, так и TNF-α, в популяции антиген-специфических CD8+ Т-клеток, секретирующих IFN-γ, TNF-α и/или IL-2. В одном из воплощений указанную долю антиген-специфических CD8+ Т-клеток, секретирующих как IFN-γ, так и TNF-α, определяют с помощью полихроматической проточной цитометрии.

Пример такого определения раскрыт в примере 1 настоящего документа (см. главу 'Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов'). В одном из воплощений антиген и иммуностимулирующий олигонуклеотид вводят в количестве, эффективном для индукции антиген-специфического иммунного ответа у указанного субъекта. В одном из воплощений антиген представляет собой любой из описанных в данной заявке антигенов.

В одном из воплощений изобретение относится к иммуностимулирующему олигонуклеотиду по изобретению для применения в индукции иммунного ответа против антигена, где по меньшей мере 40%, предпочтительно по меньшей мере 45%, еще более предпочтительно по меньшей мере 50%, еще более предпочтительно примерно 53% индуцированных антиген-специфических CD4+ Т-клеток секретируют IFN-γ в популяции антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ, TNF-α и/или IL-2. В одном из воплощений указанную долю антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ, определяют с помощью полихроматической проточной цитометрии. Пример такого определения раскрыт в примере 1 настоящего документа (см. главу 'Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов'). В одном из воплощений антиген представляет собой любой из описанных в данной заявке антигенов.

В одном из воплощений изобретение относится к иммуностимулирующему олигонуклеотиду по изобретению для применения в индукции иммунного ответа против антигена, где по меньшей мере 10%, предпочтительно по меньшей мере 15%, еще более предпочтительно по меньшей мере 20%, еще более предпочтительно примерно 22% индуцированных антиген-специфических CD4+ Т-клеток представляют собой двойные продуценты цитокинов, предпочтительно секретирующие как IFN-γ, так и TNF-α, в популяции антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ, TNF-α и/или IL-2. В одном из воплощений указанную долю антиген-специфических CD4+ Т-клеток, секретирующих как IFN-γ, так и TNF-α, определяют с помощью полихроматической проточной цитометрии. Пример такого определения раскрыт в примере 1 настоящего документа (см. главу 'Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов'). В одном из воплощений антиген представляет собой любой из описанных в данной заявке антигенов.

В одном из воплощений изобретение относится к иммуностимулирующему олигонуклеотиду по изобретению для применения в индукции иммунного ответа против антигена, где по меньшей мере 30%, предпочтительно по меньшей мере 40%, еще более предпочтительно по меньшей мере 45%, еще более предпочтительно примерно 47% индуцированных антиген-специфических CD8+ Т-клеток представляют собой двойные продуценты цитокинов, предпочтительно секретирующие как IFN-γ, так и TNF-α, в популяции антиген-специфических CD8+ Т-клеток, секретирующих IFN-γ, TNF-α и/или IL-2. В одном из воплощений указанную долю антиген-специфических CD4+ Т-клеток, секретирующих как IFN-γ, так и TNF-α, определяют с помощью полихроматической проточной цитометрии. Пример такого определения раскрыт в примере 1 настоящего документа (см. главу 'Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов'). В одном из воплощений антиген представляет собой любой из описанных в данной заявке антигенов.

В одном из воплощений изобретение относится к иммуностимулирующему олигонуклеотиду по изобретению для применения в качестве адъюванта в вакцине, где указанная вакцина индуцирует иммунный ответ против антигена и где по меньшей мере 40%, предпочтительно по меньшей мере 45%, еще более предпочтительно по меньшей мере 50%, еще более предпочтительно примерно 53% индуцированных антиген-специфических CD4+ Т-клеток секретируют IFN-γ в популяции антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ, TNF-α и/или IL-2. В одном из воплощений указанную долю антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ, определяют с помощью полихроматической проточной цитометрии. Пример такого определения раскрыт в примере 1 настоящего документа (см. главу 'Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов'). В одном из воплощений антиген представляет собой любой из описанных в данной заявке антигенов.

В одном из воплощений изобретение относится к иммуностимулирующему олигонуклеотиду по изобретению для применения в качестве адъюванта в вакцине, где указанная вакцина индуцирует иммунный ответ против антигена и где по меньшей мере 10%, предпочтительно по меньшей мере 15%, еще более предпочтительно по меньшей мере 20%, еще более предпочтительно примерно 22% индуцированных антиген-специфических CD4+ Т-клеток представляют собой двойные продуценты цитокинов, предпочтительно секретирующие как IFN-γ, так и TNF-α, в популяции антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ, TNF-α и/или IL-2. В одном из воплощений указанную долю двойных продуцирующих антиген-специфических CD4+ Т-клеток, секретирующих как IFN-γ, так и TNF-α, определяют с помощью полихроматической проточной цитометрии. Пример такого определения раскрыт в примере 1 настоящего документа (см. главу 'Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов'). В одном из воплощений антиген представляет собой любой из описанных в данной заявке антигенов.

В одном из воплощений изобретение относится к иммуностимулирующему олигонуклеотиду по изобретению, для применения в качестве адъюванта в вакцине, где указанная вакцина индуцирует иммунный ответ против антигена и где по меньшей мере 30%, предпочтительно по меньшей мере 40%, еще более предпочтительно по меньшей мере 45%, еще более предпочтительно примерно 47% индуцированных антиген-специфических CD8+ Т-клеток представляют собой двойные продуценты цитокинов, предпочтительно секретирующие как IFN-γ, так и TNF-α, в популяции антиген-специфических CD8+ Т-клеток, секретирующих IFN-γ, TNF-α и/или IL-2. В одном из воплощений указанную долю двойных продуцентов антиген-специфических CD8+ Т-клеток, секретирующих как IFN-γ, так и TNF-α, определяют с помощью полихроматической проточной цитометрии. Пример такого определения раскрыт в примере 1 настоящего документа (см. главу 'Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов'). В одном из воплощений антиген представляет собой любой из описанных в данной заявке антигенов.

В одном из воплощений изобретение относится к вакцине, содержащей антиген и иммуностимулирующий олигонуклеотид по изобретению, для применения в индукции иммунного ответа на указанный антиген, где по меньшей мере 40%, предпочтительно по меньшей мере 45%, еще более предпочтительно по меньшей мере 50%, еще более предпочтительно примерно 53% индуцированных антиген-специфических CD4+ Т-клеток секретируют IFN-γ в популяции антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ, TNF-α и/или IL-2. В одном из воплощений указанную долю антиген-специфических CD4+Т-клеток, секретирующих IFN-γ, определяют с помощью полихроматической проточной цитометрии. Пример такого определения раскрыт в примере 1 настоящего документа (см. главу "Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов'). В одном из воплощений антиген представляет собой любой из описанных в данной заявке антигенов.

В одном из воплощений изобретение относится к вакцине, содержащей антиген и иммуностимулирующий олигонуклеотид по изобретению, для применения в индукции иммунного ответа на указанный антиген, где по меньшей мере 10%, предпочтительно по меньшей мере 15%, еще более предпочтительно по меньшей мере 20%, еще более предпочтительно примерно 22% индуцированных антиген-специфических CD4+ Т-клеток представляют собой двойные продуценты цитокинов, предпочтительно секретирующие как IFN-γ, так и TNF-α, в популяции антиген-специфических CD4+ Т-клеток, секретирующих IFN-γ, TNF-α и/или IL-2. В одном из воплощений указанную долю антиген-специфических CD4+ Т-клеток, секретирующих как IFN-γ, так и TNF-α, определяют с помощью полихроматической проточной цитометрии. Пример такого определения раскрыт в примере 1 настоящего документа (см. главу 'Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов'). В одном из воплощений антиген представляет собой любой из описанных в данной заявке антигенов.

В одном из воплощений изобретение относится к вакцине, содержащей антиген и иммуностимулирующий олигонуклеотид по изобретению, для применения в индукции иммунного ответа на указанный антиген, где по меньшей мере 30%, предпочтительно по меньшей мере 40%, еще более предпочтительно по меньшей мере 45%, еще более предпочтительно примерно 47% индуцированных антиген-специфических CD8+ Т-клеток представляют собой двойные продуценты цитокинов, предпочтительно секретирующие как IFN-γ, так и TNF-α, в популяции антиген-специфических CD8+ Т-клеток, секретирующих IFN-γ, TNF-α и/или IL-2. В одном из воплощений указанную долю антиген-специфических CD8+ Т-клеток, секретирующих как IFN-γ, так и TNF-α, определяют с помощью полихроматической проточной цитометрии. Пример такого определения раскрыт в примере 1 настоящего документа (см. главу 'Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов'). В одном из воплощений антиген представляет собой любой из описанных в данной заявке антигенов.

Термин "эффективное количество" молекулы нуклеиновой кислоты относится к количеству, необходимому или достаточному для реализации желаемого биологического эффекта. Например, эффективное количество нуклеиновой кислоты, содержащей по меньшей мере один неметилированный CpG, для лечения расстройства может представлять собой такое количество, которое необходимо для устранения микробной инфекции или опухоли. Эффективное количество для применения в качестве адъюванта вакцины может представлять собой такое количество, которое полезно для индукции у субъектов иммунного ответа на вакцину. "Эффективное количество" для лечения инфекционного заболевания, расстройства, ассоциированного с аутоантигеном, или расстройства, ассоциированного с веществом, вызывающим привыкание, может представлять собой такое количество, которое полезно для индукции антиген-специфического иммунного ответа. Эффективное количество для любого конкретного применения может варьировать в зависимости от таких факторов, как заболевание или состояние, которое лечат, конкретного вводимого CpG иммуностимулирующего олигонуклеотида, размера субъекта или тяжести заболевания или состояния. Средний специалист в данной области техники может опытным путем определить эффективное количество конкретного олигонуклеотида без излишнего экспериментирования.

В аспектах изобретения вакцина может дополнительно включать адъювант. В некоторых воплощениях адъювант представляет собой агонист Toll-подобного рецептора (TLR), который не является TLR9. Агонист TLR в некоторых воплощениях представляет собой агонист TLR3 (например, стабилизированную poly I:C), TLR4 (например, производное липополисахарида (LPS), например MPL (3-О-деацил-4'-монофосфориллипид А) или GLA (гамма-линоленовая кислота)), TLR5 (например, флагеллин), TLR7 (например, небольшая молекула имидазохинолинового семейства) или TLR8 (например, небольшая молекула имидазохинолинового семейства). В некоторых воплощениях адъювант представляет собой соль алюминия, например гидрат окиси алюминия, иммуностимулирующий комплекс (ISCOM), эмульсию масло-в-воде или вода-в-масле, липосому или систему доставки, например наночастицу или микрочастицу.

Термин эффективное количество CpG иммуностимулирующего олигонуклеотида относится к количеству, необходимому или достаточному для реализации желаемого биологического действия. Например, количество CpG иммуностимулирующего олигонуклеотида, вводимое с антигеном, эффективное для индукции антиген-специфического иммунного ответа, представляет собой количество, необходимое для индукции иммунного ответа на антиген после воздействия указанного антигена. В комбинации с предложенной в данной заявке идеей, путем выбора из различных активных иммуностимулирующих олигонуклеотидов и весовых факторов, таких как сила, относительная биодоступность, масса тела пациента, тяжесть неблагоприятных побочных эффектов и предпочтительный способ введения, можно планировать эффективную профилактическую или терапевтическую схему лечения, которая не приводила бы к существенной токсичности и была бы эффективна для лечения конкретного субъекта. Эффективное количество для любого конкретного применения может варьировать в зависимости от таких факторов, как заболевание или состояние, которое лечат, конкретного CpG иммуностимулирующего олигонуклеотида, который вводят, размера субъекта или тяжести заболевания или состояния. Специалист в данной области техники может опытным путем определить эффективное количество конкретного CpG иммуностимулирующего олигонуклеотида и/или антигена, и/или другого терапевтического агента без необходимости чрезмерного экспериментирования в свете данного описания.

Дозы описанных в данной заявке соединений для местного введения субъекту, как правило, варьируются от примерно 0,1 мкг до 50 мг на введение, которое, в зависимости от применения, можно осуществлять ежесуточно, еженедельно или ежемесячно, и с любым другим интервалом времени между ними. Как правило, локальные дозы варьируются от примерно 10 мкг до 10 мг на введение, и возможно от примерно 100 мкг до 1 мг, с 2-4 ведениями, интервалы времени между которыми составляют сутки или недели. Как правило, иммуностимулирующие дозы варьируются от 1 мкг до 10 мг на введение, и наиболее типично от 10 мкг до 1 мг для ежесуточных или еженедельных введений. Дозы описанных в данной заявке соединений для парентеральной доставки с целью индукции антиген-специфического иммунного ответа, где соединения доставляются с антигеном, а не с другим терапевтическим агентом, обычно в 5-10000 раз выше, чем эффективная локальная доза для применений вакцинного адъюванта или иммуностимулятора, и более конкретно в 10-1000 раз выше, и наиболее конкретно в 20-100 раз выше. Дозы описанных в данной заявке соединений для парентеральной доставки, например, для индукции врожденного иммунного ответа, для увеличения ADCC, для индукции антиген-специфического иммунного ответа, когда CpG иммуностимулирующие олигонуклеотиды вводят в комбинации с другими терапевтическими агентами или в специализированных носителях для доставки, типично варьируются от примерно 0,1 мкг до 10 мг на введение, которое, в зависимости от применения, может быть осуществлено ежесуточно, еженедельно или ежемесячно, и с любым другим интервалом времени между ними. Как правило, парентеральные дозы для этих целей варьируются от примерно 10 мкг до 5 мг на введение, и, как правило, от примерно 100 мкг до 1 мг, с 2-4 введениями, разделенными по времени друг от друга сутками или неделями. Однако в некоторых воплощениях парентеральные дозы для этих целей могут быть использованы в диапазоне 5-10000 раз выше, чем типичные дозы, описанные в данной заявке.

Для любого из описанных в данной заявке соединений терапевтически эффективное количество исходно может быть определено на животных моделях. Терапевтически эффективная доза также может быть определена на основании клинических данных для CpG-олигонуклеотидов, которые тестировали на людях (например, были начаты клинические испытания на людях) и для соединений, которые, как известно, демонстрируют близкие фармакологические активности, таких как другие адъюванты, например LT, и другие антигены для целей вакцинации. Более высокие дозы могут потребоваться для парентерального введения. Применяемая доза может быть скорректирована на основании относительной биодоступности и активности вводимого соединения. Корректировка дозы для достижения максимальной эффективности на основании описанных выше способов и других способов, которые хорошо известны в данной области техники, находится в пределах знаний среднего специалиста в данной области техники.

Препараты по изобретению вводят в фармацевтически приемлемых растворах, которые стандартно могут содержать фармацевтически приемлемые концентрации соли, буферных агентов, консервантов, совместимых носителей, адъювантов и возможно других терапевтических ингредиентов.

Для применения в терапии эффективное количество CpG иммуностимулирующего олигонуклеотида может быть введено субъекту любым способом, доставляющим олигонуклеотид к желаемой поверхности. Введение фармацевтической композиции по настоящему изобретению можно осуществлять любыми способами, известными специалистам в данной области. Предпочтительные пути введения включают, но не ограничиваются этим, парентеральный (например, внутримышечный, подкожный, интрадермальный, внутривенный, внутрипузырный или интраперитонеальный), местный (например, кожный (трансдермальный), мукозальный), пероральный, интраназальный, интравагинальный, интраректальный, трансбуккальный, внутриглазной или подъязычный.

Иммуностимулирующие олигонуклеотиды, либо отдельно, либо в сочетании с другими терапевтическими агентами, могут быть введены с помощью любого из описанных в данной заявке путей. В некоторых предпочтительных воплощениях введение является локальным. Локальное введение может включать местное нанесение на слизистые поверхности, например кожу, такую как кожа рта и половых органов.

Иммуностимулирующие олигонуклеотиды, если желательно доставлять их системно, могут быть приготовлены для парентерального введения посредством инъекции, например болюсной инъекции или непрерывной инфузии. Препараты для инъекции могут быть представлены в стандартной лекарственной форме, например в ампулах или многодозовых контейнерах с добавлением консерванта. Композиции могут принимать такие формы, как суспензии, растворы или эмульсии в масляных или водных разбавителях, и могут содержать агенты, используемые для приготовления препаратов, такие как суспендирующие агенты, стабилизаторы и/или разрыхлители.

Фармацевтические композиции для парентерального введения включают водные растворы иммуностимулирующих олигонуклеотидов в водорастворимой форме. Дополнительно, суспензии иммуностимулирующих олигонуклеотидов могут быть приготовлены в виде подходящих масляных суспензий для инъекций. Подходящие липофильные растворители или разбавители включают жирные масла, такие как кунжутное масло, или синтетические сложные эфиры жирных кислот, такие как этилолеат или триглицериды, или липосомы. Водные суспензии для инъекции могут содержать вещества, которые увеличивают вязкость суспензии, такие как натрий-карбоксиметилцеллюлозу, сорбит или декстран. Возможно, суспензия также может содержать подходящие стабилизаторы или агенты, которые увеличивают растворимость иммуностимулирующих олигонуклеотидов для обеспечения приготовления высококонцентрированных растворов.

Иммуностимулирующие олигонуклеотиды, если желательно доставлять их системно, могут быть приготовлены для парентерального введения посредством инъекции, например болюсной инъекции или непрерывной инфузии. Препараты для инъекции могут быть представлены в стандартной лекарственной форме, например в ампулах или многодозовых контейнерах с добавлением консерванта. Композиции могут принимать такие формы, как суспензии, растворы или эмульсии в масляных или водных разбавителях, и могут содержать агенты, используемые для приготовления препаратов, такие как суспендирующие агенты, стабилизаторы и/или разрыхлители.

Можно разбавить или увеличить объем терапевтического средства с помощью инертного материала. Эти разбавители могут включать углеводы, в частности маннит, α-лактозу, безводную лактозу, целлюлозу, сахарозу, модифицированные декстраны и/или крахмал. Некоторые неорганические соли также могут быть использованы в качестве наполнителей, включающих трифосфат кальция, карбонат магния и/или хлорид натрия. Некоторые имеющиеся в продаже разбавители представляют собой Fast-Flo, Emdex, STA-Rx 1500, Emcompress и Avicell.

Для облегчения растворения терапевтического средства в водной среде поверхностно-активное вещество может быть добавлено в качестве увлажняющего агента. Поверхностно-активные вещества могут включать анионные детергенты, такие как лаурилсульфат натрия, диоктилнатрий сульфосукцинат и/или диоктилнатрий сульфонат. Могут быть использованы катионные детергенты, и они включают бензалкония хлорид или бензэтония хлорид. Перечень возможных неионных детергентов, которые могут быть включены в композицию в качестве поверхностно-активных веществ, включает лауромакрогол 400, полиоксил 40 стеарат, полиоксиэтилен гидрогенизированное касторовое масло 10, 50 и/или 60, глицеролмоностеарат, полисорбат 40, 60, 65 и/или 80, сложный эфир сахарозы и жирной кислоты, метилцеллюлозу и карбоксиметилцеллюлозу. Эти поверхностно-активные вещества могут быть представлены в препарате иммуностимулирующих олигонуклеотидов либо сами по себе, либо в виде смеси в различных отношениях.

Фармацевтические препараты для парентерального введения включают водные растворы иммуностимулирующих олигонуклеотидов в водорастворимой форме. Дополнительно, суспензии иммуностимулирующих олигонуклеотидов могут быть приготовлены в виде подходящих масляных суспензий для инъекции. Подходящие липофильные растворители или разбавители включают жирные масла, такие как кунжутное масло, или синтетические сложные эфиры жирных кислот, такие как этилолеат или триглицериды, или липосомы. Водные суспензии для инъекции могут содержать вещества, которые увеличивают вязкость суспензии, такие как натрий-карбоксиметилцеллюлозу, сорбит или декстран. Возможно, суспензия также может содержать подходящие стабилизаторы или агенты, которые увеличивают растворимость иммуностимулирующих олигонуклеотидов для обеспечения приготовления высококонцентрированных растворов.

Альтернативно, иммуностимулирующие олигонуклеотиды могут находиться в порошковой форме для разведения подходящим разбавителем, например стерильной апирогенной водой, перед использованием.

Для перорального введения соединения (т.е. CpG иммуностимулирующие олигонуклеотиды, антигены и другие терапевтические агенты) могут быть легко приготовлены путем объединения иммуностимулирующих олигонуклеотидов с фармацевтически приемлемыми носителями, хорошо известными в данной области техники. Такие носители обеспечивают возможность приготовления иммуностимулирующих олигонуклеотидов по изобретению в виде таблеток, пилюль, драже, капсул, жидкостей, гелей, сиропов, взвесей, суспензий и т.п. для перорального приема субъектом, которого лечат. Фармацевтические препараты для перорального применения могут быть получены в виде твердого эксципиента, возможно путем измельчения полученной смеси и обработки смеси гранул после добавления подходящих вспомогательных агентов, при желании, с получением таблеток или сердцевин драже. Подходящие эксципиенты представляют собой, в частности, наполнители, такие как сахара, включая лактозу, сахарозу, маннит или сорбит; препараты целлюлозы, такие как, например, кукурузный крахмал, пшеничный крахмал, рисовый крахмал, картофельный крахмал, желатин, трагакантовую камедь, метилцеллюлозу, гидроксипропилметилцеллюлозу, натрий-карбоксиметилцеллюлозу и/или поливинилпирролидон (PVP). При желании, могут быть добавлены разрыхлители, такие как сшитый поливинилпирролидон, агар или альгиновая кислота, или их соль, такие как альгинат натрия. Возможно, пероральные препараты также могут быть приготовлены в физиологическом растворе или буферах, т.е. EDTA (этилендиаминтетрауксусная кислота) для нейтрализации внутренних кислотных условий, или могут быть введены без каких-либо носителей.

Также рассматриваются пероральные лекарственные формы вышеуказанных агентов или препаратов. Агенты или препараты могут быть химически модифицированы таким образом, что пероральная доставка производного является эффективной. Как правило, рассматриваемая химическая модификация представляет собой присоединение по меньшей мере одной группировки к самому агенту или препарату, где указанная группировка обеспечивает (а) ингибирование протеолиза; и (б) захват в кровоток из желудка или кишечника. Также желательно увеличение общей стабильности агента или препарата и увеличение времени циркуляции в организме. Примеры таких группировок включают: полиэтиленгликоль, сополимеры этиленгликоля и пропиленгликоля, карбоксиметилцеллюлозу, декстран, поливиниловый спирт, поливинилпирролидон и полипролин. Abuchowski and Davis, 1981, "Soluble Polymer-Enzyme Adducts" In: Enzymes as Drugs, Hocenberg and Roberts, eds., Wiley-lnterscience, New York, N.Y., pp.367-383; Newmark, et al., 1982, J. Appl. Biochem. 4:185-189. Другие полимеры, которые могут быть использованы, представляют собой поли-1,3-диоксолан и поли-1,3,6-тиоксолан. Для фармацевтического применения, как указано выше, предпочтительны полиэтиленгликолевые группировки.

Также рассматривается интраназальная доставка фармацевтической композиции по настоящему изобретению. Интраназальная доставка обеспечивает проникновение фармацевтической композиции по настоящему изобретению в систему кровообращения непосредственно после введения терапевтического продукта в нос без необходимости осаждения продукта в легком. Препараты для интраназальной доставки включают препараты с декстраном или циклодекстраном.

Для интраназального введения полезным устройством является небольшой твердый флакон, к которому присоединен распылитель отмеренных доз. В одном из воплощений отмеренную дозу доставляют путем помещения раствора фармацевтической композиции по настоящему изобретению в камеру определенного объема, которая имеет щель с размером, подходящим для распыления аэрозольного препарата путем образования спрея, когда жидкость в камере сжимают. Камеру сжимают для введения фармацевтической композиции по настоящему изобретению. В конкретном воплощении камера представляет собой устройство с поршнем. Такие устройства имеются в продаже.

Альтернативно, пластиковый сжимаемый флакон с щелью или отверстием, имеющим размер, подходящий для распыления аэрозольного препарата путем образования спрея при сжатии флакона. Отверстие обычно находится в верхней части флакона, и верхняя часть обычно сужена для частичного прохождения в носовые пути для эффективного введения аэрозольной композиции. Предпочтительно, интраназальный ингалятор будет обеспечивать отмеренное количество аэрозольного препарата для введения отмеренной дозы лекарственного средства.

Для трансбуккального введения композиции могут принимать форму таблеток или лепешек, приготовленных традиционным образом.

Соединения могут быть приготовлены также в композициях для ректального или вагинального введения, таких как суппозитории или удерживающие клизмы, например, содержащие традиционные основы для суппозитория, такие как масло какао или другие глицериды.

В дополнение к описанным выше композициям соединения также могут быть приготовлены в виде депо-препарата. Такие композиции длительного действия могут быть приготовлены с подходящими полимерными или гидрофобными веществами (например, в виде эмульсии в подходящем масле) или ионообменными смолами, или в виде труднорастворимых производных, например труднорастворимой соли.

Фармацевтические композиции также могут содержать подходящие твердофазные или гель-фазные носители или эксципиенты. Примеры таких носителей или эксципиентов включают, но не ограничиваются этим, карбонат кальция, фосфат кальция, различные сахара, крахмалы, производные целлюлозы, желатин и полимеры, такие как полиэтиленгликоли.

Подходящие жидкие или твердые формы фармацевтических препаратов представляют собой, например, водные или солевые растворы для ингаляции, микроинкапсулированы, находятся в составе кохлеатов, наносятся на микроскопические частицы золота, содержатся в липосомах, распыляются, представляют собой аэрозоли, лепешки для имплантации в кожу, или высушены на остром предмете для процарапывания в кожу. Фармацевтические композиции также включают гранулы, порошки, таблетки, покрытые таблетки (микро)капсулы, суппозитории, сиропы, эмульсии, суспензии, кремы, капли или препараты с длительным высвобождением активных соединений, в которых обычно используют эксципиенты и добавки и/или вспомогательные вещества, такие как разрыхлители, связующие, покрывающие агенты, набухающие агенты, смазывающие вещества, корригенты, подсластители или солюбилизаторы, как описано выше. Фармацевтические композиции пригодны для применения во многих системах для доставки лекарственных средств. Краткий обзор способов доставки лекарственных средств см. в Langer, Science 249:1527-1533, 1990.

CpG иммуностимулирующие олигонуклеотиды и, возможно, другие лекарственные средства и/или антигены можно вводить сами по себе (чистые) или в форме фармацевтически приемлемой соли. При применении в медицине соли должны быть фармацевтически приемлемыми, а фармацевтически неприемлемые соли могут быть соответственно использованы для получения их фармацевтически приемлемых солей. Такие соли включают, но не ограничиваются этим, соли, полученные из следующих кислот: соляной, бромистоводородной, серной, азотной, фосфорной, малеиновой, уксусной, салициловой, пара-толуолсульфоновой, винной, лимонной, метансульфоновой, муравьиной, малоновой, янтарной, нафталин-2-сульфоновой и бензолсульфоновой. Такие соли также могут быть получены в виде солей щелочных или щелочноземельных металлов, таких как натриевые, калиевые или кальциевые соли карбоновокислотной группы.

Пригодные буферные агенты включают: уксусную кислоту и соль (1-2% мас./об.); лимонную кислоту и соль (1-3% мас./об.); борную кислоту и соль (0,5-2,5% мас./об.) и ортофосфорную кислоту и соль (0,8-2% мас./об.). Пригодные консерванты включают бензалкония хлорид (0,003-0,03% мас./об.); хлорбутанол (0,3-0,9% мас./об.); парабены (0,01-0,25% мас./об.) и тимеросал (0,004-0,02% мас./об.).

Фармацевтические композиции по изобретению содержат эффективное количество CpG иммуностимулирующего олигонуклеотида и, возможно, антигены и/или другие терапевтические агенты, возможно включенные в фармацевтически приемлемый носитель. Термин фармацевтически приемлемый носитель означает один или более совместимых твердых или жидких наполнителей, разбавителей или инкапсулирующих веществ, которые пригодны для введения человеку или другому позвоночному животному. Термин "носитель" означает органический или неорганический ингредиент, природный или синтетический, с которым объединяют активный ингредиент для облегчения применения. Компоненты фармацевтических композиций также способны смешиваться с соединениями по настоящему изобретению и друг с другом таким образом, что не возникает взаимодействия, которое в значительной степени нарушало бы желаемую фармацевтическую эффективность.

Настоящее изобретение далее проиллюстрировано следующими примерами, которые никоим образом не следует рассматривать как ограничивающие объем изобретения. Полное содержание всех ссылок (включая литературные ссылки, опубликованные патенты, опубликованные патентные заявки и находящиеся на одновременном рассмотрении патентные заявки), процитированных в данной заявке, специально включено в данное описание посредством ссылки во всей их полноте.

ПРИМЕРЫ

Пример 1:

Иммуностимулирующий олигонуклеотид CPG 24555 сравнивали с олигонуклеотидами CPG 10103 и CPG 7909 в отношении их способности увеличивать антиген-специфические иммунные ответы у мышей после внутримышечной (в/м) иммунизации с использованием поверхностного антигена гепатита В (HBsAg) или овальбумина (OVA) в качестве модельных антигенов.

Способы и материалы

Все ODN получали из лиофилизированного олигодезоксинуклеотида (ODN). Кратко, ODN растворяли в не содержащем эндотоксин буфере Трис-EDTA при рН 8,0 (OmniPur®; ЕМ Science, Gibbstown, NJ) и разбавляли в стерильном, не содержащем эндотоксин физиологическом растворе, забуференном фосфатами (PBS), при рН 7,2 (Sigma Chemical Company, St. Louis, МО) в асептических условиях для предупреждения как микробной, так и эндотоксиновой контаминации. Концентрированные растворы хранили при 4°С до применения.

Самок мышей BALB/c и С57 BI/6 дикого типа приобретали в Charles River Canada (Quebec, Canada). Дефектных по TLR9 мышей с фоном С57 выводили в Taconic Farms и переносили в Coley Animal Care Facility для исследований. Мышей содержали в микроизоляторных клетках в Animal Care Facility в Coley Pharmaceutical Group Canada. Все исследования проводили в соответствии с Animal Care Committee (Комитет по уходу за животными) Coley Canada согласно рекомендациям Association for assessment and accreditation of laboratory animal care (Ассоциация по оценке и сертификации ухода за лабораторными животными) (AAALAC International) и Canadian Council on Animal Care (Канадский совет по уходу за животными). Животные имели массу примерно 18-20 г в начале исследования.

Иммунизация мышей

Поверхностный антиген гепатита В (HBsAg)

Мышей BALB/c (n=10/группу) иммунизировали внутримышечно (в/м) в левую переднюю большеберцовую мышцу 1 мкг HBsAg; подтип ad (Cliniqa, 4076), отдельно или в комбинации с 10 мкг CPG 24555, CPG 10103 или CPG 7909 в общем объеме 50 мкл. Через 2 недели после примирующей иммунизации у животных брали кровь из подчелюстной вены с использованием гепарина в качестве антикоагулянта и подвергали бустерной иммунизации с использованием такого же вакцинного препарата, как использовали для первичной иммунизации. Через 2 недели после бустерной иммунизации у животных брали кровь посредством пункции в сердце с использованием гепарина в качестве антикоагулянта, умерщвляли посредством цервикальной дислокации, и селезенки асептически извлекали для применения в иммунном анализе для обнаружения антиген-специфической активности CTL, секреции IFN-γ (культуральные супернатанты) и секретирующих множество цитокинов (IFN-γ, TNF-α и IL-2) CD4 Т-клеток по сравнению с CD8 Т-клетками. Плазму для каждого момента забора крови использовали для обнаружения антиген-специфических общих IgG и изотипов IgG, IgG1 и IgG2a.

Куриный овальбумин (OVA)

Мышей C57BI/6 дикого типа и дефектных по TLR9 (C57BI/6 TLR9-/-) (n=10/группу) иммунизировали внутримышечно (в/м) в левую переднюю большеберцовую мышцу 20 мкг OVA фракция VII (Sigma, A7641) отдельно или в комбинации с 10 мкг CPG 24555, CPG 10103, CPG 7909 или не-CpG контрольным ODN 2137 в общем объеме 50 мкл. Животных подвергали бустерной иммунизации с использованием такой же композиции вакцины, как использовали для первичной иммунизации на 14-е и 21-е сутки после первичной иммунизации. На 7-е сутки после последней бустерной иммунизации у животных брали кровь посредством пункции в сердце с использованием гепарина в качестве антикоагулянта, умерщвляли посредством цервикальной дислокации, и селезенки асептически извлекали для применения в иммунном анализе для обнаружения антиген-специфической активности CTL, секреции IFN-γ (культуральные супернатанты), тетрамер-положительных CD8 Т-клеток и секретирующих множество цитокинов (IFN-γ, TNF-α и IL-2) CD4 Т-клеток по сравнению с CD8 Т-клетками. Плазму использовали для обнаружения антиген-специфических общих IgG и изотипов IgG, IgG1 и IgG2c.

Иммунные анализы

Определение антиген-специфических титров антител

Антитела (общие IgG, IgG1 и IgG2a/c), специфические в отношении HBsAg (анти-HBs) или овальбумина (анти-OVA) обнаруживали и количественно определяли с помощью ELISA-анализа с разведением в конечной точке, который осуществляли в трех параллелях на образцах от отдельных животных. Титры в конечной точке определяли как наибольшее разведение плазмы, которое приводило к значению абсорбции (OD 450 нм), вдвое большему, чем значение для неиммунизированной плазмы с величиной отсечения 0,05. Их представляли в виде группы средних геометрических титров (GMT)±SEM.

Оценка ответов CTL

Селезенки, извлеченные через 1 неделю (для OVA) или 2 недели (для HBsAg) после последней иммунизации, использовали для анализа ответов антиген-специфических цитотоксических Т-лимфоцитов (CTL). Селезенки гомогенизировали до одноклеточной суспензии в среде RPMI 1640 для культур тканей (Hyclone, Logan, UT), дополненной 10% фетальной бычьей сыворотки (Hyclone, Logan, UT), раствором пенициллина-стрептомицина (конечная концентрация 1000 Е/мл и 1 мг/мл соответственно; Invitrogen, Burlington, ON), L-глутамином (конечная концентрация 2 мМ; Invitrogen, Burlington, ON) и 5×10-5 М β-меркаптоэтанола (Invitrogen, Burlington, ON). HBsAg-специфические лимфоциты в суспензиях спленоцитов (3×106 клеток/мл) повторно стимулировали в течение 5 суток путем инкубации с облученной мышиной клеточной линией (P815/S), экспрессирующей HBsAg, и OVA-специфические лимфоциты в суспензиях спленоцитов (3×106 клеток/мл) повторно стимулировали в течение 5 суток путем инкубации с облученной мышиной клеточной линией (EG.7), экспрессирующей OVA. После повторной стимуляции способность лимфоцитов уничтожать клетки, экспрессирующие HBsAg или OVA, определяли с использованием анализа высвобождения 51Cr. Результаты представлены в виде % специфического лизиса при различных соотношениях эффектора и мишени (Е:Т).

Оценка антиген-специфической секреции IFN-γ спленоцитами

Спленоциты через 1 неделю (для OVA) или 2 недели (для HBsAg) после последней иммунизации использовали для измерения секреции IFN-γ после антигенной рестимуляции. Кратко, суспензии клеток селезенки получали, как для анализа CTL, и доводили до конечной концентрации 5×106 клеток в мл в среде RPMI 1640 для культур тканей (Hyclone, Logan, UT), дополненной 2% нормальной мышиной сыворотки (Cedarlane Laboratories, Ontario, Canada), раствором пенициллина-стрептомицина (конечная концентрация 1000 Е/мл и 1 мг/мл соответственно; Invitrogen, Burlington, ON), L-глутамином (конечная концентрация 2 мМ; Invitrogen, Burlington, ON) и 5×10-5 М β-меркаптоэтанола (Invitrogen, Burlington, ON) [полная RPMI 1640]. Суспензию спленоцитов высевали в 96-луночные планшеты с U-образным дном для культур тканей (100 мкл/лунку) вместе с 100 мкл каждого стимулятора (как описано в соответствующих подписях к чертежам), разбавленного до соответствующих концентраций в полной среде RPMI 1640. Конканавалин А (10 мкг/мл, Sigma) использовали в качестве положительного контроля, и клетки, культивируемые только со средами, использовали в качестве отрицательных контролей. Каждый образец спленоцитов высевали в трех параллелях и клетки инкубировали в увлажненном 5% CO2-инкубаторе при 37°С в течение 72 ч. Культуральные супернатанты собирали в конце периода инкубации и хранили при -80°С до проведения анализа. Имеющиеся в продаже наборы для анализов (мышиный IFN-γ OptEIA; BD Pharmingen, Mississauga, ON) использовали в соответствии с инструкциями производителя для анализа уровней IFN-γ в культуральных супернатантах.

Количественная оценка OVA тетрамер-положительной популяции CD8

Суспензию спленоцитов, полученную как описано выше, также использовали для количественной оценки OVA тетрамер-положительных популяций CD8 с помощью FACS (клеточный сортер с активацией флуоресценции). Спленоциты (2×106) из индивидуальных образцов селезенки переносили в тест-пробирки 12×75 мм, содержащие 500 мкл буфера для окрашивания: DPBS (фосфатно-солевой буфер Дульбекко), содержащий 1% фетальной телячьей сыворотки (Hyclone, Logan, UT) и 0,1% азида натрия (Sigma). Клетки центрифугировали при 1200 об/мин в течение 5 минут, и супернатант удаляли. Fc-рецепторы блокировали путем инкубации клеток при 4°С в течение 10 минут с антимышиными CD16/CD32 (Fc-блок) (BD Pharmingen). Клетки промывали буфером для окрашивания и окрашивали в течение 20 минут при 4°С с использованием OVA-специфического (SIINFEKL) тетрамера класса 1 (Beckman Coulter). Клетки затем снова промывали буфером для окрашивания и окрашивали в течение 20 минут при 4°С с антимышиными CD8a-FITC (фенилизотиоцианат) (BD Pharmingen). Клетки промывали буфером для окрашивания, ресуспендировали в 500 мкл буфера для окрашивания и анализировали с использованием проточного цитометра FC500 (Beckman coulter). OVA-специфические CD8 Т-клетки идентифицировали как клетки, которые были положительны в отношении CD8a, а также тетрамера. Данные выражены в виде % CD8 и тетрамер-положительных клеток.

Количественная оценка антиген-специфических популяций Т-клеток, секретирующих множество цитокинов

Объединенные суспензии спленоцитов для каждой группы повторно стимулировали в 24-луночных тканевых культуральных планшетах в среде RPMI 1640 для культур тканей (Hyclone, Logan, UT), дополненной 2% нормальной мышиной сыворотки (Cedarlane Laboratories, Ontario, Canada), раствором пенициллина-стрептомицина (конечная концентрация 1000 Е/мл и 1 мг/мл, соответственно; Invitrogen, Burlington, ON), L-глутамином (конечная концентрация 2 мМ; Invitrogen, Burlington, ON) и 5×10-5 M (3-меркаптоэтанола (Invitrogen, Burlington, ON).

Для повторной стимуляции CD4: 5×106 клеток стимулировали в течение ночи в конечном объеме 1 мл, содержащем 5 мкг/мл HBsAg.

Для повторной стимуляции CD8 5×106 клеток стимулировали в течение 5 часов в конечном объеме 1 мл, содержащем 5 мкг/мл пептида HBs (IPQSLDSWWTSL).

Среды без стимуляторов использовали в качестве отрицательного контроля, тогда как 10 нг/мл РМА (Sigma) и 1 мкг/мл иономицина (Sigma) [добавленного в течение последних 4 часов инкубации] использовали в качестве положительных контролей. Дополнительно, в течение последних 4 часов повторной стимуляции Brefelden A (BD Pharmingen) и монензин (BD Pharmingen) добавляли для остановки белкового транспорта.

После повторной стимуляции клетки промывали буфером для окрашивания и Fc-рецепторы блокировали путем инкубации клеток при 4°С в течение 10 минут с антимышиными CD16/CD32 (Fc-блок) (BD Pharmingen). Клетки затем центрифугировали и ресуспендировали в буфере для окрашивания, содержащем 5 мкг/мл либо антимышиного CD4-ECD (Invitrogen), либо антимышиного CD8-ECD (Invitrogen), и инкубировали в течение 30 минут при 4°С. Клетки промывали буфером для окрашивания и ресуспендировали в растворе BD Fix/Perm (BD Pharmingen) в течение 20 минут при 4°С. Клетки снова промывали раствором BD Perm Wash (BD Pharmingen) и ресуспендировали в 1х растворе BD Perm Wash (BD Pharmingen), содержащем 5 мкг/мл каждого из IL-2-FITC (BD Pharmingen), TNF-APC (BD Pharmingen) и IFN-y-PeCy7 (BD Pharmingen), и инкубировали в течение 20 минут при комнатной температуре с защитой от света. Клетки промывали 1х раствором BD Perm Wash (BD Pharmingen) и ресуспендировали в нормальном буфере для окрашивания и анализировали с использованием проточного цитометра FC500 (Beckman Coulter).

Результаты

Гуморальные иммунные ответы

Все три протестированных CpG ODN (CPG 24555, 10103 и 7909) значительно увеличивали HBsAg и OVA-специфические общие титры IgG у мышей дикого типа (Р<0,05). Не было значительных различий между тремя CpG ODN с точки зрения их способности увеличивать HBsAg или OVA-специфические общие IgG у мышей (Фиг.1).

Способность CPG 24555, CPG 10103 и CPG 7909 увеличивать антительные титры у дефектных по TLR9 животных тестировали с использованием OVA. Общие антительные титры, обнаруженные через 1 неделю после бустерной иммунизации при любой из схем вакцинации, составляли менее 100, и ни один из CpG ODN не был способен значительно увеличивать антительные титры против OVA по сравнению с тем, когда вакцину использовали отдельно или в комбинации с не-CpG ODN 2137 (данные не представлены).

У мышей распределение изотипа IgG широко используют в качестве показателя природы иммунного ответа, когда высокие уровни IgG2a или IgG2c являются показателями Тh1 -опосредованного иммунного ответа, в то время как высокие титры IgG1 являются показателями Тh2-опосредованного иммунного ответа. Все три CpG ODN способствовали индукции сильных Тh1-опосредованных иммунных ответов с отношениями IgG2a/IgG1 и IgG2c/IgG1 более 1 (Фиг.1) и со значительно увеличенными титрами IgG2a/c по сравнению с титрами, когда используют только один антиген (Р<0,05) (Фиг.2).

Клеточные иммунные ответы: ответы CTL

Функциональный путь для измерения ответов на основе Тh1 заключаются в измерении активности CTL против антигенпредставляющих клеток-мишеней. Как видно на Фиг.3, все протестированные CpG ODN обладали способностью значительно увеличивать антиген-специфические ответы CTL против OVA у мышей по сравнению с ответами, когда антиген использовали один или в комбинации с не-CpG ODN 2137 (Р<0,05; Фиг.3 правая панель). Не было существенного различия между протестированными CpG ODN в отношении их способности стимулировать индукцию OVA-специфических CTL, за исключением соотношения 6,25:1 Е:Т, где обе группы CPG 24555 и CPG 7909 демонстрировали значительно более высокие OVA-специфические CTL по сравнению с группами, получающими CPG 10103.

Что касается HBsAg, как CPG 24555, так и 10103, но не CPG 7909 были способны индуцировать значительно более высокие антиген-специфические CTL ответы по сравнению с ответами, когда использовали только антиген. (Р<0,05; Фиг.3, левая панель). Не было существенного различия между CPG 24555 и CPG 10103 в отношении их способности стимулировать индукцию HBsAg-специфических CTL-ответов у мышей.

Опосредованное CpG ODN увеличение ответов CTL не было обнаружено у дефектных по TLR9 мышей (Фиг.4).

Антиген-специфические CDS Т-клетки

МНС класс I H-2Kb -SIINFEKL специфические тетрамеры использовали для количественной оценки CD8 Т-клеточных ответов у мышей, иммунизированных OVA. Все протестированные CpG ODN увеличивали антиген-специфические CD8 Т-клетки по сравнению с тем, когда OVA использовали отдельно или в комбинации с не-CpG контрольным ODN 2137 (Фиг.5). CPG 7909 превосходил CPG 24555 и 10103 в стимуляции индукции OVA-специфических CD8 Т-клеток (Р<0,05). Не было существенного различия между CPG 24555 и 10103 в отношении их способности индуцировать OVA-специфические CD8 Т-клетки (Р>0,05).

CPG-опосредованное увеличение OVA-специфических CD8 Т-клеток не было обнаружено у дефектных по TLR9 мышей (Фиг.5).

Антиген-специфическая секреция IFN-γ

Продукцию интерферона гамма (IFN-γ) в ответ на антигенную стимуляцию в качестве показателя клеточного иммунитета также исследовали путем обнаружения цитокина в культуральном супернатанте спленоцитов, повторно стимулированных вакцинным антигеном с использованием иммуноферментативного анализа. Культуральные супернатанты спленоцитов, собранные от животных, иммунизированных либо HBsAg, либо OVA с использованием CPG 24555 или CPG 10103, демонстрировали значительно более высокие уровни IFN-γ по сравнению с уровнями, достигаемыми при иммунизации одним антигеном. При использовании с HBsAg CPG 24555 был значительно лучше в стимуляции антиген-специфической секреции IFN-γ по сравнению с CPG 10103 или CPG 7909 (Фиг.6; левая панель). При использовании с OVA CPG 24555 был равен CPG 10103, но лучше, чем CPG 7909 в стимуляции антиген-специфической секреции IFN-γ (Фиг.6; правая панель).

Опосредованное CpG ODN увеличение антиген-специфической секреции IFN-γ не было обнаружено у животных, дефектных по TLR9 (Фиг.7).

Антиген-специфические популяции Т-клеток, секретирующих множество цитокинов

Согласно недавним открытиям продукция IFN-γ самими Т-клетками не является прогностической для способности антиген-специфических Т-клеток индуцировать защитный иммунный ответ. Таким образом, в этом исследовании авторы изобретения оценивали способность антиген-специфических CD4 и CD8 Т-клеток продуцировать IL-2, TNF-α и IFN-γ с использованием полихроматической проточной цитометрии.

Для CD4 и CD8 Т-клеток относительно низкий уровень секреции IL-2 обнаружен по сравнению с секрецией IFN-γ и TNF-α (Фиг.8). Что касается CD4 Т-клеток, CPG 24555 способствовал индукции более высокого процента Т-клеток, секретирующих два цитокина, по сравнению с CPG 10103 и 7909 (23% для CPG 24555 по сравнению с 4 и 6% для CPG 10103 и 7909, соответственно). В целом обнаружили очень низкий процент HBsAg-специфических CD4 Т-клеток, продуцирующих три цитокина (2, 0 и 1% для CPG 24555, 10103 и 7909, соответственно) (Фиг.8А).

Что касается CD8 Т-клеток, как CPG 24555, так и CPG 7909 способствовали индукции высокого уровня Т-клеток, секретирующих два цитокина, по сравнению с CPG 10103 (48 и 56% для CPG 24555 и CPG 7909, соответственно, тогда как только 19% для CPG 10103). Подобно CD4 клеткам, наблюдали очень низкий процент HBsAg-специфических CD8+ Т-клеток, продуцирующих три цитокина (1,0 и 0% для CPG 24555, 10103 и 7909, соответственно) (Фиг.8В).

Таблица 1
Процент HBsAg-специфических CD4+ Т-клеток, которые представляют собой продуценты одного, двух или трех цитокинов, секретирующие IFN-γ и/или IL-2, и/или TNF-α
CD4+Т-клетки только Ag Ag+CpG 24555 Ag+CpG 10103
IFN-γ* 69% 53% 36%
TNF-α* 41% 65% 62%
IL-2* 15% 9% 6%
IFN-γ/IL-2# 7% 2% 0%
IFN-γ/TNF-α# 10% 22% 2%
TNF-α/IL-2# 8% 5% 2%
IFN-γ/IL-2/TNF-α 0% 2% 0%
% продуцентов одного цитокина 75% 75% 96%
% продуцентов по меньшей мере двух цитокинов 25% 25% 4%
*указывает на общую долю клеток, продуцирующих эти цитокины, независимо от того, являются ли они продуцентами одного, двух или трех цитокинов
# указывает на общую долю клеток, продуцирующих эти два цитокина, независимо от того, являются ли они продуцентами двух или трех цитокинов
Таблица 2
Процент HBsAg-специфических CD8+ Т-клеток, представляющих собой продуценты одного, двух или трех цитокинов, секретирующие IFN-γ и/или IL-2, и/или TNF-α
CD8+Т-клетки только Ag Ag+CpG 24555 Ag+CpG 10103
IFN-γ* 63% 67% 76%
TNF-α* 42% 76% 37%
IL-2* 10% 7% 6%
IFN-γ/IL-2# 5% 2% 0%
IFN-γ/TNF-α# 10% 47% 18%
TNF-α/IL-2# 2% 2% 1%
IFN-γ/IL-2/TNF-α 2% 1% 0%
% продуцентов одного цитокина 87% 51% 81%
% продуцентов по меньшей мере двух цитокинов 13% 49% 19%
*указывает на общую долю клеток, продуцирующих эти цитокины, независимо от того, являются ли они продуцентами одного, двух или трех цитокинов
#указывает на общую долю клеток, продуцирующих эти два цитокина, независимо от того, являются ли они продуцентами двух или трех цитокинов

Обсуждение

Исследования предназначены для сравнения CPG 24555 с CPG 10103 и CPG 7909 в отношении его способности увеличивать антиген-специфические иммунные ответы у мышей при использовании с 2 модельными антигенами: HBsAg и OVA. CPG 24555 и CPG 10103 имеют идентичную нуклеотидную последовательность, за исключением того, что CPG 24555 имеет обращение 3' большей части CG динуклеотида, что приводит к элиминации CpG-мотива в CPG 24555. CPG 7909 представляет собой CpG ODN В-класса, обладающий доказанной адъювантной активностью в клинических исследованиях на людях с множеством вакцинных антигенов.

Элиминация 3' CpG-мотива в CPG 24555 не оказывала какого-либо отрицательного влияния на его способность увеличивать антиген-специфические иммунные ответы и продемонстрировала равное (антительные ответы и антиген-специфические CD8 Т-клетки, как измерено с помощью тетрамерного окрашивания) или лучшее (антиген-специфическая секреция IFN-γ) увеличение адаптивных иммунных ответов по сравнению с CPG 10103. Аналогично, CPG 24555 равен CPG 7909 в увеличении антиген-специфических антительных ответов, а также CTL ответов. CPG 24555 превосходил CPG 7909 в стимулировании антиген-специфической секреции IFN-g.

Увеличение адаптивных иммунных ответов всеми тремя протестированными CpG ODN зависело от TLR9, поскольку никакого увеличения адаптивных иммунных ответов не обнаружили у мышей, дефектных по TLR9.

Как показано в таблице 1, более высокую долю антиген-специфических CD4+ Т-клеток, продуцирующих IFN-γ, получали с CPG 24555. Также получали более высокую долю полифункциональных антиген-специфических CD4+ Т-клеток, продуцирующих по меньшей мере два цитокина среди IFN-γ, TNF-α и IL-2 (т.е. как IFN-γ, так и TNF-α, как IFN-γ, так и IL-2, или как TNF-α, так и IL-2, или даже продуцентов трех цитокинов, секретирующих IFN-γ, TNF-α и IL-2).

В отношении CD8+ Т-клеток (таблица 2) получали более высокую долю полифункциональных антиген-специфических CD8+ Т-клеток, продуцирующих два цитокина и, в частности, IFN-γ и TNF-α, как IFN-γ, так и IL-2.

Взятые вместе эти результаты демонстрируют, что CPG 24555 лучше CPG 10103 в отношении образования популяций полифункциональных антиген-специфических Т-клеток, когда используется в качестве адъюванта. Это может быть важным, поскольку полагают, что полифункциональные Т-клетки, в частности, в отношении продукции хемокинов (таких как IFN-γ, TNF-α и IL-2) являются лучшими эффекторными клетками по сравнению с Т-клетками, которые секретируют один цитокин.

Пример 2

Сравнение CPG 24555 и CPG 10103

Нуклеотидные последовательности протестированных ODN

CPG ODN 10103

5' T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T 3' (SEQ ID NO:2)

CPG ODN 24555

5' T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3' (SEQ ID NO:1)

He-CpG ODN 22881

5' T*G*C*T*G*C*T*T*T*T*T*G*G*C*T*G*C*T*T*T*T 3' (SEQ ID NO:4)

He-CpG ODN 2137

5' T*G*C*T*G*C*T*T*T*T*G*T*G*C*T*T*T*T*G*T*G*C*T*T 3' (SEQ ID NO:5)

* указывает на фосфоротиоатную связь (PS)

Подчеркнутый участок последовательностей представляет различие между CPG ODN 10103 и CPG ODN 24555.

Оптимальный для людей CpG-мотив: GTCGTT

Врожденный иммунитет в человеческих РВМС

Человеческие РВМС (5×106/мл) инкубировали с различными концентрациями CPG 10103, CPG 24555 или не-CpG контрольным ODN 22881 в течение 24 или 48 ч. Клеточные супернатанты собирали и анализировали в отношении секреции цитокинов/хемокинов с использованием имеющегося в продаже набора для ELISA (Фиг.9А и Фиг.9В).

Врожденный иммунитет in vivo у мышей BALB/c

Мышам BALB/c (n=5/группу) инъецировали подкожно PBS (контроль плацебо), CPG 24555, CPG 10103 или не-CpG контрольный ODN 2137 в дозе 100 мкг. У животных брали кровь через 3 часа после инъекции, и плазму анализировали в отношении IP-10 (Фиг.10А) и IL-12 (Фиг.10В) или IL-6 (Фиг. 10С) с использованием имеющегося в продаже ELISA. Представленные результаты представляют собой средние значения для группы ± стандартная ошибка среднего (NS=незначимый).

Гуморальный иммунитет in vivo у мышей BALB/c

Мышам BALB/c инъецировали внутримышечно HBsAg (1 мкг) с CPG 2455, CPG 10103 или не-CpG контрольным ODN 2137 в дозе 10 мкг или без них. Мышей инъецировали на 0 и 14 сутки. Представленные результаты представляют собой HBsAg-специфические общие титры IgG через 2 недели после бустерной иммунизации, измеренные с помощью ELISA в конечной точке (Фиг.11А).

Мышам C57bI/6 инъецировали внутримышечно OVA (20 мкг) с CPG ODN 2455, CPG 10103 или не-CpG контрольным ODN 2137 в дозе 10 мкг или без них. Мышей инъецировали на 0, 7 и 21 сутки. Представленные результаты представляют собой OVA-специфические общие титры IgG через 1 неделю после последней иммунизации (Фиг.11В).

Мышам BALB/c инъецировали внутримышечно Influenza А НА из Texas 1/77, H3N2 (1 мкг) ± квасцы (25 мкг Al3+) с CPG ODN 2455, CPG 10103 или не-CpG контрольным ODN 2137 в дозе 10 мкг или без них. Представленные результаты представляют собой кинетику HA-специфического общего IgG в различные моменты времени после иммунизации, измеренные с помощью ELISA в конечной точке (Фиг.11С).

Т-клеточные ответы у мышей BALB/c

Мышам BALB/c инъецировали внутримышечно HBsAg (1 мкг) с CPG ODN 2455, CPG 10103 или не-CpG контрольный ODN 2137 в дозе 10 мкг или без них. Мышей инъецировали на 0 и 14 сутки. Представленные результаты представляют собой HBsAg-специфические CTL, измеренные по высвобождению 51Cr через 2 недели после бустерной иммунизации (Фиг.12А).

Мышам C57bI/6 инъецировали внутримышечно OVA (20 мкг) с CPG ODN 2455, CPG 10103 или не-CpG контрольным ODN 2137 в дозе 10 мкг или без них. Мышей инъецировали на 0, 7 и 21 сутки. Представленные результаты представляют собой OVA-специфические CTL, измеренные по высвобождению 51Cr через 1 неделю после последней иммунизации (Фиг.12 В).

Мышам BALB/c инъецировали внутримышечно HBsAg (1 мкг) с CPG ODN 2455, CPG 10103 или не-CpG контрольный ODN 2137 в дозе 10 мкг или без них. Мышей инъецировали на 0 и 14 сутки. Спленоциты через 2 недели после последней иммунизации инкубировали с соответствующим антигеном в течение 72 часов, и культуральные супернатанты тестировали в отношении IFN-γ с помощью ELISA (Фиг.13А).

Мышам C57bI/6 инъецировали внутримышечно OVA (20 мкг) с CPG ODN 2455, CPG 10103 или не-CpG контрольный ODN 2137 в дозе 10 мкг или без них. Мышей инъецировали на 0, 7 и 21 сутки. Спленоциты через 1 неделю после последней иммунизации инкубировали с соответствующим антигеном в течение 72 часов, и культуральные супернатанты тестировали в отношении IFN-γ с помощью ELISA (Фиг.13В).

Результаты и обсуждение

CPG 10103 и CPG 24555 имеют идентичные нуклеотидные последовательности, за исключением обращения 3' большей части CG-динуклеотида, представленного в CPG 10103, на GC в CPG 24555, что приводит к элиминации CpG-мотива в CPG 24555. Основываясь на приведенных ранее сообщениях, принимая во внимание одинаковую фланкирующую последовательность, расположение мотива и расстояние между ними, увеличенное число CpG-мотивов должно приводить к повышенной иммунной стимуляции. На основании предшествующих знаний ожидали, что CPG 24555 будет менее иммуностимулирующим, чем CPG 10103, и менее эффективным в качестве адъюванта вакцины. Однако вышеуказанные результаты демонстрируют, что CPG 24555 обладает сходным или большим иммуностимулирующим потенциалом и адъювантной активностью по сравнению с CPG 10103.

Пример 3

Сравнение CPG 10103, CPG 24555 и CPG 7909 в качестве вакцинного адъюванта для гемагглютининового антигена вируса гриппа (НА) у мышей BALB/C

Способы и материалы

Самок мышей BALB/C (10/группу) иммунизировали посредством внутримышечной (в/м) инъекции в левую переднюю большеберцовую мышцу (ТА) гемагглютинином вируса гриппа А (НА) из Texas 1/77, H3N2(1 мкг) ± CpG или контрольным ODN (10 мг) ± квасцы (25 мг Al3+) в общем объеме 50 мкл. У мышей брали кровь с различными временными интервалами после иммунизации для оценки НА-специфического антительного ответа. Половину животных в группе умерщвляли через 6 недель после иммунизации для оценки клеточно-опосредованных иммунных ответов (CTL, НА-специфическая секреция IFN-g и анализ посредством проточной цитометрии секреции цитокинов Т-клетками).

Таблица 3
Реагент Источник, № партии Исходная конц. Конечная конц.
Антиген вируса гриппа A (Texas 1/77 H3N2) Microbix Biosystems Inc. 13037A8 1,0 мг/мл 0,02 мг/мл
Квасцы (Al3+) Alhydrogel "85"2% Cedarlane 85339 10,4 мг/мл 0,5 мг/мл
CPG 7909 Coley, Lot ACZ-03I-016-M 37,15 мг/мл 0,2 мг/мл
CPG 24555 (также известный как CPG 10103GC4) Avecia, Партия # ASD-A0218-157 [обозначеная как CPG10103] 17,75 0,2 мг/мл
CPG 10103 Dow Chemical, Партия #ММ021230 24,51 мг/мл 0,2 мг/мл
Контрольный ODN 2137 Coley, Партия # 008 22,18 мг/мл 0,2 мг/мл
PBS Sigma (P4244) Партия # 096К6064 Н/А Н/А

Н/А - не анализировали

Результаты и обсуждение

Антитела против НА через 6 недель после иммунизации

Через 6 недель после иммунизации измеряли количество антител против НА. CPG 24555 превосходил CPG 10103 и CPG 7909 в увеличении продукции НА-специфического IgG (Фиг.14).

Титры ингибирования гемагглютинации (HIA) через 4 недели после иммунизации

Функциональность антител оценивали с использованием анализа ингибирования гемагглютинации (HIA). При использовании только в качестве адъюванта CPG 24555 превосходил CPG 10103 (р=0,009) и равен CPG 7909 (р=0,1) в отношении увеличения титров HIA (Фиг.15). Все 3 протестированные CpG ODN были равны в отношении увеличения титров HIA при использовании в комбинации с квасцами.

Секреция НА-специфического IFNγ

Измеряли концентрацию секретируемого IFNγ. При использовании только в качестве адъюванта CPG 24555 превосходил CPG 10103 в отношении увеличения НА-специфической секреции IFN-γ (маркер клеточно-опосредованного иммунитета) (Фиг.16). При использовании в комбинации с квасцами CPG 24555 превосходил CPG 10103 и CPG 7909 в отношении увеличения НА-специфической секреции IFN-γ (Фиг.16).

Пример 4

Сравнение CPG 24555 и CPG 7909 в качестве вакцинного адъюванта с поверхностным антигеном гепатита В (HBsAg) у яванских макак

Материалы и способы

Яванских макак (3-5 лет; от 2,5 до 5,5 кг; n=5/группу; за исключением n=4 в группе HBsAg+IMX) иммунизировали внутримышечно (0,6 мл 1 М инъекция в правые четырехглавые мышцы):

1) Engerix-B (педиатрическая доза; 10 мг HBsAg)

2) Engerix-B+CPG 7909 (0,5 мг)

3) Engerix-B+CPG 24555 (0,5 мг)

Животные получали 3 иммунизации; в 0 неделю (примирующая иммунизация), 4 (бустерная иммунизация 1) и 8 (бустерная иммунизация 2). У животных брали кровь до примирующей иммунизации, через 4 недели после примирующей иммунизации (4 неделя), 2 недели после бустерной иммунизации 1 (6 неделя), 4 недели после бустерной иммунизации 1 (8 неделя) и 2 недели после бустерной иммунизации 2 (10 неделя).

HBsAg-специфические иммунные анализы осуществляли следующим образом:

1) Титр и авидность антител

2) Внутриклеточная секреция цитокинов (IL-2, IFN-γ, TNF-α)

3) Полифункциональные Т-клетки

4) Анализ ELISPOT: IL2, TNF-α, IFN-γ, перфорин

Результаты и обсуждение

Гуморальные ответы

О возможном более раннем контакте животных в этом исследовании с вирусом гепатита В свидетельствует высокий уровень титров HBsAg-специфических антител, обнаруженных до вакцинации. Кроме того, одно животное в партии оказалось положительным в отношении HBV при серологических исследованиях, что свидетельствует о возможном контакте с HBV. Однако все животные, используемые в этом исследовании, оказались отрицательными в отношении HBV согласно PCR (полимеразная цепная реакция). Наблюдалось увеличение титра антител против HBsAg с каждой бустерной иммунизацией. Добавление CpG к Engerix-B увеличивало титры HBsAg-специфических антител по сравнению с тем, когда использовали только Engerix-B (Фиг.17). Кроме того, добавление CpG увеличивало авидность антител по сравнению с тем, когда использовали только Engerix-B (Фиг.18). CPG 24555 был равен CPG 7909 в отношении увеличения как титра, так и авидности антител.

Т-клеточные ответы: внутриклеточная секреция цитокинов CD4 Т-клетками

Добавление CpG к Engerix-B имело тенденцию увеличивать частоту опосредованной CD4 Т-клетками секреции IFN-γ и TNF-α, но не секрецию IL-2 (Фиг.19А, В и С). В целом, CPG 24555 был равен или превосходил CPG 7909 в отношении индукции СD4-опосредованных цитокинов.

Т-клеточные ответы: Полифункциональные CD4 Т-клетки;

Количественный анализ

Количество клеток, секретирующих один, два или три цитокина, измеряли на 10 неделе (через 2 недели после бустерной иммунизации 2). CPG 24555 был равен CPG 7909 в отношении индукции Engerix-B специфических CD4 Т-клеток, секретирующих один цитокин. В целом, обнаружили относительно низкий уровень CD4 Т-клеток, продуцирующих три цитокина. Однако CPG 24555 индуцировал более высокий уровень CD4 Т-клеток, продуцирующих три цитокина, по сравнению с CPG 7909 или только Engerix-B (Фиг.20А). Кроме того, животные, иммунизированные Engerix-B+CPG 24555, имели более высокую долю Т-клеток, продуцирующих три цитокина, по сравнению с животными, иммунизированными только Engerix-B или Engerix-B+CPG 7909 (Фиг.20В).

Т-клеточные ответы: полифункциональные CD4 Т-клетки;

Количественный анализ

Измеряли количество клеток, секретирующих IL-2, IFN-γ и TNFα или комбинации этих цитокинов. CPG 24555 был равен или превосходил CPG 7909 в отношении индукции полифункциональных Т-клеток (Фиг.21А и Фиг.21В).

Т-клеточные ответы: Полифункциональность CD4 Т-клеток

Долю CD4 Т-клеток, продуцирующих три цитокина, измеряли через 2 недели после бустерной иммунизации 2. Более высокую долю CD4 Т-клеток, продуцирующих три цитокина, обнаружили для CPG 24555 по сравнению с CPG 7909 (Фиг.22).

Заключения

На основании этих данных элиминация 3' CpG-мотива в CPG 24555 не оказывала какого-либо отрицательного влияния на его способность увеличивать антиген-специфические иммунные ответы и продемонстрировала равное или лучшее увеличение адаптивных иммунных ответов по сравнению с CPG 10103 и CPG 7909. Адъювантная активность CPG 24555, обнаруженная с множественными антигенами у мышей, также переносилась на приматов, отличных от людей, где CPG 24555 демонстровал равную (гуморальный иммунитет) или превосходящую (Ag-специфические полифункциональные Т-клетки) адъювантную активность по сравнению с CPG 7909 с поверхностным антигеном гепатита В у яванских макак.

Специалисты в данной области техники знают или смогут определить с использованием не более чем стандартных экспериментов множество эквивалентов описанных в данной заявке конкретных воплощений изобретения. Предполагается, что такие эквиваленты охвачены следующей формулой изобретения.

1. Иммуностимулирующий олигонуклеотид, состоящий из нуклеотидной последовательности
5' TCGTCGTTTTTCGGTGCTTTT 3' (SEQ ID NO:1).

2. Иммуностимулирующий олигонуклеотид по п.1, содержащий одну или более фосфоротиоатных связей.

3. Применение иммуностимулирующего олигонуклеотида по п.1 для получения иммуностимулирующего олигонуклеотида с такой же иммуностимулирующей активностью, содержащего указанный олигонуклеотид и по меньшей мере один липофильный замещенный нуклеотидный аналог и пиримидин-пуриновый динуклеотид.

4. Применение олигонуклеотида по п.1 в качестве адъюванта в вакцине для индукции антиген-специфического иммунного ответа.

5. Применение по п.4, где олигонуклеотид находится в количестве, эффективном для индукции антиген-специфического иммунного ответа.

6. Применение по п.5, где индуцированный антиген-специфический иммунный ответ представляет собой Th1-иммунный ответ.

7. Применение по п.4, где антиген, присутствующий в вакцине, представляет собой микробный антиген, аутоантиген или вещество, вызывающее привыкание, выбранное из кокаина или никотина.

8. Применение по п.7, где микробный антиген представляет собой бактериальный антиген, вирусный антиген или паразитарный антиген.

9. Применение по п.8, где:
а) бактериальный антиген ассоциирован с Staphylococcus aureus, бактерией, вызывающей кариес зубов, или бактерией, вызывающей периодонтальное заболевание;
б) вирусный антиген ассоциирован с респираторно-синцитиальным вирусом (RSV), вирусом простого герпеса 1, вирусом простого герпеса 2, вирусом иммунодефицита человека-1 (HIV-1) или HIV-2, или
в) паразитарный антиген ассоциирован с паразитом, вызывающим малярию.

10. Применение по п.9, где:
а) бактерия, которая вызывает кариес зубов, представляет собой Streptococcus mutans, Streptococcus sobrinus, Streptococcus sanguis, Lactobacillus acidophilis или Actinomyces viscosus; или
б) бактерия, которая вызывает периодонтальное заболевание, представляет собой Porphyromonas gingivalis или Actinobacillus actinomycetemcomitans.

11. Применение по п.7, где аутоантиген представляет собой опухолевый антиген, антиген, ассоциированный с болезнью Альцгеймера, антиген против человеческого антитела, антиген, который экспрессируется из человеческих эндогенных ретровирусных элементов, или никотиновый гаптен, конъюгированный с носителем.

12. Применение по п.11, где:
а) опухолевый антиген представляет собой HER2 (рецептор человеческого эпидермального фактора роста 2), MAGE (антиген, ассоциированный с меланомой), NY-ESO (раково-тестикулярный антиген), PSA (простатспецифический антиген), СЕА (карциноэмбриональный антиген) или вариант EGFR (рецептор эпителиального фактора роста);
б) антиген, ассоциированный с болезнью Альцгеймера, представляет собой tau или β-амилоид;
в) антиген представляет собой IgE; или
г) носитель, с которым конъюгирован никотиновый гаптен, представляет собой дифтерийный токсин (DT).

13. Применение по п.4, где антиген, присутствующий в вакцине, представляет собой пептид, рекомбинантный белок, очищенный белок, цельный убитый патоген, живой ослабленный вирус или вирусный вектор, живую ослабленную бактерию или бактериальный вектор, полисахарид, гаптен или кодируется плазмидной ДНК.

14. Применение по п.4, где антиген, присутствующий в вакцине, конъюгирован с носителем.

15. Применение по п.14, где носитель представляет собой дифтерийный токсин (DT) или вирусоподобную частицу, где вирусоподобная частица представляет собой РНК-фаг Q-β поверхностный антиген гепатита В (HBsAg) или коровый антиген гепатита В (HBcAg).

16. Применение по п.4, где вакцина дополнительно содержит один или более адъювантов.

17. Применение по п.16, где адъювант представляет собой агонист Toll-подобного рецептора (TLR), который не является TLR9.

18. Применение по п.17, где агонист представляет собой агонист TLR3, TLR4, TLR5, TLR7 или TLR8.

19. Применение по п.18, где:
а) агонист TLR3 представляет собой стабилизированную poly I:С (полиинозиновая-полицитидиловая кислота);
б) агонист TLR4 представляет собой производное липополисахарида (LPS), выбранное из MPL (монофосфориллипид А) или GLA (гаммалиноленовая кислота);
в) агонист TLR5 представляет собой флагеллин; или
г) агонист TLR7 или TLR8 представляет собой небольшую молекулу имидазохинолинового семейства.

20. Применение по п.16, где адъювант представляет собой соль алюминия, иммуностимулирующий комплекс (ISCOM), эмульсию масло-в-воде или вода-в-масле, липосому или систему доставки, выбранную из наночастицы или микрочастицы.

21. Применение по п.20, где соль алюминия представляет собой гидрат окиси алюминия.

22. Применение по п.4, где олигонуклеотид содержит одну или более фосфоротиоатных связей.

23. Применение по п.4, где вакцина приготовлена для введения.

24. Применение по п.4, где:
а) вакцина приготовлена для введения парентеральным путем, где парентеральный путь представляет собой внутримышечный, подкожный, интрадермальный, внутривенный или интраперитонеальный путь; или
б) вакцина приготовлена для введения местным путем, где местный путь представляет собой кожный, трансдермальный пути или путь через поверхность слизистой оболочки.

25. Применение по п.24, где путь через поверхность слизистой оболочки представляет собой пероральный, интраназальный, интравагинальный, интраректальный, интрабуккальный или внутриглазной пути.



 

Похожие патенты:

Изобретение относится к биотехнологии, в частности генной инженерии, и может быть использовано для лечения новообразований различной природы. .

Изобретение относится к молекулярной генетике и может быть использовано в животноводстве, селекции и пищевой промышленности. .

Изобретение относится к генной инженерии, биохимии, биотехнологии и иммунологии. .

Изобретение относится к области биотехнологии, молекулярной биологии, медицины и ветеринарии. .

Изобретение относится к области молекулярной биологии и может быть использовано для направленной модификации последовательности дуплексной ДНК (днДНК). .

Изобретение относится к области биотехнологии и касается способа получения гексахлорфлуоресцеин-меченых олигодезоксирибонуклеотидов. .

Изобретение относится к области медицинской микробиологии и касается способа дифференциации штаммов Yersinia pestis. .

Изобретение относится к области биотехнологии, а именно к способу определения строения интерфазных хромосом, способу колориметрической гибридизации in situ, способу визуального обнаружения Робертсоновских транслокаций между акроцентрическими хромосомами в образце, полученном от человека, и способу подтверждения присутствия маркерных хромосом в образце.

Изобретение относится к области молекулярной биологии и биотехнологии и может быть использовано в медицине и в фармацевтической промышленности. .

Изобретение относится к области биотехнологии. .

Изобретение относится к биохимии и представляет собой способ ослабления экспрессии мРНК TNFR1 у субъекта. .

Изобретение относится к области биотехнологии, а именно к способу обнаружения нуклеотидной последовательности в геномном образце. .

Изобретение относится к области молекулярной биологии и биотехнологии и может быть использовано при получении рекомбинантных белков различного назначения, включающих не встречающуюся в природе аминокислоту фенилселеноцистеин (ФСЦ).

Изобретение относится к области молекулярной биологии и может быть использовано для направленной модификации последовательности дуплексной ДНК (днДНК). .
Наверх