Способ получения суспензий гидрогелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины и их применение



Способ получения суспензий гидрогелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины и их применение
Способ получения суспензий гидрогелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины и их применение
Способ получения суспензий гидрогелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины и их применение
Способ получения суспензий гидрогелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины и их применение
Способ получения суспензий гидрогелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины и их применение
Способ получения суспензий гидрогелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины и их применение
Способ получения суспензий гидрогелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины и их применение
Способ получения суспензий гидрогелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины и их применение
Способ получения суспензий гидрогелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины и их применение

 

C12N15 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2478706:

Дебабов Владимир Георгиевич (RU)
Мойсенович Михаил Михайлович (RU)
Агапов Игорь Иванович (RU)
Кобозев Игорь Петрович (RU)
Богуш Владимир Григорьевич (RU)
Привалова Евгения Михайловна (RU)

Изобретение представляет собой способ получения суспензии гидрогелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины. Способ включает получение раствора белка, который освобождают от растворителя, получение гидрогеля и получение микрогелевой суспензии, определение размера гелевых микрочастиц, получение гелевых микрочастиц с заданными размерами. При этом используют рекомбинантный белок паутины паука-кругопряда, который растворяют в растворе лития хлористого в муравьиной кислоте. Диализ раствора проводят против калий-фосфатного буфера, центрифугируют. Раствор белка подвергают воздействию ультразвука. Раствор оставляют при комнатной температуре до образования геля. Гель протирают через сито, помещают в 96% этиловый спирт, встряхивают, выдерживают. Микрочастицы разделяют дифференциальным центрифугированием. Изобретение относится также к применению суспензии гидрогелевых микрочастиц, полученных описанным способом, для адгезии и пролиферации клеток человека или животных на поверхности гидрогелевых микрочастиц или имплантации гидрогелевых микрочастиц в организм человека или животных. Изобретение позволяет эффективно получать суспензии гидрогелевых микрочастиц с заданными размерами. 2 н. и 3 з.п. ф-лы, 6 ил., 14 пр.

 

Область техники, к которой относится изобретение.

Изобретение относится к области биотехнологии и направлено на способ получения суспензий гелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины и их применению.

Уровень техники

Паутина является уникальным биоматериалом, сочетающим в себе удивительную прочность и эластичность. По этим показателям она не имеет аналогов как в природе, так и среди материалов, созданных человеком. Так, например, каркасная нить паутины паука-кругопряда Nephila clavipes no значениям прочности на разрыв превосходит сталь и сопоставима с кевларом, а по величине энергии разрыва превосходит и кевлар; в то же время она может растягиваться до 35% своей длины [Gosline J.M. et al. Endeavor, 1986, v.10, 37-43].

Получение промышленных количеств таких материалов возможно лишь с помощью генно-инженерных и биотехнологических методов. К настоящему времени выделены и достаточно полно охарактеризованы несколько генов, кодирующих белки паутины [Xu M. & Lewis R. Proc. Natl.Acad.Sci, USA, 1990, v.87, 7120-7124; HinnmanM. & Lewis R.J.Biol. Chem, 1992, v.267, 19320-19324; Guerette P. et al. J.Science, 1996, v.272, 112-115; Hayashi C.Y.& Lewis R.V.J.Mol. Biol.,1998, v.275, 773-784]. Эти гены относятся к наиболее протяженным из известных цистронов (размеры мРНК лежат в диапазоне от 7,5 до 15,5 т.н.) и состоят из большого числа тандемно повторяющихся протяженных последовательностей, которые заметно различаются у разных генов. Наиболее изученная каркасная нить паука-кругопряда Nephila clavipes состоит из двух белков - спидроина 1 и спидроина 2 (MaSp1 и MaSp2 соответственно) синтезируемых большой ампуловидной железой [Hinnman M. & Lewis R.J.Biol. Chem., 1992, v.267, 19320-19324; Guerette P. et al. Science, 1996, v.272, 112-115]. Повторяющийся элемент спидроина 1 можно представить в виде следующей консенсусной последовательности:

[GGAGQGGYGGLGSQGAGRGGLGGQGAG(A)4-7],

а повторяющуюся последовательность спидроина 2 - в виде

[GPGGYGPGQQGPGGYAPGQQPSGPGS(A)6-10].

Принципиальным различием между этими белками является то, что в случае спидроина 1 элементарным повтором является трипептид GGX (Х=А, S или Y), а в случае спидроина 2 - пентапептиды GPGGY и GPGQQ. При этом для спидроина 1 характерна повышенная прочность, а для спидроина 2, способного образовывать (β-спирали [Hayashi et al., 1999, Int. J.Biol. Macromol., v.24, 271-275], - большая эластичность. Взаимодействие этих белков в составе каркасной нити паутины и обеспечивает уникальное сочетание ее свойств.

Белки MiSp1 и MiSp2, синтезируемые малой ампуловидной железой, и белок Flag ловчей нити паука-кругопряда также имеют повторяющуюся структуру. Повторяющиеся области обогащены аланином и глицином. Мотивы GGX и GA представлены по всей длине аминокислотной последовательности как белка MiSpl, так и белка MiSp2 [К. Vasanthavada et al. Cell. Mol. Life Sci, 2006, v.63, 1986-1999]. В последовательности белка Flag ловчей нити доминантные повторяющияся мотивы представлены пентапептидом GPGG1X и трипептидом GGX.

Результаты исследования белков каркасной нити паука-кругопряда Nephila clavipes, а также белка ловчей нити и белков, синтезируемых малой ампуловидной железой [KohlerT. & VollrathF. J. Exp.ZooL, 1995, v.271, 1-17; Colgin M.A. & Lewis R., Protein Sci., 1998, v.7, 667-672], позволили выдвинуть модульную гипотезу строения белков паутины [Hinman at al., 2000, TIBTECH, V.1, 374-379]. Структурный анализ белков паутины свидетельствует о наличии в них кристаллических областей, образованных β-складчатыми структурами (считается, что они формируются блоками (А)n и (GA)n), которые обеспечивают прочность нитей паутины и которые погружены в менее структурированный Gly-обогащенный матрикс, ответственный за эластичность. На концах молекул содержатся неповторяющиеся (NR) уникальные консервативные последовательности, которые необходимы, как полагают, для повышения растворимости белков в концентрированном растворе внутри железы, а также для правильной подгонки молекул при формировании нити при прядении.

В первом случае более 80% целевого белка обнаруживалось в водонерастворимой фракции, и средний выход составлял 6-8 мг белка на 1 литр ферментационной культуры дрожжей. В дрожжах Pichia pastoris средний выход чистого белка 1F9 составил приблизительно 70 мг на 1 кг влажной клеточной массы (приблизительно 23 мг/л ферментационной культуры). Последовательности рекомбинантных белков были максимально приближены к последовательностям природных белков, в частности, повторяющаяся область белка 1F9 содержала 9 повторов «мономера», состоящего из пяти вариантов первичных повторов, обнаруженных в природном спидроине 1. С целью увеличения уровня синтеза рекомбинантного белка в клетках дрожжей структура генов 1F9 и 2Е12 была модифицирована путем замены "редких" триплетов на кодоны, характерные для эффективно экспрессирующихся генов дрожжей, а количество внутренних повторов нуклеотидных последовательностей сведено к минимуму. Фрагменты ДНК, кодирующие соответствующие мономеры обоих белков, были получены в результате химико-ферментативного синтеза и затем амплифицированы. Конечный ген белка 1F9 кодировал девять повторов соответствующего «мономера», составляющих белок с молекулярной массой 94 кДа; белок 2Е12 (молекулярная масса 113 кДа), содержал 12 «мономерных» повторов.

В растворах белков 1F9 и 2Е12, очищенных с использованием катионообменной хроматографии, были исследованы структурные переходы, возникающие при определенных воздействиях [Bogush V.G. & Debabov V.G., 2009, J.Neuroimmune PharmacoL, v.4, 17-27]. Несмотря на отсутствие гидрофильных N- и С-концевых уникальных последовательностей (NR), которые, как предполагалось ранее, необходимы для формирования нанофибрилл и мицелл, оба белка в водном растворе спонтанно формировали нанофибриллы длиной 100 нм - 1 мкм и мицеллы диаметром около 1 мкм. Причем нанофибриллы имели спиралевидную структуру с периодом в 40 нм.

Из уровня техники известен способ получения гидрогеля из аналога паучьего спидроина 1, который был взят в качестве ближайшего аналога [Rammensee S, Huemmerich D, Hermanson KD, Scheibel T, Bausch AR (2006) Rheological characterization of hydrogels formed by recombinantly produced spider silk. Appl Phys A Mater Sci Process 82:261-264].

Для получения гидрогеля в статье использован аналог паучьего спидроина 1-ADF-4 с 16 повторами консенсусной последовательности (С16):

(GSSAAAAAAAASGPGGYGPENQGPSGPGGYGPGGP), с молекулярной массой 48 кДа.

Белок был экспрессирован в E.coli BLR (DE3). Очищенный белок промывали в 8 М мочевине, растворяли в 6М GdmSCN и диализовали против 10 мМ NH4HCO3. Нерастворившиеся фрагменты удаляли ЦФ при 50000 g, 30 мин. Оставшийся раствор белка лиофилизировали.

Лиофилизированный белок растворяли в 6М GdmSCN и диализовали против 5 мМ фосфата калия рН 8,0. Нерастворившиеся фрагменты удаляли ЦФ при 125000 g, 30 мин. Осадок отбрасывали.

Добавляли метанол до концентрации 10%. При этом белок собирался в нанофибриллы при концентрации от 5 до 30 мг/мл.

В зависимости от концентрации нанофибриллы образовывали гидрогель за период от нескольких дней до 1 недели.

Этот гидрогель легко разрушался при встряхивании и струении.

Для упрочнения гидрогель сшивали аммоний пероксодисульфатом (APS) и Tris(2,2'-bipiridyl)dichlororuthenium(II)(Rubpy). Количество реагентов рассчитывали так, чтобы финальная концентрация составляла 10 мМ APS и 100 мкм Rubpy. Реагенты добавляли к гидрогелю и давали впитаться в течение ночи. Затем гидрогель экспонировали на видимом свету под вольфрамовой лампой в течение 1 мин и остатки жидкости удаляли с поверхности гидрогеля.

Отличие предложенной методики от известной:

- использовали другие последовательности белков;

- два белка - аналога спидроинов 1 и 2, а не один;

- более разнообразные последовательности (более приближенные к природным);

- белки имеют высокие молекулярные массы - 94 и 113 кД, что должно давать более плотные гидрогели;

- экспрессия генов - в клетках дрожжей, а не в E.coli.

- гели получали в течение ночи, а не нескольких дней;

- получены суспензии гидрогелевых микрочастиц с заданными диапазонами размеров и различной плотностью.

Возможность получать гидрогели в виде суспензии гидрогелевых микрочастиц имеет большое преимущество по сравнению с неизмельченными гидрогелями: частицы могут быть покрыты монослоем клеток (это уже показано авторами) и вводиться с помощью шприца в организм. Заявленный метод позволяет использовать значительно большее количество клеток на единицу объема материала и способствует лучшей выживаемости клеток благодаря более эффективной доставке питательных веществ. Суспензия микрогелей может использоваться для нанесения на поверхность ран, что имеет определенные преимущества по сравнению с пленками (не надо подбирать размер, лучший газообмен и доступ лекарственных веществ). Кроме того, суспензии гидрогелевых микрочастиц с заданными размерами позволяют использовать их в медицине в случаях, когда необходимо достичь равномерной и программируемой скорости биодеградации микрочастиц.

Раскрытие изобретения

Авторами настоящего изобретения впервые предложен способ получения рекомбинантных белков паутины пауков-кругопрядов (Araneidae) в клетках дрожжей, обеспечивающий продукцию рекомбинантных белков в количествах, в десятки раз превышающих количества рекомбинантных белков паутины, продуцируемых в соответствии со способами, известными из предшествующего уровня техники, и способ получения суспензий гидрогелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины и их медицинское применение.

Согласно предложенному способу рекомбинантные белки паутины пауков-кругопрядов экспрессируют в клетках дрожжей в виде гибрида с убиквитин-подобным белком, занимающим в составе гибрида N-концевое положение и содержащим сайт процесинга, распознаваемый природными дрожжевыми протеиназами, предпочтительно убиквитин-специфичными протеиназами DUB или SUMO-специфичными протеиназами дрожжей, в результате чего в ходе экспрессии гибридные белки подвергаются процессингу под действием протеиназ, что обеспечивает накопление в клетках дрожжей зрелого белка паутины, не содержащего гибридный компонент, причем белок накапливается в водонерастворимой фракции дрожжевых клеток.

Предпочтительно способ согласно изобретению предусматривает получение рекомбинантного белка паутины, консенсусные последовательности которого происходят из каркасных белков большой ампуловидной железы и/или белков малой ампуловидной железы или белка ловчей нити паука-кругопряда.

В одном из предпочтительных воплощений способ, согласно изобретению, предусматривает получение рекомбинантных белков паутины, консенсусные последовательности которых происходят из каркасных белков большой ампуловидной железы Nephila clavipes и/или Nephila madagascariensis, и убиквитин-подобный белок выбирают из группы, включающей убиквитин и белок SUMO дрожжей Saccharomyces cerevisiae.

В одном из наиболее предпочтительных воплощений способ согласно изобретению, направлен на получение рекомбинантного белка 2Е12 каркасной нити паука-кругопряда Nephila madagascariensis в клетках Saccharomyces cerevisiae под контролем промотора гена GAL1 дрожжей, причем ген рекомбинантного белка слит с последовательностью, кодирующей убиквитин или белок SUMO Saccharomyces cerevisiae.

Еще в одном наиболее предпочтительном воплощении способ согласно изобретению направлен на экспрессию гена рекомбинантного белка 1F9 каркасной нити паука-кругопряда Nephila clavipes в клетках Saccharomyces cerevisiae под контролем промотора гена GAL1 дрожжей, причем ген рекомбинантного белка слит с последовательностью, кодирующей убиквитин или белок SUMO Saccharomyces cerevisiae.

В соответствии с еще одним аспектом изобретение обеспечивает хозяйские клетки дрожжей, продуцирующие рекомбинантные белки паутины паука-кругопряда. Наиболее предпочтительными хозяйскими клетками, согласно изобретению, являются клетки дрожжей Saccharomyces cerevisisae. В еще одном аспекте изобретение обеспечивает штаммы-продуценты рекомбинантых белков 1F9 и 2Е12 каркасной нити паука-кругопряда.

Краткое описание чертежей

Фиг.1. Электрофорез в 12% ПААГ с ДДС-Na фракций 1F9 после хроматографии на катионообменной колонке HiPrep 16/10 SP FF. Дорожки: 1 - исходный раствор перед нанесением на колонку; 2 - проскок; 3-6 - фракции, содержащие белок 1F9, 7 - образец стандартного 1F9.

Фиг.2. Электрофорез в 12% ПААГ с ДДС-Na фракций 2Е12 после хроматографии на катионообменной колонке HiPrep 16/10 SP FF. Дорожки: 1 - исходный раствор перед нанесением на колонку; 2 - проскок; 3 - стандарты молекулярных масс (сверху вниз, в кДа): 170, 130, 95, 72, 55, 43, 34, 26, 17; 4 - фракция, содержащая 2Е12, 5 - образец стандартного 2Е12.

Фиг.3. Карта вектора pPDX3-HUB-1F9.

Обозначения: SPIDROIN - синтетический ген рекомбинантного белка 1F9 (спидроин-1 паука N.clavipes); HUB - ген убиквитина дрожжей S.cerevisiae; GAL1 - промоторная область гена GAL1 дрожжей S.cerevisiae; URA3 и PGK1 - структурные гены URA3 и PGK1 дрожжей S.cerevisiae соответственно; сус1Т - последовательность терминатора транскрипции гена CYC1 дрожжей S.cerevisiae; 2 mkm - фрагмент эндогенной 2-микронной плазмиды дрожжей S.cerevisiae, содержащий область начала репликации; pUC18 - фрагмент плазмиды pUC18, содержащий ген бета-лактамазы (ApR) и область начала репликации, обеспечивающий селективную амплификацию вектора в клетках E.coli.

Фиг.4. Карта вектора pPDX3-SUMO-1F9.

Обозначения: SPIDROIN - синтетический ген рекомбинантного белка 1F9 (рекомбинантный спидроин-1 паука N.clavipes); SUMO - ген SMT3 дрожжей S.cerevisiae, кодирующий белок SUMO; GAL1 - промоторная область гена GAL1 дрожжей S.cerevisiae; URA3 и PGK1 - структурные гены URA3 и PGK1 дрожжей S.cerevisiae соответственно; сус1Т - последовательность терминатора транскрипции гена CYC1 дрожжей S.cerevisiae; 2 mkm - фрагмент эндогенной 2-микронной плазмиды дрожжей S.cerevisiae, содержащий область начала репликации дрожжей; pUC18 - фрагмент плазмиды pUC18, содержащий ген бета-лактамазы (ApR) и область начала репликации для обеспечения селективной амплификации вектора в клетках Е.coli.

Фиг.5. Схема вектора pPDX3-HUB-2E12.

Условные обозначения: SPIDROIN - последовательность ДНК, кодирующая рекомбинантный белок 2Е12; HUB - последовательность ДНК, кодирующая убиквитин дрожжей S.cerevisiae; GAL1 - промоторная область гена GAL1 дрожжей S.cerevisiae; URA3 и PGK1 - структурные гены URA3 и PGK1 дрожжей S.cerevisiae соответственно; cyc1T - последовательность терминатора транскрипции гена CYC1 дрожжей S.cerevisiae; 2 mkm - фрагмент эндогенной 2-микронной плазмиды дрожжей S.cerevisiae, содержащий область начала репликации; pUC18 - фрагмент плазмиды pUC18, содержащий ген бета-лактамазы (ApR) и область начала репликации, обеспечивающий селективную амплификацию вектора в клетках E.coli.

Фиг.6. Фотография искусственной нити из белка 1F9 в сосуде с этанолом.

Осуществление изобретения

Настоящее изобретение основано на неожиданном открытии, что экспрессия рекомбинантного белка паутины паука-кругопряда в клетках дрожжей в виде слитого белка с убиквитин-подобным белком, занимающим в составе гибрида N-концевое положение, позволяет в десятки раз увеличить продукцию рекомбинантного белка паутины, причем рекомбинантный белок, экспрессируемый в виде гибридного белка, накапливается в клетках дрожжей в водонерастворимой фракции в виде процессированного белка, не содержащего гибридный компонент.

Следовательно, в одном из аспектов настоящее изобретение обеспечивает способ получения рекомбинантного белка паутины паука-кругопряда в клетках дрожжей, предусматривающий конструирование вектора экспрессии, трансформацию клеток дрожжей полученным вектором экспрессии и экспрессию в трансформированных клетках гена рекомбинантного белка паутины паука-кругопряда, отличающийся тем, что используют вектор экспрессии, который включает последовательность ДНК, кодирующую рекомбинантный белок паутины паука-кругопряда, слитую с последовательностью, кодирующей убиквитин-подобный белок, занимающий в составе слитого белка N-концевое положение по отношению к рекомбинантному белку паутины, и содержащий сайт процессинга, распознаваемый природными дрожжевыми протеиназами, предпочтительно убиквитин-специфичными протеиназами DUB или SUMO-специфичными протеиназами дрожжей, в результате чего в ходе экспрессии гибридные белки подвергаются процессингу под действием протеиназ, что обеспечивает накопление в клетках дрожжей в водонерастворимой фракции рекомбинантного белка паутины в виде процессированного белка, не содержащего гибридный компонент.

Рекомбинантные белки, получаемые способом согласно изобретению, имеют явно выраженную периодическую структуру, которая может быть представлена в виде ряда консенсусных последовательностей, выведенных путем выравнивания повторяющихся единиц природных белков паутины пауков-кругопрядов. Рекомбинантные белки согласно изобретению представляют собой белки, последовательности которых содержат как повторы одной консенсусной последовательности, так и комбинации повторов консенсусных последовательностей различного типа, происходящих из каркасных белков большой ампуловидной железы, и/или белков малой ампуловидной железы, и/или белков Flag ловчей нити паука-кругопряда, в частности, выбираемых из группы, включающей консенсусные последовательности:

где MaSpl и MaSpl - белки каркасной нити большой ампуловидной железы Latrodectus hesperus [Lawrence B.A. et al., 2004, Biomacromolecules, v.5, 689-695];

MiSp1 и MiSp1 - белки малой ампуловидной железы Nephila clavipes [Colgin M.A. & Lewis R.V., 1998, Protein ScL, v.7, 667-672];

Flag - белок ловчей нити Nephila madagascariensis [Hayashi С.& Lewis R.V., 1998, J.Mol.Biol, v.275, 773-784].

Предпочтительно, согласно предложенному способу, используют консенсусные последовательности, происходящие из повторяющихся последовательностей белков большой ампуловидной железы Nephila clavipes и Nephila madagascariensis и выбираемые из группы:

Конструирование искусственных генов, кодирующих рекомбинантные белки большой и/или малой ампуловидных желез, или белки Flag ловчей нити паука-кругопряда включает реконструкцию последовательности ДНК, кодирующей консенсусную последовательность или комбинации повторов консенсусных последовательностей различного типа, происходящие из повторяющихся последовательностей указанных выше белков; конструирование и химический синтез серии праймеров к консенсусной последовательности/последовательностям; единовременный отжиг смеси всех синтезированных праймеров, необходимых для образования двухцепочечной молекулы ДНК, и последующую обработку их лигазой для удаления однонитевых разрывов ДНК или реакцию ПЦР с последовательным использованием необходимых праймеров и поэтапным достраиванием растущего фрагмента ДНК, причем образуемый фрагмент («мономер») затем подвергается поэтапному удвоению в составе плазмиды до получения гена необходимой длины [Богуш В.Г. с соавт., 2001, Биотехнология, т.2, 11-22; Богуш В.Г. с соавт., 2006, Биотехнология, т.4, 3-12; Bogush V.G. & Debabov V.G., 2009, J. Neuroimmune PharmacoL, v.4, 17-27].

Последовательности соответствующих кДНК могут быть выведены на основе последовательности природного белка с учетом вырожденности кода и частоты встречаемости кодонов у дрожжей. В частности, при конструировании гена, кодирующего белок 1F9 и содержащего 9 копий "мономера", фрагменты, кодирующие наиболее типичные первичные повторы, были выбраны из последовательности природного белка и отличались друг от друга набором делеций. Реконструированная последовательность ДНК включала приблизительно 400 п.н. и кодировала полипептид, соответствующий 134 аминокислотным остаткам. «Редкие» кодоны в последовательности искусственного гена были заменены на наиболее часто используемые у дрожжей. «Мономер» был получен с помощью химико-ферментативного синтеза, и мультимерная форма получена путем пошаговой мультипликации мономера в составе рекомбинантной плазмиды [Богуш В.Г. с соавт., 2001, Биотехнология, т.2, 11-22].

При конструировании гена 2Е12 были использованы последовательности спидроинов типа 2 большой ампуловидной железы, содержащиеся в базе данных белковых последовательностей NCBI и включающие более 200 аминокислотных остатков. На основании математического анализа всех последовательностей были разработаны последовательности блоков (каждый состоял из 3-5 первичных повторов) и составлена формула полного искусственного гена [Bogush V.G. et al., 2009, J. Neuroimmune PharmacoL, v.4, 17-27].

В одном из предпочтительных воплощений предложенный способ получения рекомбинантного белка паутины паука-кругопряда в клетках дрожжей предусматривает слияние гена рекомбинантного белка паутины с последовательностью ДНК, кодирующей убиквитин или белок SUMO дрожжей Saccharomyces cerevisiae.

В одном из наиболее предпочтительных воплощений изобретения в клетках Saccharomyces cerevisiae получают рекомбинантный белок 1F9 каркасной нити паутины паука-кругопряда Nephila clavipes, причем структурный ген белка 1F9 слит с последовательностью ДНК, кодирующей убиквитин Saccharomyces cerevisiae. Еще в одном наиболее предпочтительном воплощении изобретения в клетках Saccharomyces cerevisiae получают рекомбинантный белок 2Е12 каркасной нити паутины паука-кругопряда Nephila madagascariensis, причем ген белка 2Е12 слит с последовательностью ДНК, кодирующей убиквитин Saccharomyces cerevisiae.

В еще одном наиболее предпочтительном воплощении изобретения в клетках дрожжей Saccharomyces cerevisiae экспрессируют слитый белок, содержащий последовательность рекомбинантного белка 1F9, причем последовательность белка 1F9 слита с последовательностью белка SUMO дрожжей Saccharomyces cerevisiae. Рекомбинантные белки, получаемые согласно предложенному способу, были выделены из водонерастворимой фракции хозяйских клеток Saccharomyces cerevisiae с помощью хроматографии на катионообменной колонке (примеры 9 и 11). Электрофоретический анализ фракций (Фиг.1 и 2) показал, что рекомбинантные белки 1F9 и 2Е12 накапливаются во фракции водонерастворимых белков клеток дрожжей (в водорастворимой фракции рекомбинантные белки практически отсутствуют) и не содержат компонент убиквитин-подобного белка. На это указывает электрофоретическая подвижность анализируемых белков и отсутствие в геле полос, соответствующих по подвижности слитым белкам (убиквитин-1F9 и убиквитин-2Е12). Аналогичные результаты получены для рекомбинантных белков, выделенных и очищенных из водонерастворимой фракции хозяйских клеток Saccharomyces cerevisiae, продуцирующих рекомбинантные белки паутины, слитые с белком SUMO. Продукция рекомбинантных белков клетками Saccharomyces cerevisiae составляет не менее 100 мг/л ферментационной культуры.

Отсутствие рекомбинантных белков, получаемых в соответствии с предложенным изобретением, в водорастворимой фракции позволяет практически избежать потери белка в процессе выделения и очистки в отличие от известного способа [Богуш В.Г. с соавт., 2001, Биотехнология, т.2, 11-22], согласно которому только около 80% целевого белка обнаруживалось в водонерастворимой фракции.

Таким образом, при осуществлении способа получения рекомбинантного белка паутины согласно изобретению рекомбинантный белок, синтезируемый в клетках Saccharomyces cerevisiae, накапливается во фракции водонерастворимых белков в виде процессированного белка, не содержащего гибридный компонент, причем клетки, экспрессирующие рекомбинантный белок паутины, накапливают в десятки раз больше рекомбинантного белка, чем в соответствии со способами, известными из предшествующего уровня техники.

Очищенные рекомбинантные белки паутины паука-кругопряда, согласно изобретению, способны образовывать надмолекулярные структуры различных типов, в частности анализируемые белки формируют не растворяющиеся в воде нити (Пример 12, Фиг.6).

В соответствии с одним из аспектов изобретение обеспечивает клетки-хозяева дрожжей, продуцирующие рекомбинантные белки паутины пауков-кругопрядов. В качестве подходящих клеток-хозяев для получения рекомбинантных белков паутины используют клетки дрожжей, которые выбирают из группы, включающей Saccharomyces cerevisiae, Kluyveromyces lactis, Hansenula polymorpha, Pichia pastoris и Schizosaccharomyces pombe. Предпочтительными клетками-хозяевами являются клетки Saccharomyces cerevisisae. Наиболее предпочтительно, в качестве клеток-хозяев используют реципиентный штамм Saccharomyces cerevisiae D702, который является диплоидным, что обеспечивает повышенную стабильность его экспрессионных характеристик. Saccharomyces cerevisiae D702 содержит гомозиготные мутации в хромосомных аллелях структурного гена PGK1, кодирующего фосфоглицерат киназу, что обеспечивает стабильное поддержание вектора на средах, содержащих любой единственный источник углерода, усваиваемый дрожжами Saccharomyces cerevisiae, и гена GAL80, кодирующего белок - репрессор промотора GAL1, а также гомозиготную мутацию, приводящую к изменению регуляции гена GAL4, кодирующего белок - активатор промотора GAL1, вследствие чего осуществляется галактозо-регулируемая экспрессия генов, находящихся под контролем промотора GAL1.

В одном из наиболее предпочтительных воплощений изобретения клетки реципиентного штамма Saccharomyces cerevisiae D702 трансфомируют экспрессионным вектором pPDX3-HUB-1F9. Полученный в результате штамм SCR-702-1F9, продуцирующий рекомбинантный белок 1F9 каркасной нити паутины паука-кругопряда Nephila clavipes, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов (ВКПМ) как штамм Saccharomyces cerevisiae ВКПМ Y-3583.

Еще в одном из наиболее предпочтительных воплощений изобретения клетки реципиентного штамма Saccharomyces cerevisiae D702 трансфомируют экспрессионным вектором pPDX3-HUB-2E12. Полученный в результате штамм SCR-702-2E12, продуцирующий рекомбинантный белок 2Е12 каркасной нити паутины паука-кругопряда Nephila madagascariensis, депонирован во Всероссийской Коллекции Промышленных Микроорганизмов (ВКПМ) как штамм Saccharomyces cerevisiae ВКПМ Y-3584.

Еще в одном из наиболее предпочтительных воплощений изобретения клетки реципиентного штамма Saccharomyces cerevisiae D702 трансфомируют экспрессионным вектором pPDX3-SUMO-1F9.

Характеристика штаммов-продуцентов. Генотип:

Морфологические признаки:

При культивировании при температуре 28°С в течение 48 часов на агаризованной среде YPD следующего состава (в мас.%): пептон-2, дрожжевой экстракт - 1, глюкоза - 2, агар - 2, вода - остальное, клетки штаммов-продуцентов Saccharomyces cerevisiae имеют овальную форму, 3-7 мкм в диаметре. Клетки почкуются. Почкование истинное, многостороннее. Истинного мицелия не образуют. Колонии имеют следующий вид:

1) на агаризованной среде YPD колонии белого цвета с ровным краем, матовой поверхностью, линзовидным профилем и сметанообразной консистенцией;

2) на агаризованной среде с крахмалом (состав в мас.%: пептон - 2, дрожжевой экстракт - 1, крахмал - 1, агар - 2, вода - остальное) колонии белого цвета с узорчатым краем, матовой поверхностью, линзовидным профилем и крупчатой консистенцией.

Рост в жидкой среде с крахмалом: при 28°С в течение первых 24 ч культивирования - жидкость мутная, осадок белый, не комкуется, пристеночных пленок не образует.

Физико-химические признаки:

Оба штамма - факультативные анаэробы. Температура роста - 20-33°С (оптимум - 28°С). рН культивирования - 3,8-7,4 (оптимум - 5,0).

Ассимиляция источников углерода:

Оба штамма сбраживают глюкозу, фруктозу, мальтозу, сахарозу, декстрины, крахмал. Не сбраживают лактозу, галактозу, инулин, ксилозу, арабинозу. Ассимиляция источников азота:

Оба штамма усваивают аминокислоты, сернокислый аммоний, азотнокислый аммоний.

Хранение:

Штаммы хранят при температуре -70°С в 20% водном растворе глицерина. Возможно хранение на агаризованной богатой среде с глюкозой в течение 3 месяцев при +4°С.

Стабильность:

Стабильность заявляемых штаммов сохраняется при 20 последовательных пересевах на агаризованной среде YPD при температуре 28°С.

Патогенность:

Не являются патогененными.

Изобретение илюстрируется следующими примерами, представленными для подтверждения, но не ограничения оъема притязаний.

Еще одним аспектом изобретения является способ получения суспензий гелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины.

Другим аспектом изобретения является применение суспензий гелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины в медицинских целях.

Примеры

Пример 1. Конструирование вектора pPDX3-HUB

Структурный ген убиквитина дрожжей амплифицируют в реакции ПЦР с использованием в качестве матрицы хромосомной ДНК лабораторного штамма S.cerevisiae Y618 [Kartasheva et al, 1996, Yeast, v.l2, 1297-13], выделяемой по методу Сидорука [Сидорук с соавт., 2008, Сборник тезисов и докладов «Актуальные вопросы генетики, радиобиологии и радиоэкологии», Дубна, ОИЯИ, стр.100]. Праймерами для амплификации служат N513 (5'-ataccatggaacatcatcatcatcatcatggaggcatgcagatcttcgtcaagactttga) и N514 (5'-actggatccacctcttagccttagcacaac). Полученный в результате амплификации фрагмент ДНК размером 510 п.о. элюируют из агарозного геля с использованием набора Qiagen (Qiagen, cat. №28706), обрабатывают рестриктазами NcoI и BamHI и клонируют в расщепленной по тем же сайтам лабораторной плазмиде pUC18x-GALl-NcoI, несущей HindIII/Ncol фрагмент ДНК, кодирующий промоторную область гена GAL1 дрожжей. S.cerevisiae. В результате получают плазмиду р101-25, содержащую в своем составе нуклеотидную последовательность, кодирующую убиквитин дрожжей S.cerevisiae, слитую с нуклеотидной последовательностью промоторной области гена GAL1 дрожжей S.cerevisiae. Плазмида p101-25 содержит сайт узнавания рестриктазы XhoI в полилинкерной области следом за сайтом клонирования BamHI.

HindIII/XhoI фрагмент ДНК плазмиды р101-25, включающий промоторную область гена GAL1 и нуклеотидную последовательность, кодирующую убиквитин, клонируют в лабораторном векторе pPDX3, ДНК которого расщеплена по тем же сайтам. В результате клонирования получают вектор pPDX3-HUB, который используют для клонирования генов рекомбинантных белков паутины.

Пример 2. Конструирование экспрессионного вектора pPDX3-HUB-1F9

Экспрессионный вектор pPDX3-HUB-1F9 (Фиг.3) получают в результате клонирования BgIIIXhoI фрагмента ДНК лабораторной плазмиды pUC21-1F9 размером 3.6 т.п.н., включающего ген белка 1F9, в векторе pPDX3-HUB, ДНК которого расщеплена по сайтам BamHI и XhoI. В результате клонирования получают экспрессионный вектор pPDX3-HUB-1F9, в составе которого структурный ген белка 1F9 слит в одной рамке считывания со структурным геном, кодирующим убиквитин. Вектор используют для экспрессии белка 1F9 в клетках дрожжей S.cerevisiae.

Пример 3. Конструирование экспрессионного вектора pPDX3-HUB-2Е12

Экспрессионный вектор pPDX3-HUB-2E12 получают в результате клонирования BgIII/XhoI фрагмента ДНК лабораторной плазмиды pUC21-2Е12 размером 4.2 т.п.н., включающего ген белка 2Е12, в векторе pPDX3-HUB, ДНК которого расщеплена по сайтам BamHI и XhoI. В результате клонирования получают экспрессионный вектор pPDX3-HUB-2E12, в составе которого структурный ген белка 2Е12 слит в одной рамке считывания со структурным геном, кодирующим убиквитин. Вектор используют для экспрессии белка 2Е12 в клетках дрожжей S.cerevisiae.

Пример 4. Конструирование вектора pPDX3-SUMO.

Структурный ген SMT3 дрожжей S.cerevisiae, кодирующий белок SUMO, амплифицируют в реакции ПНР с использованием в качестве матрицы хромосомной ДНК лабораторного штамма S.cerevisiae, как в примере 1. Амплификацию проводят в две стадии. Сначала амплифицируют два перекрывающихся фрагмента ДНК, для чего используют следующие пары праймеров:

Фрагмент 1 размером 129 п.о.:

N450 (5'-atatccatggaaaagagatctgactcagaagtcaatcaagaa)

N454 (5'-cttgaagaaaatctctgaa)

Фрагмент 2 размером 230 п.о.:

N453 (5'-ttcagagattttcttcaag)

N452 (5'atatcaattggatccaccaatctgttctctgtga).

Амплифицированные фрагменты ДНК элюируют из агарозного геля и используют для ПЦР-лигирования. Для этого смесь фрагментов 1 и 2 используют в качестве матрицы для ПЦР, праймерами служат N450 и N452. Полученный в результате ПЦР фрагмент ДНК размером 290 п.о. элюируют из агарозного геля, обрабатывают рестриктазами BgIII и BamHI и клонируют в сайт BamHI лабораторной плазмиды pUC18x-GAL1-BamHI, несущей HindIII/BamHI фрагмент ДНК, кодирующий промоторную область гена GAL1 дрожжей S.cerevisiae, содержащую ATG кодон и сайт BamHI (подчеркнут) в последовательности ATGCATGGATCC. В результате осуществляют слияние последовательности гена SMT3 дрожжей S.cerevisiae и последовательности, кодирующей промоторную область гена GAL1 дрожжей S.cerevisiae. В результате получают плазмиду p101-18, в составе которой клонированный ген SMT3 секвенируют.

Полученная плазмида p101-18 содержит фрагмент ДНК, в составе которого ген SMT3 дрожжей слит с промоторной областью гена GAL1 дрожжей. В полилинкерной части плазмиды p101-18 следом за сайтом клонирования BamHI находится сайт узнавания рестриктазы XhoI. HindIII/XhoI фрагмент ДНК плазмиды p101-18, включающий промоторную область гена GAL1 и клонированный ген SMT3, клонируют в лабораторном векторе pPDX3, ДНК которого расщеплена по тем же сайтам. В результате клонирования получают вектор pPDX3-SUMO, который используют для клонирования генов рекомбинантных белков паутины.

Пример 5. Конструирование экспрессионного вектора pPDX3-SUMO-1F9.

Экспрессионный вектор pPDX3-SUMO-1F9 (Фиг.4) получают в результате клонирования BgIII/XhoI фрагмента ДНК лабораторной плазмиды pUC21-1F9 размером 3.6 т.п.н., включающего ген белка 1F9, в векторе pPDX3-SUMO, ДНК которого расщеплена по сайтам BamHI и XhoI. В результате клонирования получают экспрессионный вектор pPDX3-HUB-1F9, в составе которого структурный ген белка 1F9 слит в одной рамке считывания со структурным геном, кодирующим убиквитин. Вектор используют для экспрессии белка 1F9 в клетках дрожжей S.cerevisiae.

Пример 6. Конструирование штамма SCR-702-1F9 - продуцента белка 1F9(ВКПМ Y-3583).

Штамм SCR-702-1F9 получают в результате трансформации лабораторного штамма D702 экспрессионным вектором pPDX3-HUB-1F9. Для осуществления трансформации клетки штамма D702 подращивают в течение 18-24 часов при температуре 28°С на агаризованной среде YPGE следующего состава в мас.%: бактопептон - 2, дрожжевой экстракт - 1, бактоагар - 2, этанол - 2, глицерин - 3, вода - остальное. Трансформацию выращенных клеток штамма D702 проводят по методу Ito с соавт. [Ito et al., 1983, J.BacterioL, v.153, 163-168]. Трансформанты отбирают по способности расти на среде YPD следующего состава в мас.%: бактопептон - 2, дрожжевой экстракт - 1, глюкоза - 2, бактоагар - 2, вода - остальное. Один из полученных трансформантов называют SCR-702-1F9.

Пример 7. Конструирование штамма SCR-702-2E12 - продуцента белка 2Е12.

Штамм SCR-702-2E12 получают в результате трансформации лабораторного штамма D702 экспрессионным вектором pPDX3-HUB-2E12. Трансформацию осуществляют, как в примере 6. Штамм SCR-702-2E12 депонирован во Всероссийской Коллекции Промышленных Микроорганизмов как штамм Saccharomyces cerevisiae ВКПМ Y-3584.

Пример 8. Конструирование штамма D702-SUMO-1F9 - продуцента белка 1F9.

Штамм D702-SUMO-1F9 получают в результате трансформации лабораторного штамма D702 экспрессионным вектором pPDX3-SUMO-1F9. Трансформацию осуществляют, как в примере 4, за исключением того, что используют плазмиду pPDX3-SUMO-1F9.

Пример 9. Анализ экспрессии рекомбинантных белков 1F9 и 2Е12 в клетках штаммов Saccharomyces cerevisiae.

Клетки S.cerevisiae ВКПМ Y-3583, ВКПМ Y-3584 или D702-SUMO-1F9 культивируют в колбах при 30°С на ротационной качалке со скоростью 250 об/мин на жидкой среде YPD состава, в мас.%: бактопептон - 2, дрожжевой экстракт - 1, глюкоза - 2, вода - остальное, засевая в титре 5×105-5×106 мл-1. Образцы для анализа отбирают через 46 часов роста культуры. Конечная оптическая плотность культуры составляет ОД600=40-45. Клетки отделяют от среды культивирования осаждением с помощью центрифугирования при 10000 g в течение 1 мин и используют для последующего анализа экспрессии белков 1F9 и 2Е12 микрометодом в пробирке на 1,5 мл. Для этого осадок клеток суспендируют в "буфере для разрушения" (0,05 М фосфата натрия, 2,5 мМ ЭДТА, 5% глицерина) из расчета 100 мкл буфера на 100 мкл влажного осадка клеток. Разрушение клеток осуществляют с помощью стеклянных шариков (d=0,45-0,65 мм) на встряхивателе для пробирок типа «Вортекс». Для этого 570 мг шариков смешивают с 200 мкл суспензии клеток, смесь встряхивают при 0°С в течение 90 сек, к содержимому пробирок добавляют 250 мкл «буфера для разрушения» и встряхивание повторяют еще 60 сек. В пробирки вносят 500 мкл «буфера для разрушения», содержимое пробирок перемешивают, после чего полученные образцы центрифугируют в течение 10 мин при 16000 g. В супернатанте, содержащем водорастворимые белки дрожжевых клеток, с помощью 1М раствора ацетата натрия доводят рН до 4,0 и выпавший материал удаляют центрифугированием в течение 5 мин при 16 тыс.об/мин; супернатант затем прогревают при 65°С 20 минут и выпавшие в осадок балластные белки удаляют центрифугированием; полученный раствор диализуют 40 минут против 10 мМ ацетата натрия, рН 4,0. Осадок водонерастворимых белков суспендируют в 750 мкл «буфера для разрушения», переносят в новые пробирки и центрифугируют в течение 15 мин при 16000 g. Полученный осадок (100 мкл), содержащий целевые белки, суспендируют в 400 мкл буфера «6,5G» (6,5 М раствор гуанидин гидрохлорида или гуанидин тиоцианата в буфере, содержащем 0.1 М фосфата натрия, 0.01 М Tris-HCl, рН 6.5) и целевые белки экстрагируют в течение ночи на магнитной мешалке при температуре +4°С. Затем суспензию центрифугируют в течение 15 мин при 16000 g, супернатант с перешедшим в него целевым белком диализуют против 300 мл 5 мМ ацетата натрия в течение 1,5 часов. Полученный образец центрифугируют в течение 15 мин при 16000 g и супернатант используют для электрофоретического анализа уровня продукции целевого белка.

Электрофоретический анализ целевого белка проводят 12% ПААГ-ДДС-Na по стандартной процедуре Лэммли [Laemmli, 1970, Nature, v.227, 680-685]. Для анализа раствор разводят приблизительно в 500-1000 раз «буфером для образцов» (0.0625 М Tris-HCl, рН 6.8, 2 мас.% ДДс-Na, 0.0025 мас.% бромфенол blue). И кипятят в водяной бане в течение 5 минут. Аликвоты в 3-15 мкл наносят на 12% ПААГ и подвергают электрофорезу в аппарате Bio Rad MiniPROTEAN, пока фронт красителя будет на расстоянии 1 см до конца геля. Гели отмывают в воде и окрашивают в 0,2% растворе Кумасси R-250 (Fermentas). Электрофоретический анализ показывает, что белки 1F9 и 2Е12 накапливаются во фракции водонерастворимых белков клеток дрожжей S.cerevisiae и не содержат компонент SUMO или убиквитина (Фиг.1 и 2). На это указывает электрофоретическая подвижность анализируемых белков и отсутствие в геле полос белка, соответствующих по подвижности гибридным белкам 1F9 и 2Е12, слитых с белком SUMO или убиктивином.

Количественную оценку чистоты препаратов осуществляли с помощью программы «Видеоденситометр Сорбфил 1.0», для чего окрашенные гели после электрофореза сканировали, полученное изображение вводили в компьютер и оценку количества белка в пятне и на каждой дорожке определяли с помощью указанной программы. В качестве стандартов сравнения использовали высокоочищенные препараты исследуемых белков, известное количество которых наносили на соседние дорожки в том же геле. Чистота препаратов белков, оцененная таким способом, составляла 96% и выше.

Пример 10. Продукция белков 1F9 и 2Е12 штаммами Saccharomyces cerevisiae ВКПМ Y-3583 и ВКПМ Y-3584

Для получения посевного материала штаммы ВКПМ Y-3583 и ВКПМ Y-3584 выращивают в среде YPD на ротационной качалке со скоростью 250 об/мин при температуре 28°С в течение 20-24 часов. 50 мл посевного материала используют для засева 3-литрового ферментера Anglicon, содержащего 950 мл среды YPD. Ферментацию проводят при температуре 28°С, аэрации 1 л/мин и скорости перемешивания 1000 об/мин. Через 24 часа после засева ферментера начинают подпитку среды культивирования 50%-ным раствором глюкозы со скоростью 2 мл/ч и устанавливают рН-статирование культуры на уровне рН 6.8±0.1, используя для подтитровки растворы 10% серной кислоты и 10% NaOH. Среднее общее время ферментирования составляет 72 часа. По данным электрофоретического анализа продукция белка 1F9 в этих условиях составляет не менее 200 мг/л культуральной жидкости, и продукция белка 2Е12 в этих условиях составляет не менее 100 мг/л культуральной жидкости.

Пример 11. Выделение и очистка рекомбинантных белков 1F9 и 2Е12 из водонерастворимой фракции клеток Saccharomyces cerevisiae.

Выделение и очистку белков 1F9 и 2Е12 из водонерастворимой фракции клеток штаммов-продуцентов ВКПМ Y-3583 и ВКПМ Y-3583 проводят с использованием методов, описанных Богушем с соавт. [Богуш В.Г. с соавт., 2001, Биотехнология, т.2, 11-22; Богуш В.Г. с соавт., 2006, Биотехнология, т.4, 3-12; Bogush V.G. et al., 2009, J. Neuroimmune Pharmacol., v.4, 17-27]. При наращивании биомассы дрожжей S.cerevisiae в 3-литровом ферментере на среде YPD без подпитки в присутствии 2% глюкозы в стартовой среде с одной ферментации получают в среднем 400-500 г влажной клеточной биомассы. 1 кг промытой влажной биомассы суспендируют в «буфере для разрушения» и клетки разрушают с помощью стеклянных шариков в проточной мельнице в течение 1,5 часов, центрифугируют полученную суспензию и собирают осадок. Экстракцию целевого белка из осадка осуществляют с помощью раствора 10% лития хлористого в 90%-ной муравьиной кислоте в течение 16-18 часов с последующим центрифугированием. Осадок отбрасывают, а супернатант подвергают ультрафильтрации с последующей диафильтрацией через мембрану М50 для перевода в 10 мМ ацетат натрия, рН 4,0 и удаления белков клетки хозяина с молекулярной массой ниже 50 кДа.

Окончательную очистку проводят с помощью ионно-обменной хроматографии на катионообменной колонке HiPrep 16/10 SP FF (GE Healthcare) в системе ФПЛС. После прохождения фильтрата через колонку и последующей промывки колонки 10 мМ Na-фосфатным буфером, рН 7,0 и затем 10 мМ натрий-ацетатным буфером, рН 4,0, белки 1F9 и 2Е12 элюируют с колонки 10%-ным раствором NaCl в том же буфере и идентифицируют электрофоретически в 12% ПААГ-ДДс-Na, фракции с целевым белком объединяют, диализуют против деионизованной воды, замораживают при

-70°С и лиофильно высушивают. Лиофилизованный препарат представляет собой субстанцию белого цвета, похожую на вату.

Пример 12. Определение характеристик белков 1F9 и 2Е12

Для проведения анализа полученного препарата чистого рекомбинантного белка предварительно растворяют навеску препарата в 90%-ной муравьиной кислоте с 10%-ным хлоридом лития в течение не менее 2 часов, диализуют против деионизованной воды (1-1,5 часа) и анализируют с помощью SDS-электрофореза в 12% ПААГ. Наличие одной полосы в геле, соответствующей молекулярномой массе рекомбинантного белка, подтверждает гомогенность получаемого препарата. Полученные препараты обоих белков характеризуются коэффициентом экстинкции, равным приблизительно 0,48±0,02 ОЕ280/мг. Эта величина соответствует теоретически рассчитанной, исходя из аминокислотного состава этих белков (0,49 ОЕ280/м), и свидетельствует о высокой чистоте полученных препаратов.

Для анализа способности очищенных рекомбинантных белков паутины паука-кругопряда образовывать надмолекулярные структуры различных типов эти белки были протестированы на способность формировать не растворяющиеся в воде нити. Нити получают в результате спиннинга (прядения) концентрированного раствора белка через узкое отверстие. Для этого навеску очищенного лиофильно высушенного препарата белка растворяют в 90%-ной муравьиной кислоте с 10%-ным хлоридом лития в течение не менее 2 часов, диализируют против деионизованной воды в течение 1-1,5 часов и нерастворившийся материал удаляют центрифугированием. Раствор белка пропускают через специально сконструированный микроспиннерет с внутренним диаметром около 50 мкм со скоростью 5-10 мкл/мин в коагуляционную ванну с 96%-ным этанолом. При этом образуется водонерастворимая нить, которая свободно ниспадает на дно сосуда. Вновь образованные искусственные нити в сосуде с этанолом представлены на Фиг.6. Новообразованную нить выдерживают в сосуде с 96%-ным спиртом в течение 20 минут, затем максимально растягивают в 75%-ном этаноле, отжигают, выдерживают в деионизованной воде и высушивают на воздухе. Нити, подвергнутые всем этапам воздействия, характеризуются значениями относительной разрывной нагрузки в 10-15 сН/текс (13 мПа).

Приведенные результаты показывают, что при осуществлении предложенного способа получения рекомбинантных белков паутины паука-кругопряда достигнуто существенное повышение выхода рекомбинантных белков, причем получаемые рекомбинантные белки характеризуются высокой чистотой и физико-химическими свойствами, характерными для природных белков паутины. Предложенный способ получения рекомбинантного белка паутины позволяет получать препараты рекомбинантного белка с очень высокой степенью очистки в промышленном масштабе, разрабатывать способы микропрядения для получения на его основе искусственных волокон, а также способы формирования пленок, гидрогелей, микрогелей и микрокапсул на основе рекомбинантных белков паутины для использования в биотехнологии, медицине, косметологии, автомобильной и авиационной промышленности и других областях.

Пример 12. Получение микрогелевых частиц с заданным размером.

1. Получение раствора белка.

Белок рекомбинантной паутины (10-20 мг) растворяют 12-18 час в 250 мкл 10% лития хлористого в 90%-ной муравьиной кислоте.

2. Освобождение от растворителя.

2.1. Диализ раствора против 1 л калий-фосфатного буфера (КФБ), рН 8,0).

2.2. Диализ ведут 3 часа с двумя сменами диализного буфера (интервал смены - 1 час).

2.3. ЦФ (20 мин).

2.4. Определение концентрации белка по СФ (λ=280 нм).

3. Получение геля.

3.1. 200 мкл раствора белка озвучивают ультразвуком 10 сек (УЗВ).

3.2. Раствор оставляют при комнатной температуре до образования геля (20-25 час).

4. Получение микрогелевой суспензии.

4.1. 50 мг геля протирают через сито с размером ячеек 200 мкм.

4.2. Частицы микрогеля собирают шпателем в пробирку, добавляют 300 мкл 96%-ного этилового спирта, встряхивают и выдерживают 5 мин.

4.3. Частицы осаждают ЦФ 5 мин.

4.4. К осадку приливают 300 мкл воды, встряхивают.

5. Определение размера микрогелевых частиц. Размер частиц контролируют под микроскопом, используя камеру Горяева. В суспензии превалируют частицы с размерами 50-200 мкм.

6. Получения микрогелевых частиц с размерами 10-100, 50-200, 150-300, 200-400 мкм.

6.1. Метод дифференциального ЦФ.

- к осадку микрогелевых частиц добавляют 600 мкл воды, встряхивают вручную;

- ЦФ 5 сек и отбирают 300 мкл с частицами в другую пробирку;

- в первую пробирку вновь добавляют 300 мкл воды, встряхивают;

- ЦФ 5 сек и отбирают 300 мкл с частицами во вторую пробирку;

- вторую пробирку ЦФ (10 мин, 14500 об/мин);

- осадок суспендируют в нужном объеме воды.

6.2. Метод просеивания.

Как в п.4, но используют сито с размером ячеек 100, 200, 300, 400 мкм, в суспензии превалируют частицы с размерами соответственно 10-100, 50-200, 150-300, 200-400 мкм.

Пример 13. Адгезия и пролиферация мышиных фибробластов на поверхности гидрогелевых микрочастиц из рекомбинантного спидроина.

Культивирование клеток

Суспензию гидрогелевых микрочастиц размером 400 мкм помещали в лунки 24-луночного планшета для культивирования клеток и добавляли 1000 мкл суспензии мышиных фибробластов 3Т3 в концентрации 24000 клеток в 1 мл культуральной среды DMEM (Sigma), содержащей 10% фетальной бычьей сыворотки. Через 2 часа отмывали не прикрепившиеся к субстрату клетки и инкубировали при 37°С в присутствии 6.1% CO2. Культуральную среду меняли каждые 2 дня. Изучали адгезию и рост клеточной культуры методом лазерной сканирующей конфокальной микроскопии.

Лазерная конфокальная микроскопия

Для сканирующей лазерной конфокальной микроскопии использовали микроскоп Axiovert 200M LSM510 МЕТА (Carl Zeiss, Jena, Germany) с объективом Plan-Neofluar 10х/0,3. Серии оптических срезов для получения изображений с высоким разрешением получали с одного или синхронно с двух каналов с установленным согласно рекомендациям производителей размером пинхола (pinhole). Диаметр пинхола был 1 диск Эйри (Airy unit), дающий оптимальное соотношение сигнала к шуму. Настраивали Пример 13. Адгезия и пролиферация мышиных фибробластов на поверхности гидрогелевых микрочастиц из рекомбинантного спидроина.

Изучение адгезии и роста клеток на поверхности гидрогелевых микрочастиц

Для определения количества прикрепленных клеток изучали образцы методом конфокальной микроскопии через 24 часа после инокуляции. Изменение количества клеток наблюдали через 4, 7 и 14 дней инкубации. Образцы фиксировали формалином и выявляли клетки флуоресцентным красителем SYTOX® Green nucleic acid stain (Invitrogen, Карлсбадам, США), ядерным красителем с высокой афинностью к нуклеиновым кислотам. Гидрогелевые микрочастицы с клетками инкубировали в растворе в течение 20 минут при постоянном перемешивании. После связывания SYTOX Green с ДНК наблюдается увеличение его флюоресценции в 500 раз (согласно инструкциям производителя). На 4-й, 7-й и 14-й день культивирования наблюдалось увеличение количества фибробластов, свидетельствующее об активной пролиферации клеток

Пример 14. Имплантация гидрогелевых микрочастиц под кожу мышам. Для исследования местного действия после имплантации и способности к деградации гидрогель из аналога спидроина 1 имплантировали подкожно лабораторным мышам линии Balb/c четырехмесячного возраста. Перед операцией животные в течение 7 дней содержались в виварии для акклиматизации. Содержание животных и условия проведения экспериментов in vivo соответствовали ГОСТ Р ИСО 10993-2-2009 "Требования к обращению с животными" и ГОСТ Р ИСО 10993-6-2009 "Исследование местного действия после имплантации".

Условия хирургического вмешательства и эксперимента

Перед процедурой имплантации удаляли шерсть с поверхности кожи мышей депиляционным кремом. Проводили премедикацию карпрофеном (carprofen): препарат Римадил (Pfizer Animal Health, США) (с действующим веществом карпрофен) вводили из расчета 5 мг на 1 кг согласно рекомендациям производителя.

Операцию проводили в стерильных условиях под общей анестезией препаратом Золетил 100 (Virbac Sante Animale, Kappoc, Франция) в дозе 5 мг на 100 г. Введение препарата внутрибрюшинное. Перед имплантацией участок кожи в месте разреза обеззараживали 0,05%-ным раствором хлоргексидина (Биоген, РФ), а излишки антисептика удаляли стерильными салфетками. Для имплантации делали разрез длиной 5 мм на спине животного абаксиально относительно срединной линии; подкожный карман формировали с помощью заостренного шпателя, отделяя подкожные ткани от мышечного слоя. 200 мкл образца в виде суспензии микрочастиц в фосфатно-солевом стерильном буфере помещали в образовавшуюся полость с помощью стерильного пинцета. Разрез закрывали нерассасывающейся полипропиленовой нитью, накладывая простые узелковые хирургические швы. Рану обрабатывали антисептиком и закрывали клеем медицинским БФ-6 (Вертекс ЗАО, РФ).

После пробуждения животные были активны и не проявляли признаков дискомфорта. Через 2 месяца имплантированные образцы извлекали для гистологических исследований.

Извлечение имплантата и подготовка образцов тканей

Исследования проводились в соответствии с ГОСТ Р ИСО 10993-6-2009 "Исследование местного действия после имплантации".

Имплантированные образцы с прилежащей тканью извлекали, промывали фосфатно-солевым буфером и фиксировали в смеси Буэна согласно стандартной методике. Образцы дегидратировали в растворах этанола возрастающей концентрации (растворы этанола 50%, 60%, 70%, 80%, 96%, 100%) по 2 часа в каждом, удаляли спирт инкубацией в смеси изопропанола и O-ксилола (1:1) в течение 2 часов и в двух сменах чистого O-ксилола по 30 минут. Обезвоженные образцы подготавливали к заливке в парафин последовательной инкубацией в расплавленной смеси Histomix® (BioVitrum, РФ) и O-ксилола (1:1) в течение 1 часа и далее в трех сменах расплавленного Histomix® при 52°С по 30 минут в каждой. Подготовленные образцы ткани помещали в формы для заливки блоков и заливали расплавленным Histomix®.

Подготовка срезов для гистологических исследований

Для приготовления срезов толщиной 5 мкм из заключенных в парафин образцов использовали микротом Ротмик-1 (Орион Медик, РФ). Срезы наклеивали на поверхность предметных стекол. Срезы перед гистологическими исследованиями депарафинировали последовательной инкубацией в двух сменах O-ксилола и в 100% этаноле, ополаскивали в 100% этаноле, двух сменах 96% спирта и двух сменах дистиллированной воды.

Депарафинированные срезы окрашивали смесью гематоксилина и эозина по стандартной методике. Перед окрашиванием срезы промывали дистиллированной водой. Далее срез инкубировали в растворе квасцового гематоксилина по Эрлиху, промывали в водопроводной воде, инкубировали в 1%-ном водном растворе эозина и промывали в водопроводной воде. После удаления излишков воды срезы последовательно инкубировали в 96% этаноле и ксилоле, а затем заключали в бальзам.

Микроскопические исследования имплантата

Микроскопические исследования для изучения местного действия после имплантации проводились согласно ГОСТ Р ИСО 10993-6-2009. Гистологические срезы изучали с использованием микроскопа Zeiss Imager Al (Zeiss) с объективами Zeiss ЕС Plan-Neofluar 40х/0,75 Ph2 и А-plan 20х/0,45 Ph2. Изображения получали с помощью камеры AxioCam MRc 5 (Zeiss), изображения обрабатывали с помощью программного обеспечения Axio Vision 4.7.2 (Zeiss). Также срезы изучали на микроскопе Leica DM 1000 (Leica Microsystems, Inc., Банокберн, США) с объективами Leica Hi-Plan 40x/0,65 и 10х/0,25 и камерой Leica DFC 295 и полученные изображения обрабатывали при помощи программного обеспечения Leica Application Suite Version 3.4.0.

В результате было установлено, что при имплантации гидрогеля происходит интеграция имплантата в окружающие ткани и новообразование ткани. Гистологическое изучение имплантатов не показало никаких фенотипических изменений прорастающих в имплантат тканей, которые могли бы свидетельствовать о нарушениях физиологии контактирующих с гидрогелем клеток: адипоциты и фибробласты имеют характерные для клеток этого типа морфологию и размер. Обнаруженный высокий уровень неоваскуляризации подтверждает отсутствие токсического действия на эндотелиальные клетки. Признаков формирования неблагоприятных условий для роста клеток в местах активной деструкции имплантата не обнаружено, в местах разрушения гидрогеля происходит активный рост ткани и выявляются молодые фибробласты.

1. Способ получения суспензии гидрогелевых микрочастиц с заданными размерами на основе рекомбинантного белка паутины, включающий получение раствора белка, освобождение от растворителя, получение гидрогеля, получение микрогелевой суспензии, определение размера гелевых микрочастиц, получение гелевых микрочастиц с заданными размерами, отличающийся тем, что используют рекомбинантный белок паутины паука-кругопряда, консенсусные последовательности которого происходят из повторяющихся последовательностей белков каркасной нити MaSp1 и/или MaSp2 большой ампуловидной железы, белков MiSp1 и/или MiSp2 малой ампуловидной железы или белка Flag ловчей нити паука-кругопряда, который растворяют в растворе лития хлористого в муравьиной кислоте, диализ раствора проводят против калий-фосфатного буфера (КФБ), центрифугируют, раствор белка подвергают воздействию ультразвука, раствор оставляют при комнатной температуре до образования геля в течение 20-25 ч, гель протирают через сито с нужным размером ячеек, помещают в 96%-ный этиловый спирт, встряхивают, выдерживают 5 мин, микрочастицы разделяют дифференциальным центрифугированием.

2. Способ по п.1, в котором последовательность рекомбинантного белка паутины паука-кругопряда включает консенсусные последовательности, происходящие из повторяющихся последовательностей белков каркасной нити MaSp1 и MaSp2 большой ампуловидной железы пауков Nephila clavipes и Nephila madagascariensis, выбранные из группы:
AGQGGYGGLGSQGAGRGGLGGQGAGAAAAAAAGGAGQGGLGGQG
AGQGAGASAAAAGGAGQGGYGGLGSQG
AGRGGLGGQGAGAVAAAAAGGAGQGGYGGLGSQG
AGRGGQGAGAAAAAAGGAGQRGYGGLGNQG
GPGGYGPGQQGPGAAAAASA
GRGPGGYGPGQQGPGGSGAAAAAA
GSGPGGYGPGQQGPGGPGAAAAAAA
GRGPGGYGPGQQGPGQQGPGGSGAAAAAA
GRGPGGYGPGQQGPGGPGAAAAAA
GPGGYGPGQQGPGAAAAAAA
GSGAGGYGPGQQGPGGPGAAAAAA
GSGPGGYGPGQQGPGGSSAAAAAA
GSGPGGYGPGQQGPGGSGAAAAAAAA
GRGPGGYGQGQQGPGGPGAAAAAA

3. Способ по п.1, отличающийся тем, что содержит последовательности рекомбинантного белка 1F9 каркасной нити паука-кругопряда Nephila clavipes.

4. Способ по п.1, отличающийся тем, что содержит последовательности рекомбинантного белка каркасной нити 2Е12 паука-кругопряда Nephila madagascariensis.

5. Применение суспензии гидрогелевых микрочастиц, полученных способом по п.1, для адгезии и пролиферации клеток человека или животных на поверхности гидрогелевых микрочастиц или имплантации гидрогелевых микрочастиц в организм человека или животных.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к получению рецептора фактора некроза опухоли, и может быть использовано в медицине. .

Изобретение относится к области биотехнологии, конкретно к получению рецептора фактора некроза опухоли, и может быть использовано в медицине. .

Изобретение относится к области иммунологии. .

Изобретение относится к области иммунологии. .

Изобретение относится к области биотехнологии, конкретно к получению модифицированных белков IGF-1, и может быть использовано в медицине. .

Изобретение относится к области биотехнологии, конкретно к получению модифицированных белков IGF-1, и может быть использовано в медицине. .

Изобретение относится к области биохимии. .

Изобретение относится к области биотехнологии, конкретно к экспрессионным конструкциям, и может быть использовано для экспрессии иммуноглобулина

Изобретение относится к области биотехнологии

Изобретение относится к области биотехнологии, в частности к способу анализа частоты взаимодействия нуклеотидной последовательности-мишени с одной или несколькими представляющими интерес нуклеотидными последовательностями
Изобретение относится к области биотехнологии, а именно к способу дифференцирования подвидов туляремийного микроба
Наверх