Набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для видоспецифичной экспресс-идентификации вируса эбола-судан методом полимеразной цепной реакции



Набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для видоспецифичной экспресс-идентификации вируса эбола-судан методом полимеразной цепной реакции
Набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для видоспецифичной экспресс-идентификации вируса эбола-судан методом полимеразной цепной реакции
Набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для видоспецифичной экспресс-идентификации вируса эбола-судан методом полимеразной цепной реакции

 


Владельцы патента RU 2487167:

Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") (RU)

Изобретение относится к области биотехнологии и касается набора олигонуклеотидных праймеров и флуоресцентномеченых зондов для видоспецифической экспресс-идентификации вируса Эбола-Судан методом полимеразной цепной реакции в реальном времени. Набор включает последовательности, видоспецифичные для вируса Эбола-Судан:

внешние: 5'→3'5'CCGTTATTCTCYACRAAGRTSATTAGTGA3'

3'←5'5'TTCTCTAGGTCTGTGACAAAACTACTCCC3'

внутренние: 5'→3'5'TGGGATGCAGTHTTYGARCC3'

3'←5'5'ACAACCATCATRTTGCTTGGAAAGGCTT3'

зонд: FAM - TATTGCCCCAGAATCGAAATTTTTCTTTTTCATTGAA-BHQ1.

Представленное изобретение может быть использовано в медицине для быстрого выявления генетического материала (РНК) вируса Эбола-Судан. 1 ил., 3 табл., 2 пр.

 

Изобретение относится к биотехнологии, в частности к генетической инженерии, и может быть использовано в медицине для выявления генетического материала (РНК) вируса Эбола-Судан в клинических или секционных пробах, в образцах внешней среды с целью постановки диагноза или коррекции лечения, а также для решения научно-исследовательских задач по изучению свойств филовирусов, созданию диагностических, профилактических или лечебных препаратов против филовирусов. При помощи набора диагностических праймеров возможно выявление генетического материала (РНК) вирусов Эбола-Судан в исследуемом образце.

Вирусы Эбола входят в семейство филовирусов (Filoviridae). Семейство Filoviridae, в соответствии с последними решениями Международного Таксономического Комитета, включает в себя два рода: Marburgvirus и Ebolavirus (http:/www.ncbi.nlm.nih.gov/ICTVdb/Ictv/index.him).

Род Ebolavirus включает в себя 4 вида:

- Эболавирус Рестон (Reston ebolavirus - REBOV);

- Эболавирус Судан (Sudan ebolavirus - SEBOV);

- Эболавирус леса Тай (Tai Forest ebolavirus - TFEBOV);

- Эболавирус Заир (Zaire ebolavirus - ZEBOV).

Заболевания, вызванные вирусом Эбола, протекают с одинаковыми клиническими проявлениями. Необходимость диагностировать филовирусы друг от друга вызвана как минимум двумя причинами. Во-первых, дифференциация геморрагической лихорадки Марбург от геморрагической лихорадки Эбола необходима, потому что для лечения этих заболеваний может использоваться специфический иммуноглобулин. Антигенного перекреста между вирусом Марбург и вирусом Эбола нет, и иммуноглобулины от одного заболевания не помогут при лечении другого. Вторая причина необходимости идентификации вида филовируса связана с тем, что правильное молекулярно-эпидемиологическое заключение необходимо для проведения адекватных и своевременных мероприятий санитарно-эпидемиологического надзора.

Известны праймеры (аналог) для определения генетического материала вирусов Марбург и Эбола [Zhai J., Palacios G., Towner J.S et al. Rapid Molecular Strategy for Filovirus Detection and Characterization // J. Clin. Microbiol., 2007, 45(1): 224-6].

Однако накопление данных по геномному разнообразию филовирусов и детальный анализ этих данных показали, что и этот набор праймеров в ряде случаев может не обеспечить надежной идентификации филовирусов, поскольку были выявлены геноварианты вируса, для которых вышеназванные наборы праймеров не обладают достаточной специфичностью, чтобы обеспечить надежный синтез целевых фрагментов ДНК. Для ПЦР использованы не меченные флюорофором праймеры, и это не позволяет определить количество РНК вируса в анализируемой пробе. Кроме этого, с помощью предложенных праймеров можно провести только один раунд ПЦР, а по данным литературы [Towner J.S., Rollin P.E., Bausch D.G. et al. Rapid Diagnosis of Ebola Hemorrhagic Fever by Reverse Transcription-PCR in an Outbreak Setting and Assessment of Patient Viral Load as a Predictor of Outcome // J. Virol., 2004, 78(8): 4330-41] чувствительность тест-систем, использующих однораундовый ПЦР, составляет 100-1000 РНК вируса. Однораундовая тест-система, ввиду низкой чувствительности, может не определить наличие РНК вируса, как, например, это было в случае туристки из Колорадо (2008 год), у которой после возвращения из Уганды на 10 сут после появления клинических признаков заболевания РНК вируса Марбург определена не была. При перестановке этого же образца двураундовым ПЦР уже через 6 мес (когда ИФА тест показал нарастание антител к вирусу Марбург) РНК вируса Марбург была обнаружена [Fujita N., Miller A., Gershman К. et al. Imported Case of Marburg Hemorrhagic Fever, Colorado, 2008 // JAMA, 2010, 303 (5): 413-5. (Reprinted MMWR. 2009; 58: 1377-1381)].

Наиболее близким аналогом (прототипом) являются семейство-специфичные олигонуклеотидные праймеры, которые позволяют выявить наличие в образце одного из представителей семейства филовирусов методом ПЦР [Grolla A., Lucht A., Dick D., Strong J.E., Feldmann H. Laboratory diagnosis of Ebola and Marburg hemorrhagic fever // Bull Soc Pathol Exot, 2005, 98(3): 205-209].

Однако для проведения ПЦР используются семейство-специфичные праймеры, которые позволяют выявить наличие в образце одного из представителей семейства филовирусов и не позволяют идентифицировать вид вируса. При лечении больного сывороткой или плазмой важно знать, к какому виду относится вирус, вызвавший заболевание, в противном случае эффективность лечения будет существенно снижена. Кроме этого, определение вида филовируса очень важно и для организации противоэпидемических мероприятий.

Техническим результатом заявляемого изобретения является создание более специфичного набора олигонуклеотидных праймеров и зондов для идентификации генетического материала вируса Эбола-Судан в клинических образцах и биологических жидкостях, образцах внешней среды и других вируссодержащих пробах (культуральная вируссодержащая жидкость и т.д.) методом мультиплексного ПЦР в режиме реального времени.

Указанный технический результат достигается путем сконструированного набора олигонуклеотидных праймеров и флуоресцентномеченых зондов (на консервативную область L-гена, кодирующего РНК полимеразу вируса Эбола-Судан для видоспецифичной экспресс-идентификации вируса Эбола-Судан методом полимеразной цепной реакции в реальном времени, включающего последовательности, видоспецифичные для вируса Эбола-Судан:

внешние:

5'→3'5'CCGTTATTCTCYACRAAGRTSATTAGTGA3'

3'←5'5'TTCTCTAGGTCTGTGACAAAACTACTCCC3'

внутренние:

5'→3'5'TGGGATGCAGTHTTYGARCC3'

3'←5'5'ACAACCATCATRTTGCTTGGAAAGGCTT3'

зонд:

FAM - TATTGCCCCAGAATCGAAATTTTTCTTTTTCATTGAA-BHQ1

На начальном этапе для каждого из вирусов были подобраны и синтезированы пары специфических олигонуклеотидных праймеров и зонды для гибридизационно-флуоресцентной детекции продуктов ПЦР.

Таблица 1.
Праймеры и зонды для детекции вируса Эбола-Судан
Вирус Праймеры и зонды Структура олигонуклеотидной последовательности Т отжига (°С) Размер ампликона
Эбола-Судан F12981 CCGTTATTCTCYACRAAGRTSATTAGTGA 56 504
R13485 TTCTCTAGGTCTGTGACAAAACTACTCCC 56
F13060 TGGGATGCAGTHTTYGARCC 55 307
R13367 ACAACCATCATRTTGCTTGGAAAGGCTT 56
Z13201 Kp*-TATTGCCCCAGAATCGAAATTTTTCTTTTTCATTGAA-BHQ1 64 -
Примечание; Кр* - краситель (FAM)

Для этого в базе данных NCBI Mega BLAST (http://www.ncbi.nlm.mh.gov/) были выбраны наиболее консервативные участки геномов вируса Эбола-Судан. Были проанализированы все имеющиеся в литературе последовательности каждого из вирусов. Для всех филовирусов участки-мишени генома соответствовали L-гену, кодирующему основной компонент РНК-полимеразы. Последовательности праймеров и зондов, температуры их отжига и размеры продуктов амплификации представлены в таблице 1.

Подбор и анализ свойств олигонуклеотидных праймеров и зондов проводился с использованием программного обеспечения Vector NTI 9.0.0 (InforMax).

Пример 1. Проверка аналитической чувствительности набора праймеров и зондов.

Для контроля амплификации были получены положительные контрольные образцы, представляющие собой рекомбинантные плазмиды, несущие вирусспецифические вставки, являющиеся матрицей для амплификации вирусспецефических ДНК-фрагментов.

Для проведения ПЦР в режиме реального времени в качестве анализируемых образцов использовали рекомбинантную плазмидную ДНК, включающую вставку ДНК, соответствующую детектируемым участкам геномов вируса Эбола-Судан.

Условия проведения амплификации оптимизировались по следующим параметрам: концентрация ионов магния в реакционной смеси; концентрация праймеров и зондов в реакционной смеси; температура отжига праймеров.

Для определения чувствительности набора из концентрированного раствора плазмидной ДНК были приготовлены последовательные 10-кратные разведения. Определение концентрации ДНК в разведениях при исследовании чувствительности праймеров осуществляли при помощи флуориметра QUBIT (Invitrogen, США) и наборов реагентов производителя.

ПЦР в режиме реального времени и регистрацию результатов проводили в приборе Rotor Gene 6000 (Corbett Research, Австралия) по каналам Green (470 nm/510 nm) и Yellow (530 nm/555 nm).

В результате выполненных экспериментов было определено минимальное количество рекомбинантной плазмидной ДНК, содержащей фрагмент генома вируса Эбола-Судан. При использовании внешних праймеров к геному вируса Эбола-Судан - 0.48 плазмидной ДНК.

Для определения аналитической чувствительности моновариантов систем «праймеры-зонд» для детекции каждого вируса из концентрированных растворов положительных контрольных образцов были приготовлены последовательные 10-кратные разведения. Определение концентрации ДНК в разведениях при исследовании чувствительности праймеров осуществляли при помощи коммерческого набора «Quant-iT dsDNA, HS» («Invitrogen», США) и флуориметра QUBIT («Invitrogen», США). Минимальное количество ДНК-матриц, детектируемое с применением заявляемых праймеров и зондов после оптимизации условий проведения реакции, выраженное в ГЭ (геномных эквивалентах) в 30 мкл реакционной смеси, представлено в таблице 2.

Таблица 2.
Аналитическая чувствительность моновариантов систем «праймеры-зонд»
Название вируса Аналитическая чувствительность (ГЭ)
Эбола-Судан 1.0×105

Пример 2. Определение РНК вируса Эбола-Судан в вируссодержащих образцах.

Оценку эффективности выявления генетического материала вирусов проводили на штамме Boniface вируса Эбола-Судан. Штаммом вируса Эбола заражали 10 мышей линии BALB/c. На 5 сут у животных забирали кровь и определяли наличие специфической вирусной РНК.

Предварительную инактивацию образцов и выделение РНК проводили в условиях, регламентированных Методическими указаниями МУ 1.3.2569-09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности».

Процедуру выделения РНК из исследуемого материала проводили с использованием набора «Комплект реагентов для выделения ДНК/РНК из сыворотки или плазмы крови» (НПФ Литех, Россия) в соответствии с инструкцией по применению.

ПЦР в режиме реального времени проводили с праймерами F13060 и R13367, фланкирующими участок ДНК в 307 п.н., в реакционной смеси следующего состава (на 1 исследование):

кДНК 5 мкл
10×Taq буфер без Mg2+ 3 мкл
100 mM раствор MgCl2 0,7 мкл
5 mM раствор dNTP 1 мкл
Смесь праймеров (концентрация каждого 10-15 мкмол/л) 2 мкл
Зонд (концентрация 5-10 мкмол/л) 1 мкл
SmartTaq ДНК-полимераза 0,3 мкл
Вода для ПЦР 17 мкл
Общий объем 30 мкл

Реакцию обратной транскрипции проводили с использованием набора реагентов «Реверта-L» (ЦНИИЭ, Россия) в соответствии с инструкцией по применению.

В качестве отрицательного контрольного образца в реакционную смесь добавляли ТЕ-буфер.

ПЦР в режиме реального времени и регистрацию результатов проводили в приборе Rotor Gene 6000 (Corbett Research, Австралия) по следующей программе, приведенной в таблице 3:

Таблица 3.
Режимы проведения ПЦР
Температура (°С) Время (минуты:секунды) Количество циклов
95 05:00 1
95 00:15 45
55 00:15
72 00:30

Детекцию сигнала флуоресценции осуществляли при шаге циклирования 55°С на канале Green (470 nm/510 nm) для вируса Эбола-Судан.

Результаты интерпретировали на основании наличия (или отсутствия) пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией, что соответствует наличию (или отсутствию) значения порогового цикла Ct в соответствующей графе в таблице результатов. Результат считали положительным в случае, если кривая накопления флуоресценции для соответствующего образца имела характерную «сигмовидную» форму и пересекала пороговую линию. При этом значение Ct для данного образца было не больше 40 (фиг.1).

На фиг.1 приведены кривые флуоресценции на трех оптических каналах амплификатора Rotor Gene 6000 (Corbett Research, Австралия). Флуоресценция в образцах, содержащих: генетический материал вирусов Эбола-Заир и Эбола-Судан (EBOV) - 4 образца на канале Green.

Таким образом, из выше приведенных примеров 1 и 2 видно достижение заявляемого технического результата: создан видоспецифичный набор олигонуклеотидных праймеров и зондов для идентификации генетического материала вируса Эбола-Судан в клинических образцах и биологических жидкостях, образцах внешней среды и других вируссодержащих пробах (культуральная вируссодержащая жидкость и т.д) методом мультиплексного ПЦР в режиме реального времени.

Набор олигонуклеотидных праймеров и флуоресцентно-меченых зондов для видоспецифичной экспресс-идентификации вируса Эбола-Судан методом полимеразной цепной реакции в реальном времени, включающий последовательности, видоспецифичные для вируса Эбола-Судан:
внешние:
5'→3'5'CCGTTATTCTCYACRAAGRTSATTAGTGA3'
3'←5'5'TTCTCTAGGTCTGTGACAAAACTACTCCC3'
внутренние:
5'→3'5'TGGGATGCAGTHTTYGARCC3'
3'←5'5'ACAACCATCATRTTGCTTGGAAAGGCTT3'
зонд:
FAM - TATTGCCCCAGAATCGAAATTTTTCTTTTTCATTGAA-BHQ1.



 

Похожие патенты:

Изобретение относится к биотехнологии, конкретно - к областям диагностической медицинской микробиологии, медицинской биохимии, прикладной иммунохимии и разработки диагностических тест-систем, касается разработки нового способа для высокочувствительного определения белка летального фактора сибирской язвы (LF) в инфицированных образцах биологического происхождения и окружающей среде.

Изобретение относится к области молекулярной биологии. .

Изобретение относится к области биотехнологии, а именно к способу идентификации генов FAE1.1, контролирующих содержание эруковой кислоты в семенах рапса. .

Изобретение относится к области биотехнологии, конкретно к исследованию агентов, ингибирующих mTOR, и может быть использовано в медицине. .

Изобретение относится к области молекулярной биологии и может быть использовано для идентификации и дифференциации прокариотических микроорганизмов. .

Изобретение относится к области биотехнологии и касается способа идентификации агента на основе высокопроизводительного скрининга. .

Изобретение относится к области молекулярной биологии и медицины. .

Изобретение относится к визуализирующим агентам, подходящим для оптической визуализации in vivo организма млекопитающего. .

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров и способа их использования для выявления Lactobacillus delbrueckii subspecies bulgaricus в заквасочных культурах.

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для генотипирования В.mallei. .

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для генотипирования В.mallei. .

Изобретение относится к области биотехнологии, молекулярной биологии, молекулярной эпидемиологии. .

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для генотипирования В.mallei. .

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для генотипирования В.mallei. .

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для генотипирования В.mallei. .

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для генотипирования B.mallei. .

Изобретение относится к области биотехнологии и касается олигонуклеотидных праймеров для генотипирования В.mallei. .

Изобретение относится к области молекулярной биологии и генетике. .

Изобретение относится к области молекулярной биологии и вирусологии. .
Наверх