Новые анти-il 13 антитела и их использование



Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование
Новые анти-il 13 антитела и их использование

 


Владельцы патента RU 2487887:

ДЖЕНЕНТЕК, ИНК. (US)

Изобретение относится к иммунологии. Предложены варианты антител, специфичных к IL13 человека, и продуцирующая гибридомная клеточная линия, депонированная в АТСС под номером PTA-5657. Описаны: варианты кодирующих полинуклеотидов; вектор для экспрессии антитела; клетка-хозяин для экспрессии антитела, а также варианты способа получения антитела с использованием вектора, полинуклеотида, гибридомы или клетки-хозяина. Раскрыты: фармацевтическая композиция для лечения IL13 опосредованных заболеваний и способы лечения аллергических, воспалительных и иных заболеваний, использующие антитела против IL13 человека. Использование антител обеспечивает антитела, которые не связываются с мышиным IL13 и нейтрализуют активность IL13 человека, что может найти применение в медицине. 21 н. и 19 з.п. ф-лы, 21 ил., 11 пр.

 

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ

Интерлейкин (IL)-13 является плейотропным цитокином Т-хелперных клеток 2-го подкласса (Th2). Аналогично IL4, IL13 принадлежит к семейству цитокинов I типа, имеющим третичную структуру, заданную 4α-спиральным гидрофобным пучковым кором. IL13 имеет приблизительно 30% аминокислотную гомологию с IL4 и имеет многие общие свойства с IL4 (Wynn, Ann. Rev. Immunol., 21: 425 (2003)). Функциональное сходство IL4 и IL13 приписывают тому факту, что IL13 может связывать альфа-цепь рецептора IL4 (IL4R-α) после его связывания с альфа-цепью 1 рецептора IL13 (IL13Rα1) (Hershey, J. Allergy Clin. Immunol., 111:677 (2003)). IL4Rα активируется IL4 и IL13, приводя к фосфорилированию Jak1-зависимых STAT6. Как IL4, так и IL13 активирует пролиферацию В-клеток и индуцирует переключение классов IgG4 и IgE совместно с CD40/CD40L (Punnonen et al., Proc. Natl. Acad. Sci. USA, 90: 3730 (1993), Oettgen et al„ J. Allergy Clin. Immunol., 107: 429 (2001)).

Однако, в отличие от IL4, IL13 не вовлечен в дифференциацию наивных Т-клеток в ТП2-клетки (Zurawski et al., Immunol. Today, 15: 19 (1994)). IL13 позитивно регулирует FceRI и таким образом способствует IgE-праймингу тучных клеток (de Vries, Allergy Clin. Immunol. 102: 165 (1998). В моноцитах/макрофагах IL13 позитивно регулирует экспрессию CD23 и антигенов МНС I и II классов, отрицательно регулирует экспрессию Fey и CD14 и ингибирует антитело-зависимую цитотоксичность (de Waal Malefyt et al., J. Immunol., 151: 6370 (1993), Chomarat et al., Int. Rev. Immunol., 17: 1 (1998)). IL13, но не IL4, способствует выживаемости эозинофилов, активации и рекрутингу (Horie et al., Intern. Med., 36: 179 (1997), Luttmann et al., J. Immunol. 157:1678 (1996), Pope et al., J. Allergy Clin. Immunol., 108: 594 (2001). IL13 также проявляет важные функции на негематопоэтических клетках, таких как клетки гладких мышц, эпителиальные клетки, эндотелиальные клетки и клетки фибробластов. IL13 усиливает пролиферацию и холинергически индуцируемое сокращение гладких мышц (Wills-Karp, J. Allergy Clin. Immunol., 107: 9 (2001), В эпителиальных клетках IL13 является сильным индуктором образования хемокинов (Li et al., J. Immunol. 162: 2477 (1999), изменяет мукоцилиарную дифференцировку (Laoukili et al., J. Clin. Invest, 108: 1817 (2001), снижает частоту движения ресничек клеток реснитчатого эпителия (Laoukili et al., J. Clin. Invest., 108: 1817 (2001), и приводит к метаплазии бокаловидных клеток (Zhu et al., J. Clin. Invest., 103: 779 (1999), Grunig et al., Science, 282: 2261 (1998)). В эндотелиальных клетках IL13 является сильным индуктором сосудисто-клеточной адгезивной молекулы 1 (VCAM-1), которая является важной для рекруитмента эозинофилов (Bocher et al., J. Immunol. 154: 799 (1995)). В фибробластах кожи человека IL13 индуцирует синтез коллагена 1 типа в фибробластах кожи человека (Roux et al., J. Invest. Dermatol., 103: 444 (1994)).

Хотя IL13 и IL4 имеют определенные функциональные сходства, изучение заболевания на животных моделях и мышах с «выключенным» геном показало, что IL13 обладает уникальными эффекторными функциями, отличными от IL4 и предоставляет убедительные доказательства, что IL13, независимо от других Th2-цитокинов, является необходимым и достаточным для индукции всех признаков аллергической астмы (Wills-Karp et al., Science, 282: 2258 (1998), Walter et al., J. Immunol. 167: 4668 (2001)). IL13 может играть более существенную роль чем другие Th2-цитокины в эффекторных функциях, связанных с симптомами астмы (Curr, Curr. Opin. Immunol., 11: 610 (1999)). Это утверждение подкрепляется на болезни человека строгой корреляцией между уровнями IL13 и генетическими полиморфизмами в гене IL13 и корреляциями заболевания (Wills-Karp. et al., Respir. Res. 1: 19 (2000); Vercelli et al., Curr. Opin. Allergy Clin. Immunol., 2: 389 (2002); He et al., Genes Immunol., 4: 385 (2003), Arima et al., J. Allergy Clin. Immunol., 109: 980 (2003), Liu et al., J. Clin. Allergy Immunol., 112: 382 (2003)). Полученные данные дают основание предполагать, что IL13 индуцирует признаки аллергической реакции посредством его действия на слизистый эпителий и клетки гладких мышц скорее, чем посредством традиционных путей с вовлечением эозинофилов и событий, опосредованных IgE (Wills-Karp et al., Sci., 282: 2258 (1998)).

Астму описывают как хроническое легочное заболевание, которое заключается в воспалении дыхательных путей, гиперчувствительности и обструкции. Физиологически, гиперчувствительность дыхательных путей подтверждают снижением бронхиального дыхания после бронхопровокации с использованием метахолина или гистамина. Другие механизмы запуска, которые провоцируют обструкцию дыхательных путей, включают в себя холодный воздух, физическую нагрузку, вирусную инфекцию верхних дыхательных путей, курение и респираторные аллергены. Бронхиальная провокация аллергеном индуцирует на ранней стадии мгновенное (IgE)-опосредованное снижение иммуноглобулина Е в бронхиальном дыхании, за которым у многих пациентов следует фаза замедленной IgE-опосредованной реакции со снижением бронхиального дыхания в течение 4-8 часов. Ранний ответ вызван резким высвобождением веществ, вызывающих воспаление, таких как гистамин, простагландин D2 (PGD2), лейкотриен, триптаза и фактор активации тромбоцитов (PAF), тогда как поздний ответ вызывается de novo синтезированными про-воспалительными цитокинами (например, TNFα, IL4, IL13) и хемокинами (например, МСР-1 и MIP-1α) (Busse et al. In: Allergy: Principles and Practice, Ed. Middleston, 1173 (1998)). У пациентов с хронической астмой стойкие легочные симптомы опосредуются повышенным ответом Тп2-клкток. Предполагают, что цитокины Th2 играют жизненную роль в заболевании (Larche et al., J. Allergy Clin. Immunol., 111: 450 (2003)), конкретно, IL13 и IL4 продуцируются Th2-клетками с NK фенотипом (NKT) в дыхательных путях, как показано на модели астмы у грызунов (Akbari et al., Nature Med., 9: 582 (2003)). Суммарная патология дыхательных путей астматического характера демонстрирует легочную гиперинфильтрацию, гладкомышечную гипертрофию, утолщение lamina reticularis, отек слизистой, отшелушивание эпителиальных клеток, разрушение клеток ресничек и гиперсекрецию слизистых желез. Микроскопически астма характеризуется наличием повышенного числа эозинофилов, нейтрофилов, лимфоцитов и плазматических клеток в бронхиальных тканях, повышенной бронхиальной секрецией и слизью. В начальной стадии существует рекрутинг лейкоцитов из кровотока активированными CD4+ Т-лимфоцитами к дыхательным путям. Активированные Т-лимфоциты также направляют высвобождение воспалительных медиаторов из эозинофилов, тучных клеток и лимфоцитов. Кроме того, ТП2-клетки продуцируют IL4, IL5, IL9 и IL13. IL4 вместе с IL13 передает сигнал переключения с IgM на IgE антитела.

Сшивка мембранно-связанных молекул IgE аллергеном вызывает дегрануляцию тучных клеток, высвобождение гистамина, лейкотриенов и других медиаторов, которые навсегда сохраняют воспаление дыхательных путей. IL5 активирует рекрутинг и активацию эозинофилов. Активированные тучные клетки и эозинофилы также производят свои цитокины, которые помогают навсегда сохранить воспаление. Такие повторяющиеся циклы воспаления в легких вместе с поражением пульмональных тканей с последующей регенерацией могут производить долговременные структурные изменения («перестройку») дыхательных путей.

Умеренную астму в настоящее время лечат с помощью ежедневно вдыхаемого противовоспалительного кортикостероида или ингибитора тучных клеток, например, кромолин-натрия или недокромила плюс вдыхаемого бета2-агониста по мере необходимости (3-4 раза в день) для облегчения прорыва симптомов или астмы, индуцированной аллергеном или физическими нагрузками. Кромолин-натрия и недокромил блокируют бронхоспазм и воспаление, но являются обычно эффективными только для астмы, которая вызывается аллергенами или физическими нагрузками и типична только для молодых астматиков. Ингалируемые кортикостероиды улучшают воспаление, гипереактивность дыхательных путей и обструкцию, и снижают число резких обострений. Однако, требуется, по меньшей мере, месяц до достижения выраженных эффектов и вплоть до года для появления заметного улучшения. Наиболее частыми побочными эффектами являются хрипота и грибковая инфекция полости рта, то есть кандидоз. Сообщалось о более серьезных побочных эффектах, например, частичной супрессии надпочечников, ингибировании роста и сниженном костеобразовании, но только вместе с применением повышенных доз. Беклометазон, триамцинолон и флунизолид, вероятно, имеют сходную эффективность; тогда как будесонид и флутиказон являются более эффективными и, по имеющимся данным, имеют меньше системных побочных эффектов.

Даже пациенты с умеренным заболеванием обнаруживают воспаление дыхательных путей, в том числе инфильтрацию слизистой оболочки и эпителия активированными Т-клетками, тучными клетками и эозинофилами. Т-клетки и тучные клетки высвобождают цитокины, Которые активируют рост эозинофилов и созревание и образование IgE-антител, а те, в свою очередь, повышают микрососудистую проницаемость, разрушают эпителий и стимулируют нервные рефлексы и слизеобразующие железы. Результатом является гиперреактивность дыхательных путей, бронхостеноз и гиперсекреция, выражающиеся свистящим дыханием, кашлем и одышкой.

Традиционно астма лечилась с использованием пероральных и ингалируемых бронхолитических средств. Эти агенты предотвращают симптомы астмы, но ничего не делают для лежащего в основе воспаления. Распознавание в течение последних 10 лет важности воспаления в этиологии астмы привело к повышенному применению коритикостероидов, но многие пациенты продолжают страдать от неконтролируемой астмы.

Вследствие важности лечения воспалительных заболеваний у людей, конкретно астмы, новые биоактивные компоненты, имеющие немного побочных эффектов, являются непрерывно искомыми. Разработка активных и специфических ингибиторов IL13, которые сохраняют активность в течение длительного времени при введении в астматические дыхательные пути, обеспечивает новый подход в лечении астмы, так же как и в лечении других заболеваний, опосредованных IL13 и IgE.

КРАТКОЕ ИЗЛОЖЕНИЕ ИЗОБРЕТЕНИЯ

Данное изобретение относится, по меньшей мере, частично к антителам, которые связываются специфически и с высокой аффинностью как с гликозилированным, так и с негликозилированным человеческим IL13; не связывают мышиный IL13 и нейтрализуют активность человеческого IL13 при молярном соотношении приблизительно 1:2 (Mab:IL13). Также включенными в изобретение являются антитела, содержащие антигенсвязывающие участки, полученные из вариабельных областей легкой и/или тяжелой цепи указанных антител. Антитела изобретения могут быть моноклональными, и моноклональное антитело может быть антителом человека, химерным антителом или гуманизированным антителом.

Примерами таких антител являются 228 В/С-1, 228А-4, 227-26 и 227-43. Гибридомы, которые продуцируют эти антитела, депонировали 20 ноября 2003 г.в Американской коллекции типовых культур, 10801 University Blvd., Manassas, VA 20110-2209, под инвентарными номерами РТА-5657, РТА-5656, РТА-5654 и РТА-5655 соответственно.

Изобретение включает в себя антитела, которые имеют VL-последовательность, по меньшей мере, на 95% гомологичную последовательности, изложенной в SEQ ID NO:3 и VH-последовательность, по меньшей мере, гомологичную на 95% последовательности, изложенной в SEQ ID NO:4; антитела, которые имеют VL-последовательность, по меньшей мере, на 95% гомологичную таковой, изложенной в SEQ ID NO:5 и VH-последовательность на 95% гомологичную таковой, изложенной в SEQ ID NO:6; и антитела, которые имеют VL-последовательность на 95% гомологичную таковой, изложенной в SEQ ID NO:7 и VH-последовательность на 95% гомологичную таковой, изложенной в SEQ ID NO:8. Изобретение также включает в себя молекулу рекомбинантного антитела или его IL13-связывающий фрагмент, содержащую, по меньшей мере, одну тяжелую цепь антитела, или его 11-13-связывающий фрагмент, содержащий не относящиеся к человеку CDRs в положениях 31-35 (CDR1), 50-65 (CDR2) и 95-102 (CDR3) (нумерация по Кэботу) из антитела мыши, в котором положения 27-30 имеют аминокислоту Gly26, Phe27, Ser28, Leu29, Asn30, (SEQ ID NO:18); и по меньшей мере, одну легкую цепь антитела, или его IL13-связывающий фрагмент, содержащий не относящиеся к человеку CDRs в положениях 24-34 (CDR1), 50-56 (CDR2) и 89-97 (CDR3)) из антитела мыши, и каркасные участки моноклонального антитела человека.

Изобретение включает в себя антигенсвязывающие фрагменты антитела человека антител данного изобретения, в том числе, но, не ограничиваясь, Fab, Fab' и F(ab')2, Fd, одноцепочечные Fvs (scFv), одноцепочечные антитела, соединенные дисульфидными связями Fvs (sdFv). Изобретение также включает в себя однодоменные антитела, содержащие или VL- или VH-домен. Пример scFv, изображают на фигуре 21, имеющий последовательность SEQ ID NO:152.

Изобретение включает в себя гуманизированные последовательности моноклонального антитела 228 В/С-1. Эти молекулы рекомбинантного гуманизированного антитела содержат в себе вариабельную область легкой цепи, содержащей аминокислотную последовательность, имеющую формулу: FRL1-CDRL1-FRL2-CDRL2-FRL3-CDRL3-FRL4, где FRL1 состоит из любой из последовательностей SEQ ID Nos: 20-25; CDRL1 состоит из любой из последовательностей SEQ ID Nos: 99-103; FRL2 состоит из SEQ ID NO: 29; CDRL2 состоит из любой из последовательностей SEQ ID Nos: 104-114; FRL3 состоит из любой из последовательностей SEQ ID Nos: 30-56; CDRL3 состоит из любой из последовательностей SEQ ID Nos: 115-116 и FRL4 состоит из SEQ ID NO: 57-59; и содержащие вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, имеющую формулу: FRH1-CDRH1-FRH2-CDRH2-FRH3-CDRH3-FRH4, в которой FRH1 состоит из любой из последовательностей SEQ ID Nos: 60-66; CDRH1 состоит из любой из последовательностей SEQ ID NOs: 117-122;

FRH2 состоит из любой из последовательностей SEQ ID NOs: 67-75; CDRH2 состоит из любой из последовательностей SEQ ID NOs: 123-134; FRH3 состоит из любой из последовательностей SEQ ID NOs: 76-90; CDRH3 состоит из любой из последовательностей SEQ ID NOs: 135-141; FRH4 состоит из любой из последовательностей SEQ ID NOs: 91-92. Вариабельная область тяжелой цепи может дополнительно содержать по меньшей мере СН1-домен константной области или СН1-, СН2- и СН3-домены константной области. Константная область тяжелой цепи может содержать IgG-антитело, в котором IgG-антитело является IgG1-антителом, IgG2-антителом, IgG3-антителом или IgG4-антителом.

Изобретение также включает в себя молекулы рекомбинантных антител, в которых вариабельную легкую цепь выбирают из любой из последовательностей SEQ ID NOs: 3, 5, 7, 93, 95, 97, 142, 144 и 150, и вариабельную тяжелую цепь выбирают из любой из последовательностей SEQ ID NOs: 4, 6, 8, 94, 96, 98, 143, 145,146, 147, 148 и 149. Конкретное антитело содержит вариабельную легкую цепь, имеющую последовательность, изложенную в SEQ ID NO: 142 и вариабельную тяжелую цепь, имеющую последовательность, изложенную в SEQ ID NO: 143.

Изобретение включает в себя гибридомные клеточные линии, которые продуцируют моноклональные антитела 228 В/С-1, 228А-4, 227-26 и 227-43. Изобретение включает в себя нуклеиновые кислоты, кодирующие моноклональные антитела 228 В/С-1, 228А-4, 227-26 и 227-43, клеточные линии, содержащие нуклеиновую кислоту, кодирующую эти антитела или их цепи, и векторы, содержащие нуклеиновую кислоту, кодирующую эти антитела или их цепи.

Изобретение также включает антитела, которые связывают тот же самый эпитоп, что и 228 В/С-1. Типичные полипептиды содержат всю или часть последовательности SEQ ID NO:1 или ее варианты, или SEQ ID NO: 2, в которой 13 аминокислоту заменяют из глутаминовой кислоты на лизин. Изобретение также относится к эпитопу, узнаваемому антителами данного изобретения. Эпитопные пептиды включают в себя пептид, существенно содержащий или состоящий из ESLINVSG (SEQ ID NO:18) или YCAALESLINVS (SEQ ID NO: 19).

Изобретение включает в себя композицию, содержащую антитела в соответствии с приложенной формулой изобретения в сочетании с фармацевтически приемлемым носителем, разбавителем, наполнителем или стабилизатором.

Изобретение включает в себя способ лечения субъекта, страдающего от астматических симптомов, содержащий введение субъекту, например, субъекту, который в этом нуждается, количества анитела, в соответствии с формулой изобретения, эффективного для снижения астматических симптомов, при котором антитело может отрицательно регулировать активность IL13 у пациента, снижать бронхиальную гиперчувствительность у пациента и/или снижать эозинофилию в легких субъекта. Изобретение также включает в себя способ ингибирования инфекции респираторно-синцитиального вируса (RSV), содержащий введение субъекту, например, субъекту, который в этом нуждается, ингибирующего количества антитела в соответствии с изобретением, описанным в формуле.

Антитело изобретения может быть введено одним или несколькими путями, в том числе внутривенно, интраперитонеально, ингаляцией, внутримышечно, подкожно или перопально. Изобретение включает в себя приспособление для ингаляции, которое доставляет пациенту терапевтически эффективное количество антитела в соответствии с изобретением, описанным в формуле.

Изобретение включает в себя способ обнаружения белка интерлейкин-13 у субъекта, например, у пациента, страдающего от аллергического заболевания, предусматривающий, например, шаги, позволяющие антителу заявляемого изобретения контактировать с пробой; и обнаружения интерлейкина-13 посредством появления иммунной реакции. Описывают также способы диагностирования сверхэкспрессии IL13 у субъекта, предусматривающие этапы (а) получения пробы от субъекта; (b) объединение пробы с антителом в соответствии с заявляемым изобретением в условиях, которые делали бы возможной иммунную реакцию с IL13 и (с) определения, является ли IL13 сверхэкспрессированным или нет относительно нормального уровня экспрессии IL13.

Изобретение включает в себя способ продуцирования антител заявляемого изобретения, предусматривающий этапы а) создания иммуногенной композиции, содержащей компонент гликозилированного IL13 и иммуногенный компонент; b) изготовления инъецируемого раствора, содержащего указанный иммуногенный компонент в забуференном фосфатом физиологическом растворе (PBS), и адъювант; с) иммунизации мыши с использованием указанного инъецируемого раствора путем комбинирования внутривенных и внутрибрюшинных инъекций, а) продуцирования гибридомы слиянием клетки селезенки из указанной иммунизированной мыши с клеткой миеломы; е) селекции гибридомы, продуцирующей антитело, имеющего характеристики антитела, заявленного в изобретении; и f) выделения указанного антитела.

Изобретение включает в себя способ ингибирования продукции IgE-антитела у пациента, который предусматривает введение пациенту эффективного количества продукции IgE-антитела, ингибирующее эффективное количество антител в соответствии с заявленным изобретением. Ингибирование продукции IgE-антител может предупредить бронхиальную астму, аллергические риниты, аллергические дерматиты и анафилаксию, а также лечить бронхиальную астму, аллергические риниты, аллергическую реакцию (uticaria), и атопические дерматиты.

Изобретение включает в себя способ лечения у пациента нарушения опосредованного IL13, содержащий введение пациенту эффективного количества антитела или его антигенсвязывающего фрагмента в соответствии с заявленным изобретением, при котором указанное антитело или его антигенсвязывающий фрагмент ингибируют связывание IL13 с рецептором и ингибируют одну или несколько функций, ассоциированных со связыванием интерлейкина с указанным рецептором.

Изобретение включает в себя способ лечения у пациента нарушения опосредованного IgE, содержащий введение пациенту эффективного количества антитела или его антигенсвязывающего фрагмента в соответствии с заявленным изобретением, при котором указанное антитело или его антигенсвязывающий фрагмент ингибируют связывание IL13 с его рецептором и ингибируют одну или несколько функций, связанных со связыванием интерлейкина с указанным рецептором.

Изобретение включает в себя способ снижения тяжести астмы у млекопитающих, содержащий введение млекопитающим терапевтически эффективного количества анти-IL13 моноклонального антитела, имеющего, по меньшей мере, одну из следующих характеристик: способность связывать человеческий IL13 с КД между приблизительно от 1×1010 до приблизительно 1×1012 М; способность ингибировать одну или несколько функций, ассоциированных со связыванием интерлейкина IL13 с рецептором IL13; и неспособность антитела связывать мышиный IL13.

Заболевания и/или состояния, опосредованные IL13, которые рассматривают в изобретении, включают в себя, но не ограничиваясь, аллергическую астму, неаллергическую (эндогенную) астму, аллергические риниты, атопические дерматиты, аллергические конъюнктивиты, экзему, утикарию, пищевые аллергии, хроническое обструктивное легочное заболевание, язвенные колиты, инфекции, вызванные респираторно-синцитиальным вирусом (RSV), увеиты, склеродерму и остеопорозы.

КРАТКОЕ ОПИСАНИЕ РИСУНКОВ

Фиг.1 изображает связывание анти-IL13 моноклональных антител с человеческим IL13.

Фиг.2 изображает связывание анти-IL13 моноклональных антител с мутантным IL13-FC.

Фиг.3 иллюстрирует, что не существует ингибирования связывания MAb 228 В/С-1 с человеческим IL13 моноклональными антителами MAb JES10-5A2 (Pharmingen).

Фиг.4 иллюстрирует эффект анти-IL13 моноклональных антител на пролиферацию клеток L-1236 лимфомы Ходжкина.

Фиг.5 иллюстрирует эффект анти-IL13 моноклональных антител на IL13-индуцированную супрессию экспрессии CD14 в моноцитах человека.

Фиг.6 иллюстрирует эффект анти-IL13 моноклональных антител на IL13-индуцированную позитивную регуляцию экспрессии CD23 в моноцитах человека.

Фиг.7 иллюстрирует эффект анти-IL-13 моноклональных антител на IL13-индуцированное фосфорилирование STAT6 в клетках ТНР-1.

Фиг.8 изображает аминокислотную последовательность областей VH и VL моноклонального антитела 228 В/С-1.

Фиг.9 изображает аминокислотную последовательность областей VH и VL моноклонального антитела 228А-4.

Фиг.10 изображает аминокислотную последовательность областей VH и VL моноклонального антитела 227-26.

Фиг.11 изображает последовательности вариабельных областей легкой цепи для гуманизации моноклонального антитела 228 В/С-1. Клоны от В до R представляют клоны, тестированные с помощью матрицы 2 человека для VK и мышиной VH. Конструировали клоны HT2-NEW и HT2-DP27 с каркасными областями человека как для VK, так и для VH.

Фиг.12 изображает последовательности, соответствующие тяжелой цепи клонов на Фигуре 11.

Фиг.13 А-Е изображают ELISA-профили для комбинаторных гуманизированных кадидатов.

Фиг.14 А изображает ELISA-профили для 89 Vk/276G. Фиг.14 В изображает результаты ELISA-теста для конструкции FL 115Vk/73Vh FL.

Фиг.15 изображает последовательности кадидатов комбинаторной библиотеки.

Фиг.16 изображает профиль конкурентного связывания для двух кандидатов (CL5 и CL-13), показанный в сравнении с химерным кандидатом (228 В/С #3) при связывании с IL13. Посторонний Fab является 51, который демонстрирует отсутствие способности к конкуренции.

Фиг.17 изображает последовательности трех аффинно-созревших кандидатов.

Фиг.18 показывает упорядочение последовательностей белка IL13.

Фиг.19 изображает связывающий эпитоп Mab 228B/C-1.

Фиг.20 изображает варианты CDR и соответствующие им последовательности SEQ ID Nos.

Фиг.21 изображает последовательности вариабельной легкой цепи и вариабельной тяжелой цепи для селекции кандидатов рекомбинантных антител.

ПОДРОБНОЕ ОПИСАНИЕ

Изобретение не ограничивается конкретной методологией, протоколами, клеточными линиями, векторами или реагентами, описанными здесь, поскольку они могут варьировать. Кроме того, терминологию в изобретении используют только с целью описания конкретных вариантов воплощения изобретения, и она не предназначена для ограничения рамок данного изобретения. Как используют здесь и в приложенной формуле изобретения, формы единственного числа "a", "an" и "the" включают в себя множественные ссылки, если контекст ясно не предписывает иначе, например, ссылка на «клетку-хозяин» включает в себя множественность таких клеток хозяина.

Если не определено иначе, все технологические и научные термины и акронимы, используемые здесь, имеют те же значения, что обычно подразумеваются любым из специалистов в области изобретения. Хотя любые способы и материалы, сходные или эквивалентные таковым, описанным здесь, могут быть использованы в практике данного изобретения, типичные способы, устройства и материалы описывают здесь.

Все патенты и публикации, упомянутые здесь, включенные в виде ссылок для полноты, разрешенные законом с целью описания и раскрытия белков, ферментов, векторов, клеток-хозяина, и методологий, изложенных здесь, которые могут быть использованы вместе с настоящим изобретением. Однако, ничего здесь не должно быть рассмотрено в виде признания того, что изобретение является дающим право предсказания такого раскрытия на основании предшествующего изобретения.

Иммуноген

Рекомбинантный IL13 использовали для иммунизации мышей для выработки гибридом, которые продуцируют моноклональные антитела изобретения. Рекомбинантный IL13 является коммерчески доступным из ряда источников (см., например, R&D Systems, Minneapolis, MM., PeproTech, Inc., NJ, и Sanofi Bioindustries, Inc., Tervose, PA.). Альтернативно, ген или кДНК, кодирующие IL13, могут быть клонированы в плазмиде или другом экспрессионном векторе и экспрессированы в любой из ряда экспрессирующих систем в соответствии со способами, хорошо известными специалистам в данной области. Способы клонирования и экспрессии IL13 и последовательность нуклеиновой кислоты для IL13 являются хорошо известными (см., например, патент США N 5652123). Из-за вырожденности генетического кода может быть продуцировано множество нуклеотидных последовательностей, кодирующих полипептиды IL13. Можно варьировать нуклеотидную последовательность селекцией комбинаций на основе случайных выборов кодонов. Такие комбинации делают в соответствии со стандартным триплетным генетическим кодом применительно к нуклеотидной последовательности, которая кодирует встречающийся в природе полипептид IL13, и все такие вариации необходимо рассмотреть. Любой из этих полипептидов может быть использован в иммунизации животного для получения антител, которые связываются с IL13.

Иммуногенный IL13-полипептид может, если это выгодно, быть экспрессирован в виде слитого белка, который имеет IL13-полипептид прикрепленный к сливающемуся сегменту. Слитый сегмент часто помогает в очистке белка, например, давая возможность слитому белку быть выделенным и очищенным аффинной хроматографией. Слитые белки могут быть произведены культивированием рекомбинантной клетки, трансформированной слитой последовательностью нуклеиновых кислот, которая кодирует белок, в том числе слитый отрезок, присоединенный или к карбоксильному и/или аминоконцевому концу белка. Слитые отрезки могут включать в себя, но не ограничиваться, Fc-области иммуноглобулина, глутатион-S-трансферазу, β-галактазидазу, поли-гистидиновый фрагмент, обеспечивающий связывание с ионами двухвалентных металлов, и мальтозо-связывающий белок.

Типичные полипептиды содержат всю или часть последовательности SEQ ID NO:1 или ее варианты, или SEQ ID NO: 2, в которой 13 аминокислотой является Хаа и может быть заменена, исходя из мол. массы, например, глутаминовая кислота на лизин.

Слитый белок, содержащий мутантную форму человеческого IL13, использовали для получения антител данного изобретения. Эта мутантная форма IL13, содержащая единичную мутацию, приводящую к инактивированной форме белка (Thompson et al., J. Biol. Chem. 274: 2994 (1999)). Для создания нейтрализующих антител с высокой аффинностью слитый белок, содержащий мутантный белок IL13, сливали с Fc иммуноглобулинов, конкретно IgG1, и экспрессировали в клеточной линии млекопитающих, так чтобы рекомбинантный белок был гликозилирован естественным образом. Fc-фрагмент слитого белка может обеспечить конформационную структуру, которая экспонирует ключевой эпитоп.Гликозилирование может иметь повышенную иммуногенность эпитопа, позволяющую образование антител к конкретному эпитопу.

IL13-полипетиды, экспрессированные в E. coli, негликозилированы и коммерчески доступные тестированные антитела были произведены с использованием этого белка. Авторы тестировали эти антитела, например, R&D Systems и Pharmingen, и обнаружили, что антитела, произведенные с помощью иммуногена, продуцированного в Е.coli, не дают перекрестную реакцию с эпитопом, связанным антителами данного изобретения.

Производство антител

Антитела изобретения могут быть произведены любым из подходящих способов, известным в данной области. Антитела изобретения могут содержать поликлональные антитела. Способы приготовления поликлональных антител известны специалистам в данной области (Hariow, et al., Antibodies: a Laboratory Manual, (Cold spring Harbor Laboratory Press, 2nd ed. (1988), которая внедрена сюда в виде ссылки в ее полноте).

Например, иммуноген, как описано выше, может быть введен различным животным-хозяевам, в том числе, но, не ограничиваясь, кроликам, мышам, крысам и т.д., для индукции образования антител специфичных к антигену. Введение иммуногена может быть связано с одной или несколькими инъекциями иммунизирующего агента и, если желательно, адъюванта. Различные адъюванты могут быть использованы для усиления иммунологического ответа в зависимости от вида хозяина и включают, но не ограничиваются, адъювант Фрейнда (полный или неполный), минеральные гели, такие как гидроксид алюминия, поверхностно-активные вещества, такие как лизолецитин, плюрониловые полиолы, полианионы, пептиды, масляные эмульсии, гемоцианины лимфы улитки, динитрофенол и потенциально полезные адъюванты человека, такие как БЦЖ (бацилла Кальметта-Герена) и Corynebacterium parvum. Дополнительные примеры адъювантов, которые могут быть использованы, включают в себя адъювант MPL-TDM (монофосфориллипид А, синтетический трегалозодикориномиколат). Процедуры иммунизации являются хорошо известными в данной области и могут быть исполнены любым способом, который вызывает иммунный ответ в выбранном животном-хозяине. Адъюванты также являются хорошо известными в данной области.

Типично, иммуноген (с адъювантом или без адъюванта) инъецируют внутрь млекопитающего подкожными или внутрибрюшинными инъекциями, или внутримышечно или внутривенно. Иммуноген может включать в себя IL13-полипептид, слитый белок или их варианты. В зависимости от природы полипептидов (то есть, степени гидрофобности, степени гидрофильности, стабильности, суммарного заряда, изоэлектрической точки и т.д.) может быть полезным конъюгирование иммуногена с белком, который известно, что является иммуногенным при иммунизации млекопитающих. Такое конъюгирование включает в себя или химическую конъюгацию путем дериватизации активных химических функциональных групп как к иммуногену, так и к иммуногенному белку, который должен быть конъюгирован, так что образуется ковалентная связь, или посредством методологии, основанной на слиянии с белком, или другими способами, известными специалистам в данной области. Примеры таких иммуногенных белков включают в себя, но не ограничиваются, гемоцианин лимфы улитки, овальбумин, сывороточный альбумин, бычий тироглобулин, соевый ингибитор трипсина и смешанные Т-хелперные пептиды. Различные адъюванты могут быть использованы для усиления иммунологического ответа, как описывают выше.

Антитела изобретения содержат моноклональные антитела. Моноклональные антитела могут быть приготовлены с использованием гибридомной технологии, такой как технология, описанная Kohler и Milstein, Nature, 256:495 (1975), и патент США N 4376110, и Harlow, et al., Antibodies: A Laboratory Manual, (Cold spring Harbor Laboratory Press, 2 sup. nd. ed. (1988), и Hammerling, et al., Monoclonal Antibodies and T-Cell Hybridomas (Elsevier, N.Y., (1981)), или другими способами, известными специалистам. Другие примеры методов, которые могут быть применены для производства моноклональных антител, включают в себя, но не ограничиваются, технологию В-клеточной гибридомы человека (Kosbor et al., 1983, Immunology Today 4:72; Cole et al., 1983, Proc. Natl. Acad. Sci. USA 80:2026-2030), и способ гибридомы EBV (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., стр.77-96). Такими антителами могут быть любые из класса иммуноглобулинов в том числе IgG, IgM, IgE, IgA, IgD и любой их подкласс. Гибридома, продуцирующая Mab данного изобретения, может быть культивирована in vitro или in vivo.

С использованием типичных гибридомных технологий, хозяин, например, мышь, гуманизированная мышь, мышь с иммунной системой человека, хомяк, кролик, верблюд или любое другое подходящее животное-хозяин типично иммунизируют с использованием иммуногена для извлечения лимфоцитов, которые продуцируют или являются способными продуцировать антитела, которые будут специфически связываться с IL13. Альтернативно, лимфоциты могут быть иммунизированы с помощью антигена in vitro.

В общих чертах, в создании антителопродуцирующих гибридом, используют или лимфоциты периферической крови ("PBLs"), если необходимы клетки человеческого происхождения, или используют клетки селезенки, или клетки лимфатических узлов, если необходимы источники млекопитающих, не имеющих отношения к человеку. Затем лимфоциты сливают с иммортализованными клеточными линиями с использованием агента, вызывающего слияние клеток, такого как полиэтиленгликоль, для образования гибридомной клетки (Coding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986), стр.59-103), Иммортализованные клеточные линии являются обычно трансформированными клетками млекопитающих, конкретно миеломными клетками грызуна, бычьими, или клетками человеческого происхождения. Типично используют миеломную клеточную линию мышей или крыс. Гибридомные клетки могут быть культивированы в подходящей культуральной среде, которая предпочтительно содержит одно или несколько веществ, которые ингибируют рост или выживание неслитых, иммортализованных клеток. Например, если родительские клетки теряют фермент гипоксантин-гуанинфосфорибозилтрансферазу (HGPRT или HPRT), культуральная среда для гибридом типично будет включать в себя гипоксантин, аминоптерин и тимидин ("НАТ-среда), вещества, которые препятствуют росту HGPRT-дефицитных клеток.

Предпочтительными иммортализованными клеточными линиями являются линии, которые эффективно сливаются, поддерживают стабильный высокий уровень экспрессии антитела при помощи отобранных антитело-продуцирующих клеток и являются чувствительными к среде, такой как НАТ-среда. Более предпочтительными иммортализованными клеточными линиями являются линии миеломы мышей, которые могут быть получены, например, из Salk Institute Cell Distribution Centre, San Diego, Calif, и Американской коллекции типовых культур, Manassas, Va. Клеточные линии миеломы человека и гетеромиеломы мишь/человек также могут быть использованы для производства моноклональных антител человека (Kozbor, J. Immunol. 133:3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Appliations, Marcel Dekker, Inc., New York, (1987) стр.51-63).

Культуральная среда, в которой культивируют гибридомные клетки, может быть проанализирована на наличие моноклональных антител, направленных против IL13. Специфичность связывания моноклональных антител, продуцированных гибридомными клетками, определяют, например, иммунопреципитацией или анализом связывания in vitro, таким как радиоиммуноанализ (RIA) или твердофазным иимуноферментным анализом (ELISA). Такие технологии являются известными в данной области и среди специалистов. Аффинность связывания моноклонального антитела с IL13 может, например, быть определена Скэтчардовским анализом (Munson et al., Anal. Biochem., 107:220 (1980)).

После идентификации желаемых гибридомных клеток клоны могут быть субклонированы методами серийных разведении и выращены стандартными способами (Goding, как сказано выше). Подходящая культуральная среда для этой цели включает в себя, например, среду Dulbecco's Modified Eagle's Medium и RPMI-1640. Моноклональные антитела, секретируемые субклонами, могут быть выделены или очищены из культуральной среды общепринятыми способами очистки иммуноглобулинов, например, протеин-А-сефарозой, хроматографией на гидроксиапатите, гель-проникающей хроматографией, гель-электрофорезом, диализом или аффинной хроматографией,

Различные способы существуют в области производства моноклональных антител и, таким образом, изобретение не ограничивается их исключительным производством в гибридомах. Например, моноклональные антитела могут быть изготовлены способами рекомбинантной ДНК, такими как описанные в патенте США N 4816567. В данном контексте термин «моноклональное антитело» относится к антителу, произведенному из одиночного эукариотического, фагового или прокариотического клона. ДНК, кодирующая моноклональные антитела изобретения может быть легко выделена и секвенирована с использованием общепринятых процедур (например, с использованием олигонуклеотидных зондов, которые способны связываться специфически с генами, кодирующими тяжелую и легкую цепи мышиных антител, или подобные цепи из человеческих, гуманизированных или других источников). Гибридомные клетки изобретения служат в качестве предпочтительного источника такой ДНК. Выделенная в свое время ДНК может быть помещена в экспрессионные векторы, которые затем трансформируют внутрь клеток хозяина, таких как клетки NSO, COS-клетки обезьян, клетки яичников китайского хомячка (СНО) или клетки миеломы, которые обычно не продуцируют белок иммуноглобулин, для получения синтеза моноклональных антител в рекомбинантных клетках хозяина. ДНК также может быть модифицирована, например, подставляя кодирующую последовательность константных доменов тяжелой и легкой цепей человека вместо гомологичных последовательностей мыши (патент США N 4816567; Morrison et al., выше), или ковалентным присоединением к иммуноглобулиновой кодирующей последовательности всей или части кодирующей последовательности неиммуноглобулинового полипептида. Такой неиммуноглобулиновый полипептид может быть замещен на константные домены антитела изобретения, или может быть замещен на вариабельные домены одного антигенсвязывающего сайта антитела изобретения для создания химерного бивалентного антитела.

Антитела могут быть моновалентными антителами. Способы получения моновалентных антител являются хорошо известными в данной области. Например, один метод включает в себя рекомбинантную экспрессию легкой цепи иммуноглобулина и модифицированной тяжелой цепи. Тяжелая цепь является укороченной вообще в любой точке в Fc-области для предотвращения образования поперечных связей. Альтернативно, подходящие цистеиновые остатки замещают другим аминокислотным остатком или делегируют для предотвращения образования поперечных связей.

Фрагменты антител, которые узнают специфические эпитопы, могут быть произведены известными способами. Например, Fab- и Р(ab')2-фрагменты изобретения могут быть произведены протеолитическим расщеплением иммуноглобулиновых молекул с использованием ферментов, таких как, папаин (для получения Fab-фрагментов) или пепсин (для получения Р(ab')2-фрагментов). F(ab')2-фрагменты содержат вариабельную область, константную область легкой цепи и СН1-домен тяжелой цепи.

В некоторых случаях, в том числе использование антител in vivo на людях и в анализах обнаружения in vitro, может быть предпочтительным использование химерных, гуманизированных или человеческих антител. Химерным антителом является молекула, в которой различные участки антитела получают от различных видов животных, например, антитела, имеющие вариабельный домен, полученный из моноклонального антитела мыши и константную область иммуноглобулинов человека. Способы получения химерных антител хорошо известны в данной области. См., например, Morrison, Science 229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Gillies et al., (1989) J. Immunol. Methods 125: 191-202; патенты США NN 5807715; 4816567 и 4816397, которые внедрены здесь в виде ссылки в их полноте.

Гуманизированными антителами являются молекулы антител, полученные в видах, не принадлежащих к человеку, которые связывают необходимый антиген, имеющие одну или несколько областей, определяющих комплементарность (CDRs), из видов, не принадлежащих к человеку, и каркасные области (FR) молекулы иммуноглобулинов человека. Часто остатки каркасной области в каркасных областях человека будут замещены соответствующим остатком из CDR донорного антитела для изменения, предпочтительно улучшения, связывания антигена. Такие каркасные замещения идентифицируют способами, хорошо известными в данной области, например, моделированием взаимодействий CDR и каркасных остатков для идентификации каркасных остатков важных для связывания антигена, и сравнением последовательности для установления необычных каркасных остатков в конкретных положениях (См., например, Queen et al., патент США N 5585089; Riechmann et al., Nature 332:323 (1988), которые внедрены сюда в виде ссылки в ее полноте). Антитела могут быть гуманизированы с использованием различных способов, известных в данной области, в том числе, таких как, CDR-трансплантация (Европейский патент 239400; публикация согласно РСТ WO 91/09967, патенты США NN 5225539; 5530101 и 5585089), облицовка или шлифовка (veneering or resurfacing) (Европейский патент 592106; Европейский патент 519596; Padlan, Molecular Immunology 28 (4/5): 489-498 (1991); Studnicka et al., Protein Engineering 7(6); 805-814 (1994); Roguska, et al., PNAS 91: 969-973 (1994)) и перетасовка цепей (патент США N 5565332).

Вообще, гуманизированное антитело имеет один или несколько аминокислотных остатков внедренных в антитело из источника, не относящегося к человеку. Такие аминокислотные остатки, не относящиеся к человеку, именуемые «импортированными» остатками, которые типично берут из «импорт»-вариабельного домена. Гуманизация может быть фактически выполнена следующими способами: Винтера с сотрудниками (Jones et al., Nature, 321:522-525 (1986); Reichmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988), замещением последовательностей CDRs или CDR грызуна на соответствующие последовательности антитела человека. Следовательно, такие «гуманизированные» антитела являются химерными антителами (патент США N 4816567), в котором существенно меньший, чем интактный вариабельный домен человека заместили соответствующей аминокислотной последовательностью из видов, не относящихся к человеку. Практически, гуманизированные антитела являются типично человеческими антителами, в которых некоторые CDR-остатки и, возможно, некоторые PR-остатки замещают из аналогичных сайтов антител грызунов.

Полностью человеческие антитела являются конкретно желательными для терапевтического лечения пациентов. Антитела человека могут быть изготовлены различными способами известными в данной области, в том числе методами фагового дисплея, описанными выше, с использованием библиотек антител, полученных из иммуноглобулиновых последовательностей человека. См. также патенты США NN 4444887 и 4716111 и публикации согласно РСТ WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735 и WO 91/10741; каждую из которых приводят здесь в виде ссылки в ее полноте. Технические приемы Cole с сотрудниками и Boerder с сотрудниками являются также приемлемыми для приготовления моноклональных антител человека (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Rise, (1985); и Boerner et al., J. Immunol. 147 (1):86-95, (1991)).

Также антитела человека могут быть продуцированы с использованием трансгенных мышей, которые не способны экспрессировать функциональные эндогенные иммуноглобулины, но которые могут экспрессировать иммуноглобулиновые гены человека. Например, комплексы генов тяжелой и легкой цепей иммуноглобулинов человека могут быть внедрены произвольно или гомологичной рекомбинацией в эмбриональные стволовые клетки мышей. Альтернативно вариабельная область, константная область и область, обеспечивающая разнообразие, человека могут быть внедрены в эмбриональные стволовые клетки мышей в добавление к генам тяжелой и легкой цепей человека. Гены тяжелой и легкой цепей иммуноглобулинов мышей могут быть приведены в нефункциональное состояние отдельно или вместе с внедрением иммуноглобулиновых локусов человека гомологичной рекомбинацией. Конкретно, гомозиготная делеция JH-области предотвращает эндогенное образование антител. Модифицированные эмбриональные стволовые клетки подращивают и микроинъекцией вводят в бластоциты для создания химерных мышей. Затем химерных мышей размножают для получения гомозиготного потомства, которое экспрессирует человеческие антитела. Трансгенных мышей иммунизируют нормальным образом с использованием выбранного антигена, например, целого полипептида изобретения или его частью. Моноклональные антитела, направленные против антигена, могут быть получены от иммунизированных трансгенных мышей с использованием общепринятой гибридомной технологии. Трансгены иммуноглобулинов человека, накопленные трансгенными мышами, перестраиваются во время дифференциации В-клеток и впоследствии подвергаются механизму переключения классов и соматической мутации. Таким образом, с использованием такой технологии возможно продуцирование терапевтически полезных антител IgG, IgA, IgM и IgE. Для обзора этой технологии продуцирования антител человека см., Lonberg and Huszar, Int. Rev. Immunol. 13:65-93 (1995). Для детального обсуждения этой технологии продуцирования антител человека и моноклональных антител человека и процедур образования таких антител смотри, например, публикации согласно РСТ WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735; Европейский патент N 0598877; патенты США NN 5413923; 5625126; 5633425; 5569825; 5661016; 5545806; 5814318; 5885793; 5916771 и 5939598, которые приводят здесь в виде ссылки в ее полноте. Кроме того, компании, такие как Abgenix, Inc. (Freemont, Calif.), Genphann (San Jose, Calif.) и Medarex, Inc. (Princeton, N.J.) могут быть привлечены к получению антител человека против выбранного антигена с использованием технологии, сходной с технологией, описанной выше.

Также моноклональные антитела (MAbs) человека могли быть приготовлены иммунизацией мышей, трансплантированных лейкоцитами периферической крови человека, спленоцитами или костным мозгом (например, триомной техникой XTL). Полностью человеческие антитела, которые узнают выбранный эпитоп, могут быть произведены с использованием техники, именуемой «управляемая селекция». В этом подходе селектированное моноклональное антитело, не относящееся к человеку, например, мышиное антитело, используют для направления селекции полностью человеческого антитела, узнающего тот же самый эпитоп. (Jespers et al., Bio/technology 12:899-903 (1988)).

Кроме того, антитела к полипептидам изобретения могут, в свою очередь, быть использованы для создания анти-идиотипических антител, которые «имитируют» полипептиды изобретения, с использованием технологий хорошо известных специалистам в данной области. (См, например, Greenspan & Bona, FASEB J. 7(5):437-444; (1989) и Nissinoff, J. Immunol. 147(8): 2429-2438 (1991)). Например, антитела, которые связываются с полипептидом и полностью ингибируют мультимеризацию полипептида и/или связывание полипептида изобретения с лигандом, могут быть использованы для образования анти-идиотипов, которые «имитируют» мультимеризацию полипептида и/или связывающий домен и, как следствие, связываются с полипептидом и нейтрализуют его и/или его лиганд. Такие нейтрализующие анти-идиотипы или Fab-фрагменты таких анти-идиотипов могут быть использованы в терапевтических режимах для нейтрализации полипептидного лиганда. Например, такие анти-идиотипические антитела могут быть использованы для связывания полипептида изобретения и/или для связывания его лигандов/рецепторов, и таким образом, для блокировки его биологической активности.

Антитела данного изобретения могут быть биспецифическими антителами. Биспецифические антитела являются моноклинальными, предпочтительно человеческими или гуманизированными антителами, которые имеют специфичность связывания, по меньшей мере, для двух различных антигенов. В изобретении одно из специфических связываний может быть направлено к IL13, другое может быть для любого другого антигена и предпочтительно для белка клеточной поверхности, рецептора, субъединицы рецептора, ткане-специфичного антигена, белка вирусного происхождения, кодируемого вирусом белка оболочки, белка бактериального происхождения, или бактериального поверхностного белка и так далее.

Способы изготовления биспецифических антител являются хорошо известными. Традиционно, рекомбинантное производство биспецифических антител базируется на коэкспрессии двух иммуноглобулиновых пар тяжелой цепи/легкой цепи, где две тяжелые цепи имеют различные специфичности (Milstein and Cuello, Nature, 305:537-539 (1983)). В результате случайного выбора тяжелой и легкой цепей иммуноглобулинов, такие гибридомы (квадромы) продуцируют потенциальную смесь десяти различных молекул антител, из которых только одно имеет правильную биспецифичную структуру. Очистку правильной молекулы обычно производят стадиями аффинной хроматографии. Похожие процедуры раскрывают в WO 93/08829, опубликованной 13 мая 1993 и у Trauneckeret al., EMBO J., 10:3655-3659 (1991).

Вариабельные домены антител с необходимыми специфичностями связывания (антитело-антиген связывающими сайтами) могут быть слиты с последовательностями константного домена иммуноглобулинов. Слияние предпочтительно существует с константным доменом тяжелой цепи иммуноглобулинов, содержащим, по меньшей мере, часть шарнирной, СН2- и СН3-областей. Он может иметь первую константную область тяжелой цепи (СН1), содержащую сайт необходимый для связывания легкой цепи, имеющийся, по меньшей мере, в одном из слияний. ДНК, кодирующие слияния тяжелых цепей иммуноглобулинов и, если желательно, легкую цепь иммуноглобулинов, встраивают в отдельные экспрессионные векторы и котрансформируют в подходящий организм хозяина. Для дополнительных деталей производства биспецифических антител смотри, например, Suresh et al., Meth. In Enzym., 121:210 (1986).

Получение гетероконъюгата антител также рассматривают в изобретении. Гетероконъюгат антител компонуют из двух ковалентно соединенных антител. Такие антитела, например, предложили для направления клеток иммунной системы к нежелательным клеткам (патент США N 4676980). Рассматривают, что антитела могут быть приготовлены in vitro с использованием известных способов в синтетической белковой химии, в том числе способов, включающих сшивающие агенты. Например, иммунотоксины могут быть сконструированы с использованием реакции дисульфидного обмена или образованием тиоэфирной связи. Примеры подходящих реагентов для этой цели включают в себя иминотиолат и метил-4-меркаптобутиримидат и, которые раскрыты, например, в патенте США N 4676980.

Кроме того, можно создать однодоменные антитела к IL13. Примеры этой технологии были описаны в WO 9425591 для антител, произведенных из тяжелой цепи Ig верблюдовых (Camelidae), также в US 20030130496, описывающих выделение одиночного домена полностью человеческих антител из фаговых библиотек.

Идентификация анти-il13 антител

Изобретение предоставляет моноклональные антитела-антогонисты, которые ингибируют и нейтрализуют действие IL13. В частности, антитела изобретения связываются с IL13 и ингибируют активацию альфа-цепь-1 рецептора IL13 (IL13Ra1). Антитела изобретения включают в себя антитела, обозначенные 228 В/С-1, 228А-4, 227-26 и 227-43 и раскрывают гуманизированные клоны антител 228 В/С-1. Изобретение также включает в себя антитела, которые связываются с тем же самым эпитопом, что и одно из этих антител, например, что и моноклональное антитело 228 В/С-1.

Кандидатов на IL13-антитела тестировали методом твердофазного иммуноферментного анализа (ELISA), вестерн-иммуноблотинга или другими иммунохимическими методами. Анализы, проведенные для характеристики индивидуальных антител, включали в себя: (1) ингибирование IL13-аутокринной пролиферации клеточных линий HDLM-2 и L-1236 лимфомы Ходжкина; (2) ингибирование IL13-индуцированного фосфорилирования STAT6 в клетках ТНР-1; и (3) ингибирование IL13-индуцированной супрессии экспрессии CD14 в первичных моноцитах человека; и (4) ингибирование IL3-индуцированной позитивной регуляции экспрессии CD23 в первичных моноцитах человека. Детали экспериментов описывают в примерах.

Антитела изобретения включают в себя, но не ограничиваются, поликлональные, моноклональные, моновалентные, биспецифические, гетероконъюгаты, мультиспецифические, человеческие, гуманизированные или химерные антитела, одноцепочечные антитела, однодоменные антитела, Fab-фрагменты, Р(ab')-фрагменты, фрагменты, продуцированные Fab-экспрессирующей библиотекой, антиидиотипические (anti-ld) антитела (в том числе, например, anti-ld-антитела к антителам изобретения) и эпитоп-связывающие фрагменты любого из вышекузанных.

Термин «антитело», как используют здесь, относится к молекулам иммуноглобулинов и иммунологически активным частям молекул иммуноглобулинов, т.е., молекулам, которые содержат антигенсвязывающий сайт, который специфически связывает антиген. Молекулы иммуноглобулинов изобретения могут быть любого типа (например, IgG, IgE, IgM, IgD, IgA и IgY), класса (IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2) или подкласса иммуноглобулиновой молекулы. Кроме того, термин «антитело» (АЬ) или «моноклональное антитело» (MAb) предназначают для включения интактых молекул, так же как и фрагментов антител (например, Fab- и Р(ab')2-фрагментов), которые способны специфически связываться с белком. Fab- и F(ab')2-фрагменты, у которых отсутствует Pc-фрагмент интактного антитела, очищают более быстро из кровотока животных или циркулирующей жидкости растений и могут иметь меньшее неспецифическое тканевое связывание, чем интактное антитело (Wahl et al., J. Nucl. Med. 24:316-325 (1983)).

Антитела могут быть антигенсвязывающими фрагментами антител человека изобретения и включать в себя, но не ограничиваться, Fab, Fab', и F(ab')2, Fd, одноцепочечные Fvs (scFv), одноцепочечные антитела, сшитые дисульфидными связями Fvs (sdFv), и однодоменные антитела, содержащие или VL-домен, или VH-домен. Антигенсвязывающие фрагменты антител, в том числе одноцепочечные антитела, могут содержать только вариабельную область (вариабельные области) или в сочетании с целой, или с частью нижеперечисленных: шарнирной областью, СН1-, СН2- и СН3-доменами. Также включенными в изобретение являются антигенсвязывающие фрагменты, содержащие любую комбинацию вариабельной области (вариабельных областей) с шарнирной областью, СН1-, СН2- и СН3-доменами. Антитела изобретения могут быть из любого источника животного происхождения, в том числе птиц и млекопитающих. Предпочтительными антителами являются антитела человека, приматов, не относящихся к человеку, грызунов (например, мышей и крыс), ослиные, овечьи, кроличьи, козьи, морских свинок, верблюжьи, лошади или цыпленка.

Как используют здесь, «человеческие» антитела» включают в себя антитела, имеющие аминокислотную последовательность человеческого иммуноглобулина, и включают в себя антитела, изолированные из иммуноглобулиновых библиотек человека или животных, трансгенных по одному или нескольким иммуноглобулинам человека, и которые не экспрессируют эндогенные иммуноглобулины, как описывают ниже, например, в патенте США N 5939598 Kucherlapati et al.

Антитела изобретения могут быть моноспецифическими, биспецифическими, триспецифическими или большей специфичности, мультиспецифическими. Мультиспецифические антитела могут быть специфичными для различных эпитопов IL13 или могут быть специфичными как для IL13, так и для гетерологичных эпитопов, таких как гетерологичный полипептид или материал твердой подложки. Смотри, например, публикации: согласно РСТ WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol. 147:60-69 (1991); патенты США NN 4474893; 4714681; 4925648; 5573920; 5601819; Kostelny et al., J. Immunol. 148:1547-1553(1992).

Антитела изобретения могут быть описаны или охарактеризованы на основе эпитопа (эпитопов) или части (частей) IL13, которые они узнают или специфически связывают. Эпитоп (эпитопы) или часть (части) полипептидов могут быть определены как описывают здесь, например, N-концевыми или С-концевыми положениями, размером прилегающих аминокислотных остатков, или перечислены в таблицах и фиг.х.

Антитела изобретения также могут быть описаны или охарактеризованы на основе их перекрестной реактивности. Антитела, которые связывают полипептиды IL13, которые имеют, по меньшей мере 95%, по меньшей мере 90%, по меньшей мере 85%, по меньшей мере 80%, по меньшей мере 75%, по меньшей мере 70%, по меньшей мере 65%, по меньшей мере 60%, по меньшей мере 55% и по меньшей мере 50% идентичность к IL13 (как рассчитано с использованием методов, известных в данной области и описанных здесь), также включают в данное изобретение. Антитела против IL13 могут также связываться с Кд меньшей чем приблизительно 10-7 М, меньшей чем приблизительно 10-6 М, или меньшей чем приблизительно 10-5 М с другими белками, такими как IL13-антитела из видов, других чем те, против которых анти-IL13-антитела направлены.

В конкретных вариантах воплощения антитела изобретения дают перекрестную реакцию с обезьяньими гомологами человеческого IL13 и с их соответствующими эпитопами. В конкретном варианте воплощения вышеописанная перекрестная реактивность относится к любому простому определенному антигенному или иммуногенному полипептиду, или комбинации (комбинациям) определенных антигенных и/или иммуногенных полипептидов раскрытых здесь.

Кроме того, включенными в изобретение являются антитела, которые связывают полипептиды, кодируемые полинуклеотидами, которые гибридизуются с полипептидом, кодирующем IL13 при строгих условиях гибридизации. Антитела изобретения могут также быть описаны или конкретизированы в отношении их аффинности связывания с полипептидом изобретения. Предпочтительные аффиности связывания включают в себя таковые с равновесной константой диссоциации КД от 10-8 до 10-15 М, от 10-8 до 10-8 М, от 10-8 до 10-8 М или от 10-10 до 1012 М. Изобретение также предоставляет антитела, которые конкурентно ингибируют связывание антитела с эпитопом изобретения, как определяли любым известным методом в данной области для определения конкурентного связывания, например, иммунологическими анализами, описанными здесь. В предпочтительных вариантах воплощения, антитело конкурентно ингибирует связывание с эпитопом по меньшей мере на 95%, по меньшей мере на 90%, по меньшей мере на 85%, по меньшей мере на 80%, по меньшей мере на 75%, по меньшей мере на 70%, по меньшей мере на 60% или по меньшей мере на 50%.

Векторы и клетки хозяина

В другом аспекте изобретение предоставляет векторные конструкции, содержащие нуклеотидную последовательность, кодирующую антитела данного изобретения, и клетки хозяина, содержащие такой вектор. Стандартные приемы клонирования и трансформации могут быть использованы в приготовлении клеточных линий, экспрессирующих антитела изобретения.

Рекомбинантные экспрессионные векторы, содержащие нуклеотидную последовательность, кодирующую антитела изобретения, могут быть приготовлены с использованием хорошо известных способов. Экспрессирующие векторы содержат в себе нуклеотидную последовательность, функционально сшитую с подходящими транскрипционными или трансляционными регуляторными нуклеотидными последовательностями, такими как последовательности, полученные из генов млекопитающих, микроорганизмов, вирусов или насекомых. Примеры регуляторных последовательностей включают в себя транскрипционные промоторы, операторы, энхансеры, рибосомальные сайты, связывающие мРНК и/или другие соответствующие последовательности, которые контролируют транскрипцию и инициацию трансляции и терминацию. Нуклеотидные последовательности являются «функционально сшитыми» если регуляторная последовательность функционально относится к нуклеотидной последовательности соответствующего полипептида. Таким образом, промоторную нуклеотидную последовательность функционально пришивают, например, к последовательности тяжелой цепи антитела, если промоторная нуклеотидная последовательность контролирует транскрипцию соответствующей аминокислотной последовательности.

Кроме того, последовательности, кодирующие соответствующие сигнальные пептиды, которые не являются в естественных условиях ассоциированными с последовательностями тяжелой и/или легкой цепей антитела, могут быть внедрены в экспрессионные векторы. Например, нуклеотидная последовательность сигнального пептида (секреторного лидера) может быть слита внутри рамки считывания с полипептидной последовательностью так, что антитело секретируется в периплазматическое пространство или в среду. Сигнальный пептид, который является функциональным в заданной клетке хозяина, усиливает внеклеточную секрецию подходящего антитела. Сигнальный пептид может быть отщеплен от полипептида при секреции антитела из клетки. Примеры таких секреторных сигналов являются хорошо известными и включают в себя, например, таковые, описанные в US 5698435, US 5698417 и US 56204023.

Клетки хозяина, пригодные для изобретения, включают в себя, но не ограничиваются, микроорганизмы, такие как бактерии (например, Е. Coli, В. Subtillis), трансформированные рекомбинантной ДНК бактериофага, плазмидной ДНК или космидными ДНК-экспрессирующими векторами, содержащими последовательности, кодирующие антитела; дрожжи (например, Saccharomyces, Pichia), трансформированные рекомбинантными дрожжевыми экспрессионными векторами, содержащими последовательности, кодирующие антитела; клеточные системы насекомых, инфецированные рекомбинантными вирусными экспрессирующими векторами (например, Baculovirus), содержащими последовательности, кодирующие антитела; системы растительных клеток, инфицированные рекомбинантными вирусными экспрессионными векторами (например, вирусом мозаики цветной капусты, CaMV; вирусом табачной мозаики, TMV) или трансформированные рекомбинантными плазмидными экспрессионными векторами (например, Ti-плазмидами), содержащими последовательности, кодирующие антитела; или клеточные системы млекопитающих (например, клетки COS, СНО, ВНК, 293, 373), накапливающие рекомбинантные экспрессионные конструкции, содержащие промоторы, произведенные из генома клеток млекопитающих (например, металлотионеиновый промотор), или из вирусов млекопитающих (например, аденовирусный поздний промотор; промотор 7,5К на основе вируса коровьей оспы).

Вектор может быть плазмидным вектором, однонитевым или двунитевым вектором на основе бактериофага, или вирусным вектором с однонитевыми или двунитевыми РНК или ДНК. Такие векторы могут быть внедрены внутрь клеток в виде полинуклеотидов хорошо известными методами внедрения ДНК и РНК внутрь клеток. В случае фаговых и вирусных векторов, они также могут быть внедрены в клетки в виде упакованных или инкапсулированных вирусов хорошо известными методами инфицирования и трансдукции. Вирусные векторы могут быть репликационно-компетентными или репликационно-дефектными. В последнем случае, вирусное размножение вообще произойдет только в компетентных клетках хозяина. Бесклеточные системы трансляции могут также быть применены для производства белка с использованием РНК, полученных на ДНК-конструкциях изобретения. Такие векторы могут включать в себя нуклеотидную последовательность, кодирующую константную область молекулы антитела (см., например, публикацию согласно РСТ WO 86/05807; публикацию согласно РСТ WO 89/01036 и патент США N 5122464), и вариабельный домен антитела может быть клонирован в таком векторе для экспрессии целой тяжелой или легкой цепи.

Прокариоты, пригодные в качестве клеток хозяина, в данном изобретении включают в себя грамм-отрицательные или грамм-положительные организмы, такие как E.coli, и B.subtillis. Экспрессирующие векторы для использования в прокариотических клетках хозяина обычно содержат один или несколько фенотипических селектируемых маркерных генов. Фенотипическим селектируемым маркерным геном является, например, ген, кодирующий белок, который придает устойчивость к антибиотику, или который обеспечивает аутотрофную потребность. Примеры подходящих экспрессионных векторов для прокариотических клеток хозяина включают в себя векторы, произведенные из коммерчески доступных плазмид, таких как рКК223-3 (Phannacia Fine Chemicals, Uppsala, Sweden), pGEM1 (Promega Biotec, Madison, Wisconsin., USA) и рЕТ (Novagen, Madison, Wisconsin, USA), pRSET (Invitrogen Corporation, Carlsbad, California, USA), серии векторов (Studier, F.W., J. Mol. Biol. 219:37 (1991); Shoepfer, R. Gene 124: 83 (1993)). Промоторные последовательности, обычно используемые для рекомбинантных экспрессионных векторов прокариотических клеток хозяина, включают в себя Т7 (Rosenberg, et al. Gene 56, 125-135 (1987)), β-лактамазу (пенициллиназу), лактозную промоторную систему (Chang, et al., Nature 275:615, (1978); и Goeddel et al., Nature 281:544, (1979)), триптофановую (trp) промоторную систему (Goeddel et al., Nucl. Acids Res. 8:4057, (19980)) и tac-промотор (Sambrook et al., 1990, Molecular Cloning, (2000) A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).

Дрожжи, подходящие для данного изобретения, включают в себя таковые из рода Saccharomyces, Pichia, Actinomycetes и Kluyveromyces. Дрожжевые векторы будут часто содержать последовательность точки начала репликации из 2 мкм дрожжевой плазмиды, автономно реплицирующуюся последовательность (ARS), промоторную область, последовательности для полиаденилирования, последовательности терминации транскрипции и селектируемый маркерный ген. Подходящие промоторные последовательности дрожжевых векторов включают в себя, среди прочих, металлотионеиновые промоторы, 3-фосфоглицераткиназу (Hrtzeman et al., j. Biol Chem. 255:2073, (1980)) или другие гликолитические ферменты (Holland et al., Biochem. 17:4900, (1978)), такие как энолаза, глицеральдегид-3-фосфат дегидрогеназа, гексокиназа, пируватдекарбоксилаза, фосфофруктокиназа, гюкозо-6-фосфатизомераза, 3-фосфоглицерат мутаза, пируваткиназа, триозофосфат изомераза, фосфоглюкозоизомераза и глюкокиназа. Другие подходящие векторы и промоторы для использования экспрессии в дрожжах дополнительно описывают Fleer et al., Gene, 107:285-195 (1991). Другие подходящие промоторы и векторы для дрожжей и процедур трансформации дрожжей являются хорошо известными в данной области. Процедуры трансформации дрожжей являются хорошо известными. Одну такую процедуру описывает Hinnen et al., Proc. Natl. Acad. Sci., 75:1929 (1978). Процедура Хиннена отбирает Trp*-трансформанты на селективной среде.

Системы культур клеток хозяина млекопитающих или насекомых могут также быть использованы для экспрессии рекомбинантных антител, например, бакуловирусные системы для синтеза гетерологичных белков. В системах насекомых, Autographa californica - вирус ядерного полиэдроза (AcNPV) может быть использован в качестве вектора для экспрессии чужеродных генов. Вирус растет в клетках Spodoptera frugiperda. Последовательность, кодирующая антитело, может быть клонирована индивидуально в несущественных областях (например, полиэдриновый ген) вируса и помещена под контроль AcNPV-промотора (например, полиэдринового промотора).

Клетки NSO или клетки яичника китайского хомячка (СНО) могут быть использованы для экспрессии антител изобретения в млекопитающих. Последовательности контроля транскрипции и трансляции для экспрессионных векторов клеток хозяина млекопитающих могут быть удалены путем эксцизии из вирусных геномов. Традиционно используемые промоторные последовательности и энхансерные последовательности получают из вируса полиомы, аденовируса-2, обезьянего вируса 40 (SV40) и человеческого цитомегаловируса (CMV). Последовательности ДНК, полученные из вирусного генома SV40 могут быть использованы для предоставления других генетических элементов для экспрессии последовательности структурного гена в клетках хозяина млекопитающих, таких как, ориджин SV40, ранний и поздний промоторы, усилитель, сайты сплайсинга и полиаденилирования. Вирусные ранние и поздние промоторы являются конкретно полезными поскольку оба являются легко получаемыми из вирусного генома в виде фрагмента, который также может содержать вирусный сайт начала репликации. Типичные экспрессионные векторы для использования в клетках-хозяевах млекопитающих являются коммерчески доступными.

Полинуклеотиды, кодирующие антитела

Дополнительно изобретение предоставляет полинуклеотиды или нуклеиновые кислоты, например, ДНК, содержащие нуклеотидную последовательность, кодирующую антитело изобретения и его фрагменты. Примеры полинуклеотидов включают в себя полинуклеотиды, кодирующие цепи антител, содержащие одну или несколько аминокислотных последовательностей описанных здесь. Изобретение также охватывает полинуклеотиды, которые гибридизуются в жестких условиях, или в условиях пониженной жесткости гибридизации, с полинуклеотидами, которые кодируют антитело изобретения.

Полинуклеотиды могут быть получены и нуклеотидная последовательность полинуклеотидов определена любым известным в данной области способом. Например, при известной нуклеотидной последовательности антитела, полинуклеотид, кодирующий антитело, может быть собран из химически синтезированных олигонуклеотидов (например, как описано у Kutmeier et al., BioTechniques 17:242 (1994)), который, кратко, включают в себя синтез перекрывающихся нуклеотидов, содержащих в себе части последовательности, кодирующей антитело, отжиг и лигирование этих олигонуклеотидов, а затем амплификацию лигированных олигонуклеоитидов с помощью ПЦР.

Альтернативно, полинуклеотид, кодирующий антитело, может быть синтезирован из нуклеиновой кислоты из подходящего источника. Если нет в распоряжении клона, содержащего нуклеиновую кислоту, кодирующую конкретное антитело, но последовательность молекулы антитела является известной, то нуклеиновая кислота, кодирующая иммуноглобулин, может быть химически синтезирована или получена из подходящего источника (например, кДНК-библиотеки антител или кДНК-библиотеки, созданной из нуклеиновой кислоты, предпочтительно поли-А*РНК, изолированной из любой ткани или любых клеток, экспрессирующих антитело, таких как гибридомные клетки, отобранные для экспрессии антитела изобретения) ПЦР-аплификацией с использованием синтетических праймеров, поддающихся гибридизации с 3'- и 5'-концов последовательности или клонированном с использованием олигонуклеотидного зонда, специфичного для конкретной последовательности гена для идентификации, например, кДНК-клона из кДНК-библиотеки, который кодирует антитело. Амплифицированные нуклеиновые кислоты, синтезированные ПЦР, затем могут быть клонированы в реплицирующихся клонирующих векторах с использованием любого способа, хорошо известного в данной области.

После того как определяют нуклеотидную последовательность и соответствующую аминокислотную последовательность антитела, можно манипулировать с нуклеотидной последовательностью антитела с использованием способов, хорошо известных в области манипулирования с нуклеотидными последовательностями, например, методами рекомбинантной ДНК, сайт-направленного мутагенеза, ПЦР, и так далее (см., например, методы, описанные в Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. и Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Willey & Sons, NY, которые обе включают в виде ссылок в их полноте) для создания антител, имеющих различную аминокислотную последовательность, например, для создания аминокислотных замещений, делеций и/или инсерций.

В специфическом варианте воплощения, аминокислотная последовательность вариабельных доменов тяжелой и/или легкой цепи может быть проконтролирована хорошо известными в данной области способами для идентификации последовательностей CDRs, например, сравнением с известными аминокислотными последовательностями других вариабельных областей тяжелой и легкой цепей для определения участков гипервариабельнсти последовательностей. С использованием рутинных способов рекомбинантной ДНК, один или несколько CDRs могут быть внедрены внутрь каркасных областей, например, каркасных областей человека для гуманизации антитела, не относящегося к человеку, как описывают выше. Каркасные области могут быть естественными или консенсусными каркасными областями и предпочтительно каркасными областями человека (см., например, Chothia et al., J. Mol. Biol. 278:457-479 (1998) для перечня каркасных областей). Предпочтительно, полинуклеотид, созданный комбинацией каркасных областей и CDRs кодирует антитело, которое специфически связывает полипетид изобретения. Предпочтительно, как обсуждали выше, одно или несколько аминокислотных замещений могут быть сделаны внутри каркасных областей, и предпочтительно аминокислотные замещения улучшают связывание антитела с его антигеном. Дополнительно, такие способы могут быть использованы для получения аминокислотных замещений или делеций одного или нескольких цистеиновых остатков в вариабельной области, участвующих в дисульфидной связи внутри цепей, для создания молекул антител, с одной или несколькими недостающими внутрицепочечными дисульфидными связями. Другие полинуклеотидные изменения охватывают настоящим изобретением и являются в рамках данной области.

Кроме того, могут быть использованы способы, разработанные для изготовления «химерных антител» (Morrison et al., Proc. Natl, Acad. Sci. 81:851-855 (1984); Neuberger et al., Nature 312:604-608 (1984); Takeda et al., Nature 314:452-454 (1985)) сплайсингом генов молекулы антитела мыши, подходящей антигенной специфичности, вместе с генами молекулы антитела человека подходящей биологической активности. Как описали выше, химерное антитело является молекулой, в которой различные части получены из различных видов животных, например, антитела, имеющие вариабельную область, полученную от мышиного Mab, и константную область иммуноглобулина человека, например, гуманизированные антитела.

Альтернативно, технологии, описанные для производства одноцепочечных антител (патент США N 4946778; Bird, Science 242:423-42 (1988); Huston et al., Proc. Natl, Acad. Sci. USA 85:5879-5883 (1988); и Ward et al., Nature 334:544-54 (1989)) могут быть адаптированы для получения одноцепочечных анител. Одноцепочечные антитела образуют сшиванием фрагментов тяжелой и легкой цепей Fv-области через аминокислотный мостик, приводящем к однонитевому полипептиду. Также могут быть использованы способы сборки функциональных Fv-фрагментов в Б. coli (Skerra et al., Science 242:1038-1041 (1988)).

Способы получения антител против il13

Антитела изобретения могут быть продуцированы любым способом, известным в области синтеза антител, конкретно, химическим синтезом или предпочтительно способами рекомбинантной экспрессии.

Рекомбинантная экспрессия антитела изобретения или его фрагмента, производного или аналога (например, тяжелой или легкой цепи антитела изобретения, или одноцепочечного антитела изобретения) требует конструирования экспрессионного вектора, содержащего полинуклеотид, который кодирует антитело или фрагмент антитела. После того как получили полинуклеотид, кодирующий молекулу антитела, вектор для продуцирования антитела может быть произведен технологией рекомбинантной ДНК. Конструируют экспрессирующий вектор, содержащий последовательности, кодирующие антитело, и подходящие сигналы контроля транскрипции и трансляции. Такие методы включают в себя, например, методы рекомбинантной ДНК in vitro, методы синтеза и генетической рекомбинации in vivo.

Экспрессирующий вектор переносят в клетку хозяина общепринятыми способами и затем трансфецированные клетки наращивают общепринятыми способами для производства антитела изобретения. В одном аспекте изобретения, векторы, кодирующие как тяжелую, так и легкую цепи, могут быть коэкспрессированы в клетке хозяина для экспрессии полной молекулы иммуноглобулина, как детально описывают ниже.

Как описывают выше, множество векторных систем для экспрессии клеткой-хозяином могут быть использованы для экспрессии молекул антитела изобретения. Такие системы для экспрессии клеткой-хозяином представляют собой носителей, посредством которых могут быть произведены интересующие кодирующие последовательности и впоследствии очищены, но также представляют собой клетки, которые могут при трансформации или трансфекции с помощью подходящих нуклеотидных кодирующих последовательностей экспрессировать молекулу антитела изобретения in situ. Бактериальные клетки, такие как Е.coli, и эукариотические клетки являются, как правило, используемыми для экспрессии молекулы рекомбинантного антитела, особенно для экспрессии полной молекулы рекомбинантного антитела. Например, клетки млекопитающих, такие как клетки яичника китайского хомячка (СНО), вместе с вектором, таким как главный промоторный элемент предранних генов цитомегаловируса человека, являются эффективной эксперссирующей системой для антител (Foecking et al., Gene 45:101 (1986); Cockett et al., Bio/Technology 8:2 (1990)).

Кроме того, может быть выбран штамм клеток хозяина, который модулирует экспрессию внедренных последовательностей или модифицирует и процессирует генный продукт желаемым специфическим образом. Такие модификации (например, гликозилирование) и процессинг (например, расщепление) белковых продуктов могут быть важными для функции белка. Различные клетки хозяина имеют характеристики и механизмы для посттрансляционного процессирования и модификации белков и генных продуктов. Подходящие клеточные линии или системы клеток хозяина могут быть выбраны для обеспечения точной модификации и процессинга экспрессированного чужеродного белка. В завершение, могут быть использованы эукариотические клетки-хозяина, которые обладают клеточным механизмом для правильного процессинга первичного транскрипта, гликозилирования и фосфорилирования генного продукта. Такие клетки хозяина млекопитающих включают в себя, но не ограничиваются, клетки СНО, COS, 293, 3Т3 или миеломные клетки.

Для длительного и высокопродуктивного продуцирования рекомбинантных белков предпочтительной является стабильная экспрессия. Например, могут быть сконструированы клеточные линии, которые стабильно экспрессируют молекулу антитела. Скорее, чем использование экспрессирующих векторов, которые содержат вирусные точки начала репликации, клетки хозяина могут быть трансформированы ДНК, контролируемой подходящими элементами контроля экспрессии (например, промотором, энхансером, последовательностями, терминаторами транскрипции, сайтами полиаденилирования и т.д.) и селективными маркерами. После внедрения чужеродной ДНК генно-инженерным клеткам может быть предоставлена возможность для роста в течение 1-2 дней в обогащенной среде, а затем клетки переносят на селективную среду. Селективный маркер в рекомбинантной плазмиде придает устойчивость к селекции и делает возможным для клеток стабильную интеграцию плазмиды в их хромосомы и обеспечивает рост с образованием локусов, которые, в свою очередь, могут быть клонированы и распространены в клеточные линии. Этот способ преимущественно может быть использован для генно-инженерных клеточных линий, которые экспрессируют антительную молекулу. Такие генно-инженерные клеточные линии могут быть конкретно полезными в скрининге и оценке сложных соединений, которые взаимодействуют прямо или косвенно с антительной молекулой.

Ряд систем селекции может быть использован, включающий, но не ограничивающийся, гены тимидинкиназы вируса герпеса простого (Herpes simplex virus) (Wigler et al., Cell 11:223 (1997)), гипоксантин-гуанинфосфорибозилтрансферазы (Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA 48:202 (1992)), и гены аденинфосфорибозилтрансферазы (Lowy et al., Cell 22:817 (1980)) могут быть использованы в tk-клетках, hgprt-клетках и aprt-клетках соответственно. Также устойчивость к антиметаболитам может быть использована в качестве основы для селекции следующих генов: dhfr, который придает устойчивость к метотрексату (Wigler et al. Proc. Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al., Proc. Natl. Acad. Sci. USA 78:1527 (1981)); gpt, который придает устойчивость к микофеноловой кислоте (Mulligan & Berg, Proc. Natl. Acad. Sci. USA 78:2072 (1981)); neo, который придает устойчивость к аминогликозиду G-418 (Wu and Wu, Biotherapy 3:87-95 (1991); и hygro, который придает устойчивость к гигромицину (Santerre et al., Gene 30:147 (1984)). Общеизвестные методы в области технологии рекомбинантной ДНК могут быть рутинно применены для отбора желаемого рекомбинантного клона и такие методы описаны, например, у Ausubel et al., (eds), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, (2000) Laboratory Manual, Stockton Press, NY (1990) и в главах 12 и 13, Dracopoli et al., (eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre-Garapin et al., J. Mol. Biol. 150:1 (1981), которые включают сюда в виде ссылок в их полноте.

Уровни экспрессии антительной молекулы могут быть повышены путем амплификации векторов (см. обзор Bebbington and Hentschel, "The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells" (DNA Cloning, Vol.3. Academic Press, New York, (1987)). В случае, когда маркер в векторной системе, экспрессирующей антитело, обладает способностью амплифицироваться, повышение уровня ингибитора, имеющегося в культуре клетки хозяина, увеличит число копий маркерного гена. Поскольку амплифицированная область связана с геном антитела, то наработка антитела также возрастет (Grouse et al., Mol. Cell. Biol. 3:257 (1983)).

Клетка-хозяин может быть котрансфецирована двумя экспрессирующими векторами изобретения, первый вектор, кодирующий полученный полипептид тяжелой цепи, и второй вектор, кодирующий полученный полипептид легкой цепи. Оба вектора могут содержать идентичные селективные маркеры, которые обеспечивают эквивалентную экспрессию полипептидов тяжелой и легкой цепей. Альтернативно, может быть использован одинарный вектор, который кодирует и обеспечивает экспрессию полипептидов как тяжелой, так и легкой цепей. В таких случаях легкая цепь должна быть помещена перед тяжелой цепью во избежание избытка токсичной свободной тяжелой цепи (Proudfoot, Nature 322:52 (1986); Kohler, Proc. Natl. Acad. Sci. USA 77:2197 (1980)). Кодирующие последовательности тяжелой и легкой цепей могут содержать кДНК или геномную ДНК.

Если только молекула изобретения была продуцирована животным, была химически синтезирована или экспрессирована на основе рекомбинантных технологий, она может быть очищена любым способом известным в области очистки иммуноглобулиновой молекулы, например, хроматографией (например, ионообменной, аффинной, конкретно аффинностью к специфическому антигену после протеин-А и эксклюзионной хроматографией), центрифугированием, дифференциальной растворимостью или другими стандартными способами очистки белков. Кроме того, антитела изобретения или их фрагменты могут быть слиты с гетерологичными полипептидными последовательностями, описанными здесь или с другими, известными в этой области, для облегчения очистки.

Изобретение охватывает антитела, рекомбинантно слитые или химически конъюгированные (в том числе конъюгации как ковалентные, так и нековалентные) с полипептидом. Слитые или конъюгированные антитела изобретения могут быть использованы для облегчения очистки. См, например, Harbor et al., выше, и публикация согласно РСТ WO 93/21232; Европейский патент 439095; Naramura et al., Immunol. Lett. 39:91-99 (1994); патент США N 5474981; Gillies et al., Proc. Natl. Acad. Sci. 89:1428-1432; Fell et al., J. Immunol. 146:2446-2452 (1991), которые приводят в виде ссылки в их полноте.

Кроме того, антитела или их фрагменты изобретения могут быть слиты с маркерными последовательностями, например, с пептидом, для облегчения очистки. В предпочтительных вариантах маркерной аминокислотной последовательностью является гексагистидиновый пептид, например, tag-последовательность, имеющаяся в векторе pQE (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, Calif., 91311) среди прочих, многие из которых являются коммерчески доступными. Как описывается, например, Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824 (1989), гексагистидин предусмотрен для подходящей очистки слитого белка. Другие tag-пептиды, пригодные для очистки, включают в себя, но не ограничиваются, "HA"-tag, который соответствует эпитопу, полученному из гриппозного белка гемагглютинина (Wilson et al., Cell 37:767 (1984)) и "flag"-метку.

Диагностические применения анти-Il13 антител.

Антитела изобретения включают в себя производные, которые являются модифицированными, например, ковалентным присоединением молекулы любого типа к антителу, так что такое ковалентное присоединение не мешает связыванию с IL13. Например, но не с целью ограничения, антительные производные включают в себя антитела, которые модифицировали, например, биотинилированием, пероксидазой хрена (HRP) или другими веществами поддающимися обнаружению.

Антитела изобретения могут быть использованы, например, но, не ограничиваясь, для очистки или обнаружения IL13, в том числе в диагностических методах как in vitro, так и in vivo. Например, антитела используют в иммуноанализах для качественного и количественного определения уровней IL13 в биологических пробах. См., например, Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (внедренной сюда в виде ссылки в ее полноте).

Как обсуждают более детально ниже, антитела изобретения могут быть использованы или в чистом виде, или в комбинации с другими композициями. Кроме того, антитела могут быть рекомбинантно слиты с гетерологичным полипептидом с N- или С-концов или химически конъюгированы (в том числе ковалентным или нековалентным конъюгированиями) с полипептидами или другими композициями. Например, антитела изобретения могут быть слиты в результате рекомбинации или конъюгированы с молекулами, используемыми в виде меток в методах обнаружения.

Кроме того, изобретение охватывает антитела или их фрагменты, конъюгированные с диагностическим средством. Антитела могут быть использованы с точки зрения диагностики для, например, мониторинга развития или прогрессирования аллергического ответа в качестве части процедуры клинического тестирования, например, для определения эффективности данного режима лечения. Обнаружение может быть облегчено сшивкой антитела с детектируемым веществом. Примеры детектируемых веществ включают в себя различные ферменты, простетические группы, флуоресцентные вещества, люминесцентные вещества, биолюминесцентные вещества, радиоактивные вещества, позитронно-активные металлы с использованием позитронно-эмиссионных томографии и парамагнитных ионов металлов. Детектируемые вещества могут быть пришиты или конъюгированы или непосредственно к антителу (или его фрагменту) или косвенно, через промежуточное соединение (например, линкер, известный в данной области) с использованием способов известных в данной области. См., например, патент США N 4741900 для ионов металлов, которые могут быть конъюгированы с антителами для использования в качестве диагностикумов в соответствии с изобретением. Примеры подходящих ферментов включают в себя пероксидазу хрена, щелочную фосфатазу, бетагалактозидазу или ацетилхолинестеразу;

примеры подходящих комплексов простетических групп включают в себя стрептавидин/биотин и авидин/биотин; примеры подходящих флуоресцентных материалов включают в себя умбеллиферон, флуоресцеин, флуоресцеин-изотиоционат, родамин, дихлортриазиниламин-флуоресцеин, дансилхлорид или фикоэритрин; пример люминесцентного материала включает в себя люминол; примеры биолюминесцентных материалов включают люциферазу, люциферин и акворин и примеры подходящих радиоактивных материалов включают 125I, 131I, 111In или 99Tc.

Антитела также могут быть прикреплены к твердым подложкам, которые являются конкретно полезными для иммуноанализов или очистки антигена-мишени. Такие подложки из твердых материалов включают в себя, но не ограничиваются, стекло, целлюлозу, полиакриламид, нейлон, полистирен, поливинилхлорид или полипропилен.

Меченые антитела и их производные и аналоги, которые специфически связываются с IL13, могут быть использованы в диагностических целях для детекции, диагностики или мониторинга заболевания, нарушений и/или состояний, связанных с аберрантной экспрессией и/или активностью IL13. Изобретение предусматривает обнаружение аберрантной экспрессии IL13, включающее (а) анализ экспрессии IL13 в клетках или жидкости организма индивидуума с использованием одного или нескольких антител изобретения специфичных к IL13 и (b) сравнение уровня экспрессии гена со стандартным уровнем экспрессии гена, в результате чего повышается или снижается в анализируемом IL13 уровень экспрессии по сравнению со стандартным уровнем экспрессии, указывающий на аберрантную экспрессию.

Антитела могут быть использованы для обнаружения наличия и/или уровней IL13 в пробе, например, в жидкости организма или пробе ткани. Метод обнаружения может включать в себя контактирование пробы с IL13-антителом и определения количества антитела, которое связывается с пробой.

Изобретение предоставляет диагностический анализ для диагностики нарушения, включающий (а) анализ экспрессии IL13 в клетках или жидкости организма индивидуума с использованием одного или нескольких антител изобретения специфичных к IL13 и (b) сравнение уровня экспрессии гена со стандартным уровнем экспрессии гена, при котором повышается или снижается в анализируемом IL13 уровень экспрессии по сравнению со стандартным уровнем экспрессии, указывающий на конкретное нарушение.

Антитела изобретения могут быть использованы для анализа уровней белка в биологических пробах с использованием классических иммуногистологических методов, известных специалистам в данной области (см., например, Jalkanen, et al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, et al., J. Cell. Biol. 105:3087-3096 (1987)). Другие методы, основанные на антителах, пригодных для обнаружения белка экспрессии гена, включают иммуноанализы, такие как твердофазный иммуносорбентный анализ (ELISA) и радиоиммуноанализ (RIA). Подходящие метки для иммуноанализов известны в данной области и включают в себя ферментативные метки, такие как глюкозооксидаза; радиоизотопы, такие как йод (125I, 121I), углерод (14С), сера (35S), тритий (3Н), индий (112In) и технеций (99Tc); люминесцентные метки, такие как люминол; и флуоресцентные метки, такие как флуоресцеин и родамин, и биотин.

Одним аспектом изобретения является обнаружение и диагностика заболевания или нарушения, ассоциированного с аберрантной экспрессией IL13 у животного, предпочтительно млекопитающего и наиболее предпочтительно у человека. В одном варианте воплощения диагностика включает в себя: а) введение (например, парентерально, подкожно или внутрибрюшинно) субъекту эффективного количества меченной молекулы, которая специфически связывается с IL13; b) ожидание в течение интервала времени после введения, давая возможность меченной молекуле для предпочтительного концентрирования в местах субъекта, в которых полипептид экспрессируется (и для несвязанной меченной молекулы возвращение к фоновому уровню); с) определение фонового уровня; и d) обнаружение меченной молекулы у субъекта, так что обнаружение меченной молекулы выше фонового уровня указывает на то, что субъект имеет конкретное заболевание или нарушение, связанное с аберрантной экспрессией IL13. Фоновый уровень может быть определен различными методами, в том числе сравнением обнаруженного количества меченной молекулы со стандартным значением, предварительно определенном для конкретной системы.

В данной области будет понятным, что размер субъекта и используемая система визуализации будут определять величину сканируемого вещества, необходимого для создания диагностической визуализации. В случае радиоизотопной частицы, для человеческого субъекта, количество инъецированной радиоактивности в норме составит приблизительно от 5 до 20 милликюри 99Tc. Затем меченное антитело или фрагмент антитела будет предпочтительно аккумулироваться в определенном месте клеток, которые содержат специфический белок. Визуализацию in vitro описывают S.W.Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments." (Chapter 13 in Tumour Imaging: The Radiochemical Detection of Cancer, S.W.Burchiel and B.A.Rhodes, eds., Masson Publishing Inc. (1982).

В зависимости от нескольких переменных, в том числе типа использованной метки и способа введения, временной интервал после введения для предоставления возможности меченной молекуле предпочтительно концентрироваться в участках субъекта и для возвращения несвязанной меченной молекулы к фоновому уровню составляет от 6 до 48 часов, или от 6 до 24 часов, или от 6 до 12 часов. В другом варианте воплощения временной интервал после введения составляет от 5 до 20 дней или от 5 до 10 дней.

В воплощении изобретения мониторинг заболевания или нарушения выполняют повторяющимися методами диагностики заболевания или нарушения, например, через один месяц после начального диагноза, черех шесть месяцев после начального диагноза, через один год после начального диагноза, и т.д.

Наличие меченой молекулы может быть обнаружено у пациента с использованием методов известных в данной области и сканированием in vitro. Эти методы зависят от типа использованной метки. Специалисты в данной области определят подходящий метод детектирования и конкретную метку. Методы и приспособления, которые могут быть использованы в диагностических методах изобретения включают, но не ограничиваются, компьютерную томографию (СТ), полное сканирование всего тела, например, позиционно-эмиссионной томографей (PET), магнитно-резонансную интроскопию (MRI) и сонографию (УЗИ).

В специфическом варианте воплощения молекулу метят радиоизотопом и обнаруживают у пациента с использованием радиационно-чувствительного операционного инструмента (Thurston et al., патент США N 5441050). В другом варианте воплощения молекулу метят флуоресцентным веществом и обнаруживают у пациента с использованием чувствительного к флуоресценции сканирующего инструмента. В другом варианте воплощения молекулу метят позитронно-активным металлом и обнаруживают у пациента с использованием позитронно-эмиссионной томографии. Еще в другом варианте воплощения молекулу метят парамагнитной меткой и обнаруживают с использованием магнитно-резонансной интроскопии (MRI).

В другом аспекте изобретение предоставляет способы диагностики предрасположенности пациента к развитию заболевания, вызванного неконтролируемой экспрессией цитокинов. Повышенные количества IL13 в конкретных клетках пациента, тканях или жидкости тела свидетельствует о том, что пациент является предрасположенным к конкретному иммунному заболеванию. В одном варианте способ включает в себя сбор клеток, ткани или пробы жидкости тела субъекта, имеющего известно низкий или нормальный уровни IL13, анализ ткани или жидкости тела на наличие IL13 в ткани и прогнозирование предрасположенности пациента к конкретному иммунному заболеванию, основанное на уровне экспрессии IL13 в ткани или жидкости тела. В другом варианте способ включает в себя сбор клеток, ткани или пробы жидкости тела, содержащих известный определенный уровень IL13 у пациента, анализ ткани или жидкости тела для количественного определения IL13 и прогнозирование предрасположенности пациента к конкретному иммунному заболеванию, основанное на изменении количества IL13 по сравнению с определенным или тестированным уровнем, установленным для нормальной клетки, ткани или жидкости тела. Определенный уровень IL13 может быть известного количества, основанного на литературных значениях, или может быть определен заблаговременно измерением количества в нормальной клетке, ткани или жидкости тела. Конкретно, определение уровней IL13 в конкретных тканях или жидкости тела делает возможным специфическое и раннее, предпочтительно до появления заболевания, обнаружение иммунного заболевания у пациента. Иммунные заболевания, которые могут быть диагностированы с использованием настоящих способов, включают в себя, но не ограничиваются, иммунные заболевания описанные здесь. В предпочтительном воплощении, тканью или жидкостью тела является периферическая кровь, лейкоциты, биопсийные ткани, например, биопсии легких или кожи, и ткань.

Терапевтическое применение анти-Il13 антител

Антитела с конъюгированным с ними терапевтическим компонентом или без него, введенные в чистом виде или в комбинации с цитотоксическим фактором (факторами) могут быть использованы в качестве лекарственного средства. Изобретение направлено на лечение, основанное на антителах, которое включает в себя введение антител изобретения животному, млекопитающему или человеку для лечения IL13-опосредованного заболевания, нарушения или состояния. Животное или субъект могут быть животным, нуждающемся в конкретном лечении, таким как животное имеющее диагноз конкретного нарушения, например, нарушение, относящееся к IL13. Антитела, направленные против IL13, являются пригодными для ингибирования аллергических реакций у животных, в том числе, но не ограничивается, у коров, свиней, лошадей, цыплят, кошек, собак, приматов, не принадлежащих к человеческому роду, и т.д., а также у людей. Например, введением терапевтически приемлемой дозы антитела, или антител, данного изобретения, или коктейля данных антител или в комбинации с антителами различных источников, аллергический ответ на антигены может быть снижен или элиминирован у леченного млекопитающего.

Терапевтические композиции изобретения включают в себя, но не ограничиваются, антитела изобретения (в том числе их фрагменты, аналоги и производные, как описывают здесь) и нуклеиновые кислоты, кодирующие антитела изобретения, как описывают ниже (в том числе их фрагмены, аналоги и производные и анти-идиотипические антитела как описывают здесь) Антитела изобретения могут быть использованы для лечения, ингибирования или предупреждения заболеваний, нарушений или состояний, ассоциированных с аберрантной экспрессией и/или активностью IL13, в том числе, но не ограничивается, любого одного или нескольких заболеваний, нарушений или состояний, описанных здесь. Лечение и/или предупреждение заболеваний, нарушений или состояний, ассоциированных с аберрантной экспрессией и/или активностью IL13, включает в себя, но не ограничивается, облегчение, по меньшей мере, одного из симптомов, ассоциированных с такими заболеваниями, нарушениями или состояниями. Антитела изобретения могут быть приготовлены в фармацевтически приемлемых композициях, в виде известных в данной области, или в виде описанных здесь.

Анти-IL13 антитела изобретения могут быть использованы для лечения различных заболеваний. Данное изобретение предоставляет способ предупреждения или лечения IL13-опосредованных заболеваний у млекопитающих. Способ включает в себя введение млекопитающему количества анти-IL13 антитела предупреждающего заболевание или для лечения. Анти-IL13 антитело связывается с IL13 и регулирует экспрессию цитокинов и клеточных рецепторов, дающую в результате уровни цитокинов, присущие состояниям, не пораженным заболеванием. Таким образом, заболевания для лечения включают в себя: аллергию, астму, аутоиммунное заболевание или другие воспалительные заболевания. Другие аллергические заболевания включают аллергические риниты, атопические дерматиты, пищевую гиперчувствительность и крапивницу; иммуноопосредованные заболевания кожи, в том числе буллезные заболевания кожи, экссудативную многоформную эритему и контактные дерматиты; аутоиммунное заболевание в том числе псориазы, ревматоидные артриты, хронические артриты у несовершеннолетних; воспалительные кишечные заболевания (то есть, язвенные колиты, болезнь Крона); другие заболевания, ассоциированные с IL13, в том числе идиопатическую интерсцициальную пневмонию, метаплазию бокаловидных клеток, воспалительные и фиброзные легочные заболевания, такие как кистозный фиброз, глютензависимая энтеропатия и болезнь Уиппла; иммунологические заболевания легких, такие как эозинофильная пневмония, идиопатический пневмофиброз и гиперчувствительный пневмонит; хроническое обструктивное легочное заболевание, респираторно-синцитальная вирусная инфекция (RSV), увеиты, склеродерму, остеопорозы и лимфому Ходжкина.

Количество антитела, которое будет эффективным в лечении, ингибировании и предупреждении заболевания или нарушения, связанного с аберрантной экспрессией и/или активностью IL13, может быть определено стандартными клиническими способами. Антитело может быть введено в схему лечения, согласующуюся с заболеванием, например, однократный прием или несколько приемов в течение от одного до нескольких дней до улучшения состояния заболевания, или периодические приемы в течение продолжительного периода для предупреждения аллергии или астмы. Кроме того, in vitro анализы могут быть дополнительно применены для облегчения определения оптимальных схем приема. Точная доза, которая используется в композиции, также будет зависеть от курса введения и серьезности заболевания или нарушения и должна быть определена в соответствии с решением профессионала и обстоятельствами пациента. Эффективные дозы могут быть экстраполированы из кривых доза-ответ, полученных in vitro на модельных тест-ситемах на животных.

Для антител доза, введенная пациенту, типично составляет от 0,1 мг/кг до 100 мг/кг массы тела пациента. Предпочтительно доза, введенная пациенту, находится между 0,1 мг/кг и 20 мг/кг массы тела пациента, более предпочтительно от 1 мг/кг до 10 мг/кг массы тела пациента. Как правило, человеческие антитела имеют более длительный период полужизни в теле человека, чем антитела из других видов вследствие иммунного ответа на чужеродные полипептиды. Таким образом, более низкие дозы человеческих антител и меньшая частота введений является зачастую возможной. Более того, дозировка и частота введения антител изобретения могут быть снижены увеличением поглощения антител и проницаемости тканей (например, в головной мозг) модификациями, например, липидизацией.

Антитела изобретения могут быть преимущественно использованы в комбинации с другими моноклональными или химерными антителами, или с лимфокинами или гематопоэтическими факторами роста (например, IL-2, IL-3, IL-7, интерферон), например, которые служат для увеличения числа или активации эффекторных клеток, которые взаимодействуют с антителами.

Антитела изобретения могут быть введены в чистом виде или в комбинации с другими видами лечений, такими как, иммунотерапия, бронходилаторами, молекулами анти-IgE, антигистаминами или антилейкотриенами.

В данном аспекте антитело существенно очищают (например, антитело существенно свободно от веществ, которые лимитируют его эффект или продуцируют нежелательные побочные эффекты).

Различные системы доставки известны и могут быть использованы для введения антитела изобретения, в том числе инъецирование, например, инкапсуляция в липосомах, в микрочастицах, микрокапсулах, рекомбинантных клетках, обеспечивающих экспрессию вещества, опосредованный рецепторами эндоцитоз (см., например, Wu et al., J. Biol. Chem. 262:4429-4432 (1987)), конструирование нуклеиновой кислоты в виде части ретровирусного или другого вектора и т.д.

Анти-IL13 антитело может быть введено млекопитающему в любой приемлемой манере. Способы введения включают в себя, но не ограничиваются, интрадермальный, внутримышечный, интраперитонеальный, внутривенный, подкожный, интраназальный, эпитдуральный, ингаляцию и пероральный пути. Антитела или композиции могут быть введены любым удобным путем, например, инфузионным или болюсным введением, абсорбцией через эпителиальные или кожно-слизистые выстилки (например, слизистую оболочку полости рта, ректальную и интестинальную слизистую оболочку, и т.д.) и могут быть введены вместе с другими биологически активными агентами. Введение может быть системным или локальным. Кроме того, введение может быть желательным для внесения антител для лечебных целей или композиций изобретения в центральную нервную систему любым подходящим путем, в том числе интравентрикулярной и интратекальной инъекцией; интравентрикулярная инъекция может быть обеспечена интравентрикулярным катетером, например, присоединенным к резервуару, например, резервуару Омайя.

Также может быть применено пульмональное введение, например, с использованием ингалятора или распылителя, и композиция с аэрозольным агентом. Антитело также может быть введено в легкие пациента в форме порошковидной композиции (см., например, патент США N 6514496).

В специфическом варианте может быть желательным введение антител или композиций изобретения для лечебных целей локально в область, которой требуется лечение; это может быть достигнуто, например, но, не ограничиваясь, локальной инфузией, местной аппликацией, инъекцией, посредством катетера, посредством суппозитория, посредством имплантата, причем указанный имплантат является пористым, непористым или желатиновым материалом, в том числе мембранами, такими как силастиковые мембраны или волокна. Предпочтительно при введении антитела изобретения должна соблюдаться осторожность и использование материалов, которые не абсорбируют белок.

В другом варианте антитело может быть доставлено в везикуле, конкретно в липосоме (см., Langer, Science 249:1527-1533 (1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, Proc. Natl. Acad. Sci. стр.353-365 (1989); Lopez-Berestein, там же, стр.317-327; см. целиком там же).

В другом варианте антитело может быть доставлено в системе с контролируемым высвобождением. В одном варианте воплощения может быть использован насос (см., Langer, выше; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321:574 (1989)). В другом варианте могут быть использованы полимерные материалы (см. Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Controlled Drug Biovailability, Drug Product Desighn and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); см. также Levy et al., Science 228:190 (1985); During et al., Ann. Neurol. 25:351 (1989); Howard et al., J. Neurosurg. 71:105 (1989)). В другом варианте система с контролируемым высвобождением может быть помещена вблизи мишени для лечения.

Данное изобретение также предоставляет фармацевтические композиции. Такие композиции содержат терапевтически эффективное количество антитела и физиологически приемлемый носитель. В специфическом воплощении термин «физиологически приемлемый» означает одобренный Федеральным контрольным органом или правительством государства (штата) или перечисленный в Американской фармакопее или других общепризнанных фармакопеях для применения на животных или более конкретно, на людях. Термин «носитель» относится к разбавителю, адъюванту или носителю, с которым вводят лекарственное средство. Такими физиологическим носителями могут быть стерильные жидкости, такие как вода или масла, в том числе масла нефтяного, животного, растительного или синтетического происхождения, такие как арахисовое масло, соевое масло, минеральное масло, кунжутное масло и тому подобное. Вода является предпочтительным носителем при введении фармацевтической композиции внутривенно. Солевые растворы, и водный раствор декстрозы, и растворы глицерина также могут служить в качестве жидких носителей, конкретно для инъецируемых растворов. Подходящие фармацевтические наполнители включают в себя крахмал, глюкозу, лактозу, сахарозу, солод, рис, муку, мел, силикагель, стеарат натрия, глицеролмоностеарат, тальк, хлорид натрия, сухое обезжиренное молоко, глицерин, пропилен, гликоль, вода, этанол и тому подобное. По желанию, композиция также может содержать незначительные количества увлажнителей или эмульгаторов, или рН-буферных агентов. Такие композиции могут принимать форму растворов, суспензий, эмульсий, таблеток, гранул, капсул, порошков, композиций с замедленным высвобождением и тому подобное. Композиция может быть приготовлена в виде суппозиториев с традиционными связующими агентами и носителями, такими как триглицериды. Пероральная композиция может включать в себя стандартные носители, такие как фармацевтического качества манит, лактоза, крахмал, стеарат магния, сахарин натрия, целлюлоза, карбонат магния и т.д. Примеры подходящих носителей описывают в "Remington's Pharmaceutical Sciences", E.W.Martin. Такие композиции будут содержать эффективное количество антитела, предпочтительно в очищенной форме вместе с подходящим количеством носителя для предоставления формы для подходящего введения пациенту. Форма должна соответствовать способу введения.

В одном варианте композицию готовят в соответствии со стандартными процедурами в виде фармацевтической композиции, адаптированной для внутривенного введения людям. Типично, композиции для внутривенного введения являются растворами в стерильном изотоническом водном буфере. При необходимости композиция может также включать солюбилизирующий агент и локальный анестетик, такой как лигнокаин для облегчения боли в месте инъекции. В большинстве случаев ингредиенты подают или порознь, или смешанными вместе в индивидуальную лекарственную форму, например, в виде сухого лиофилизированного порошка или безводного концентрата в герметически укупоренной емкости, такой как ампула или пакет с указанием количества действующего вещества. При введении композиции инфузионно действующее вещество может быть дозировано с использованием инфузионных флаконов, содержащих стерильные, фармацевтического качества, воду или солевой раствор. При введении композиции инъецированием, могут быть предоставлены ампулы стерильной воды для инъекций или солевого раствора, так что ингредиенты могут быть смешаны перед введением.

Изобретение также предоставляет фармацевтический пакет или набор, содержащий одну или несколько емкостей, заполненных одним или несколькими ингредиентами фармацевтических композиций изобретения. Дополнительно, присоединенной к такой емкости (емкостям) может быть информация в форме, установленной государственным органом, регламентирующим производство, применение или продажу фармацевтических препаратов или биологических продуктов, информация, которая отражает утверждение органом по производству, применению или продаже для введения человеку.

Кроме того, антитела изобретения могут быть кнъюгированы с различными эффекторными молекулами, такими как гетерологичные полипептиды, лекарственные средства, радионуклиды или токсины. См., например, публикации согласно РСТ WO 92/08495; WO 91/14438; WO 89/12624; патент США N 5314995 и Европейский патент 396387. Антитело или его фрагмент могут быть конъюгированы с терапевтическим веществом, таким как цитотоксин, например, цитостатиком или цитотоксическим агентом, терапевтическим средством или ионом радиоактивного металла, например, альфа-излучателем, например, 213BL Цитотоксин или цитотоксичный агент включает в себя любой агент, который является вредным для клеток. Примеры включают в себя паклитаксол, цитохалазин В, грамицидин D, этидийбромид, эметин, митомицин, этопозид, тенопозид, винкристин, винбластин, колхицин, доксорубицин, даунорубицин, дигидроксиантрациндион, митоксантрон, митрамицин, актиномицин D, 1-дегидротестостерон, глюкокортикоиды, новокаин, тетракаин, лидокаин, анаприлин и пуромицин и их аналоги или гомологи. Терапевтические агенты включают в себя, но не ограничиваются, антиметаболиты (например, метотрексат, 6-меркаптопурин, 6-тиогуанин, цитарабин, 5-фторурацил-декарбазин), алкилирующие агенты (например, мехлоротамин, тиоепа-хлорамбуцил, мелфалан, кармустин (BSNU) и ломустин (CCNU), циклотосфамид, бусульфан, дибромоманитол, стрептозотоцин, митомицин С и цис-дихлордиамин-платина (II) (DDP) цисплатин), антрациклины (например, дуанорубицин (прежде, дауномицин) и доксорубицин), антибиотики (например, дактиномицин (прежде, актиномицин), блеомицин, митрамицин и антрамицин (АМС)) и антимитотические агенты (например, винкристин и винбластин).

Способы конъюгирования такого терапевтического агента с антителами являются хорошо известными, см., например, Amon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", в Monoclonal Antibodies And Cancer Therapy, Reisfeld et al., (eds.), стр.243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery", в Controlled Drug Delivery (2nd Ed.), Robinson et al., (eds), стр.623-53 (Marcel Dekker, Inc. 1987); Thrope, "Antibody Carriers Of Cytotoxic Agents in Cancer Therapy: (2000) Review" в Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), стр.475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody in Cancer Therapy" в Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds), стр.303-16 (Academic Press 1985) и Thrope et al., "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates" Immunol. Rev. 62:119-58 (1982). Альтернативно, антитело может быть конъюгировано с вторичным антителом с образованием антительного гетероконъюгата. (см., например, Segal в патенте США N 4676980).

Конъюгаты изобретения могут быть использованы для модификации данного биологического ответа, терапевтический агент или лекарственное средство не должны быть сконструированы в виде лимитирующих классические химические терапевтические агенты. Например, лекарственное средство может быть белком или полипептидом, обладающим желаемой биологической активностью. Такие белки могут включать в себя, например, токсин, такой как абрин, рицин А, экзотоксин Pseudomonas или дифтерийный токсин; белок, такой как фактор некроза опухоли, α-интерферон, β-интерферон, фактор роста нервов, фактор роста тромбоцитов, тканевый активатор плазминогена, апоптический агент, например, TNF-α, TNF-β, AIM I (См. Международную публикацию N WO 97/33899), AIM II (См. Международную публикацию N WO 97/34911), Fas-лиганд (Takahashi et al., Int. Immunol., 6:1567-1574 (1994)), VEGI (См. Международную публикацию N WO 97/23105), тромботический агент или анти-ангиогенный агент, например, ангиостатин или эндостатин; или модификаторы биологического ответа, такие как лимфокины, интерлейкин-1 ('"IL-1"), интерлейкин-2 ("IL-2"), интерлейкин-6 ("IL-6"), гранулоцитарный макрофагальный колониестимулирующий фактор ("GM-CSF"), гранулоцит-колониестимулирующий фактор ("G-CSF") или другие факторы роста.

Генная терапия на основе антител

В другом аспекте изобретения нуклеиновые кислоты, содержащие последовательности, кодирующие антитела или их функциональные производные, вводят для лечения, ингибирования или предупреждения заболевания или нарушения, ассоциированного с аберрантной экспрессией и/или активностью IL13 посредством генной терапии. Генная терапия относится к терапии, выполненной введением субъекту экспрессирующейся или экспрессируемой нуклеиновой кислоты. В этом варианте изобретения нуклеиновые кислоты продуцируют кодируемый ими белок, который опосредует терапевтический эффект. Любой из имеющихся способов генной терапии может быть использован в соответствии с данным изобретением. Примеры способов описывают ниже.

Для полного обзора способов генной терапии см., Goldspiel et al., Clinical Pharmacy 12:488-505 (1993); Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993) и Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May, TIBTECH 11(5):155-215(1993).

В одном аспекте композиция содержит последовательности нуклеиновых кислот, кодирующие антитело, причем указанные последовательности нуклеиновых кислот являются частью экспрессирующих векторов, которые экспрессируют антитело, или его фрагменты, или химерные белки, или его тяжелую или легкую цепи в подходящем хозяине. Конкретно, такие последовательности нуклеиновых кислот имеют промоторы, функционально пришитые к области, кодирующей антитело, причем указанный промотор является индуцибельным или конститутивным и, дополнительно, ткане-специфичным.

В другом конкретном варианте, используют молекулы нуклеиновых кислот, в которых последовательности, кодирующие антитело, и любые другие искомые последовательности фланкированы участками, которые активируют гомологичную рекомбинацию в желаемом сайте генома, таким образом обеспечивающие внутрихромосомную экспрессию нуклеиновых кислот, кодирующих антитело (Koller and Smithies, Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); Zijistra et al., Nature 342:435-438 (1989). В специфических вариантах воплощения экспрессированная молекула антитела представляет собой одноцепочечное антитело; альтернативно, последовательности нуклеиновых кислот включают в себя последовательности, кодирующие как тяжелую, так и легкую цепи или их фрагменты антитела.

Доставка нуклеиновых кислот пациенту может быть или прямой, случай при котором пациента подвергают воздействию нуклеиновыми кислотами или векторами, несущими нуклеиновые кислоты, или косвенной, случай, при котором клетки сначала трансформируют нуклеиновыми кислотами in vitro, затем трансплантируют пациенту. Эти два подхода являются известными, как генная терапия in vitro или ex vivo, соответственно.

В специфическом воплощении последовательности нуклеиновой кислоты вводят прямо in vivo, где они экспрессируются с образованием кодируемого продукта. Это может быть выполнено любым из ряда способов, известных в данной области, например, конструированием их в виде части подходящего вектора, экспрессирующего нуклеиновые кислоты и его введением, таким образом, что они становятся внутриклеточными, например, инфицированием с использованием дефектных или ослабленных ретровирусных или других вирусных векторов (см., патент США N 4980286), или прямой инъекцией депротеинизированной (пер., «голой») ДНК, или с использованием бомбардировки микрочастицами (например, генной пушкой, Biolistic, Dupont), или нанесением покровного слоя липидов, или рецепторов клеточной поверхности, или трансфецирующих агентов, инкапсулированием в липосомах, микрочастицах или микрокапсулах, или их введением в сшивке с пептидом, который, как известно, проникает в ядро, введением их в сшивке с лигандом, подвергающемуся рецептор-опосредованному эндоцитозу (см., например, Wu and Wu, J. Biol, Chem. 262:4429-4432 (1987)) (который может быть использован для типов клеток-мишеней, специфически экспрессирующих рецепторы) и так далее. В другом варианте могут быть образованы комплексы нуклеиновой кислоты с лигандом, в которых лиганд содержит сливающий вирусный пептид для разрушения эндосом, позволяя нуклеиновой кислоте избежать лизосомальнго расщепления. Еще в другом варианте воплощения нуклеиновая кислота может быть направлена in vivo для клеточно-специфичного поглощения и экспрессии, с использованием специфического рецептора (см., например, международные публикации согласно РСТ WO 92/06180, WO 92/22635; WO 92/20316; WO 93/14188; WO 93/20221). Альтернативно, нуклеиновая кислота может быть введена внутриклеточно и внедрена в ДНК клетки хозяина для экспрессии гомологичной рекомбинацией (Koller and Smithies, Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); Zijistra et al., Nature 342:435-438(1989)).

В специфическом варианте воплощения используют вирусные векторы, которые содержат последовательности нуклеиновых кислот, кодирующие антитело изобретения. Например, может использоваться ретровирусный вектор (см., Miller et al., Meth. Enzymol. 217:581-599 (1993)). Такие ретровирусные векторы содержат компоненты, необходимые для правильной упаковки вирусного генома и интеграции в ДНК клетки хозяина. Последовательности нуклеиновых кислот, кодирующих антитело для использования в генной терапии, клонируют в одном или нескольких векторах, которые способствуют доставке гена пациенту. Более детально о ретровирусных векторах может быть найдено у Boesen et al., Biotherapy 6:291-302 (1994), который описывает использование ретровирусного вектора для доставки гена mdr1 к гематопоэтическим стволовым клеткам для придания стволовым клеткам большей резистентности к химиотерапии. Другими ссылками, иллюстрирующими применение ретровирусных векторов в генной терапии, являются: Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kienri et al., Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993) и Grossman and Wilson, Curr. Opin. Gen. and Dev. 3:110-114 (1993).

Аденовирусы могут также быть использованы в данном изобретении. Аденовирусы являются особенно привлекательными носителями в настоящем изобретении для доставки антител к респираторному эпителию. Аденовирусы легко инфицируют респираторный эпителий. Другими мишенями для систем доставки на аденовирусной основе являются: печень, центральная нервная система, эндотелиальные клетки и мышцы. Аденовирусы имеют преимущество, обеспечивающее инфицирование неделящихся клеток. Kozarsky and Wilson, Curr. Opin. Gen. Dev. 3:499-503 (1993) представляют обзор генной терапии на аденовирусной основе. Bout et al., Human Gene Therapy 5:3-10 (1994) демонстрировали применение аденовирусных векторов для переноса генов в респираторный эпителий макак-резусов. Другие примеры использования аденовирусов в генной терапии могут быть найдены в Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155 (1992); Mastrangeli et al., J. cLin. Invest. 91:225-234 (1993); международная публикация согласно РСТ WO 94/12649 и Wang, et al., Gene Therapy 2:775-783 (1995). Аденоассоциированный вирус (AAV) также может быть рекомендован для использования в генной терапии (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); патенты США NN 5436146; 6632670; 6642051).

Другой подход к генной терапии включает в себя передачу гена клеткам культуры тканей такими методами как электропорация, липофекция, кальций-фосфатная трансфекция или заражение вирусом. Обычно метод переноса включает в себя перенос селектируемого маркера в клетки. Затем клетки подвергают селекции для выделения таких клеток, которые приобрели и экспрессируют внедренный ген. Затем такие клетки доставляют пациенту.

В этом варианте воплощения нуклеиновую кислоту вводят в клетку перед введением in vivo полученной рекомбинантной клетки. Такое внедрение может быть выполнено любым из способов, известных в данной области, в том числе, но, не ограничиваясь, трансфекцией, электропорацией, микроинъецированием, инфицированием вирусным вектором или вектором бактериофага, содержащим последовательности нуклеиновых кислот, слиянием клеток, хромосомо-опосредованным переносом генов, микроклеточным переносом генов, слиянием сферопластов и т.д. Ряд способов являются известными в данной области для внедрения чужеродных генов в клетки (см., например, Loeffler and Behr, Meth. Enzymol. 217:599-618 (1993); Cohen et al., Meth. Enzymol. 217:618-644 (1993); Cline, Pharmac. Ther. 29:69-92m (1985) и могут быть использованы в соответствии с настоящим изобретением, при условии, что неотъемлемые физиологические и связанные с развитием функции реципиентных клеток не нарушены. Способ должен предоставить стабильный перенос нуклеиновой кислоты в клетку, так что нуклеиновая кислота становится экспрессируемой клеткой и предпочтительно наследуемой и экспрессируемой клеточным потомством.

Полученные рекомбинантные клетки могут быть доставлены пациенту различными способами известными в данной области. Рекомбинантные клетки крови (например, гематопоэтические стволовые или клетки-предшественники) являются предпочтительно вводимыми внутривенно. Количество клеток предвиденных для использования зависит от желаемого эффекта, состояния пациента и т.д. и может быть определено любым специалистом в данной области.

Клетки, внутрь которых может быть внедрена нуклеиновая кислота для целей генной терапии, охватывают любой желаемый, пригодный тип клеток и включает в себя, но, не ограничиваясь, эпителиальные клетки, эндотелиальные клетки, кератиноциты, фибробласты, мышечные клетки, гепатоциты; клетки крови, такие как Т-лимфоциты, В-лимфоциты, моноциты, макрофаги, нейрофилы, эозинофилы, мегакариоциты, гранулоциты; различные стволовые клетки или клетки-предшественники, конкретно гематопоэтические стволовые клетки или клетки-предшественники, например, в виде полученных из костного мозга, крови пуповины, периферической крови, печени плода и т.д.

В одном варианте воплощения клетка, используемая для генной терапии, является аутологической пациенту. Последовательности нуклеиновых кислот, кодирующие антитело изобретения, внедряют внутрь клеток, так что они являются способными экспрессироваться клетками или их потомством, а рекомбинантные клетки затем вводят in vivo для терапевтического эффекта. В специфическом варианте используют стволовые клетки или клетки-предшественники. Любые стволовые клетки и/или клетки-предшественники, которые могут быть изолированы и поддержаны in vitro, могут потенциально быть использованы в соответствии с этим изобретением (см., международная публикация согласно РСТ WO 94/08598; Stemple and Anderson, Cell 71:973-985 (1992); Rheinwald, Meth. Cell Bio. 21A:229 (1980) и Pittelkow and Scott, Mayo Clinic Proc. 61-771 (1986)).

ПРИМЕРЫ

ПРИМЕР 1:

ПОЛУЧЕНИЕ IL13-иммуногена: мутированного, инактивированного IL13/FC человка (MT-IL13/FC)

А. Клонирование и конструирование экспрессионной плазмиды для МТ-IL13/FC

Сообщалось, что человеческий IL13 с мутацией (глутаминовая кислота на лизин) по аминокислотному остатку #13 связывает IL13Ra1 с эквивалентной или более высокой аффиностью, но с утерянной способностью активировать клетки, секретирующие lL13Ra1 (Thompson et а1., J. Biol. Chem., 274:29944 (1999)). Этот мутированный неактивный IL13, обозначенный MT-IL13, экспрессировали в клетках почек человеческого эмбриона 293-Т. Очищенный рекомбинантный белок использовали в качестве иммуногена в настоящем изобретении для выработки анти-IL13 моноклональных антител. Два олигонуклеотидных праймера:

5' MGCTTTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGAAGCTCAT3' (SEQ ID NO 9)

5' CTCGAGGTTGAACCGTCCCTCGCGAAAAAG 3'(SEQ ID NO 10)

соответствующих олигонуклеотидной последовательности гена MT-IL13, синтезировали и использовали в качестве затравок в полимеразных цепных реакциях (ПЦР) для клонирования гена IL13 из библиотеки кДНК яичек человека (BD Biosciences Clontech, Palo Alto, CA). ПЦР-фрагмент (342 пары оснований), у которого отсутствует прогнозированная сигнальная пептидная последовательность IL13, лигировали в вектор pSecTag/FRT (Invitrogen, Carlsbad, CA), который содержал секретируемую сигнальную пептидную последовательность на 5'-конце и последовательность Fcy1 (шарнирная и константная области СН3 и СН3) человека на 3'-конце. Структуру конструкций подтверждали секвенированием.

В. Получение MT-IL13/FC из трансфецированных клеток 293Т

Для транзиентной экспрессии MT-IL13/FC очищенную плазмидную ДНК трансфецировали в клетки 293Т с помощью липофектамина 2000 (Invitrogen), в соответствии с протоколом фирмы-производителя. На 72-й час посттрансфекции, культуральные супернатанты из трансфецированных клеток собирали для очистки. Для стабильной экспрессии MT-IL13/FC были приняты клеточные линии с использованием клеточной линии 293Т Flp-ln (Invitrogen). Для подтверждения экспрессии культуральные супернатанты анализировали гель-электрофорезом в присутствии додецилсульфата натрия (SDS-PAGE). Разделенные белки переносили на нитроцеллюлозную мембрану и детектировали реакцией с мышиными моноклональными антителами против IgG (Fc) человека, конъюгированными с пероксидазой хрена (HRP) (Sigma, St. Louis, МО) или поликлональными козьими антителами против IL13 (R&D Systems, Minneapolis, MN), которые затем детектировали мечеными пероксидазой ослиными антителами против козьих IgG (Jackson ImmunoResearch Laboratories, West Grove, PA). Иммунореактивные белки идентифицировали на пленке с использованием усиленной хемилюминесцентной детекции (Supersignal West Pico Chemiluminescent Substrate, Pierce, Rockford, IL).

С. Очистка MT-IL13/FC

MT-IL13/Fc очищали с использованием hyper-D-protein А аффинной колонки (Invitrogen), уравновешенной забуференным фосфатом физиологическим раствором (PBS). После нанесения супернатанта культуры клеток на колонку смолу промывали более чем 20 объемами колонки PBS. Затем смолу промывали буфером SCC (0,05 М лимоннокислый натрий, 0,05 М хлорид натрия, рН 6,0) для удаления несвязавшихся белков. Затем, слитые с IL13 белки элюировали (0,05 М лимоннокислый натрий, 0,15 М хлорид натрия, рН 3,0) и диализовали в PBS.

Фракции с аффинной колонки, содержащие MT-IL13/Fc, анализировали SDS-PAGE-электрофорезом. Чистоту белков анализировали окрашиванием Coomassie Blue и идентичность белков оценивали Westem-иммуноблотингом с использованием козьих антител против IgG (Fc) человека (Sigma) и козьих антител против IL13 человека (R&D Systems), как описано ранее.

ПРИМЕР 2:

Получение моноклональных антител против IL13

Самцов мышей A/J (Harian, Indianpolis, IN), 8-12 недельного возраста, инъецировали подкожно 20 мкг MT-IL13/Fc в полном адъюванте Фрейнда (D'rfco Laboratories, Detroit, MT) в 200 мкл PBS, рН 7,4. С двухнедельным интервалом мышей дважды инъецировали подкожно 20 мкг MT-IL13/Fc в неполном адъюванте Фрейнда. Затем, через две недели и за три дня до умерщвления, мышей снова инъецировали внутрибрюшинно 20 мкг того же самого иммуногена в PBS. Клетки селезенки, выделенные из одной или нескольких иммунизированных антигеном мышей, использовали для слияния. Аналогичные процедуры иммунизации и слияния также использовали с экспрессированным в E.coli IL13 человека (R&D Systems) в качестве иммуногена.

В процессе слияния, сводящемуся к образованию моноклональных антител MAb 228B/C-1 против IL13, объединяли 26,4×106 клеток селезенки и 58,8×106 клеток селезенки от двух иммунизированных мышей. Для каждого слияния готовили суспензии однородных клеток из селезенки иммунизированных мышей и использовали для слияния с клетками миеломы Sp2/0. Sp2/0 и клетки селезенки в соотношении 1:1 подвергали слиянию в среде, содержащей 50% полиэтиленгликоль (молекулярная масса 1450) (Kodak, Rochester, NY) и 5% диметилсульфоксид (Sigma). Затем клетки доводили до концентрации 1,5×105 клеток селезенки на 250 мкл суспензии в среде DMEM (Invitrogen, CA), содержащей 10% эмбриональную бычью сыворотку, 100 ед/мл пенициллина, 100 мкг/мл стрептомицина, 0,1 мМ гипоксантина, 0,4 мкМ аминоптерина и 16 мкМ тимидина. Двести пятьдесят микролитров суспензии клеток вносили в каждую из приблизительно пятидесяти лунок 96-луночных микрокультуральных планшет.Приблизительно через десять дней отбирали культуральные супернатанты для скрининга на реактивность с МТ-IL13/FC в ELISA-тесте.

Лунки микрокультуральных планшетов Immulon 2 (Dynatech Laboratories, Chantilly, VA) сенсибилизировали в течение ночи при комнатной температуре добавлением очищенного MT-IL13/Fc (0,1 мкг/мл). Затем наносимый раствор удаляли, слегка ударяя планшет, вносили 200 мкл блокирующего/разбавляющего буфера (PBS, содержащий 2% бычий сыворочный альбумин и 0,05% TWEEN®20) в каждую лунку на один час для блокирования неспецифических сайтов. Затем, через час, лунки промывали PBST-буфером (PBS, содержащем 0,05% TWEEN®20). Отбирали по 50 микролитров культурального супернатанта из каждой лунки, в которой проводили слияние, смешивали с 50 мкл блокирующего/разбавляющего буфера и затем добавляли в индивидуальные лунки микрокультуральных планшетов. Через один час инкубации лунки промывали PBST. Затем связанные мышиные антитела детектировали реакцией с козьими, конъюгированными с HRP, антителами против мышиных IgG (Fc-специфичными), (Jacson ImmunoResearch Lab, West Grove, PA) и разбавляли при 1:2000 с использованием блокирующего/разбавляющего буфера. Раствор пероксидазного субстрата, содержащий 0,1% 3,3,5,5,-тетраметилбензидин (Sigma, St. Loius, МО) и 0,003% перекиси водорода (Sigma), добавляли в лунки для развития окраски в течение 30 минут. Реакцию останавливали добавлением 50 мкл 2М H2SO4 на лунку. Оптическую плотность OD450 реакционной смеси определяли с использованием устройства BioTek ELISA Reader (BioTek Instruments, Winooski, VM).

Затем культуральные супернатанты из позитивных лунок после скрининга на MT-IL13/Fc тестировали на отсутствие связывания с посторонним слитым белком Fγ1. Затем конечные позитивные лунки отбирали для клонирования однородных клеток методом серийных разведении. Культуральные супернатанты моноклональных антител повторно тестировали для подтверждения их реакционной способности с использованием ELISA-теста. Отобранные гибридомы выращивали в роллерных колбах и отработанный культуральный супернатант собирали для очистки антител афиинной хроматографией с иммобилизованным протеином А.

Очищенные антитела тестировали четырьмя анализами: i) Перекрестной реактивностью с 293Т-клетками, экспрессирующими MT-IL13/FC и E.coli, экспрессирующими мышиный 1L13; ii) Ингибированием 11-13-аутокринной пролиферации клеток HDLM-2 и L-1236;

iii) Ингибированием индуцированного 1L13 фосфорилирования STAT6 в клетках ТНР-1; и iiii) Ингибированием регулируемой 1L13 экспрессии CD14 и CD23 на моноцитах человека.

Получали семьдесят три моноклональных антитела против 1L13 (anti-IL13 MAbs) из слияний, выполненных на MT-IL13/FC и иммунизированных 1L13 мышах. Тридцать девять из этих MAbs очищали для характеристики иммуноферментным, ELISA, и клеточным анализами. Тринадцать из этих 39 MAbs ингибировали индуцированную 1L13 аутокринную пролиферацию клеток HDLM-2 и L-1236 (см., описание анализа и результатов в Примере 5). Обнаружили, что четыре MAbs обладают очень сильной реактивностью с человеческим 1L13 в ELISA и были нейтрализующими в отношении к 1L13 человека в функциональных клеточных анализах. Эти MAbs обозначали 228 В/С-1, 228А/-4, 227-26 и 227-43. Все эти антитела производили с использованием гликозилированного MT-IL13/FC в качестве иммуногена.

ПРИМЕР 3:

Иммунобиологическая реактивность моноклональных антител против IL13 с человеческим и мышиным IL13 в ELISA-тесте

Иммунологическую реактивность различных моноклональных анти-IL13 антител тестировали твердофазным иммуноферментным анализом, ELISA. Различные лунки 96-луночных микрокультуральных планшетов покрывали или Е.coli, экспрессирующими негликозилированный IL13 человека (R&D Systems), клетками 293Т, экспрессирующими гликозилированный MT-IL13/FC, или Е.coli, экспрессирующими мышиный IL13 (R&D Systems) добавлением 100 мкл белка 1L13 в концентрации 0,1 мкг/мл в PBS. После инкубации в течение ночи при комнатной температуре лунки обрабатывали PBSTB (PBST, содержащий 2% БСА) для насыщения остающихся связывающих сайтов. Затем лунки промывали PBST.

По 100 мкл двукратно последовательно разведенных моноклональных антител против 1L13 (anti-IL13 MAbs) (0,5 мкг/мл (3,33 нМ) до 0,05 нг/мл (0,00033 нМ)) прибавляли в лунки на 1 час при комнатной температуре. В качестве позитивного контроля тестировали моноклональные антитела против 1L13 JES-5A2 от BD Biosciences-Pharmingen, San Diego, CA. Это антитело создавали с использованием в качестве антигена экспрессированного в E.coli IL13 человека. Изотипически сходное моноклональное мышиное антитело др120 против HIV-1 (anti-HIV-1 др120 MAb) использовали в качестве постороннего отрицательного контроля. Затем лунки промывали PBST. Связанные антитела детектировали инкубированием с разбавленными козьими, конъюгированными с пероксидазой хрена, антителами против мышиных IgG (Fc) (Jackson ImmunoResearch) в течение одного часа при комнатной температуре. Затем добавляли раствор пероксидазного субстрата для развития окраски как описано выше. Оптическую плотность OD450 измеряли с использованием ELISA-ридера.

Фиг.1 демонстрирует дозозависимое связывание моноклональных антител против IL13: 228 В/С-1, 228А-4, 227-26, 227-43 и отрицательного контроля в ELISA-тесте. Среди этих моноклональных антител 228 В/С-1 показывал самую интенсивную иммунореактивность. Фиг.2 демонстрирует дозозависимое связывание моноклональных антител против IL13 с MT-IL13/Fc в ELISA-тесте. 228 В/С-1 и 228А-4 показывали самую интенсивную иммунореактивность с MT-IL13/Fc, в то время как 227-26 и 227-43 демонстрировали умеренную иммунореактивность.

Фигуры 1 и 2 демонстрируют, что 228 В/С-1 имеют наивысшую аффинность как к гликозилированному, так и к негликозилированному IL13 человека среди всех тестированных моноклональных антител против IL13. Все эти анти-IL13 моноклональные антитела не дают перекрестную реакцию с мышиными IL13 в ELISA-тесте (данные не представлены).

ПРИМЕР 4

Отсутствие конкурентного связывания 228 В/С-1-Hrp с IL13 человека в присутствии JES10-5A2.

Для изучения, связывают ли JES10-5A2 и 228 В/С-1 один и тот же эпитоп IL13 человека, использовали конкурентный ELISA-тест для изучения эффекта JES10-5A2 на связывание 228 В/С-1-Hrp с экспрессированным в Е.coli IL13 человека. Каждую лунку 96-луночного микрокультурального планшета инкубировали со 100 мкл белка IL13 при 0,1 мкг/мл в PBS. После инкубирования в течение ночи при комнатной температуре лунки обрабатывали PBSTB (PBST, содержащем 2% БСА) для насыщения остаточных связывающих сайтов. Затем лунки отмывали с использованием PBST. 50 микролитров двукратно последовательно разведенных 228 В/С-1 и JES10-5A2 (из конечной концентрации 20 мкг/мл до 9,76 нг/мл) смешивали с 50 мкл предварительно титрованных 228 В/С-1-HRP (при разведении 1:6400). Затем смеси вносили в лунки и инкубировали в течение часа при комнатной температуре. Затем добавляли пероксидазный субстрат для развития окраски как описано выше. Оптическую плотность OD450 измеряли с использованием ELISA-ридера.

Фиг.3 демонстрирует, что JES10-5A2 не конкурирует за связывание 228 В/С-1-HRP с IL13 человека, свидетельствующее о том, что 228 В/С-1 и JES10-5A2 связываются с различными сайгами IL13 человека.

ПРИМЕР 5

Скрининг нейтрализующих моноклональных антител поротив IL13 при помощи IL13-аутокрин-зависимого анализа пролиферации с использованием клеток L-1236 и HDLM-2

Клетки L-1236 и HDLM-2 являются линиями клеток лимфомы Ходжкина, полученные из Немецкой Коллекции микроорганизмов и клеточных культур (DSMZ, Braunschweig, Germany). Эти клеточные линии продуцируют IL13, который, в свою очередь, активирует их клеточную пролиферацию аутокринным способом (Карр U et al., J. Exp. Med. 189:1939 (1999)).

Клетки культивировали (25000 клеток/лунку) в присутствии или в отсутствие различных моноклональных антител против IL13 (0,2, 0,02 и 0,002 мкг/мл) в 5% CO2 при 37°С в течение 3-5 дней. Затем определяли клеточную пролиферацию или анализом с использованием тетразольного соединения MTS (Promega, Madison, WI) (считывание при OD490), или введением 3H-тимидина (Amersham Biosciences, Piscataway, NJ).

Ожидали, что добавление анти-IL13-нейтрализующих моноклональных антител к культуре этих клеточных линий ингибирует их пролиферацию путем связывания и инактивирования продуцированного этими клетками IL13. Результаты, представленные на Фигуре 4, демонстрируют эффект моноклональных антител против IL13 данного изобретения на пролиферацию клеток L-1235. Моноклональные антитела 228 В/С-1 демонстрируют наивысшую способность ингибировать пролиферацию клеток L-1236 дозозависымым образом в числе протестированных нейтрализующих антител. ТА1-37 (моноклональные антитела против IL13, продуцированные с использованием в качестве иммуногена экспрессированного в Е.coli IL13 человека) не имели какой бы то ни было ингибирующей активности даже в дозе до 0,2 мкг/мл. Аналогичные результаты получали с клетками NDLM-2.

ПРИМЕР 6

Анализ IL13-регулируемой экспрессии CD14 и CD23 на первичных моноцитах человека

IL13 индуцирует супрессию экспрессии CD14 и позитивную регуляцию экспрессии CD23 в моноцитах человека (de Waal Malefyt et al., J. Immunol. 151: 6370 (1993), Chomarat et al., Int. Rev. Immunol., 17:1 (1998)). Лейкоциты периферической крови (PBLs) выделяли из свежесобранной гепаринизированной цельной крови здоровых людей-доноров центрифугированием в градиенте плотности Histopaque 1077 (Sigma). PBLs (1,5×106) суспендировали в среде RLMI-1640 medium (Invitrogen) с 5% эмбриональной бычьей сывороткой, добавленной в каждую лунку 96-луночного планшета для культуры тканей, содержащую рекомбинантный IL13 (в конечной концентрации 10 нг/мл = 0,813 нМ) и моноклональное антитело против IL13 или постороннее антитело (трехкратные последовательные разведения из конечной 12 мкг/мл = 80 нМ). Экспрессию CD14 или экспрессию CD23 на моноцитах подавляли или позитивно регулировали, соответственно, добавлением 0,813 нМ IL13 человека в инкубационную среду. Контрольная среда содержала среду RPMI-1640/FBS без рекомбинантного IL13.

Клетки инкубировали в 5% CO2 при 37°С в течение 2 дней. Клетки собирали для окрашивания с помощью anti-CD14-FITC или anti-CD23-PE (BD Biosciences-Pharmingen). Уровни экспрессии CD14 и CD23 в популяции моноцитов измеряли проточной цитометрией и представляли медиантной интенсивностью флуоресценции (MFI).

Эффекты моноклональных антител против IL13 на IL13-суппресирующую экспрессию CD14 в моноцитах человека изображают на Фигуре 5. Среди всех тестированных моноклональных антител против IL13228B/C-1 обладал самой высокой способностью к ингибированию эффекта IL13 на экспрессию CD14. Полное ингибирование эффекта IL13 достигали при 0,33 нМ. Ингибиторные активности моноклональных антител MAbs 227-26 и 228А-4 были умеренными, тогда как активность JES10-5A2 была слабой. Эффект IL13 не мог быть полностью ингибирован JES10-5A2 даже при 80 нМ.

Эффекты моноклональных антител против IL13 на М3-индуцированную позитивную регуляцию CD23 в моноцитах человека изображают на фиг.6. Аналогично результатам по экспрессии CD14 (фиг.5), 228 В/С-1 обладал самой высокой способностью к ингибированию эффекта IL13 на экспрессию CD23 среди тестированных моноклональных антител против IL13. Полное ингибирование при помощи 228 В/С-1 достигали при 0,33 нМ. Ингибирующая способность JES10-5A2 была слабой.

Исходя из результатов, представленных на фиг.х5 и 6, полное ингибирование IL13 при помощи 228 В/С-1 может быть достигнуто при молярном стехиометрическом соотношении 1:2 (MAb:IL13) и, следовательно, 228 В/С-1 является очень высокоаффинным нейтрализующим антителом против IL13 человека.

ПРИМЕР 7

Анализ IL-13-индуцированного фосфорилирования STAT6 в клетках ТНР-1

IL13 может активировать миеломную клеточную линию ТНР-1 (АТСС, Manassas, VA), индуцируя фосфорилирование STAT6, которое является критической стадией пути трансдущии сигнала IL13 (Murata Т. et al., Int. Immiinol. 10: 1103-1110 (1998)). Тестировали монокпональные антитела против IL13 на ингибирование IL13 в этом анализе.

Клетки ТНР-1 поддерживали в среде Dulbecco's Modified Eagle Medium (DMEM) (Invitrogen), снабженной 5% эмбриональной бычьей сывороткой. В день экспериментов клетки отмывали и инкубировали в среде DMEM без сыворотки при 37°С в 5% CO2 в течение 2 часов. Затем 0,3×106 клеток в 80 мкл среды без сыворотки вносили в каждую лунку 96-луночного планшета с круглодонными лунками. Сто двадцать микролитров среды, содержащей IL13 человека (конечная концентрация 10 нг/мл = 0,813 нМ) и моноклональные антитела против IL13 (5-кратные последовательные разведения из конечной концентрации 0,5 мкг/мл = 3,333 нМ). Лунки с отрицательным контролем или не содержали IL13, или содержали IL13 и изотипически сходное постороннее мышиное моноклональное антитело.

Смесь инкубировали при 37°С в 5% CO2 в течение 10 минут. Затем планшеты центрифугировали при 300×g в течение 3 минут при 4°С. После удаления супернатанта осадок клеток ресуспендировали в 100 мкл нередуцирующего буфера Laemmli для образцов (SDS-PAGE loading buffer, Bio-Rad, CA) и затем переносили в микроцентрифужные пробирки. Пробирки прогревали при 95°С в течение 5 минут и затем центрифугировали при 10000×g в течение 10 минут при комнатной температуре. Супернатанты собирали и анализировали в 4-20% градиентном SDS-PAGE. Разделенные в геле белки переносили на PVDF-мембрану, которую затем инкубировали с разведенными мышиными моноклональными антителами против Stat6 человека (Y641, фосфоспецифическими) (BD Biosciences Pharmingen).

Связанное антитело детектировали козьими, конъюгированными с пероксидазой хрена, антителами, против IgG (Fc) мыши (Jackson ImmunoResearch Laboratories). Иммунореакгивные белки идентифицировали на пленке, с использованием усиленной хемилюминесцентной детекции (Supersignal West Pico Chemiluminescent Substrate, Pierce). Фиг.7 изображает результаты эффекта моноклональных антител против IL13 на IL13-индуцированное фосфорилирование Stat6 в клетках ТНР-1, Stat6 является фосфорилированным в клетках ТНР-1, обработанных 0,813 нМ IL13 человека. Обнаруживали дозозависимое ингибирование фосфорилирования Stat6 при обработке клеток моноклональными антителами 228 В/С-1, 228А/-4, 227-26, 227-43 и JES-5A2. Моноклональные антитела 228 В/С-1 являются наиболее сильно нейтрализующими антителами среди тестированных моноклональных антител против IL13 человека. Полное ингибирование при помощи 228 В/С-1 достигали при концентрации между 0.667 нМ и 0,133 нМ. Приблизительное молярное стехиометрическое соотношение между 228 В/С-1 и IL13 для полного ингибирования составляло 1:2. Это согласуется с данными, представленными на Фиг.х5 и 6.

ПРИМЕР 8

Молекулярное клокирование генов тяжелой и легкой цепей анти-IL13 моноклональных антител

Выделяли тотальную РНК из клеток гибридомы с использованием набора QIAGEN kit (Valencia, CA). Реакцию обратной транскрипции (одноцепочечная кДНК) выполняли следующим образом: 1-1,5 мг тотальной РНК смешивали с 1 мл 10 мМ смеси нуклеотидтрифосфатов (dNTPs), 50 нг вырожденных гексамеров и воды, свободной от РНКазы, в конечном объеме 12 мл.

Реакционную смесь инкубировали при 65°С в течение 5 минут и немедленно помещали в лед на 1 минуту. После короткого центрифугирования добавляли следующие реагенты: 4 мл 5 х кратного однонитевого буфера (250 Мм Tris-HCl, pH 8,3; 375 Мм KCl, 15 Мм MgCl2, 2 мл 0,1 Мм DTT и 1 мл ингибитора РНКазы, свободного от РНКаз (40 ЕД/мл). После перемешивания реакционную смесь инкубировали при комнатной температуре в течение 2 минут.Затем к реакционной смеси добавляли 1 мл Superscript II RT (50 ЕД/мл) и инкубировали при 25°С в течение 10 минут, за которым следует 50 минут при 42°С. После краткого центрифугирования реакционную смесь инкубировали в течение 15 минут при 70°С для инактивации обратной транскриптазы. Затем прибавляли 1 микролитр РНКазы Н (2 ЕД/мл) и реакционную смесь инкубировали в течение 20 минут при 37°С для разрушения РНК.

Для амплификации вариабельных доменов тяжелой и легкой цепей использовали метод, описанный O'Brien and Jones (O'Brien S. and Jones Т., "Humanizing antibodies by CDR grafting", Antibody Engineering, Springer Lab manual, Eds. Kontermann and Duble, S (2001)). Вкратце, 5'-праймеры выбирали из участков сигнального пептида (11 наборов для легкой цепи и 12 наборов вырожденных праймеров для тяжелой цепи) и 3'-праймеры выбирали из константной области или легкой, или тяжелой цепи. 5'- и 3'-праймеры (1,5 мл, 10 Мм) смешивали с 5 мл 10-ти кратного ПЦР-буфера (250 Мм Tris-HCl, pH 8,8; 20 Мм MgSO4, 100 Мм KCl, 100 Мм (NH4)2SO4, 1% Triton X-100, 1 мг/мл БСА, свободного от нуклеаз), 1 мл кДНК, как приготовлено ранее, 1 мл Turbo pfu (Stratagene) и доводили водой до суммарного объема реакционной смеси 50 мл. ПЦР выполняли следующим образом: 1 цикл при 94°С в течение 4 минут; 25 циклов при 94°С в течение 30 секунд; при 53°С в течение 30 секунд и при 72°С в течение 45 секунд; и 1 цикл при 72°С в течение 7 минут. Реакционные смеси делили электрофорезом в 1% агарозном геле.

Амплифицированный ДНК-фрагмент очищали и клонировали в вектор pcDNA3.1. Клонирование выполняли с использованием набора для клонирования Invitrogen TOPO cloning kit в соответствии с рекомендуемым протоколом (Invitrogen). От 50 до 200 колоний трансформированных E.coli использовали для очистки плазмид. Плазмиды секвенировали с использованием Т7-праймера. Преобладающие последовательности для тяжелой и легкой цепей клонировали в экспрессирующий вектор М13 Fab гибридизационным мутагенезом (Glaser S. et al., Antibody Engineering (Oxford University Press, New York (1995)), Near RI, BioTechniques 12:88 (1992)). Связывающие способности экспрессированного Fab подтверждали ELISA-тестом. Фигуры 8-10 изображают аминокислотные последовательности VH- и VL-цепей для 228 В/С, 228А-4 и 227-26, соответственно.

ПРИМЕР 9

Гуманизация клона 228 В/С

А. Общий протокол

Вариабельные области мышиного антитела 228 В/С клонировали и секвенировали как описано в примере 8. Химерный Fab в фаговом векторе конструировали в качестве контроля, который объединял вариабельные области мышиного 228 В/С и константную область каппа-цепи человека и СН1-участок IgG человека.

Для начала процесса гуманизации, подходящую последовательность v-гена, выбранную из известных последовательностей генов зародышевой линии человека, отбирали для получения каркасных областей от одной до трех (FM1-FM3), и отбирали подходящую последовательность J-гена для получения каркасной области 4 (FM4) в соответствии с критериями, описанными в WO 04/070010 (приведенную здесь в виде ссылки). Эта матрица может быть выбрана на основе, например, ее сравнительной полной длины, размера CDRs, аминокислотных остатков, локализованных на соединении между каркасной и CDRs областями, полной гомологии и так далее. Выбранная матрица может быть смесью более чем одной последовательности или может быть консенсусной матрицей.

Конструирование экспрессионного вектора, содержащего созданные варианты тяжелой и легкой цепи, составляет формулы:

FRH1-CDRH1-FRH2-CDRH2-FRH3-CDRH3-FRH4 (i) и

FRL1-CDRL1-FRL2-CDRL2-FRL3-CDRL3-FRL4 (ii),

где FRH1, FRH2, FRH3, FRH4, FRL1, FRL2, FRL3 и PRL4 представляют варианты каркасной матрицы последовательностей тяжелой и легкой цепи, выбранных из матриц зародышевой линии и CDRs представляют таковые родительского антитела. Различия между мышиным родительским антителом и выбранными матричными последовательностями человека определяли для помощи в качестве основы при создании библиотеки антительных Fabs. Эта библиотека может быть создана индивидуально для легкой цепи и затем для тяжелой цепи, или одновременно. Аффинное созревание CDR-областей может также быть проанализировано одновременно или последовательно с гуманизацией каркасной области.

Библиотеку вариантных Fabs создавали, содержащую (1) мышиный аминокислотный остаток, (2) аминокислотный остаток из выбранного гена зародышевой линии человека, или произвольно, (3) случайно выбранную аминокислоту из каждого из выбранных положений, обнаруживших отличие от мышиной каркасной последовательности. Желаемые варианты синтезировали отжигом перекрывающихся олигонуклеотидов и затем внедрением выбранного остатка в каркасные положения, которые представляли интерес. Амплификацию продукта отжига делали с использованием двух праймеров, один из которых являлся биотин-меченым. Биотиновую метку использовали для очистки одной нити праймера и ее использовали в качестве мутагенного олигомера в мутагенезной реакции Кункеля с использованием вектора интереса в формате U-матрицы (Rosok, М. J. et al., (1996) Journal of Biological Chemistry 271:22611-22618). После отжига и элонгации плазмиды реакционную смесь подвергали перевариванию с использованием уникальным ферментом рестрикции, XbaI, который расщепляет исходную матрицу, но не вновь синтезированную мутировавшую нить. Плазмиду электропорировапи в компетентные клетки для амплификации и смешивали с фаго-компетентным типом клеток E.coli для продуцирования фаговых частиц. Плазмидные конструкции обладают способностью синтезировать Fab, который секретируется в супернатант.Индивидуальные бляшки отбирали и антитела элюировали для анализов.

Библиотеку анализировали на качество и полноту. При сиквенсе выбранных наугад проб библиотеки определяли количество отобранных кандидатов, которые имели правильные инсерции областей Vk (или Vh), Это количество использовали для определения суммарной эффективности библиотеки. Как только библиотеку создавали, проводили скрининг кандидатов с использованием функционального анализа на основе ELISA для определения, какой из кандидатов продуцировал функциональные Fabs специфичные к IL13. Такие кандидаты, демонстрирующие активность по отношению к IL13 сопоставимую с химерным клоном дополнительно анализировали для воспроизводимости. Несколько кандидатов секвенировали для определения насколько толерантными к гуманизации были каркасные положения-мишени.

После того как обнаружили, что библиотеки являются представительными, варианты анализировали на аффинность связывания, и те найденные варианты, которые обладают сопоставимой или более высокой аффинностью чем химерное контрольное антитело, секвенировали. Если анализированные изоляты не содержали остаток гена зародышевой линии человека в выбранном положении в каркасной области, делали заключение о том, что аминокислотный остаток человека не был устойчив в данном положении. С этой точки, при тестировании только мышиных и человеческих аминокислот, может быть создана другая библиотка Fab, рандомизирующая аминокислоты в положениях, где человеческие матричные остатки не были обнаружены. Затем, Fabs с подходящими для замещения остатками (не мышиные) могли быть отобраны и преобразованы в целые моноклональные антитела (MAbs). Кроме того, консенсусные матрицы могут быть использованы в качестве исходной каркасной области.

В. Vk-гуманизация моноклоанальных антител против IL13

Сначала выполняли гуманизацию вариабельной области легкой цепи (Vk). Однако гуманизация может начаться или одной цепи, или гуманизировать одновременно обе цепи. Выбранная матрица была матрицей 2 человека и являлась следствием изучения эффектов на 9-ти основаниях возле CDRs в легкой цепи для определения их способности к гуманизации без потери функциональной активности. Положениями, которые изучали на легкой цепи для второго раунда скрининга, были 4, 9, 12, 73, 81, 82, 83, 84 и 109.

Создавали библиотеку, изменяя каждое из этих положений или с мышиными или с человеческими матричными остатками. Скринировали приблизительно 860 вариантов с использованием функционального ELISA-анализа. Только 18 кандидатов демонстрировали функции, сопоставимые с химерным клоном. Эти кандидаты анализировали дополнительно. Шесть кандидатов из 18 демонстрировали более высокую аффинность к антигену по сравнению с химерным клоном, и эти 6 секвенировали. Результаты сиквенса представляют на Фиг.х11А и В, и из этих результатов положения 4, 12 и 81 говорят в пользу мышиного остатка.

С. Гуманизация Vh.

Для оценки вклада каркасных остатков тяжелой цепи в суммарную Функцию антитела-кандидата создавали библиотеку, изменяя 10 положений внутри каркасной матрицы человека DP27, которая отличалась от мышиного родителя при поддержании мышиной легкой цепи. Библиотеку создавали с использованием синтезированных перекрывающихся олигонуклеотидов для Vh и создания мышиной Vk с использованием ПЦР. Затем Vk и Vh инсертировали в Fab-экспрессирующий вектор с использованием мутагенеза и затем библиотеку скринировали на функциональные Fabs. Вариабельность библиотеки составляла (210/70%)×3=3840.

С использованием ELISA-теста в 96-луночном формате провели скрининг суммарно 1056 кандидатов. Кандидатами из этой библиотеки, которые выбрали для секвенирования, были такие, которые давали наивысшие значения по результатам скрининга. Пять из этих высокоактивных кандидатов секвенировали для определения их уровня гуманизации и их последовательности представлены на Фиг.х12А и В. Из этих результатов три из каркасных остатков на тяжелой цепи говорили в пользу мышиного остатка (#24, 68 и 94).

Вторым изученным каркасом была матрица человека NEW. Создавали комбинаторную библиотеку, в которой как Vk, так и Vh гуманизировали конкурентно. Девять остатков на Vk были различными между мышиными и человеческими остатками и также девять остатков выбирали для Vh. Скринировали приблизительно 5200 кандидатов (55 96-луночных планшетов) из этой библиотеки. Из скринирования приблизительно 300 кандидатов давали результаты, совместимые с химерным клоном. Из этой группы, тридцать кандидатов секвенировали для определения уровня гуманизации этих функциональных клонов.

Результаты сиквенса легких цепей представляют на Фиг.х11А и В. Последовательности тяжелой цепи представляют на Фиг.х12А и В. Положение 83 на Vk имело высокую степень для сохранения мышиного остатка, тогда как несколько положений в матрице Vh говорило в пользу мышиного остатка. Конкретно, положение 94 сохраняло мышиный остаток в 29 из 30 скринированных кандидатов. Хотя никакие кандидаты, кажется, не имеют полностью гуманизированные каркасные области, несколько вариабельных областей, которые были высоко гуманизированными или в Vk, или Vh, будут использованы для дальнейшей гуманизации. Наиболее гуманизированную Vk комбинировали с наиболее гуманизированной Vh для анализа функциональной активности. (См. фиг.13).

Вторую библиотеку, которая объединяла интересующие каркасные остатки Vk и Vh, создавали с использованием DP27 в качестве матрицы тяжелой цепи и Ht2 в качестве матрицы легкой цепи. Как описывают выше, синтезировали перекрывающиеся олигонуклеотиды, которые содержали каркасную область человека или с остатками человека, или с мышиными остатками в каждом искомом положении. Эти олигонуклеотиды смешивали и затем отжигали для создания полных вариабельных областей. Области амплифицировали с помощью ПЦР и затем превращали в одноцепочечные фрагменты. Фрагменты фосфорилировали и затем использовали в реакции мутагенеза для внедрения вариабельных областей в вектор на основе М13. Затем проводили скрининг библиотеки на функциональные Fabs, которые обладали специфичностью к IL13 в ELISA-тесте. Последовательности легкой цепи и тяжелых цепей показывают на Фиг.х11С и D и 12С и D, соответственно.

Из результатов секвенирования, Vk-цепь была толерантна к остаткам человека на всем протяжении и таким образом, эта цепь была полностью гуманизирована. Для тяжелой цепи, два положения являлись нетерпящими остатки человека: положение 24 и 94. Таким образом, вариабельная область тяжелой цепи была ~98% гуманизированной.

D. Создание комбинаторных гуманизированных кандидатов

Поскольку ни один из кандидатов, отобранных в результате скрининга любой из библиотек, был бы полностью гуманизирован, то гуманизацию конструировали. Конструировали серии кандидатов, в которых получали желаемые уровни гуманизации. Наиболее гуманизированную Vk из библиотеки НТ2 комбинировали с наиболее гуманизированной VD или из NEW или из DP27 библиотек. Затем эти комбинаторные кандидаты анализировали для определения, какой из них сохранял специфическую функцию, при поддержании наивысшего уровня гуманизации. Кандидатами, выбранными из HT2-NEW, были HT2-NEW#73 для тяжелой цепи и HT2-NEW#115 для легкой цепи. Кандидатами, выбранными из HT2-DP27 для легкой цепи были HT2-DP27#89 и HT2-DP27#144 и кандидатами для тяжелой цепи были HT2-DP27#123 и HT2-DP27#276. Для HT2-DP27 делали конструкции следующим образом, #89 Vk с #276 Vh и #89 Vk с #123 Vh; #144 Vk с #276 Vh и #144 Vk с #123 Vh. Дополнительно делали одну конструкцию с #144 Vk DP27 с #73 Vh NEW для определения различаются ли взаимодействия NEW и DP27 с легкой цепью НТ2.

Эти комбинации тестировали ELISA-тестами для определения существования любой дальнейшей потери функции при дальнейшей гуманизации. Для этих анализов, антиген IL13 вносили в планшет в предельном количестве. Затем добавляли в планшет в известной концентрации Fabs против IL13 и титровали до конца планшета при разведении 1:3. Связывание определяли с вторичными антителами, которые являются специфичными к Fab. Фиг.13 изображает результаты функциональных анализов. Фиг.13А - 115Vk/73Vh; Фиг.13 В - 89Vk/276Vh; Фиг.13С - 144Vk/276Vh; Фиг.13D - 144Vk/123Vh и Фиг.13Е - 144Vk/73Vh. Из этих данных полученные результаты наводили на мысль, что сконструированные комбинации гуманизированных вариабельных областей неблагоприятно не влияли на связывание Fabs с антигеном.

Поскольку результаты на фиг.х11 и 12 наводили на мысль о том, что легка цепь НТ2 могла быть полностью гуманизированной и все, за исключением 2 положений в DP27 (24 и 94), могли быть гуманизированы, то конструировали идеальный гуманизированный кандидат, в котором оставляли только 2 мышиных остатка. При создании этого конкретного кандидата анализировали клон в сравнении с его родителем, а также другие кандидаты для определения возможной потери функции. Из данных, представленных на Фигуре 14А, этот гуманизированный кандидат не обнаруживал существенной потери функции с его высокой степенью гуманизации (89 Vk/2760). Гуманизацию также делали для каркасного кандидата HT2-NEW. Этот кандидат имел конечный уровень гуманизации 98%, как те два мышиных остатка, которые оставались на тяжелой цепи. Фиг.14 В изображает результаты ELISA-теста для этой конструкции (115Vk/73VhFL).

Предприняли попытку дальнейшей гуманизации 89Vk/276G замещением двух остающихся мышиных остатков. После мутирования положений в остатках человека, кпоны-кандидаты анализировали ELISA-тестом и сравнивали с родителем. Однако наблюдали существенную потерю функции после замещения мышиных остатков остатками выбранной матрицы. В связи с этим, создавали другую библиотеку, в которой два положения Vh рандомизировали для предоставления всем аминокислотам этих двух положений. Проводили скрининг кандидатов с использованием функционального ELISA-теста и тридцать кандидатов, которые давали сопоставимые результаты с родительским клоном (89Vk/276G) секвенировали для определения аминокислот, присутствующих в положениях-мишенях. Список кандидатов и аминокислот в 2-х положениях показывают ниже.

Кандидат 24 94 Кандидат 24 94
228В/С V G RL49 А Т
DP27 F R RL59 I M
89/276G V G RL61 S T
RL7 А S RL62 Т T
RL8 L S RL70 S L
RL11 Т V RL72 V Т
RL12 I I RL78 I M
RL15 L L RL79 V T
Кандидат 24 94 Кандидат 24 94
RL19 S L RL84 L Т
RL27 G V RL88 L S
RL32 G G RL89 L S
RL35 S L RL91 G L
RL36 G V RL95 I L
RL40 L S RL97 Т Т
RL45 Т Т RL18 S R

Таким образом, из этого определения, существует несколько аминокислот, которые, по-видимому, являются толерантными в обозначенных положениях и все еще не дают результатов по существенной потере функции. Таким образом, изменением каркасных остатков на аминокислоты, которые не обнаружены ни в мышиной последовательности, ни в каркасной области человека, создавали полностью функциональный Fab без вредного эффекта на связывание с антигеном-мишенью. Кандидатами, которые дополнительно тестировали из этой рандомной библиотеки, были RL-19 и RL-36.

ПРИМЕР 10

Оптимизация CDR

После определения оптимальной каркасной последовательности для кандидата антитела против IL13 производили оптимизацию CDRs. Для этого процесса рандомизировали аминокислотную последовательность CDR и затем проводили скрининг библиотек для идентификации таких кандидатов, которые имели эквивалентную или лучшую функциональную активность, чем родительский клон. Для этой библиотеки родительским кандидатом был RL36 (см. выше). Шесть CDRs рандомизировали поочередно и проводили скрининг библиотек с использованием функционального ELISA-теста. Кандидаты с высокой реакционной способностью секвенировали для сравнения с CDR родителя. Отмечают, что все уникальные последовательности, перечисленные в таблицах ниже, также фигурируют на Фигуре 20 с соответствующими идентификационными номерами последовательностей, SEQ ID NO.

А. Оптимизация CDRL-1

CDRL-1 содержала 15 аминокислот. Каждое из этих положений рандомизировали с использованием синтезированных олигонуклеотидов, которые смешивали в эквимолярных количествах для использования в реакции мутагенеза. Определяли эффективность внедрения мутагенных олигонуклеотидов, которая составляла 40%. С учетом этого процента, число кандидатов, которые необходимо для скрининга, составило 3600. Клоны анализировали с использованием функционального ELISA-теста и те клоны, которые давали сравнимую функциональную активность, секвенировапи. Из числа кандидатов, которые скринировали, идентифицировали 166 позитивных кандидатов. Из этой группы 10 кандидатов секвенировали для определения изменений внутри CDR. Из результатов секвенирования, результаты показаны ниже, положениями 11 и 14, приводящими к улучшенной аффинности, являются N-Q, и М-L.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
CDR-L1 R А S K S V D S Y G N S F M H
L1-21 R А S K S V D S Y G N S F L H
L1-39 R А S K S V D S Y G Q S F M H
L1-47 К А S K S V D S Y G N S F M H
L1-50 R А S K S V D S Y G N S Y M H
L1-59 R А S K S V D S Y G Q S F M H
L1-61 R А S K S V D S Y G N S F M H
L1-62 R А S K S V D S Y G N S P L H
L1-63 R А S K S V D S Y G N S F L H
L1-117 N А S K S V D S Y G N S F M H
L1-125 R А S K S V D S Y G N S F M H

В. Оптимизация CDR2-L2.

CDR-L2 содержала 7 аминокислот.Эту библиотеку готовили, как описывают выше. Эффективность этой библиотеки составляла 80% и анализировали 840 клонов. Число позитивных клонов, идентифицированных из анализа, составляло 75 и 11 клонов секвенировали. Из результатов, показанных ниже, несколько положений внутри CDR давали улучшенную активность, хотя положения и замещение аминокислот возникали рандомно. Этот результат подтверждает наблюдение о том, что CDR-L2 является самым дальним от антигенсвязывающего сайта и, по существу, должен оказывать минимальное влияние на связывание антигена.

1 2 3 4 5 6 7
CDR-L2 L А S N L E S
L2-10 L А S N L N S
L2-13 L А S N L E S
L2-25 L А S N L Q S
L2-37 L А Т N L E S
L2-41 L A S N L K S
L2-44 L A S N L E K
L2-45 L A S R L E S
L2-53 L A S N L H S
L2-58 L A S N L S S
L2-65 L A S F L E S
L2-70 L A N N L E S

С. Оптимизация CDR-L3.

CDR-L3 содержал 9 аминокислот. Эта библиотека, давшая при создании эффективность 50%, требовавшая скрининга ~1700 клонов. Из этого скрининга, идентифицировали 257 позитивных кандидатов и 10 секвенировали. Из этих результатов, только одно положение давало отличие от родительской последовательности. Несколько кандидатов демонстрировали ту же самую последовательность, что давало основание предполагать, что это позиционное изменение являлось крайне благоприятным (N на А)

1 2 3 4 5 6 7 8 9
CDR-L3 Q Q N N E D P R Т
L3-1 Q Q N N E D P R Т
L3-32 Q Q N А E D P R Т
L3-90 Q Q N N E D P R T
L3-100 Q Q N N E D P R T
L3-150 Q Q N N E D P R T
L3-170 Q Q N А E D P R T
L3-185 Q Q N А E D P R T
L3-207 Q Q N А E D P R T
L3-225 Q Q N N E D P R T

D. Оптимизация CDR-H1

CDR-H1 содержала 5 аминокислот. Эффективность этой библиотеки была 80%, требующая скрининга только приблизительно 600 кандидатов. Из скрининга, существовало 138 позитивных клонов и одиннадцать клонов секвенировали. Из результатов, приведенных ниже, второе положение внутри этой CDR, по-видимому, обеспечивало наибольшую возможность улучшения связывания антигена. Однако, несколько аминокислот благоприятно действовали на связывание.

1 2 3 4 5
CDR-H1 А Y S V N
Н1-2 А K S V N
Н1-12 G Y S V N
Н1-18 А K S V N
Н1-24 А K S V N
Н1-31 А H S V N
Н1-89 А Y S V N
Н1-90 G Y S V N
Н1-114 А S S V N
Н1-115 А Н S V N
Н1-123 А R S V N
Н1-126 А R S V N

Е. Оптимизация CDR-H2

CDR-H2 содержала 16 аминокислот. Эффективность этой библиотеки была 70%, что означало, что более 2100 кандидатов необходимо для скрининга. Из скрининга, идентифицировали 192 позитивных кандидата и тринадцать секвенировали для определения изменений, которые происходят в CDR. Из результатов секвенирования, приведенных ниже, несколько положений улучшали аффинность связывания, но ни одно из изменений аминокислот не казалось существенно отличным от родителя.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
CDR-H2 М I W G D G K I V Y N S A L K S
Н2-38 M I W G D G K I S Y N S A L K S
Н2-43 M I W G D G K I V Y N S A L E S
Н2-51 M I W G D G K I V Y N S A L K S
Н2-66 M I W G D G K I S Y N S A L K S
Н2-79 M I W G D G K I V Y N S D L K S
Н2-86 M I W G D G K V V Y N S A L K S
Н2-101 M I W G D G K I V Y N S E L K S
Н2-109 M I W G D G K I А Y N S A L K S
Н2-119 M I W G D G K I V Y N S A L K Е
Н2-121 M V W G D G K I V Y N S A L K S
Н2-129 M I W G D G K I V Y N S A L K S
Н2-169 M I W G D G K I V Y N S A L А S
Н2-176 M I W G D G K K V Y N S A L K S

F. Оптимизация CDR-Н3

CDR-H3 содержала 10 аминокислот. ообще полагали, что эта CDR является областью, которая налагает наибольшее влияние на связывание антигена, поскольку эта петля вообще находится в середине связывающего сайта. Эта библиотека имела эффективность 40%, и таким образом, необходимо было проскринировать 2400 кандидатов. Из них идентифицировали 174 позитивных кандидата и 10 секвенировали для определения изменений внутри CDR. Перечисленные ниже результаты означали, что изменение от Y до R в третьем положении может быть важной заменой для улучшения связывания.

1 2 3 4 5 6 7 8 9 10
Н3 D G Y Y Р Y А М D N
Н3-1 D G R Y Р Y А М D N
Н3-30 D G Y Y Р Y А М S N
Н3-73 D G Y Y Р Y А М А N
Н3-89 D G Y Y Р Y А М А N
Н3-130 D G R Y Р Y А М D N
Н3-131 D G R Y Р Y А М D N
Н3-133 D G Y Y Р Y А L D N
Н3-135 D G R Y Р Y А М D N
Н3-161 D G Y Y Р Y А М D N
Н3-162 D G Y Y Р Y А М K N

G. Комбинаторная библиотека

После того как определили изменения внутри CDRs, которые давали наибольшее итоговое улучшение связывания антигена, затем комбинировали лучших кандидатов для понимания, улучшают ли связывание эти изменения.

Таким образом, конструировали кандидат для комбинирования всех благоприятных замещений аминокислот.

Для создания комбинаторной библиотеки, исходный клон был клоном, который вносил изменения в CDR-L1-59 (N на Q). С этим клоном делали другие изменения для CDR-L3, N на А (4 положение), для CDR-H1, Y или на R, Н, K или S (положение 2), для CDR-H3, Y на R (положение 3) и D или на K, или S (положение 9). Никаких изменений не делали с CDR-L2 или CDR-H2. Проводили скрининг более 1100 кандидатов из этой библиотеки с использованием функционального ELISA-теста. Идентифицировали всего 120 кандидатов в качестве кандидатов, имеющих активность выше, чем родительский клон. Последовательности этих клонов показывают на Фигуре 15.

Для подтверждения того, что эти комбинаторные кандидаты сохраняют функцию, выполняли конкурентный анализ. Для этого анализа, вносили IL13 в планшет для ELISA. Кандидаты, которые являются очищенными Fabs, предварительно смешивали в различных концентрациях до постоянной концентрации меченого химерного анти-IL-13 Fab. Смесь прибавляли в планшет для ELISA. Детектировали меченое химерное анти-IL-13, способное связываться с иммобилизованным на планшете IL13.

Из результатов этого вытеснения, два анализированных кандидата демонстрировали эквивалентную способность конкурировать с химерным кандидатом (228 В/С #3) за связывание с IL13 (Фиг.16). Несоответствующим Fab являлся 51, который демонстрировал неспособность вытеснять. Фиг.17 изображает последовательности трех готовых в смысле аффинности кандидатов.

ПРИМЕР 11

Картирование эпитопов

Моноклональное антитело 228 В/С-1 против IL13 связывается с конформационным эпитопом и связывается с IL13 яичника обезьян с такой же высокой аффинностью, как он связывается с человеческим IL13. Однако 228 В/С не связывается с мышиным IL13. Таким образом, стратегия, разработанная для эпитопного картирования, представляла собой замену небольших частей IL13 обезьяны соответствующей последовательностью IL13 мыши. Синтезировали перекрывающиеся олигонуклеотиды, как показывают на фиг.18. Выполняли два раунда ПЦР для сборки гибридных конструкций IL13, так что часть IL13 обезьяны замещали соответствующей последовательностью IL13 мыши (фиг.18). Конечные кодирующие области IL13, амплифицированные ПЦР, клонировали в векторе pcDNA3.1 внутри рамки с V5 tag с использованием набора ТОРО cloning kit (Invitrogen). Всю амплифицированную ПЦР область подтверждали секвенированием для получения только мутаций в результате обмена желаемыми доменами, а не дополнительных нежелательных мутаций в экспрессирующих векторах.

Идентифицировали эпитоп, связывающий Mab против IL13, в виде 8-мерного пептида от аминокислоты #49 до 56 ESLINVSG (SEQ ID NO: 18). Этот эпитоп локализован в В-спирали и ВС-петле в IL13 человека. При использовании эпитопного пептида, полученного из IL13 яичника обезьяны для обмена соответствующей последовательностостью IL13 мыши, то в результате получали гибридную молекулу IL13, которая может связываться с 228 В/С с аффинностью, сходной с аффинностью исходного IL13 яичника обезьяны, кроме того, подтвердили, что связывание Mab 228B/C с IL13 яичника обезьяны или IL13 человека в этом пептиде между остатками #49-56. Сравнение последовательностей между IL13 человека, клеток яичника обезьяны и мыши обнаруживает, что только три остатка, lle52, Val54, Gly56, в IL13 человека не являются консервативными, что дает основание предположить, что критический остаток для взаимодействия IL13 и aHTH-IL13 Mab по этому 8-мерному пептиду детерминирован одним или комбинацией некоторых из этих трех остатков.

Далее этот эпитоп подтвердили пептидным анализом и спот-анализом. Сканировали полный IL13-пептид с серией перекрывающихся 12-мерных пептидов, синтезированных через SPOT на целлюлозной мембране. Идентифицировали только реакционноспособный пептид анти-IL13 Mab в виде 12-мерного аминокислотного пептида #44-56, YCAALESLINVS (SEQ ID NO 19), который является перекрывающимся с областью, идентифицированной посредством экспериментов с обменом доменами.

Депонирования

Следующие культуры депонировали вместе с Американской коллекцией типовых культур (American Type Culture Collection, 1081 University Boulevard, Manassas Va. 20110-2209 USA (ATCC)):

Гибридома NATCC Дата депонирования
Anti-IL13228B/C-1 PTA-5657 20 ноября, 2003
Anti-IL13228A-4 PTA-5656 20 ноября, 2003
Anti-IL13227-26 PTA-5654 20 ноября, 2003
Anti-IL13227-43 PTA-5655 20 ноября, 2003

Это депонирование делали при предоставленных возможностях Будапештского договора о международном признании депонирования микроорганизмов с целью патентной процедуры (Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty)). Он гарантирует сохранение жизнеспособности культур в течение 30 лет с даты депонирования. Организм будет подготовлен в доступном виде ATCC на условиях Будапештского договора, которые гарантируют постоянную и неограниченную доступность потомства культуры для широкого пользования на основании выдачи имеющего отношения патента США.

Уполномоченное лицо данной заявки согласно, что в случае гибели или потери, или разрушения культуры при хранении при культивировании при подходящих условиях, она будет немедленно заменена по уведомлению на жизнеспособный образец той же самой культуры. Доступность депонированного штамма не должна быть истолкована как разрешение на применение изобретения в противоречии с предоставленными правами с разрешения любого правительства в соответствии с его патентными законами.

Считают, что написанная выше спецификация будет достаточной для возможного применения на практике любому специалисту в данной области. Изобретение не должно быть ограничено рамками депонированной культуры, поскольку депонированные воплощения предназначены в качестве иллюстрации одного аспекта изобретения и любая культура, которая является функционально эквивалентной, попадает в рамки данного изобретения. И при этом, депонирование материала не служит признанием, что написанное здесь описание является неадекватным для практической возможности любого аспекта изобретения, в том числе его лучшего способа, также это не должно служить в качестве ограничения рамок формулы изобретения для специфической иллюстрации, которую она представляет. Несомненно, различные модификации изобретения в дополнение модификациям, показанным и описанным здесь, станут очевидными специалистам в данной области из вышеприведенного описания и попадают в рамки приложенной формулы изобретения.

Специалисты в данной области узнают, или будут иметь возможность удостовериться, используя не более чем рутинные эксперименты, многие эквиваленты к специфическим воплощениям изобретения, описанным здесь. Такие эквиваленты предназначены быть охваченными нижеследующей формулой изобретения.

1. Анти-IL-13 антитело, которое специфически связывается с IL-13 человека, где указанное анти-IL-13 антитело включает VL-домен вариабельной легкой цепи, содержащей CDR1, имеющий аминокислотную последовательность SEQ ID NO:99, CDR2, имеющий аминокислотную последовательность SEQ ID NO:104, и CDR3, имеющий аминокислотную последовательность SEQ ID NO:115 и VH-домен тяжелой цепи, содержащей CDR1, имеющий аминокислотную последовательность SEQ ID NO:117, CDR2, имеющий аминокислотную последовательность SEQ ID NO:123, и CDR3, имеющий аминокислотную последовательность SEQ ID NO:135.

2. Анти-1Е-13 антитело по п.1, где указанное антитело анти-IL-13 включает
(a) аминокислотные последовательности SEQ ID NO:3 и SEQ ID NO:4;
(b) аминокислотные последовательности SEQ ID NO:142 и SEQ ID NO:143;
(c) аминокислотные последовательности SEQ ID NO:144 и SEQ ID NO:145;
(d) аминокислотные последовательности SEQ ID NO:142 и SEQ ID NO:146, 147, 148 или 149.

3. Анти-IL-13 антитело по п.1, где указанное антитело включает
(a) вариабельный домен легкой цени, имеющий аминокислотную последовательность SEQ ID NO:142 и
(b) вариабельный домен тяжелой цепи, имеющий аминокислотную последовательность SEQ ID NO:143.

4. Анти-IL-13 антитело по п.2, где указанное анти-IL-13 антитело включает вариабельный домен легкой цепи, содержащий аминокислотную последовательность SEQ ID NO:3, и вариабельный домен тяжелой цепи, содержащий аминокислотную последовательность SEQ ID NO:4.

5. Анти-IL-13 антитело, которое специфически связывается с IL-13 человека, где указанное анти-IL-13 антитело включает
(a.) VH CDR1, имеющую аминокислотную последовательность SEQ ID NO:117, 118, 119, 120, 121 или 122;
(b.) VH CDR2, имеющую аминокислотную последовательность SEQ ID NO:123, 124, 125 126, 127, 128, 129, 130, 131, 132, 133 или 134; и
(с.) VH CDR3, имеющую аминокислотную последовательность SEQ ID NO:135, 136, 137, 138, 139, 140 или 141.

6. Анти-IL-13 антитело, которое специфически связывается с IL-13 человека, где указанное анти-IL-13 антитело включает
(a) VL CDR1, имеющую аминокислотную последовательность SEQ ID NO:99, 100, 101, 102 или 103
(b) VL CDR2, имеющую аминокислотную последовательность SEQ ID NO:104, 105 106, 107, 108, 109, 110, 111, 112, 113 или 114; и
(c) VL CDR3, имеющую аминокислотную последовательность SEQ ID NO: 115 или 116.

7. Анти-IL-13 антитело по любому из пп.1-6, где анти-IL-13 антитело представляет собой моноклональное антитело.

8. Анти-IL-13 антитело по любому из пп.1-6, где анти-IL-13 антитело представляет собой IgG-антитело.

9. Анти-IL-13 антитело по п.8, где анти-IL-13 антитело представляет собой IgG1, IgG2, IgG3 или IgG4 антитело.

10. Анти-IL-13 антитело по любому из пп.1, 2, 3, 5, 6, где анти-IL-13 антитело представляет собой гуманизированное антитело.

11. Анти-IL-13 антитело по любому из пп.1-9, где анти-IL-13 антитело представляет собой моновалентное, мультиспецифическое, химерное, одноцепочечное антитело или антигенсвязывающий фрагмент.

12. Анти-IL-13 антитело по п.11, где анти-IL-13 антитело представляет собой антигенсвязывающий фрагмент, который является Fab, Fab' и F(ab')2 фрагментом.

13. Анти-IL-13 антитело по п.11, где анти-IL-13 антитело представляет собой мультиспецифическое антитело, которое явялется биспецифическим антителом.

14. Гибридомная клеточная линия, которая продуцирует 228В/С-1 моноклональное анти-IL-13 антитело и указанная в АТСС с номером РТА-5657.

15. Полинуклеотид, кодирующий вариабельную область тяжелой цепи анти-IL-13 антитела по любому из пп.1-13.

16. Полинуклеотид, кодирующий вариабельную область легкой цепи анти-IL-13 антитела по любому из пп.1-13.

17. Полинуклеотид, кодирующий вариабельную область тяжелой и вариабельную область легкой цепи анти-IL-13 антитела по любому из пп.1-13.

18. Полинуклеотид, кодирующий анти-IL-13 антитело по любому из пп.1-13.

19. Полинуклеотид по любому из пп.15-18, который является выделенным.

20. Вектор рекомбинантной экспрессии антитела, содержащий полинуклеотид по любому из пп.15-19.

21. Клетка-хозяин рекомбинантной экспрессии антитела, содержащая полинуклеотид по любому из пп.15-19 или вектор по п.20.

22. Фармацевтическая композиция для использования в качестве лекарственного средства для лечения IL-13 опосредованного заболевания, содержащая терапевтически эффективное количество анти-IL-13 антитела по любому из пп.1-13.

23. Способ лечения астматических симптомов у субъекта, включающий введение субъекту эффективного количества анти-IL-13 антитела по любому из пп.1-13.

24. Способ снижения астматических симптомов у субъекта, включающий введение субъекту эффективного количества анти-IL-13 антитела по любому из пп.1-13.

25. Способ лечения воспалительного заболевания у субъекта. включающий введение субъекту эффективного количества анти-IL-13 антитела по любому из пп.1-13.

26. Способ лечения идиопатического пневмофиброза или воспалительного и фиброзного легочного заболевания у субъекта, включающий введение субъекту эффективного количества анти-IL-13 антитела по любому из пп.1-13.

27. Способ ингибирования продукции IgE антител у субъекта, включающий введение субъекту эффективного количества анти-IL-13 антитела по любому из пп.1-13.

28. Способ по п.27, где ингибирование продукции IgE антитела предназначено для предупреждения бронхиальной астмы, для предупреждения аллергических ринитов, для предупреждения аллергических дерматитов, для предупреждения анафилаксии, для лечения бронхиальной астмы, для лечения аллергических ринитов, для лечения крапивницы, или для лечения аллергических дерматитов.

29. Способ лечения IL-13 опосредованного расстройства у субъекта, включающий введение субъекту анти-IL-13 антитела по любому из пп.1-13, где IL-13 опосредованное расстройство - это аллергическая астма (атопическая астма), неаллергическая астма, аллергические риниты, атонические дерматиты, аллергические конъюнктивиты, экзема, крапивница, пищевые аллергии, хроническое обструктивное легочное заболевание, неспецифический язвенный колит, респираторно-синцитиальная вирусная (RVS инфекция) инфекция, увеиты, склеродерма или остеопороз.

30. Способ по любому из пп.23-29, где анти-IL-13 антитело вводят путем ингаляции, болюсным инъецированием или инфузией.

31. Способ лечения астмы у субъекта, включающий введение терапевтически эффективного количества анти-IL-13 антитела, по любому из пп.1-13.

32. Способ по п.31, где анти-IL-13 антитело вводят путем ингаляции, болюсным инъецированием или инфузией.

33. Способ по любому из пп.23 - 32, где субъектом является человек.

34. Способ продуцирования антитела, специфически связывающегося с IL-13 человека, включающий шаг культивирования клетки-хозяина по п.21 или гибридомной клеточной линии по п.14 с экспрессией антитела.

35. Способ продуцирования антитела, которое специфически связывается с IL-13 человека, содержащий шаг экспрессии полинуклеотида по любому из пп.15-19 или вектора по п.20.

36. Способ по п.34 или 35, дополнительно включающий шаг очистки антитела, экспрессированного из клетки-хозяина.

37. Способ по пп.34, 35 или 36, где указанная клетка является клеткой млекопитающего.

38. Способ по п.37, где указанная клетка млекопитающего является клеткой СНО, представляющей собой яйцеклетку китайского хомячка.

39. Анти-IL-13 антитело, которое специфически связывается с IL-13 человека, где указанное анти-IL-13 антитело получено способом по любому из пп.34-38.



 

Похожие патенты:

Изобретение относится к области биотехнологии, конкретно к экспрессионным конструкциям, и может быть использовано для экспрессии иммуноглобулина. .

Изобретение относится к биотехнологии и может быть использовано для получения моноклональных антител (МКА) к V антигену Yersinia pestis. .

Изобретение относится к биотехнологии и может быть использовано для получения моноклональных антител (МКА) к V антигену Yersinia pestis. .

Изобретение относится к области кристаллизации антител. .

Изобретение относится к биотехнологии и может быть использовано для получения моноклональных антител (МКА) к капсульному F1 антигену Yersinia pestis. .
Изобретение относится к области биотехнологии и вирусологии и касается получения нового штамма гибридных клеток Mus. .

Изобретение относится к области биотехнологии и иммунологии. .

Изобретение относится к иммунологии и биотехнологии. .

Изобретение относится к биотехнологии и может быть использовано для получения моноклональных антител к опухоль ассоциированному антигену Muc I человека. .

Изобретение относится к биотехнологии и может быть использовано для получения моноклональных антител к опухоль-ассоциированному антигену Muc I человека. .

Изобретение относится к биотехнологии и медицине. .
Наверх