Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)



Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)
Генетические конструкции ltf3, ltf5, ltf7, ltf10, ltf11 для получения рекомбинантного лактоферрина человека (варианты)

 


Владельцы патента RU 2491343:

Общество с ограниченной ответственностью "Биотехнологический центр трансгенеза в фарминдустрии "Трансгенфарм" (RU)
Федеральное Государственное бюджетное учреждение науки Институт биологии гена Российской академии наук (ИБГ РАН) (RU)

Изобретение относится к области биотехнологии, конкретно к получению генно-инженерных генетических конструкций для экспрессии рекомбинантного белка лактоферрина человека, и может быть использовано для создания трансгенных животных, несущих ген лактоферрина человека, и получения в промышленных масштабах изоформ рекомбинантного лактоферрина человека. Изобретение позволяет получить высокий уровень наработки целевого белка, свойства которого не отличаются от свойств нативного лактоферрина, полученного из человеческого молока. 5 н.п. ф-лы, 10 ил., 1 табл., 4 пр.

 

Область техники

Изобретение относится к области биотехнологии, молекулярной генетики, молекулярной биологии, генетической инженерии, а именно к созданию пяти генно-инженерных генетических конструкций для экспрессии рекомбинантного белка лактоферрина человека. Предложенное изобретение может быть использовано для создания трансгенных животных, несущих ген изоформ лактоферрина человека, и получения в промышленных масштабах рекомбинантного белка лактоферрина человека. Применение данных конструкций для получения трансгенных животных позволяет получить высокий уровень наработки целевого белка, свойства которого не отличаются от свойств нативного лактоферрина, полученного из человеческого молока.

Уровень техники

Известна генетическая конструкция и метод для наработки лактоферрина (патент США №7,087,808). Данное изобретение описывает метод экспрессии и последующей секреции рекомбинантных белков, фактора свертывания крови IX и лактоферрина, в молоко трансгенных млекопитающих. Данное изобретение отличается от заявленного тем, что в качестве трансгенного животного используется свинья, при этом структурные элементы представлены трансгенами, кодирующими тандем фактора свертывания крови IX и лактоферрина свиньи, где оба трансгена находятся под контролем специфического промотора, а именно -бычьего альфа-лактальбумина.

Известен метод продукции рекомбинантного лактоферрина и его пептидов (в частности, его железо-связывающего пептида) в трансгенных животных (Патент США №6,635,447). Генетическая конструкция данного изобретения отличается от заявляемого изобретения и характеризуется следующими структурными элементами: промотор выбирается из группы, состоящей из алкогольдегидрогеназы, argB, а-амилаза, глюкоамилаза, benA; терминирующая последовательность выбрана из группы: а-амилаза, глюкоамилаза, алкогольдегидрогеназа, benA; линкерная последовательность выбрана из группы а-амилаза, глюкоамилаза и лактоферрин. Уровень экспрессии целевого белка во всех изобретениях достигнут на уровне 10 мг/л, что составляет 5% от общего белка клетки. Аналогичный подход к наработке рекомбинантного лактоферрина, сходный уровень выхода целевого белка с использованием генетических конструкций у трансгенных животных, продемонстрирован в патентах США №6,228,614, №6,100,054, №5,849,881, №5,766,939, №5,571,691.

Таким образом, известные из уровня техники генетические конструкции, разработанные с целью получения рекомбинантного лактоферрина человека в молоке трансгенных млекопитающих, демонстрируют разные структурные элементы и относительно невысокий уровень продукции лактоферрина. Генетические конструкции, состоящие из тандемного повтора инсуляторов из бета-глобинового гена кур, бета-казеинового промотора из генома коз, 5'-нетранслируемой области, содержащих два первых экзона бета-казеинового гена, кодирующей области, содержащей варианты геномной последовательности лактоферрина, 3'-геномный фрагмент бета-казеинового гена, ген устойчивости к ампициллину, bla-промотор, ориджин репликации из плазмиды pBR322; сайт клонирования: NotI-SalI, предложен авторами впервые.

Постановка задачи и раскрытие изобретения

Задачей изобретения является создание рекомбинантных плазмид, предназначенных для высокой продукции белка лактоферрина человека. Рекомбинантные плазмиды обладают биологическими характеристиками, позволяющими использовать данную конструкцию для высокоэффективной продукции лактоферрина человека в молоке трансгенных коз. Предложенное изобретение позволяет достичь уровня целевого белка до 16 г/л.

Одним из эффективных эукариотических векторов является плазмида рВС1, предназначенная для создания экспрессионных конструкций для последующей продукции белков интереса в молоке трансгенных животных. Конструкция может также применяться для создания трансгенных мышей и других млекопитающих, например коров. Для достижения эффективной продукции белков интереса в молоке трансгенных животных используют такие регуляторные элементы, как промотор бета-казеинового гена коз, инсуляторы из генома кур, эффективные терминаторы транскрипции.

Сущность изобретения состоит в том, что в результате последовательного клонирования геномной копии гена лактоферрина человека в вектор рВС1 получают рекомбинантные плазмиды для создания трансгенных животных и продукции белка лактоферрина человека в их молоке. Предложено пять рекомбинантных плазмид, - LTF3, LTF5, LTF7, LTF10, LTF11, обеспечивающих высокий уровень продукции целевого белка.

В рамках данного изобретения, термин «трансферрины» означает семейство железо-переносящих белков, в которое входят трансферрин, овотрансферрин, лактоферрин. Все эти белки имеют структурное сходство.

В рамках данного изобретения, термин «генетическая конструкция» означает плазмиду, фаг, любой другой вариант искусственно созданного вектора, обеспечивающего наработку рекомбинантного белка лактоферрина.

В рамках данного изобретения «промотор» означает регуляторную последовательность нуклеотидов ДНК, которая контролирует транскрипцию рекомбинантного лактоферрина человека.

В рамках данного изобретения «изоформа лактоферрина» означает любой из двух функционально сходных белков лактоферрина, обладающих одинаковыми функциями, но не идентичными последовательностями. У изоформы, состоящей из 711 аминокислот имеется повтор из 4 аргининов, у изоформы, состоящей из 710 аминокислот - повтор из 3 аргининов. Изоформа 711 характерна для жителей России, 710 - для американского контитента.

Основание осуществления изобретения

Трансгенные животные являются удобным источником продукции белков человека. В настоящее время создано множество моделей трансгенных животных, позволяющих получать такие необходимые для человека белки, как гормон роста, протеин С, а1-антитрипсин, сывороточный альбумин, урокиназа (Kim et al., 1999). Экспрессия рекомбинантных белков в молоко животных осуществляется под контролем промоторов ряда «молочных» белков, включая as 1-казеин, b-казеин, b-лактоглобулин, WAP, а-лактальбумин, при этом промоторы таких генов, как b-казеин козы, b-лактоглобулин овцы и as 1-казеин коровы являются наиболее эффективными для гетерологичной экспрессии целевых белков (Maga et al., 1995; Hatano et al., 1998; Ninomiya et al., 1994; Wei et al., 1995; Carver et al., 1993; Barash et al., 1994; Meade et al., 1990).

Лактоферрин человека является одним из наиболее «привлекательных» объектов, в отношении которого предпринимаются попытки получения в больших количествах с использованием трансгенных животных. Лактоферрин относится к трансферринам - особому белковому семейству, осуществляющему транспорт железа в организме. Благодаря этому свойству лактоферрин обладает способностью хелатировать железо у микроорганизмов, что является основой его бактерицидного эффекта (Artym, 2006). Кроме антибактериального эффекта, лактоферрин обладает многими другими важными биологическими функциями, - иммуностимулирующей, регуляцией миелопоэза, антиоксидантной, противовоспалительной (Actor et al., 2009; Amini et al., 2011; Ashby et al., 2011; Kruzel et al., 2007). Столь разнообразный спектр его активностей диктует необходимость в получении больших количеств лактоферрина, в том числе путем его секреции в молоко трансгенных животных.

К настоящему времени отработаны технологии получения рекомбинантного лактоферрина человека из молока трансгенных животных. Так, путем внутрипротокового введения аденовирусного вектора, кодирующего сДНК лактоферрина человека, уровень продукции белка составил около 2 граммов на литр (Han et al., 2007). В другом исследовании с трансгенными кроликами уровень продукции лактоферрина составил около 2.3 мг/мл (Han et al., 2008), еще один эксперимент на трансгенных мышах продемонстрировал выход рекомбинантного лактоферрина человека на уровне 500 мкг/мл (Kim et al., 1999). Во всех этих исследованиях, на трансгенных животных различных семейств, убедительно продемонстрирована возможность управления эффективной секрецией рекомбинантного белка человека, что дает широкие возможности для улучшения технологических приемов по получению заданного уровня целевого белка.

Краткое описание фигур чертежей

Фигура 1. Генетическая карта конструкции LTF 3. Описание структурных элементов даны в тексте.

Фигура 2. Генетическая карта конструкции LTF 5. Описание структурных элементов даны в тексте.

Фигура 3. Генетическая карта конструкции LTF 7. Описание структурных элементов даны в тексте.

Фигура 4. Генетическая карта конструкции LTF 10. Описание структурных элементов даны в тексте.

Фигура 5. Генетическая карта конструкции LTF 11. Описание структурных элементов даны в тексте.

Фигура 6. Проверка наличия трансгенов в геноме мышей методом ПЦР в режиме реального времени. Представлен результат с реал-тайм ПЦР, демонстрирующий зависимость количества ПЦР продукта от циклов. Tr - это трансгены, K+ геномная ДНК человека, K- нетрансгенная мышь А). Проверка наличия трансгена LTF 3; В) Проверка наличия трансгена LTF 5; С) Проверка наличия трансгена LTF 7; D) Проверка наличия трансгена LTF 10; Е) Проверка наличия трансгена LTF 11.

Фигура 7. Проверка специфичности экспрессии трансгена в различных тканях мыши. 1 - молочная железа; 2 - печень; 3 - селезенка; 4 - яичники; 5 - почки; 6 - поджелудочная железа; 7 - сердце; 8 - легкие; 9 - тимус; 10 - головной мозг; 11 - мышечная ткань.

Фигура 8. Наследование уровня продукции лактоферрина в поколениях трансгенных мышей для различных трансгенов.

Фигура 9. Проверка наличия трансгенов геноме коз методом ПЦР в режиме реального времени. Представлен результат реал-тайм ПЦР. Tr - это трансгены, K+ геномная ДНК человека, K- нетрансгенная коза. А) Проверка наличия трансгена LTF 3; В) Проверка наличия трансгена LTF 5.

Фигура 10. Результат ПЦР в режиме реального времени. Представлена зависимость количества ПЦР продукта от циклов. Два повтора с каждого образца. А. Праймеры к лактоферрину человека. Tr - геномная ДНК трансгенной мыши, K+ геномная ДНК человека, K- геномная ДНК нетрансгенной мыши. В. Нормировочный ПЦР.

Таблица 1. Среднее содержание лактоферрина (г/л) в молоке мышей для различных конструкций.

Примеры осуществления изобретения

Осуществление изобретения проиллюстрировано следующими примерами.

Пример 1. Получение генетической конструкции LTF3.

Аликвоту плазмидной ДНК извлекают из холодильника (температура хранения - 20,0±2,0°С) и проводят трансформацию культуры Е.coli методом электропорации. Проводят культивирование трансформированной культуры на среде 2xYT с добавлением 50 мкг/мл ампициллина. Продолжительность культивирования составляет от 18 до 20 часов при температуре +37,0±0,5°С.

Плазмидная ДНК выделяется методом щелочного лизиса.

Центрифугируют при ЦФ 4°С в течение 10-15', сливают среду; далее центрифугируют 4 krpm в течение 1', удаляют остатки жидкости. Ресуспензируют в 10(5) ml раствора "I" (Глюкоза 50 mM, Tris-HCl, рН 8.0 25 mM, EDTA 10 mM); +1 ml свежеприготовленного раствора лизоцима (10 mg/ml в р-ре "I"). Далее выдерживают при нормальной температуре в течение 15', добавляют 20 ml раствора "II" (NaOH 0.2N, SDS 1%), резко выливают, смешивают при 0°С в течение 5'; добавляют 10 ml холодного 10М AcONH4 (добавляют 5 ml пипеткой по каплям), смешивают. Выдерживают при 0°С в течение 5'.

Центрифугируют 5 krpm, при 4°С в течение 10'; супернатант снимают, делят на 2 пробирки, добавляют к каждой по 12.5 мл изопропанола. Делают это на весах, чтобы пробирки имели равный вес; выдерживают при комнатной температуре в течение 10', далее центрифугируют 5 krpm при 4°С в течение 10', сбросить супернатант. Центрифугируют при комнатной температуре в течение 3', отсасывают остатки жидкости.

Суспендируют осадок в 800µl 2 М AcONH4, объединяют в одной 2 ml пробирке; выдерживают при комнатной температуре в течение 5'; и центрифугируют при комнатной температуре в течение 10'. Супернатант переносят в пробирку с 800µl изопропанола; выдерживают при комнатной температуре в течение 5'; центрифугируют при комнатной температуре в течение 5'; далее споласкивают 70% EtOH; растворяют в 0.2-1 ml Н2О.

Выделенные и очищенные препараты плазмидной ДНК оценивают электрофоретически в 0,8% агарозном геле. Концентрацию измеряют на спектрофотометре и флуорометре. Проводится рестриктное картирование отдельно по EcoRI, HindIII, NotI-SalI. Рестриктные фрагменты разделяют электрофоретически на 0,8% агарозном геле и сравнивают с эталонными картами, представленными на фигурах 2, 3, 4.

Полученный препарат представляет собой очищенный препарат ДНК рекомбинантной плазмиды LTF3, который может быть использован для подготовки фрагмента для микроинъекций. Рекомбинантная плазмида LTF3 депонирована в трансгенбанк Учреждения Российской академии наук Института биологии гена РАН.

Пример 2. Родословная рекомбинантных плазмид.

2.1. Плазмида LTF3.

Плазмида LTF3 была создана на основе вектора pBCl (Invitrogen) и геномной последовательности гена лактоферрина человека; число пассажей к моменту паспортизации: 1.

Стандартные условия выращивания in vitro, условия культивирования - линия E.coli XL-2, среда 2xYT, ампициллин 50 мкг/мл, 37°С, 18-20 часов.

Молекулярно-биологические свойства рекомбинантной плазмиды: размер конструкции: 37253 п.н., размер векторной части: 5877 п.н., маркерный признак: устойчивость к ампициллину.

Структурные элементы: тандемный повтор инсуляторов из бета-глобинового гена кур, бета-казеиновый промотор из генома коз, 5'-нетранслируемая область содержит два первых экзона бета-казеинового гена, кодирующая область содержит геномную последовательность лактоферрина состоящую из 6 экзонов и интронов между ними, далее следует кДНК копия гена представляющая 7-17 экзоны без интронов, 3'-геномный фрагмент бета-казеинового гена, ген устойчивости к ампициллину, bla-промотор, ориджин репликации из плазмиды pBR322; сайт клонирования: NotI-SalI; размер кодируемого белка: 710 а.о.; последовательность кодируемого белка: SEQ ID NO:1

Устойчивость рекомбинантной плазмиды. Хранение в течение 2 лет (срок наблюдения) в виде плазмидной ДНК при температуре минус -20°С.

Генетическая карта конструкции LTF3 приведена на Фиг 1, нуклеотидная последовательность представлена как SEQ ID NO:3.

2.2. Плазмида LTF5.

Получение рекомбинантной плазмиды LTF5 аналогично описанному выше в Примере 1.

Рекомбинантная плазмида LTF5 отличается следующими характеристиками: размер конструкции: 49509 п.н.; структурные элементы: тандемный повтор инсуляторов из бета-глобинового гена кур, бета-казеиновый промотор из генома коз, 5'-нетранслируемая область содержит два первых экзона бета-казеинового гена, кодирующая область содержит геномную последовательность лактоферрина состоящую из 17 экзонов и интронов между ними, 3'-геномный фрагмент лактоферрина, ген устойчивости к ампициллину, bla-промотор, ориджин репликации из плазмиды pBR322. размер кодируемого белка: 710 а.о.; последовательность кодируемого белка: SEQ ID NO 1.

Генетическая карта конструкции LTF5 приведена на Фиг 2, нуклеотидная последовательность представлена как SEQ ID NO:4.

2.3. Плазмида LTF7.

Получение рекомбинантной плазмиды LTF7 аналогично описанному выше в Примере 1.

Рекомбинантная плазмида LTF7 отличается следующими характеристиками: размер конструкции: 50301 п.н., размер векторной части: 5877 п.н., маркерный признак: устойчивость к ампициллину.

Структурные элементы: тандемный повтор инсуляторов из бета-глобинового гена кур, бета-казеиновый промотор из генома коз, 5'-нетранслируемая область содержит два первых экзона бета-казеинового гена, кодирующая область содержит геномную последовательность лактоферрина состоящую из 17 экзонов и интронов между ними, 3'-геномный фрагмент бета-казеинового гена, ген устойчивости к ампициллину, bla-промотор, ориджин репликации из плазмиды pBR322. Сайг клонирования: NotI-SalI.

Размер кодируемого белка: 710 а.о.; последовательность кодируемого белка: SEQ ID NO 1.

Генетическая карта конструкции LTF7 приведена на Фиг 3, нуклеотидная последовательность представлена как SEQ ID NO:5. Плазмида LTF10.

Получение рекомбинантной плазмиды LTF10 аналогично описанному выше в Примере 1.

Рекомбинантная плазмида LTF10 отличается следующими характеристиками: размер конструкции: 50642 п.н., размер векторной части: 5877 п.н., маркерный признак: устойчивость к ампициллину.

Структурные элементы: тандемный повтор инсуляторов из бета-глобинового гена кур, полностью ген лактоферрина человека (промотор лактоферрина человека, 5'-нетранслируемая область лактоферрина человека, кодирующая область содержит геномную последовательность лактоферрина состоящую из 17 экзонов и интронов между ними, 3'-геномный фрагмент лактоферрина), ген устойчивости к ампициллину, bla-промотор, ориджин репликации из плазмиды pBR322. Сайт клонирования: NotI-SalI.

Размер кодируемого белка: 711 а.о.; последовательность кодируемого белка: SEQ ID NO 2.

Генетическая карта конструкции LTF10 приведена на Фиг 4, нуклеотидная последовательность представлена как SEQ ID NO:6.

2.5. Плазмида LTF11.

Получение рекомбинантной плазмиды LTF11 аналогично описанному выше в Примере 1. Рекомбинантная плазмида LTF11 отличается следующими характеристиками: размер конструкции: 32051 п.н., структурные элементы: тандемный повтор инсуляторов из бета-глобинового гена кур, бета-казеиновый промотор из генома коз, 5'-нетранслируемая область содержит два первых экзона бета-казеинового гена, кодирующая область содержит геномную последовательность лактоферрина состоящую из 6 экзонов и интронов между ними, далее следует кДНК копия гена представляющая 7-17 экзоны без интронов, 3'-геномный фрагмент гена лактоферрина, ген устойчивости к ампициллину, bla-промотор, ориджин репликации из плазмиды pBR322. Размер кодируемого белка: 711 а.о.; последовательность кодируемого белка: SEQ ID NO 2.

Генетическая карта конструкции LTF11 приведена на Фиг 5, нуклеотидная последовательность представлена как SEQ ID NO:7.

Пример 3. Тканеспецифичность экспрессии трансгенов у млекопитающих

С помощью RT-ПЦР с последующим ПЦР в режиме реального времени был оценено наличие трансгенов и измерен уровень РНК в различных тканях мыши. Полученные данные показали, что уровень экспрессии в молочной железе в 5-1000 раз превышает уровень экспрессии в других тканях. Наиболее сильная экспрессия наблюдается в молочной железе (1) и мышцах (11). На гель нанесен RT-PCR лактоферрина (обозначено LTF) и RT-PCR нормировочного гена G3PDH (обозначено ----). (Фигуры 6, 7).

Наследование уровня продукции лактоферрина в поколениях трансгенных мышей для различных трансгенов показано на Фигуре 8. Среднее содержание лактоферрина (г/л) в молоке мышей для различных конструкций представлено в Таблице 1.

Аналогично оценивали наличие трансгенов в геноме коз (Фигура 9).

Пример 4. Зависимость уровня экспрессии трансгенов от количества копий, встроившихся в геном.

Количество копий трансгена определяли методом ПЦР в режиме реального времени с использованием интеркалирующего красителя SYBR Green. В качестве точки отсчета использовали геномную ДНК человека, в которой количество копий лактоферрина считали равное двум. Геномную ДНК мышей выделяли из хвостов, геномную ДНК человека выделяли из крови. Для минимизации неспецифичного сигнала с лактоферрина мыши, были подобраны уникальные праймеры к интрону лактоферрина человека, не обладающие существенной гомологией с последовательностью лактоферрина мыши. Используемые праймеры к лактоферрину человека: 5'-CCCAGCATCAGACAACCACTAATC, 5'-AGGAAGCCAGACACAAGAGACC. В ПЦР реакцию брали по 100нг геномной ДНК. Количество геномной ДНК измеряли на флуорометре Qubit (Invitrogen) и дополнительно проводили нормировочный ПЦР в режиме реального времени. Для нормировки использовали праймеры к гену Втр4, универсальные для человека и мыши: CGGGAGCAGGTGGACCAGGG, GTGTCCAGTAGTCGTGTGATGAGGTG. Количество копий определяли по формуле: Кол-во=2*E(C(t)к-C(t)), где C(t)к и C(t) пороговые циклы ДНК человека и трансгена, соответственно. Е - эффективность ПЦР (Фигура 15).

Было определено количество копий трансгена и проанализирована зависимость между копийностью трансгена и продукцией лактоферрина в молоке трансгенных животных. При росте количества копий примерно до 20 наблюдается плавный рост продукции, при дальнейшем росте копийности уровень остается примерно неизменным. Связь количества копий и продукции лактоферрина иллюстрируется следующими пропорциями:

- 1-2 копии - средняя продукция 6 мг/мл

- 3-5 копий - средняя продукция 7.2 мг/мл

- 6-10 копий - средняя продукция 7.9 мг/мл

- 11-20 копий - средняя продукция 11.3 мг/мл

- 21-50 копий - средняя продукция 18.9 мг/мл

- более 50 копий - средняя продукция 14.2 мг/мл.

Таблица 1
Конструкция Содержание лактоферрина, М±m (г/л)
LTF3 9,239±0,725
LTF5 16,662±1,720
LTF7 12,171±0,979
LTF10 10,215±1,122
LTF11 12,396±1,838

Литертурные источники

- Actor JK, Hwang SA, Kruzel ML. Lactoferrin as a natural immune modulator. Curr Pharm Des. 2009; 15 (17): 1956-73.

- Amini AA, Nair LS. Lactoferrin: a biologically active molecule for bone regeneration. Curr Med Chem. 2011; 18 (8): 1220-9.

- Artym J. [Antitumor and chemopreventive activity of lactoferrin]. Postepy Hig Med Dosw (Online). 2006; 60: 352-69.

- Ashby B, Garrett Q, Willcox M. Bovine lactoferrin structures promoting comeal epithelial wound healing in vitro. Invest Ophthalmol Vis Sci. 2011 Apr 25; 52 (5): 2719-26.

- Barash, I., Faerman, A., Ratovitsky, Т., Puzis, R., Nathan, M., Hurwitz, D.R., and Shani, M. (1994) Ectopic expression of 6-lactoglobulin/human serum albumin fusion genes in transgenic mice: hormonal regulation and in situ localization. Transgenic Res.3, 141-151.

- Carver, A.S., Dalrymple, M.A., Wright, G., Cottom, D.S., Reeves, D.B., Gibdon, Y.H., Keenan, J.L., Barrass, J.D., Scott, A.R., Colman, A., and Garner, 1. (1993) Transgenic livestock as bioreactors: stable expression of human a1-antitrypsin by a flock of sheep. Bio/Technology 11, 1263-1270.

- Han ZS, Li QW, Zhang ZY, Xiao B, Gao DW, Wu SY, Li J, Zhao HW, Jiang ZL, Hu JH. High-level expression of human lactoferrin in the milk of goats by using replication-defective adenoviral vectors. Protein Expr Purif. 2007 May; 53 (1): 22 5-31.

- Han ZS, Li QW, Zhang ZY, Yu YS, Xiao B, Wu SY, Jiang ZL, Zhao HW, Zhao R, Li J. Adenoviral vector mediates high expression levels of human lactoferrin in the milk of rabbits. J Microbiol Biotechnol. 2008 Jan; 18 (1): 153-9.

- Hatano, N., Eversole-Cire, P., Ferguson-Smith, A.G., Jones, P.A., Surani, M.A., and Sasaki, H. (1998) Enhancer-dependent, locus-wide regulation of the imprinted mouse insulin-like growth factor II gene. J. Biochem. 123, 984-991.

- Kim SJ, Sohn BH, Jeong S, Pak KW, Park JS, Park IY, Lee TH, Choi YH, Lee CS, Han YM, Yu DY, Lee KK. High-level expression of human lactoferrin in milk of transgenic mice using genomic lactoferrin sequence. J Biochem. 1999 Aug; 126 (2): 320-5.

- Kruzel ML, Actor JK, Boldogh I, Zimecki M. Lactoferrin in health and disease. Postepy Hig Med Dosw (Online). 2007; 61: 261-7.

- Maga, E.A. and Murray, J.D. (1995) Mammary gland expression of transgenes and the potential for altering the properties of milk. Bio/Technology 13, 1452-1457.

- Meade, H., Gates, L., Lacy, E., and Lonberg, N. (1990) Bovine as 1-casein gene sequences direct high level expression of active human urokinase in mouse milk. Bio/Technology 8, 443-446.

- Ninomiya, Т., Hirabayashi, M., Sagara, J., and Yuki, A. (1994) Functions of protein gene 5-flanking regions on growth hormone gene. Mol. Reprod. Deu. 37, 275-283.

- Wei, Y., Yarns, S., Greenberg, N.M, Whitsett, J., and Rosen, J.M. (1995) Production of human surfactant protein С in milk of transgenic mice. Transgenic Res. 4, 232-240.

1. Генетическая конструкция LTF3, последовательность которой представлена как SEQ ID NO:3, кодирующая белок лактоферрин человека, предназначенная для продукции рекомбинантного лактоферрина человека в молоко трансгенных млекопитающих, характеризующаяся следующими конструктивными признаками: размер - 37253 п.о.; маркерный признак - устойчивость к ампициллину; размер векторной части - 5877 п.о.; структурные элементы векторной части: ген устойчивости к ампициллину, bla-промотор, ориджин репликации из плазмиды pBR322; описание клонированного фрагмента: тандемный повтор инсуляторов из бета-глобинового гена кур, бета-казеиновый промотор из генома коз, 5'-нетранслируемая область содержит два первых экзона бета-казеинового гена, кодирующая область содержит геномную последовательность лактоферрина, состоящую из 6 экзонов и интронов между ними, далее следует кДНК копия гена, представляющая 7-17 экзоны без интронов, 3'-геномный фрагмент бета-казеинового гена; размер фрагмента - 31376 п.о.; сайт клонирования - NotI, SalI; размер кодируемого белка - 710 а.о.; последовательность кодируемого белка SEQ ID NO:1.

2. Генетическая конструкция LTF5, последовательность которой представлена как SEQ ID NO:4, кодирующая белок лактоферрин человека, предназначенная для продукции рекомбинантного лактоферрина человека в молоко трансгенных млекопитающих, характеризующаяся следующими конструктивными признаками: размер - 49509 п.о.; маркерный признак - устойчивость к ампициллину; размер векторной части - 5877 п.о.; структурные элементы векторной части: ген устойчивости к ампициллину, bla-промотор, ориджин репликации из плазмиды pBR322; описание клонированного фрагмента: тандемный повтор инсуляторов из бета-глобинового гена кур, бета-казеиновый промотор из генома коз, 5'-нетранслируемая область содержит два первых экзона бета-казеинового гена; кодирующая область содержит геномную последовательность лактоферрина, состоящую из 17 экзонов и интронов между ними, 3'-геномный фрагмент лактоферрина; размер фрагмента - 43632 п.о.; сайт клонирования - NotI, SalI; размер кодируемого белка - 710 а.о.; последовательность кодируемого белка - SEQ ID NO:1.

3. Генетическая конструкция LTF7, последовательность которой представлена как SEQ ID NO:5, кодирующая белок лактоферрин человека, предназначенная для продукции рекомбинантного лактоферрина человека в молоко трансгенных млекопитающих, характеризующаяся следующими конструктивными признаками: размер конструкции - 50642 п.н.; размер векторной части - 5877 п.н.; маркерный признак - устойчивость к ампициллину; структурные элементы: тандемный повтор инсуляторов из бета-глобинового гена кур, полностью ген лактоферрина человека (промотор лактоферрина человека, 5'-нетранслируемая область лактоферрина человека; кодирующая область содержит геномную последовательность лактоферрина, состоящую из 17 экзонов и интронов между ними, 3'-геномный фрагмент лактоферрина), ген устойчивости к ампициллину, bla-промотор, ориджин репликации из плазмиды pBR322; сайт клонирования - NotI-SalI; размер кодируемого белка - 710 а.о.; последовательность кодируемого белка - SEQ ID NO:1.

4. Генетическая конструкция LTF10, последовательность которой представлена как SEQ ID NO:6, кодирующая белок лактоферрина человека, предназначенная для продукции рекомбинантного лактоферрина человека в молоко трансгенных млекопитающих, характеризующаяся следующими конструктивными признаками: размер конструкции - 50642 п.н.; размер векторной части - 5877 п.н.; маркерный признак - устойчивость к ампициллину; структурные элементы: тандемный повтор инсуляторов из бета-глобинового гена кур, полностью ген лактоферрина человека (промотор лактоферрина человека, 5'-нетранслируемая область лактоферрина человека, кодирующая область содержит геномную последовательность лактоферрина, состоящую из 17 экзонов и интронов между ними, 3'-геномный фрагмент лактоферрина), ген устойчивости к ампициллину, bla-промотор, ориджин репликации из плазмиды pBR322; сайт клонирования - NotI-SalI; размер кодируемого белка - 711 а.о.; последовательность кодируемого белка - SEQ ID NO:2.

5. Генетическая конструкция LTF11, последовательность которой представлена как SEQ ID NO:7, кодирующая белок лактоферрина человека, предназначенная для продукции рекомбинантного лактоферрина человека в молоко трансгенных млекопитающих, характеризующаяся следующими конструктивными признаками: размер - 32051 п.о.; маркерный признак - устойчивость к ампициллину; размер векторной части - 5877 п.о.; структурные элементы векторной части: ген устойчивости к ампициллину, bla-промотор, ориджин репликации из плазмиды pBR322; описание клонированного фрагмента: тандемный повтор инсуляторов из бета-глобинового гена кур, бета-казеиновый промотор из генома коз, 5'-нетранслируемая область содержит два первых экзона бета-казеинового гена, кодирующая область содержит геномную последовательность лактоферрина, состоящую из 6 экзонов и интронов между ними, далее следует кДНК копия гена, представляющая 7-17 экзоны без интронов, 3'-геномный фрагмент гена лактоферрина; размер фрагмента - 26174 п.о.; сайт клонирования - NotI, SalI; размер кодируемого белка - 711 а.о.; последовательность кодируемого белка - SEQ ID NO:2.



 

Похожие патенты:

Изобретение относится к области биотехнологии. .

Изобретение относится к иммунологии. .

Изобретение относится к области биотехнологии, конкретно к получению рекомбинантного плазминогена человека, и может быть использовано в медицине для создания новых лекарственных препаратов с антиангиогенным терапевтическим эффектом.

Изобретение относится к области биотехнологии, а именно к полипептидам и составу для профилактики или лечения гипертрофии миокарда, применению и способам получения указанных полипептидов.

Изобретение относится к области иммунологии. .

Изобретение относится к области биотехнологии, конкретно к получению рецептора фактора некроза опухоли, и может быть использовано в медицине. .

Изобретение относится к генетике и спортивной медицине. .

Изобретение относится к области биотехнологии, конкретно к получению белков шелка различных насекомых, и может быть использовано в медицине для создания фармацевтически приемлемого носителя.

Изобретение относится к биохимии и представляет собой варианты антител, связывающих белок киназы анапластической лимфомы (ALK) человека. .

Изобретение относится к области биотехнологии и представляет собой выделенную нуклеиновую кислоту, включающую регуляторную последовательность РНК-полимеразы I собаки и содержащую (i) по меньшей мере 250, или по меньшей мере 350, или по меньшей мере 450 соприкасающихся нуклеотидов или всю нуклеотидную последовательность, представленную в виде последовательности SEQ ID NO:26, (ii) полинуклеотид, который по меньшей мере на 80% идентичен указанной выше нуклеотидной последовательности (i) или включает комплементарную или обратно комплементарную (i) или (ii) последовательность.
Изобретение относится к биотехнологии и представляет собой способ получения композиции на основе белково-минеральных компонентов
Наверх