Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение



Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение
Микровезикулы, полученные из рекомбинантных дрожжей, обладающие гемостатическими активностями, и их применение

 


Владельцы патента RU 2492184:

ТРОМБОТАРГЕТС ЮРОП, С.Л. (ES)

Изобретение относится к биотехнологии и представляет собой микровезикулу, несущую тканевый фактор. Полученная из дрожжей микровезикула, несущая тканевый фактор (ТФ), снижающая время коагуляции, содержит (i) мембрану дрожжей и (ii) белок тканевого фактора (ТФ) человека или его вариант, обладающий прокоагулянтной активностью, где часть указанного белка ТФ человека, обладающего прокоагулянтной активностью, встроена в указанную мембрану, и где N-концевой домен указанного белка ТФ человека или его варианта, обладающего прокоагулянтной активностью, расположен на внешней стороне указанной мембраны, и где указанный его вариант, обладающий прокоагулянтной активностью, соответствует белку тканевого фактора человека, имеющему по меньшей мере одну модификацию, выбранную из группы, состоящей из включения гетерологичной последовательности, которая пригодна для облегчения выделения или очистки варианта, причем указанная гетерологичная последовательность связана с C-концевым или N-концевым доменом; удаления сигнального пептида, приводящего к зрелому белку ТФ человека; модификации сайта N-гликозилирования, соответствующего остаткам в положениях 11-13 зрелого белка ТФ человека, причем указанная модификация делает указанный сайт нефункциональным; модификации сайта N-гликозилирования, соответствующего остаткам в положениях 124-126 в зрелом белке ТФ человека, причем указанная модификация делает указанный сайт нефункциональным; модификации сайта N-гликозилирования, соответствующего остаткам в положениях 137-139 в зрелом белке ТФ человека, причем указанная модификация делает указанный сайт нефункциональным; модификации сайтов N-гликозилирования, соответствующих остаткам 124-126 и 11-13 в зрелом белке ТФ человека, причем указанная модификация делает указанный сайт нефункциональным; модификации сайтов N-гликозилирования, соответствующих остаткам 124-126 и 137-139 в зрелом белке ТФ человека, причем указанная модификация делает указанный сайт нефункциональным; модификации сайтов N-гликозилирования, соответствующих остаткам 124-126, и 11-13, и 137-139 в зрелом белке ТФ человека, причем указанная модификация делает указанный сайт нефункциональным; удаления всего домена или его части, ответственных за связывание с FVIIa; и введения мутации в домен, ответственный за связывание с FVIIa, которая приводит к существенно сниженной аффинности к FVIIa. Изобретение позволяет получить микровезикулу, снижающую время коагуляции. 5 н. и 11 з.п. ф-лы, 34 ил., 16 табл., 6 пр.

 

Область изобретения

В основном, настоящее изобретение относится к лечению геморрагий у субъекта с помощью прокоагулянта. Более конкретно, изобретение относится к полученным из дрожжей микровезикулам, несущим тканевой фактор, содержащим мембрану дрожжей и тканевой белковый фактор или его фрагмент, или тканевой белковый фактор или его фрагмент, слитый с другим пептидом, в качестве слитого белка, обладающего прокоагулянтной активностью, и к их применению в качестве прокоагулянта, пригодного для лечения геморрагий у субъекта, а также для стимуляции ангиогенеза и клеточной миграции. Изобретение дополнительно относится к способу производства указанной полученной из дрожжей микровезикулы, несущей тканевой фактор.

Предпосылки изобретения

Гемостаз является механизмом, посредством которого живые существа отвечают на геморрагию и вовлекают в участие два процесса, которые включаются сразу после повреждения и остаются активными в течение длительного периода времени. Первый из них известен как первичный гемостаз и отличается возникновением вазоконстрикции в месте повреждения сосудов и образованием агрегатов тромбоцитов. Второй известен как вторичный гемостаз, представляющий собой фазу, в которой под действием различных протеолитических ферментов каскада коагуляции образуется фибриновый сгусток.

Некоторые кофакторы и протеолитические ферменты участвуют во второй фазе процесса свертывания крови, все обозначаются как факторы свертывания, и она состоит из нескольких фаз, заканчивающихся образованием фибрина посредством гидролиза фибриногена под действием тромбина. Тромбин предварительно образуется посредством протеолитического гидролиза апофермента, протромбина. Такой протеолиз осуществляется активированным фактором свертывания X (FXa), который связывается с поверхностью активированных тромбоцитов и только в присутствии этого фактора активированный фактор свертывания V (FVa) и ионы кальция способны гидролизовать протромбин. Активация фактора свертывания X (FX) может произойти двумя различными путями, внутренним путем и внешним путем.

Внутренний путь состоит из серии реакций, в которых каждый профермент гидролизован, переводя его в активную форму протеазы. На каждой стадии недавно образованный протеолитический фермент будет катализировать активацию следующего профермента для последовательного превращения в активную форму.

Во внешнем пути свертывания крови тканевой фактор (ТФ), расположенный на клетках адвентиции в участке повреждения, связывается с циркулирующим фактором свертывания VII/активированным фактором свертывания VII (FVII/FVIIa) с образованием комплекса ТФ::FVIIa и в присутствии кальция, чтобы служить в качестве субстрата, так что происходит активация FX. В настоящее время полагают, что внешний путь является наиболее значимым путем свертывания крови, и общепринятым является то, что в случае геморрагии, вызванной повреждением сосуда, свертывание переключается на внешний путь активации, включающий взаимодействие ТФ со своим лигандом, FVII/FVIIa.

ТФ состоит из белкового компонента (ранее обозначавшийся как апопротеин-III тканевого фактора) и фосфолипида. ТФ специфически связывается с FVII/FVIIa и выполняет важную роль во внешнем пути свертывания крови. Физиологические роли, выполняемые ТФ, хорошо известны; с одной стороны, он представляет собой рецептор, специфичный к FVIIa и, когда образуется комплекс ТФ::FVIIa, он действует в качестве субстрата, так чтобы произошла активация ТФ. Фактически, после повреждения сосуда, ТФ, который в норме изолирован на поверхности клеток адвентиции, снаружи окружающих кровеносные сосуды, вступает в контакт со своим лигандом и взаимодействует с ним, FVII присутствует в крови для образования комплекса ТФ::FVII. Когда такой комплекс образован, происходит самоактивация FVII, превращая его в активную форму (FVIIa).

Гликозилирование представляет собой регулируемый ферментом, сайтспецифичный процесс, посредством которого сахариды добавляются к липидам и белкам. Полагают, что этот процесс вовлечен в стабильность, фолдинг и транспорт; хотя для ТФ не были описаны доказательства его настоящей функции.

Широко принято, что ТФ представляет собой основной элемент, ответственный за быстроту, с которой инициируется коагуляция. Для начала коагуляции абсолютно необходимы активация FX и запуск гидролиза протромбина. Источником FXa, в основном, считается взаимодействие FVIIa с его рецептором, ТФ.

Сообщалось о получении очищенного ТФ из различных тканей, таких как: мозг человека, мозг коровы; плацента человека; мозг овцы; и легкие. Широко принято, что, несмотря на межвидовые различия в структуре белка ТФ, отсутствуют функциональные различия, что было измерено с помощью коагуляционных тестов in vitro.

Широко принято, что для того, чтобы проявить биологическую активность, ТФ должен быть связан с фосфолипидами in vitro. Было показано, что удаление фосфолипидного компонента из ТФ, например, с помощью фосфолипазы, приводит к снижению его биологической активности in vitro. Релипидирование может восстановить активность ТФ in vitro.

Хотя некоторое количество выделенного из различных тканей «очищенного» белка ТФ было доступно, низкая концентрация белка ТФ в крови и тканях и высокая стоимость, как экономическая, так и трудозатратная, очистки белка из тканей делает его дефицитным материалом. Поэтому существует необходимость поиска альтернативного источника белка ТФ, предпочтительно липидированного белка ТФ.

Белок ТФ экспрессировали в различных системах с использованием клонированной кДНК человека. Таким образом, сообщалось о сверхэкспрессии белка ТФ в E. coli (Paborsky et al, Biochemistry 28, 8072 (1989)). Более того, в патенте США № 6261803 раскрыт способ получения функционального рекомбинантного ТФ в прокариотическом организме-хозяине. В E. coli был достигнут высокий выход экспрессируемого полного белка ТФ.

Хотя экспрессия гетерологичного белка в E. coli представляет некоторые преимущества, экспрессия эукариотических белков в указанных бактериях связана с большим количеством проблем, в основном, когда белок должен экспрессироваться в виде гликозилированного эукариотического белка, из-за отсутствия у бактерий их собственных систем гликозилирования.

Поэтому альтернативная стратегия состоит в экспрессии мутантного белка ТФ, у которого отсутствует трансмембранный домен. Этот так называемый «растворимый» ТФ (или «усеченный» ТФ) накапливается в цитоплазме бактериальных клеток и может быть экспрессирован в относительно больших количествах. Однако в этой системе экспрессированный таким образом белок ТФ обычно присутствует в E. coli в квазикристаллическом состоянии в форме так называемых телец включения. В этом случае, тельца включения должны быть растворены с использованием очень больших количеств разобщающих агентов, и белки, которые должны быть мономеризованы, таким образом, затем снова должны пройти фолдинг, с большим трудом и обычно только с низким выходом, в активную, ренатурированную конформацию. Более того, в принципе, растворимый ТФ не пригоден для использования в реагентах для протромбинового времени, так как у него отсутствует домен для взаимодействия с фосфолипидами.

Другой подход к сверхэкспрессии белка ТФ состоит в использовании большого количества известных успешно используемых систем экспрессии, которые кодируют продукты слитых генов (например, с β-галактозидазой, MalE, глутатионтрансферазой, гистидиновой меткой и т.д.). Однако такие системы не пригодны для экспрессии биологически активного ТФ. Хотя могут быть обнаружены продукты экспрессии, и уровень экспрессии также может быть увеличен при использовании указанных систем, полученные таким образом продукты экспрессии иногда связаны с полной потерей функции, которая не может быть восстановлена, даже при использовании скрупулезных методов ренатурирования.

Проблемы сверхэкспрессии белка ТФ в E. coli можно обойти, осуществляя экспрессию указанного белка в эукариотической системе. Таким образом, экспрессия в дрожжевых клетках, в культурах клеток насекомых с использованием вектора на основе бакуловируса или в культивируемых клетках млекопитающих, например, в клетках яичника хомяка, или в человеческих клеточных линиях, в принципе, является пригодной. Однако среди прочих, такие системы страдают от ключевых недостатков; выход рекомбинантного белка значительно ниже, по сравнению с синтезом в рекомбинантной E. coli. Штаммы дрожжей объединяют преимущества приведенных выше отдельных систем хозяев. С одной стороны, они более близко повторяют естественную физиологию эукариотического белка, чем E. coli, и, с другой стороны, они проще в обращении, их легче культивировать, они намного быстрее растут и экономически значительно выгоднее. Тем не менее, также некоторые факторы влияют на экспрессию белков в дрожжах. Указанные факторы включают, но не ограничиваются ими:

выбор генорегуляторной последовательности, такой как промоторы, которая контролирует экспрессию гетерологичного белка; промоторные последовательности, используемые для контроля гетерологичной экспрессии, обычно должны быть «строгими», т.е. они должны осуществлять очень высокую экспрессию белка и быть пригодными для контроля, посредством которого сначала экспрессия может эффективно подавляться, пока не будет достигнута оптимальная биомасса культуры, и затем быстро переключаться на осуществление экспрессии белка; и

эффективная секреция экспрессируемого гетерологичного белка; секреция экспрессируемого белка (внеклеточная экспрессия) обычно является предпочтительной по отношению к внутриклеточной экспрессии, так как последняя сначала влечет за собой разрушение клеток, таким образом, выпуская внутренне содержимое клеток, и затем выделение желаемого белка из неочищенной смеси клеточных материалов и обломков. В свою очередь, еще более эффективная экспрессия белка зависит от некоторых факторов, включая: (i) выбор сигнальных последовательностей-белковых последовательностей, которые обычно представляют собой N-концевые участки природно-секретируемых белков, и которые направляют белок по клеточному секреторному пути, и, (ii) особые компоненты секреторного пути, которые взаимодействуют с сигнальными последовательностями и вызывают секрецию прикрепленного белка.

Stone M.J. et al (Biochem. J. (1995) 310, 605-614) описывают экспрессию поверхностного домена ТФ (усеченный ТФ) в Saccharomyces cerevisiae. Для очистки ТФ, культуры помещают в иммуноаффинную колонку, конъюгированную с антителами и ТФ элюированный белок диализируют. Приведенный способ сделал возможным доступ к миллиграммовым количествам усеченного ТФ.

Brucato CL. et al. (Protein Экспрессия and Purification 26 (2002), 386-393) описывают экспрессию полноразмерного рекомбинантного белка ТФ кролика в Pichia pastoris. Очистка белка ТФ выполняется с помощью иммобилизированной металл-аффинной хроматографии.

До сих пор не известен способ получения больших количеств биологически активного, рекомбинантного ТФ из дрожжей с высоким выходом. Преимущественно, должен быть получен указанный рекомбинантный ТФ с высоким уровнем активности, предпочтительно, с уровнем активности, пригодным для терапевтического применения. Таким образом, целью настоящего изобретения является производство подходящих количеств липидированного белка ТФ с применением рекомбинантных способов. Преимущественно, рекомбинантный белок ТФ должен быть пригоден для терапевтического применения.

Сущность изобретения

В первом аспекте изобретение относится к полученным из дрожжей микровезикулам, несущим тканевой фактор (ТФ), содержащим (i) мембрану дрожжей и (ii) белок тканевого фактора (ТФ) или его вариант, обладающий прокоагулянтной активностью, где часть указанного белка тканевого фактора (ТФ) или его фрагмент, обладающий прокоагулянтной активностью, интегрирован в указанную мембрану.

В дополнительных аспектах изобретение относится к композиции, содержащей полученную из дрожжей микровезикулу, несущую ТФ, к полученной из дрожжей микровезикуле, несущей ТФ, в качестве лекарственного средства, к фармацевтической композиции, содержащей полученную из дрожжей микровезикулу, несущую ТФ, к полученной из дрожжей микровезикуле, несущей ТФ, для лечения геморрагий у субъекта и к полученной из дрожжей микровезикуле, несущей ТФ, для лечения у субъекта заболевания, которое требует стимуляции клеточной миграции и/или ангиогенеза.

В дополнительном аспекте изобретение относится к способу производства полученной из дрожжей микровезикулы, несущей ТФ, обладающий прокоагулянтной активностью, настоящего изобретения, который включает стадии:

a) ферментации культуры рекомбинантных дрожжевых клеток, которые экспрессируют белок ТФ или его вариант, обладающий прокоагулянтной активностью, в условиях, которые позволяют экспрессировать указанный белок ТФ или его фрагмент, обладающий прокоагулянтной активностью;

b) осаждения центрифугированием продукта, образующегося при ферментации со стадии a), для формирования продукта ферментации;

c) гомогенизации указанного продукта ферментации со стадии b) для формирования ферментационного гомогената;

d) разделения указанного ферментационного гомогената со стадии c) для формирования осадка и очищенного дрожжевого экстракта (ОДЭ), содержащего указанную полученную из дрожжей микровезикулу, несущую ТФ, обладающий прокоагулянтной активностью;

e) сбора указанного очищенного дрожжевого экстракта (ОДЭ), содержащего указанную полученную из дрожжей микровезикулу, несущую ТФ, обладающий прокоагулянтной активностью; и, необязательно,

f) при желании, выделения и очистки указанной полученной из дрожжей микровезикулы, несущей ТФ, обладающий прокоагулянтной активностью.

В дополнительном аспекте изобретение относится к способу получения микровезикулы, содержащей представляющий интерес мембранный белок из эукариотической клетки-хозяина, который включает стадии:

a) выращивания культуры указанной эукариотической клетки-хозяина в условиях, которые делают возможной экспрессию указанного представляющего интерес мембранного белка;

b) гомогенизации клеточной фракции из культуры со стадии a);

c) разделения гомогената, полученного на стадии b), для формирования осадка и очищенного клеточного экстракта, содержащего указанные полученные из клетки микровезикулы, содержащие представляющий интерес мембранный белок, и

d) очистки указанных полученных из клеток микровезикул с помощью фракционирования по размеру.

В другом аспекте изобретение относится к модифицированному липидированному белку тканевого фактора (ТФ), выбранному из группы:

(i) усеченного тканевого фактора (ТФ) с частично или полностью отсутствующим доменом, ответственным за связывание с FVIIa, обладающего прокоагулянтной активностью,

(ii) мутантного белка ТФ, обладающего прокоагулянтной активностью, в котором домен, ответственный за связывание с FVIIa, не функционирует, и

(iii) мутантного белка ТФ, обладающего прокоагулянтной активностью, который несет по меньшей мере нефункциональный сайт N-гликозилирования.

В дополнительных аспектах изобретение относится к модифицированному липидированному белку ТФ настоящего изобретения для применения в качестве лекарственного средства, к фармацевтической композиции, содержащей модифицированный липидированный белок ТФ и фармацевтически приемлемый носитель, к модифицированному липидированному белку ТФ для лечения геморрагий у субъекта и для лечения заболевания, которое требует стимуляции клеточной миграции и/или ангиогенеза у субъекта.

В дополнительном аспекте изобретение относится к полинуклеотидной последовательности, которая кодирует усеченный тканевой фактор (ТФ), с частично или полностью отсутствующим доменом, отвечающим за связывание с FVIIa, обладающий прокоагулянтной активностью, мутантный белок ТФ, обладающий прокоагулянтной активностью, в котором домен, отвечающий за связывание с FVIIa, не функционален, и мутантный белок ТФ, обладающий прокоагулянтной активностью, который несет по меньшей мере нефункциональный сайт N-гликозилирования.

Изобретение также относится к вектору, который содержит полинуклеотидную последовательность настоящего изобретения, к клетке-хозяину, которая содержит полинуклеотид настоящего изобретения или вектор настоящего изобретения, и к антителу, которое специфически связывается с модифицированным белком ТФ настоящего изобретения.

Краткое описание фигур

На фиг.1 показана стратегия клонирования для образования pTT10301. Фиг.1A показывает карту плазмиды pTT10301. Фрагмент ДНК в 1050 п.о., содержащий GPD промоторы (pGPD), уникальный сайт BamHI и терминатор PGK (PGKt), вырезали из плазмиды pG1 после обработки ДНК-рестриктазами HindIII и XbaI. Фрагмент ДНК выделяли с помощью электрофореза в агарозном геле, очищали с помощью набора для выделения ДНК (Qiagen) и клонировали в плазмиду Yep352, предварительно обработанную HindIII и XbaI. Полученную плазмиду pTT10301 выращивали в E. coli и очищали с помощью коммерческого набора для очистки ДНК JETstar (Genomed Gmbh). Фиг.1B показывает рестрикционный анализ полученной плазмиды pTT10301.

На фиг.2 показан график гидрофобности/гидрофильности белка ТФ человека. Представлены четыре домена белка (лидерная последовательность, внеклеточный, трансмембранный и цитоплазматический домены).

На фиг.3 показана последовательность кДНК белка ТФ человека (GenBank №BC011029). Внутри прямоугольника находится открытая рамка считывания (ОРС), а также инициирующий (ATG) и терминирующий (TAA) кодоны. Последовательность кДНК включает четыре домена (сигнальный пептид, внеклеточный домен, трансмембранную область и цитоплазматический хвост) белка ТФ человека (чТФ). Стрелки показывают место отжига праймеров A (SEQ ID NO:2) [прямой праймер, кодирующий первые четыре аминокислоты зрелого чТФ с отсутствующим сигнальным пептидом и содержащим инициирующий кодон ATG в рамке с ТФ ОРС] и B (SEQ ID NO:2) [обратный праймер, с концевым кодоном, выделенным полужирным], оба содержат сайт рестрикции BamHI (подчеркнут). На фиг.4 показано схематическое изображение стратегии клонирования для создания плазмиды pTT10302 (фиг.4A). Фрагмент ДНК, полученный реакцией ПЦР, расщепляли с помощью BamHI и клонировали в плазмиду pTT10301, предварительно расщепленную с помощью BamHI, и дефосфорилировали. Полученную плазмиду (pTT10302) выращивали в E. coli и очищали с помощью коммерческого набора для очистки ДНК JETstar (Genomed Gmbh). Фиг.4B показывает рестрикционный анализ полученной плазмиды pTT10302.

На фиг.5 показана экспрессия рТФ в различных рекомбинантных клонах дрожжей. Вестерн-блоттинг анализ экстрактов из дрожжей, трансформированных пустой плазмидой pTT10301 (C-) и с экспрессирующим вектором, содержащим зрелый рекомбинантный белок чТФ, pTT10302 (дорожки 1-8), осуществляли с использованием очищенного мышиного моноклонального антитела против CD142 человека (BID Biosciences Pharmingen). Маркеры молекулярной массы в кДа показаны в левой части фигуры.

На фиг.6 показаны результаты Вестерн-блоттинга после обработки экстрактов yTT10301 эндогликозилазой. Таким образом, экстракты дрожжей, экспрессирующих рТФ (yTT10301), обрабатывали 500-ми единицами эндогликозилазы H (Endo H)(дорожка 2) или N-гликозидазы F (PNGase F) (дорожка 3) в течение одного часа при 37°C, следуя инструкциям производителя. Эти образцы и необработанный экстракт (дорожка 1) анализировали с помощью Вестерн-блоттинга с моноклональными антителами против ТФ человека. Маркеры молекулярной массы в кДа показаны в левой части фигуры.

Фиг.7 представляет собой фотографии лазерного конфокального микроскопа, показывающие экспрессию рТФ в рекомбинантных дрожжах yTT10301. Сферопласты из рекомбинантных дрожжей, экспрессирующих рТФ, фиксировали с помощью 4% параформальдегида и инкубировали с mAb против АТФазы дрожжей (фиг.7A) или с mAb против человеческого ТФ (фиг.7B). После инкубации со флуоресцин-конъюгированными вторичными козьими антителами против мыши, клетки изучали с помощью конфокального микроскопа (1, 3, 5 и 7) или с помощью фазового контраста (2, 4, 6 и 8). Изображения получены в конфокальном лазерном микроскопе BIO-RAD Radiance 2000.

Фиг.8 представляет собой фотографии конфокального лазерного микроскопа, показывающие экспрессию рТФ рекомбинантными дрожжами в зависимости от присутствия плазмиды pTT10302. Сферопласты из рекомбинантных дрожжей (yTT10300), содержащих пустую экспрессионную плазмиду pTT10301, фиксировали 4% параформальдегидом и инкубировали с mAb против АТФазы дрожжей (фиг.8A) или с mAb против ТФ человека (фиг.8B). После инкубации с флуоресцин-конъюгированными вторичными козьими антителами против мыши, клетки изучали с помощью конфокального микроскопа (1 и 3) или с помощью фазового контраста (2 и 4). Изображения были получены в конфокальном лазерном микроскопе BIO-RAD Radiance 2000.

На фиг.9 показано, что рТФ связан с мембранами дрожжей. Экстракт из yTT10301 обрабатывали Triton X114 и после центрифугирования водную фазу и осадок детергента отбирали по отдельности. Водную фазу снова обрабатывали Triton X114 (конечная концентрация 1%) и две фазы разделяли, как указано выше. Второй осадок детергента смешивали с первым. Цельный экстракт (дорожка 1), первую (дорожка 2), вторую (дорожка 3) водные фазы и фазу детергента (дорожка 4) анализировали с помощью SDS электрофореза в полиакриламидном геле и окраски по Кумаси (фиг.9A) или с помощью Вестерн-блоттинга реакцией с mAb против ТФ человека (фиг.9B).

Фиг.10 представляет собой график, показывающий развитие основных параметров на всем протяжении процесса ферментации. Изменение давления кислорода (PO2), которое является единственным неконтролируемым параметром, отражает изменения в потребности в кислороде, испытываемой клетками в ходе процесса. Ферментацию останавливали, когда PO2 достигало стационарного состояния (18 часов).

Фиг.11 представляет собой диаграмму, представляющую общую схему процесса ферментации для продуцирования ОДЭ-ТФ.

На фиг.12 показаны результаты Вестерн-блоттинга для определения присутствия ТФ в препаратах, полученных из первого ферментационного теста. Каждая дорожка соответствует 5 мкл или супернатанта (сн), или осадка (ос), полученных с помощью методики, описанной на фиг.11. Образцы белка анализировали с помощью Вестерн-блоттинга с использованием специфических mAb против ТФ человека. Положительный контроль (рТФ) представляет собой коммерческий ТФ (10 нг), синтезированный в E. coli (American Diagnostica, Inc.). Маркеры молекулярной массы в кДа показаны в левой части фигуры.

На фиг.13 показаны фотографии электронной микроскопии образцов ОДЭ-ТФ. Продукт ОДЭ-ТФ адсорбировали на покрытые углеродом медные сетки, предварительно обработанные тлеющим зарядом. Сетку инкубировали с PBS, содержащим 3% бычий сывороточный альбумин (БСА) в течение 1 часа перед инкубацией со специфическими mAb против чТФ или с неродственным антителом. Сетки тщательно промывали PBS и инкубировали с конъюгированными с золотом антителами кролика против IgG мыши. Сетки промывали и образцы негативно окрашивали, обрабатывая 1% уранилацетатом. Изображения получены в электронном микроскопе JEOL 1200 EXII. Стрелки указывают на положение частиц коллоидного серебра.

На фиг.14 показана схема метода очистки ОДЭ-ТФ с помощью тангенциального поточного фильтрования. A) ОДЭ-ТФ подвергали тангенциальному поточному фильтрованию (ТПФ) в системе тангенциальной фильтрации (Sartorius sartoflow Slice 200 Benchtop). ОДЭ-ТФ последовательно фильтровали через 0,45 мкм, 0,2 мкм и 0,1 мкм мембраны (Sartorius, полисульфон). Предварительно мембраны уравновешивали фосфатным буфером (20 мМ фосфат натрия pH 7,4, 500 мМ NaCl). Материал, оставшийся после фильтрования через 0,2 мкм и перед 0,10 мкм мембранами, собирали и использовали в качестве исходного материала для стадий последующей очистки. B) Для определения распределения размеров микровезикул использовали динамическое светорассеяние.

На фиг.15 показан профиль эксклюзионной хроматографии продукта ОДЭ-ТФ, выполненной на колонке Sephacryl S-500. Элюирование выполняли при 4°C с Фосфатным буфером и собирали фракции по 4 мл при скорости потока 1 мл/мин. Элюирование белка контролировали посредством измерения оптической плотности при 280 нм.

На фиг.16 показан Вестерн-блоттинг для определения рТФ. 15 мкл каждой фракции подвергали электрофорезу в 12,5% SDS-полиакриаламидном геле с трис-глицином. После электрофореза белки переносили на мембраны из нитроцеллюлозы. Затем мембраны инкубировали с коммерческими мышиными моноклональными антителами против ТФ (American Diagnostica) в течение 1 часа. Затем мембраны инкубировали с антителами кролика против IgG мыши, с последующей инкубацией с конъюгированными с пероксидазой хрена козьими антителами против IgG кролика. Иммунореактивные белки определяли с помощью хемилюминесценции с использованием ECL Advanced Western blotting kits (GE Healthcare).

На фиг.17 показан белковый профиль различных партий микровезикул, содержащих рТФ, очищенный с помощью эксклюзионной хроматографии. A) Белки из четырех различных партий очищенных микровезикул, содержащих рТФ (как указано в верхней части фигуры), фракционировали с помощью SDS электрофореза в полиакриламидном геле и гель окрашивали кумаси синим. Molecunlra маркеры массы показаны в левой части фигуры. B) Денситометрический анализ различных белковых полос в каждой партии выполняли после сканирования окрашенного геля.

На фиг.18 показан анализ тонкослойной хроматографии (ТСХ). PA: фосфатидная кислота (Sigma), PS: фосфатидилсерин (Fluka), PG: Фосфатидилглицерин (Sigma), CAR: кардиолипин (Sigma), ERG: эргостерол (Fluka), PE: фосфатидилэтаноламин (Sigma), PI: фосфатидилинозитол (Sigma), PC: фосфатидилхолин (Sigma), TAG: триацилглицериды (Sigma).

На фиг.19 показана последовательность кДНК белка ТФ человека (GenBank №BC011029). Обозначена открытая рамка считывания (ОРС), а также стартовый (ATG) и концевой (TAA) кодоны. Последовательность кДНК включает четыре домена (сигнальный пептид, внеклеточный домен, трансмембранную область и цитоплазматический хвост) белка ТФ человека (чТФ). Стрелки указывают место отжига праймеров A (SEQ ID NO:1) [прямой праймер, кодирующий первые четыре аминокислоты зрелого чТФ с отсутствующим сигнальным пептидом и содержащий инициирующий кодон ATG в рамке с ТФ ОРС] и E (SEQ ID NO:3) [обратный праймер; нуклеотиды, кодирующие гистидин, обозначены полужирным], оба содержат сайты рестрикции BamHI (подчеркнуты).

На фиг.20 показана стратегия клонирования для получения pTT10303. фиг.20A показывает, что фрагмент ДНК, полученный реакцией ПЦР, расщепляли с помощью BamHI и клонировали в плазмиду pTT10301, предварительно расщепленную с помощью BamHI, и дефосфорилировали. Полученную плазмиду pTT10303 выращивали в E. coli и очищали с помощью коммерческого набора для очистки ДНК JETstar (Genomed Gmbh). Фиг.20B показывает рестрикционный анализ полученной pTT10303.

На фиг.21 показаны результаты Вестерн-блоттинга экспрессии рТФ-гистидиновая метка. Вестерн-блоттинг экстрактов из культур рекомбинантных дрожжей yTT10302 (дорожки 1-4, соответствующие клонам 2-5) и рТФ, синтезированного в E. coli (C+). Блот подвергали взаимодействию с очищенными моноклональными антителами мыши против CD142 человека (BD Biosciences Pharmingen). Маркеры молекулярной массы в кДа показаны в левой части фигуры.

На фиг.22 также показаны результаты экспрессии рТФ-His-метка. Фиг.22A показывает SDS электрофорез в полиакриламидном геле и окрашивание кумаси синим экстрактов из дрожжей yTT10300 (дорожка 1), yTT10301, экспрессирующих рТФ (дорожка 2) или yTT10302 (клон №5), экспрессирующих рТФ-His-метка (дорожка 3). Положительный контроль, соответствующий 5 нг рТФ, синтезированного в E. coli (дорожка 4). Фиг.22B представляет собой Вестерн-блоттинг образцов, аналогично показанным на фиг.17A, с использованием моноклональных антител мыши против CD142 человека (BD Biosciences Pharmingen). Маркеры молекулярной массы в кДа показаны в левой части фигуры.

Фиг.23 схематически изображает способ очистки 6HT-ТФ.

На фиг.24 показаны результаты очисти 6HT-ТФ с помощью аффинной хроматографии. ОДЭ-6HT-ТФ использовали в качестве стартового материала. Экстракт фильтровали через фильтр с размером пор 0,2 мкм с помощью тангенциального фильтрования и использовали в 5 мл коммерческой колонке для металл-хелатирующей аффинной хроматографии (HiTrap®, Pharmacia Biotech). Колонку подвергали трем последующим промываниям стартовым буфером (20 мМ фосфатный буфер, 500 мМ NaCl, pH 7,4) без имидазола, с 10 мМ имидазолом и с 100 мМ имидазола, соответственно. 6HT-ТФ элюировали аналогичным буфером, содержащим 1M имидазол. Элюированные фракции по 2,5 мл (дорожки 4-7, соответствующие фракциям №1, №2, №3 и №4, соответственно) собирали и диализовали с 20 мМ фосфатным буфером, 50 мМ NaCl, pH 7,4. Стартовый отфильтрованный дрожжевой экстракт (дорожка 1), несвязанный материал (дорожка 2), последнее промывание стартовым буфером, содержащим 100 мМ, и первые четыре элюированные фракции анализировали с помощью SDS электрофореза в полиакриламидном геле и Вестерн-блоттинга (фиг.24A) или окрашивания серебром (фиг.24B). Маркеры молекулярной массы в кДа указаны в левой части фигуры.

На фиг.25 показаны результаты Вестерн-блоттинга очищенного 6HT-ТФ после обработки эндогликозилазой. Очищенную фракцию 6HT-ТФ обрабатывали 500-ми единицами PNGase F (дорожка 2) или Endo H (дорожка 3), следуя инструкциям производителя. Эти образцы и необработанный элюат (дорожка 1) анализировали с помощью Вестерн-блоттинга с mAb против ТФ человека. Маркеры молекулярной массы в кДа показаны в левой части фигуры.

На фиг.26 показаны результаты иммунной электронной микроскопии 6HT-ТФ, очищенного с помощью аффинной хроматографии. Первую элюированную фракцию адсорбировали на медных сетках, покрытых коллоидом. Для иммунного мечения коллоидным золотом сетку обрабатывали моноклональными антителами против ТФ.

Фиг.27 является схематическим изображением полученной из дрожжей микровезикулы, несущей ТФ настоящего изобретения. Фиг.22A показывает схематическое изображение полученной из дрожжей микровезикулы, несущей ТФ, настоящего изобретения, содержащей полученную из дрожжей мембрану (1) и белок ТФ (2) (или его фрагмент, обладающий прокоагулянтной активностью), интегрированный в указанную полученную из дрожжей мембрану (1). Изображены внутреннее пространство микровезикулы (3) и внешнее пространство микровезикулы (4). Фиг.22B и 22C показывают основное устройство полученной из дрожжей микровезикулы, несущей ТФ, настоящего изобретения. Липиды полученного из дрожжей мембранного липидного бислоя являются амфипатическими; они имеют полярные гидрофильные головки (5), направленные во внешнее пространство везикулы (4), и два гидрофобных углеводородных хвоста (6), направленных во внутреннее пространство везикулы (3). В варианте осуществления, показанном на фиг.22B, N-концевой домен белка ТФ (2) или его фрагмент, обладающий прокоагулянтной активностью, обращен во внешнее пространство везикулы (4). В варианте осуществления, показанном на фиг.22C, N-концевой домен белка ТФ (2) или его фрагмент, обладающий прокоагулянтной активностью, обращен во внутренне пространство везикулы (3).

На фиг.28 показана последовательность кДНК белка ТФ человека (GenBank №BC011029). Прямоугольником обозначена открытая рамка считывания (ОРС), а также стартовый (ATG) и концевой (TAA) кодоны. Последовательность кДНК включает четыре домена (сигнальный пептид, внеклеточный домен, трансмембранную область и цитоплазматический хвост) белка ТФ человека (чТФ). Стрелки указывают место отжига праймеров F (SEQ ID NO:4) [прямой праймер, кодирующий первые четыре аминокислоты зрелого чТФ с отсутствующим сигнальным пептидом и содержащий инициирующий кодон ATG в рамке с ТФ ОРС] и E (SEQ ID NO:3) [обратный праймер; нуклеотиды, кодирующие гистидин, выделены полужирным], оба содержат сайт рестрикции BamHI (подчеркнут).

Фиг.29. Стратегия клонирования для получения pTT10304. A) Фрагмент ДНК, полученный реакцией ПЦР, расщепляли с помощью BamHI и клонировали в плазмиду pTT10301, предварительно расщепленную с помощью BamHI, и дефосфорилировали. Полученную плазмиду pTT10304 выращивали в in E. coli и очищали с помощью коммерческого набора для очистки ДНК JETstar (Genomed Gmbh). B) Рестрикционный анализ полученного вектора pTT10304.

На фиг.30 показано схематическое изображение положения точечных мутаций в сайтах гликозилирования в ТФ человека.

На фиг.31 показан Вестерн-блоттинг с зондами из антител против ТФ1. ТМ1 относится к замене Ala-Asn в положении 11, ТМ2 относится к замене Ala-Asn в положении 124 и ТМ3 относится к замене Ala-Asn в положении 137. ТМ1,2; 1,3 и 1,2,3 относится к их комбинациям. TT103MH представляет собой ТФ дикого типа.

Фиг.32. Кривые доза-ответ прокоагулянтной активности TT-103 релипидированного рТФ. Прокоагулянтную активность измеряли в коагулометре с использованием объединенной нормальной плазмы человека и различных концентраций или TT-103 из различных пулов или релипидированного рТФ.

На фиг.33 показаны прокоагулянтные активности in vitro необработанного TT-103 (1), TT-103, подвергнутого обработке Triton X-100 (2), TT-103, подвергнутого обработке Triton X-100 после диализа, делающего возможным релипидирование рТФ (3), пустые липосомы (4) и микровезикулы из рекомбинантных дрожжей, не экспрессирующих рТФ (5). Количество рТФ, которое определяли с помощью ELISA, было одинаковым (120 нг/мл) в образцах 1, 2 и 3.

На фиг.34 показана прокоагулянтная активность TT-103 в гепаринизированной плазме (TT-103) по сравнению с релипидированным рТФ, тромбином и тромборелом С.

Подробное описание изобретения

Полученные из дрожжей несущие ТФ микровезикулы настоящего изобретения

В аспекте изобретение относится к полученным из дрожжей микровезикулам, несущим тканевой фактор, в дальнейшем обозначаемый как «полученная из дрожжей микровезикула, несущая ТФ, настоящего изобретения», содержащим (i) мембрану дрожжей и (ii) белок тканевого фактора (ТФ) или его вариант, обладающий прокоагулянтной активностью, где часть указанного белка тканевого фактора (ТФ) или его варианта, обладающего прокоагулянтной активностью, интегрирована в указанный липидный бислой. Полученная из дрожжей микровезикула, несущая ТФ, настоящего изобретения обладает прокоагулянтной активностью и, таким образом, ее можно применять в качестве лекарственного средства для лечения геморрагий у субъекта.

Как использовано в данном описании, термин «полученная из дрожжей микровезикула» относится к малому и замкнутому компартменту, который, главным образом, состоит из мембран или их фрагментов, дрожжевых клеток. В основном, мембрана относится к организованному слою из нескольких молекул, образующих плотную границу клетки (т.е. клеточную или плазматическую мембрану) или границы внутриклеточных органелл.

Компонент (i) полученной из дрожжей микровезикулы, несущей ТФ, настоящего изобретения представляет собой мембрану дрожжей, которая происходит из дрожжевых клеток, использованных в производстве полученной из дрожжей микровезикулы, несущей ТФ, настоящего изобретения. Обычно, мембрана состоит из двух ориентированных слоев липидов (т.е. липидного бислоя), в который могут встраиваться белки. Липидный бислой, который является основной структурой клеточных мембран, обычно образован амфипатическими молекулами (например, фосфолипидами, жирными кислотами и т.д.) в водной среде, каждая молекула ориентирована гидрофильной группой вовне слоя и гидрофобной группой внутрь слоя. Обычно, белки встраиваются в липидный бислой; таким образом, полученная из дрожжей микровезикула, несущая ТФ, настоящего изобретения содержит белки из мембран клеток дрожжей, которые обычно встроены в указанные мембраны дрожжевых клеток.

В конкретном варианте осуществления указанная полученная из дрожжей микровезикула является производной мембран дрожжевых клеток или их фрагментов, таких как, например, плазматические мембраны дрожжевых клеток или их фрагменты. В другом конкретном варианте осуществления указанная полученная из дрожжей микровезикула происходит из внутриклеточных мембран органелл дрожжевых клеток или их фрагментов, таких как ядро, аппарат Гольджи, эндоплазматический ретикулум и т.д.

Указанные полученные из дрожжей микровезикулы, в основном, будут продуцированы из дрожжевых клеток, использованных в их производстве (например, после обработки дрожжевого продукта ферментации гомогенизацией, как показано в способе, раскрытом в примере 1). Практически, можно использовать любые дрожжевые клетки для продуцирования указанных микровезикул, полученных из дрожжей, преимущественно из нефлоккулентных дрожжевых клеток, и, предпочтительно, дрожжевых клеток, классифицированных как «в целом считающиеся безопасными» (или GRAS) Федеральным управлением по лекарственным средствам (FDA) для потребления человеком, так как указанные GRAS-подтвержденные субстанции не требуют перед выходом на рынок одобрения FDA, так как они по большей части безопасны для животных, включая человека. Иллюстративные, неограничивающие примеры дрожжевых клеток, которые можно использовать в способе производства полученной из дрожжей микровезикулы, несущей ТФ, настоящего изобретения представляют собой так называемые спиртовые виды дрожжей, которые образуют спирт, углекислый газ, хлебопекарные дрожжи и т.п. с помощью метаболизма жидкого материала брожения. В частности, предпочтительные дрожжевые клетки включают дрожжевые клетки видов Saccharomyces и т.д., например, штамм T73 ura3- S. cerevisiae, производные штамма T73 S. cerevisiae, штамм широко используемый в производстве вина (пример 1) или виды Pichia.

Компонент (ii) полученной из дрожжей микровезикулы, несущей ТФ, настоящего изобретения представляет собой белок тканевого фактора (ТФ) или его вариант, обладающий прокоагулянтной активностью.

Как использовано в данном описании, «вариант ТФ» относится к любому полипептиду, полученному из ТФ заменой, инсерцией или добавлением одной или нескольких аминокислот.

В конкретном варианте осуществления указанный компонент (ii) полученной из дрожжей микровезикулы, несущей ТФ, настоящего изобретения представляет собой белок ТФ.

Термин «тканевой фактор» или «ТФ», как использовано в данном описании, включает природные или дикого типа (дт) ТФ любых видов животных, включая человека, а также их мутанты, поддерживающие по меньшей мере одну из функций указанных дт ТФ, преимущественно, функцию дт ТФ, касающуюся коагуляции.

Белок ТФ является интегральным мембранным гликопротеином, который широко распространен в животном мире, который, как он был обнаружен в природе, состоит из белково-подобного компонента (белка) и фосфолипида. Некоторые сайты гликозилирования присутствуют в белке ТФ для добавления олигосахаридных боковых цепей к указанному белку для формирования белка ТФ в гликозилированной форме. В зависимости от степени гликозилирования, могут быть доступны различные гликозилированные формы белка ТФ. В этом смысле, зрелый ТФ содержит три потенциальных сайта N-гликозилирования вида Asn-Xaa-Ser/Thr (Asn11-Leu12-Thr13, Asn124-Val125-Thr126 и Asn137-Asn138-Thr139). N-гликозилирование у дрожжей обычно вовлекает внутреннее ядро примерно из десяти остатков маннозы, связанных с аспарагином через два GlcNAc остатка, и разветвленной внешней цепи из 50-100 остатков маннозы. Поэтому N-гликозилирование потенциально может добавлять вплоть до 300 остатков маннозы к ТФ, увеличивая молекулярную массу примерно на 60 кДа. Кроме того, также возможно, что некоторые остатки маннозы могут быть присоединены к различным (более чем 25) сайтам O-гликозилирования. В конкретном варианте осуществления полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения содержат гликозилированный белок ТФ. Как использовано в данном описании, термин «гликозилированный» включает любую степень гликозилирования.

Схематическое изображение полученной из дрожжей микровезикулы, несущей ТФ, настоящего изобретения представлено на фиг.27.

Белок ТФ имеет доменную структуру, т.е. он представляет собой белок с независимыми функциональными участками. В конкретном варианте осуществления указанный белок ТФ представляет собой белок ТФ человека (чТФ). Каждый из доменов белка чТФ имеет уникальные функциональные и структурные характеристики: (1) сигнальный пептид или участок с лидерной последовательностью из 32 аминокислот, который подвергается посттрансляционному процессингу, когда белок превращается из незрелой формы в зрелую форму; (2) N-гликозилированный гидрофильный внеклеточный домен, содержащий примерно 219 концевых аминокислот; (3) фрагмент примерно из 23 аминокислот, в основном гидрофобных, о которых полагают, что они являются аминокислотами трансмембранного домена; и (4) карбоксильный конец из 21 аминокислоты, о которых полагают, что данные аминокислоты образуют часть цитоплазматического фрагмента белка. Доменная структура белка чТФ делает возможным синтез, например, внеклеточного домена белка или его функциональных фрагментов. Аминокислотная последовательность белка чТФ известна и может быть выяснена в базах данных о белках, таких как, например, NCBI (чТФ, номер доступа: P13726).

Кроме того, белок ТФ может быть частью слитого белка, причем указанный слитый белок содержит первый участок, включающий белок ТФ, связанный со вторым участком, содержащим другой пептид или белок. Указанный второй участок может быть связан с амино-концевым участком указанного белка ТФ или, альтернативно, указанный второй участок может быть связан с карбокси-концевым участком указанного белка ТФ. Как первый, так и второй участки могут быть напрямую связаны друг с другом или могут быть связаны через линкерный полипептид между указанными первым и вторым участками.

В конкретном варианте осуществления указанный слитый белок содержит белок ТФ и метку, обычно пептидную метку, связанную с C-концевым или N-концевым доменом указанного белка ТФ. Указанная метка, как правило, представляет собой пептид или аминокислотную последовательность, которую можно использовать при выделении или очистке указанного слитого белка. Таким образом, указанная метка способна связываться с одним или несколькими лигандами, такими как, например, один или несколько лигандов матрицы аффинности, такой как хроматографическая подложка или гранула с высокой аффинностью. Примером указанной метки является гистидиновая метка (His-метка или HT), например, метка, содержащая 6 остатков гистидина (His6 или H6), которые могут связываться с колонкой никеля (Ni2+) или кобальта (Co2+) с высокой аффинностью. His-метка, как показано в примерах 2 и 3, обладает приятной особенностью, состоящей в том, что она может связывать свои лиганды в условиях, в которых денатурируется большинство белков и разрушается большинство белок-белковых взаимодействий. Таким образом, ее можно использовать для удаления белка-затравки, меченного H6 с последующим разрушением белок-белковых взаимодействий, в которых участвовала приманка.

Дополнительные иллюстративные, неограничивающие примеры меток, пригодных для выделения или очистки слитого белка включают Arg-метку, FLAG-метку, Strep-метку, эпитоп, который может быть распознан антителом, например, c-myc-метка (распознается антителами против c-myc), SBP-метка, S-метка, кальмодулин-связывающий белок, целлюлозу-связывающий домен, хитин-связывающий домен, глутатион S-трансферазная метка, мальтозу-связывающий белок, NusA, TrxA, DsbA, Avi-метка и т.д. (Terpe K., Appl. Microbiol. Biotechnol. (2003), 60:523-525), аминокислотную последовательность, например, Ala-His-Gly-His-Arg-Pro; Pro-Ile-His-Asp-His-Asp-His-Pro-His-Leu-Val-Ile-His-Ser; Gly-Met-Thr-Ces-X-X-Cys; β-галактозидазу и т.д.

В конкретном варианте осуществления указанная метка представляет собой His-метку, связанную с C-концевым доменом указанного белка ТФ. В другом варианте осуществления указанная метка представляет собой His-метку, связанную с N-концевым доменом указанного белка ТФ.

Указанный слитый белок также обладает прокоагулянтной активностью. Прокоагулянтная активность указанного слитого белка может быть оценена, как отмечалось выше, например, с помощью любого коагуляционного теста, приведенного в примере 4, например, с помощью коагуляционного теста в плазме in vitro или с помощью коагуляционного теста в цельной крови без добавлений антикоагулянтов in vitro, или с помощью in vivo исследования на животных моделях с тяжелой геморрагией, или с помощью in vivo исследования на животных моделях с летальной геморрагией, таких как тесты, приведенные в примере 4.

Указанный слитый белок может быть получен общепринятыми средствами, например, средствами генной экспрессии нуклеотидной последовательности, кодирующей указанный слитый белок в подходящей дрожжевой клетке. Для выделения или очистки указанного слитого белка, при желании, можно использовать подходящую к случаю метку.

В другом конкретном варианте осуществления указанный компонент (ii) полученной из дрожжей микровезикулы, несущей ТФ, настоящего изобретения представляет собой фрагмент ТФ, обладающий прокоагулянтной активностью.

Как использовано в данном описании, термин «фрагмент белка ТФ, обладающий прокоагулянтной активностью» включает любой пептид из ТФ, который при липидировании обладает прокоагулянтной активностью. Прокоагулянтная активность фрагмента ТФ может быть легко оценена с помощью любого традиционного теста, например, с помощью любого из коагуляционных тестов, приведенных в примере 4. Только с целью иллюстрирования, прокоагулянтная активность фрагмента ТФ может быть определена с помощью коагуляционного теста в плазме in vitro или с помощью коагуляционного теста в цельной крови без добавления антикоагулянтов in vitro или с помощью in vivo исследования на животных моделях с тяжелой геморрагией, или с помощью in vivo исследования на моделях животных с летальной геморрагией, таких как тесты, приведенные в примере 4.

Аминокислотная последовательность указанного фрагмента белка ТФ, обладающего прокоагулянтной активностью, может быть идентичной последовательности соответствующего фрагмента нативного белка ТФ или, альтернативно, он может иметь вставки, делеции или модификации одной или нескольких аминокислот по отношению к нативному белку ТФ, при условии, что полученный фрагмент белка ТФ обладает прокоагулянтной активностью.

В конкретном варианте осуществления фрагмент ТФ, обладающий прокоагулянтной активностью, содержит зрелый белок ТФ. Термин «зрелый ТФ», как использовано в данном описании, относится к белку ТФ, в аминокислотной последовательности которого отсутствует сигнальный пептид. В предпочтительном варианте осуществления указанный зрелый белок ТФ содержит зрелый белок ТФ человека. Более того, в конкретном варианте осуществления указанный зрелый белок ТФ человека имеет аминокислотную последовательность, показанную в SEQ ID NO:1.

В другом конкретном варианте осуществления фрагмент белка ТФ, обладающего прокоагулятной активностью, представляет собой белок ТФ, где отсутствуют все или часть доменов, ответственных за связывание с FVIIa, и, таким образом, полученный белок не способен связываться с FVIIa. В данном описании указанный фрагмент белка ТФ, обладающий прокоагулянтной активностью, но с отсутствующим доменом, отвечающим за связывание с FVIIa, иногда обозначается как «усеченный белок ТФ» или «усеченная форма ТФ». Путем удлинения указанный «усеченный белок ТФ» может включать мутантные белки ТФ, обладающие прокоагулянтной активностью, в которых домен, отвечающий за связывание с FVIIa, не является функциональным.

В конкретном варианте осуществления указанный усеченный белок ТФ содержит домен, взаимодействующий с фактором X, трансмембранную область и цитоплазматический хвост при отсутствии, частичном или полном, домена, отвечающего за связывание с FVIIa. Более того, в конкретном варианте осуществления указанный усеченный белок ТФ представляет собой усеченную форму белка ТФ человека, содержащего домен, взаимодействующий с фактором X (а.к. 174-251), трансмембранную область (а.к. 252-274) и цитоплазматический хвост (а.к. 275-295) и дополнительную His-метку (пример 3). Авторы настоящего изобретения с удивлением обнаружили, что указанная усеченная форма белка ТФ, с отсутствующим доменом, отвечающим за связывание с FVIIa, обладает прокоагулянтной активностью (пример 4, таблица 3).

Авторы настоящего изобретения с удивлением обнаружили, что указанный фрагмент ТФ, с частично или полностью отсутствующим доменом, отвечающим за связывание с FVIIa, обладает прокоагулянтной активностью. Этот результат был удивительным, так как хорошо известно, что ТФ участвует во внешнем пути свертывания крови, будучи экспонированным на клетках адвентиции в участке поражения и связываясь с циркулирующим фактором свертывания VII/активированным фактором свертывания VII (FVII/FVIIa) с образованием комплекса ТФ::FVIIa, который в присутствии кальция действует в качестве субстрата с тем, чтобы произошла активация FX. Принято считать, что в случае геморрагии, вызванной повреждением сосуда, коагуляция запускается благодаря внешнему пути активации, включающему взаимодействие ТФ со своим лигандом, FVII/FVIIa.

В другом варианте осуществления модифицированный ТФ содержит одну или несколько мутаций в домене, отвечающем за связывание с FVIIa, которые приводят к тому, что модифицированный ТФ не способен связываться с указанным FVIIa или делает это с существенно сниженной аффинностью. Точечные мутации в домене ТФ, связывающем FVIIa, о которых известно, что они отключают связывание указанного FVIIa, известны в данной области (например, описанные Kelley, R.F. et al., 1995, в Biochemistry, 34:10383-10392, содержание которой включено в данное описание посредством ссылки во всей своей полноте).

Авторы настоящего изобретения также обнаружили, что прокоагулянтная активность ТФ, а также его экспрессия в дрожжевых клетках-хозяевах увеличивается, когда указанный ТФ несет мутации в сайтах гликозилирования, которые предотвращают присоединение по меньшей мере одной из трех N-связанных цепей гликозилов, найденных в ТФ дикого типа. Таким образом, в конкретном варианте осуществления полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения содержат негликозилированный фрагмент белка ТФ, обладающий прокоагулянтной активностью. Как указано выше, термин «гликозилированный» включает любую степень гликозилирования. В предпочтительном варианте осуществления вариант ТФ представляет собой полипептид, где по меньшей мере один из сайтов N-гликозилирования ТФ был модифицирован с тем, чтобы сформировать его нефункциональным, т.е. неспособным служить в качестве акцепторного участка для добавления цепей гликозилов. Сайты N-гликозилирования в последовательности ТФ, которая может быть модифицирована, были приведены выше, т.е. сайт Asn11-Leu12-Thr13, сайт Asn124-Val125-Thr126 и/или сайт Asn137-Asn138-Thr139. Любая модификация консенсусных участков N-гликозилирования приемлема до тех пор, пока добавление N-связанной цепи гликозида нарушено или в значительной степени ингибируется. Предпочтительна модификация, введенная в остаток Asn, соответствующий положениям 11, 124 и/или 136 в зрелом ТФ человека, так как он является остатком, служащим акцептором для прикрепления цепи гликозила. Как используется в настоящем изобретении, «сайты, соответствующие сайтам 11, 124 и/или 136 в зрелом ТФ человека» относятся к сайтам N-гликозилирования в других ортологах ТФ, которые могут возникать в других положениях полипептидной цепи, но которые совпадают с сайтами N-гликозилирования в зрелом ТФ человека, когда человеческая и ортологичная последовательности выравнивают на основании сходства последовательностей. Подходящим алгоритмом для выравнивания множественных последовательностей ТФ и, таким образом, для поиска сайтов N-гликозилирования в ортологах ТФ, соответствующих сайтам в зрелом ТФ человека, является программа PILEUP, которая составляет часть пакета программного обеспечения GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wis.). PILEUP создает множественное выравнивание последовательностей из группы родственных последовательностей с использованием постепенных парных выравниваний для выявления взаимосвязи и процента идентичности последовательности. Она также строит дерево или дендрограмму, показывающую кластерные взаимосвязи, используемые для создания выравнивания. PILEUP использует упрощение способа постепенного выравнивания Feng и Doolittle, J.Mol. EvoL, 35: 351-360 (1987). Предпочтительно, остатки Asn в положениях 11, 124 и/или 136 замещаются на Ala. Таким образом, в предпочтительном варианте осуществления вариант ТФ, который образует часть микровезикул, выбирают из группы N11A, N124A, N137A, N11A и N124A, N11A и N137A, N124A и N137A и N11A, N124A и N137A в зрелом ТФ человека. В любом другом ортологе ТФ мутации будут располагаться в соответствующих остатках Asn, которые образуют консенсусные сайты N-гликозилирования.

Кроме того, как в случае белка ТФ, фрагмент белка ТФ, обладающий прокоагулянтной активностью, использованный для осуществления настоящего изобретения, может быть частью слитого белка, причем указанный слитый белок содержит первый участок, содержащий указанный фрагмент белка ТФ, обладающий прокоагулянтной активностью, связан со вторым участком, содержащим другой пептид или белок. Указанный второй участок может быть связан с амино-концом участка указанного фрагмента белка ТФ или, альтернативно, указанный второй участок может быть связан с карбокси-концевым участком указанного фрагмента белка ТФ. Как первый, так и второй участки могут быть связаны напрямую или связаны через линкерный полипептид между указанными первым и вторым участками.

В конкретном варианте осуществления указанный слитый белок содержит фрагмент белка ТФ, обладающий прокоагулянтной активностью, и метку, связанную с C-концевым или N-концевым доменом указанного фрагмента белка ТФ. Указанная метка, как правило, представляет собой пептид или аминокислотную последовательность, которую можно использовать при выделении или очистке указанного слитого белка. Иллюстративные, неограничивающие примеры меток, пригодных для производства данного слитого белка, включают метки, приведенные выше в соединении со слитым белком, где первый участок был белком ТФ. В конкретном варианте осуществления указанная метка представляет собой His-метку, связанную с C-концевым доменом указанного белка ТФ или его фрагмента, обладающего прокоагулянтной активностью. В другом варианте осуществления указанная метка представляет собой His-метку, связанную с N-концевым доменом указанного белка ТФ или его фрагмента, обладающего прокоагулянтной активностью. Такой слитый белок также обладает прокоагулянтной активностью, причем его прокоагулянтная активность может быть оценена, как указано выше, например, с помощью любых коагуляционных тестов, приведенных в примере 4.

Согласно настоящему изобретению, часть указанного белка ТФ или его фрагмента, обладающего прокоагулянтной активностью, интегрирована в указанную мембрану дрожжей. Обычно указанная часть содержит липофильный участок указанного белка или фрагмента (т.е. центральный домен ТФ), тогда как его гидрофильные участки (т.е. амино-концевой участок и карбокси-концевой участок указанного белка ТФ) экспонируются на экзоплазматической или эндоплазматической стороне мембраны. Информацию, касающуюся липофильных и гидрофильных участков белка ТФ, можно получить из фиг.2, на которой показан график гидрофобности/гидрофильности белка ТФ. Пример 1, раздел 1,4 показывает, что указанный белок ТФ или его фрагмент, обладающий прокоагулянтной активностью, интегрирован в мембрану (т.е. является белком, ассоциированным с мембраной).

В конкретном варианте осуществления N-концевой домен белка ТФ или его фрагмента, обладающего прокоагулянтной активностью, экспонируется на экзоплазматической стороне указанной мембраны, тогда как в другом конкретном варианте осуществления N-концевой домен указанного белка ТФ или фрагмента, обладающего прокоагулянтной активностью, экспонируется на эндоплазматической стороне указанной мембраны (фиг.27).

Размер полученной из дрожжей микровезикулы, несущей ТФ, настоящего изобретения может меняться в относительно широких пределах, обычно, указанный размер равен или ниже 1 мкм, как правило, равен или меньше 0,1 мкм. В конкретном варианте осуществления размер полученных из дрожжей микровезикул, несущих ТФ, настоящего изобретения меняется от 0,1 до 0,01 мкм, что определено с помощью электронной микроскопии (пример 1, раздел 1,6).

Способ производства полученной из дрожжей микровезикулы, несущей ТФ, настоящего изобретения

Полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения обычно могут быть получены с помощью рекомбинантных способов. Таким образом, в другом аспекте изобретение относится к способу производства полученной из дрожжей микровезикулы, несущей ТФ, обладающий прокоагулянтной активностью (т.е. полученная из дрожжей микровезикула, несущая ТФ, настоящего изобретения), в дальнейшем обозначаемому как «способ настоящего изобретения», который включает стадии:

a) ферментации культуры рекомбинантных дрожжевых клеток, которые экспрессируют белок ТФ или его фрагмент, обладающий прокоагулянтной активностью, в условиях, которые делают возможной экспрессию указанного белка ТФ или его фрагмента, обладающего прокоагулянтной активностью;

b) осаждения центрифугированием продукта, полученного на стадии ферментации a), для формирования продукта ферментации;

c) гомогенизации указанного продукта ферментации со стадии b) для формирования ферментационного гомогената; и

d) разделения указанного ферментационного гомогената со стадии c) для формирования осадка и очищенного дрожжевого экстракта (ОДЭ), содержащего указанную полученную из дрожжей микровезикулу, несущую ТФ, обладающий прокоагулянтной активностью (т.е. полученная из дрожжей микровезикула, несущая ТФ, настоящего изобретения);

e) сбора указанного очищенного дрожжевого экстракта (ОДЭ), содержащего указанную полученную из дрожжей микровезикулу, несущую ТФ, обладающий прокоагулянтной активностью; и, необязательно,

f) при желании, выделения или очистки указанных полученных из дрожжей микровезикул, несущих ТФ, обладающий прокоагулянтной активностью.

Рекомбинантные дрожжевые клетки, которые экспрессируют белок ТФ или его фрагмент, обладающий прокоагулянтной активностью, могут быть получены с помощью общепринятых рекомбинантных способов, известных специалистам в данной области. В кратком изложении, дрожжевую клетку трансформируют с помощью дрожжевого экспрессирующего вектора, содержащего нуклеотидную последовательность, кодирующую белок ТФ или его фрагмент, обладающий прокоагулянтной активностью, функционально связанного с дрожжевыми функциональными промоторами.

кДНК, кодирующая белок ТФ или его фрагмент, обладающий прокоагулянтной активностью, может быть амплифицирована с помощью полимеразной цепной реакции (ПЦР) с использованием библиотеки кДНК в качестве матрицы и подходящих праймеров. Пример 1 раскрывает амплификацию кДНК, кодирующей зрелый белок чТФ; пример 2 раскрывает амплификацию кДНК, кодирующей зрелый белок чТФ, с 18 дополнительными нуклеотидами (кодирующими шесть гистидинов) на 3'-конце; и пример 3 раскрывает амплификацию кДНК, кодирующей усеченную форму белка чТФ (УТФ), содержащую домен, взаимодействующий с фактором X, трансмембранную область и цитоплазматический хвост, с 18 дополнительными нуклеотидами (кодирующими шесть гистидинов) на 3'-конце.

«Вектор», как использовано в данном описании, относится к молекуле нуклеиновой кислоты, способной переносить другую нуклеиновую кислоту, с которой она была связана. Термин «дрожжевой экспрессирующий вектор», как использовано в данном описании, относится к конструкциям, выполняющим экспрессию ДНК, например, сегменты нуклеиновой кислоты, плазмиды, космиды, фаги, вирусы или вирусные частицы, допускающие синтезирование представляющих интерес белков, кодируемых их соответствующими рекомбинантными генами (т.е. белок ТФ или его фрагмент, обладающий прокоагулянтной активностью), которая осуществляется в дрожжах с помощью вектора. Альтернативно, сегменты нуклеиновой кислоты также могут быть использованы для создания трансгенных дрожжевых клеток, с использованием ненаправленной или гомологичной рекомбинации, в которой представляющий интерес ген или гены стабильно интегрированы в геном дрожжей. Обычно дрожжевой экспрессирующий вектор содержит нуклеотидную последовательность, кодирующую ТФ или его фрагмент, обладающий прокоагулянтной активностью, функционально связанную с промоторами, которые функциональны в дрожжевых клетках (т.е. функционирующие в дрожжах промоторы).

Векторы для использования с изобретением представляют собой, например, векторы, допускающие автономную репликацию и/или экспрессию нуклеиновых кислот, с которыми они связаны, в дрожжевых клетках. В настоящем описании термины «плазмида» и «вектор» используют взаимозаменяемо, так как плазмида является более общеупотребимой формой вектора. Кроме того, подразумевается, что изобретение включает такие другие формы экспрессирующих векторов, которые осуществляют эквивалентные функции и которые соответственно известны в данной области. Указанный дрожжевой экспрессирующий вектор может быть дрожжевым эписомальным экспрессирующим вектором или дрожжевым интегративным экспрессирующим вектором, и они могут быть получены общепринятыми способами, известными специалистам в данной области.

Таким образом, в варианте осуществления указанный дрожжевой экспрессирующий вектор представляет собой дрожжевой эписомальный экспрессирующий вектор. Термин «дрожжевой эписомальный экспрессирующий вектор», как использовано в данном описании, относится к экспрессирующему вектору, который сохраняется в виде внехромосомной молекулы ДНК в цитоплазме дрожжей. В конкретном варианте осуществления указанный дрожжевой эписомальный экспрессирующий вектор, в дополнение к нуклеотидной последовательности, кодирующей белок ТФ или его фрагмент, обладающий прокоагулянтной активностью, функционально связанной с функционирующими в дрожжах промоторами, дополнительно содержит: (i) дрожжевой селективный ген; (ii) дрожжевой репликатор; (iii) бактериальный селективный ген и (iv) дрожжевой сигнал терминации транскрипции. Преимущественно, указанный дрожжевой эписомальный экспрессирующий вектор дополнительно содержит уникальный сайт рестрикции для клонирования выбранного гена (белок ТФ или его фрагмент, обладающий прокоагулянтной активностью) под контролем функционирующих в дрожжах промоторов с идущим за ним дрожжевым сигналом терминации транскрипции.

В производстве указанного дрожжевого эписомального экспрессирующего вектора можно использовать практически все функционирующие в дрожжах промоторы, дрожжевой селективный ген, дрожжевой репликатор, бактериальный селективный ген, дрожжевой сигнал терминации транскрипции и участок рестрикции для клонирования; тем не менее, в конкретном варианте осуществления промотор глицеральдегид-3-фосфатдегидрогеназы (pGPD) используется в качестве функционирующего в дрожжах промотора; в другом конкретном варианте осуществления ген URA3 (URA3) используется в качестве дрожжевого селективного гена; в другом конкретном варианте осуществления в качестве дрожжевого репликатора используют дрожжевой 2-микронный (2 мкм) репликатор; в другом конкретном варианте осуществления ген устойчивости к ампициллину (Amp) используют в качестве бактериального селективного гена; и в другом конкретном варианте осуществления сигнал терминации транскрипции фосфоглицераткиназы (PGKt) используют в качестве специального дрожжевого сигнала терминации транскрипции. Таким образом, в конкретном варианте осуществления (примеры 1-3), дрожжевой эписомальный экспрессирующий вектор содержит (i) ген URA3; (U) ген Amp для отбора и размножения вектора в E. coli; (iii) дрожжевой 2 мкм репликатор; (iv) pGPD; (v) специальный дрожжевой сигнал терминации транскрипции из PGKt и (vi) уникальный участок рестрикции BamHI, который делает возможным клонирование выбранных генов под контролем pGPD и идущей за ним последовательности PGKt.

В другом варианте осуществления указанный дрожжевой экспрессирующий вектор представляет собой дрожжевой интегративный экспрессирующий вектор. Термин «дрожжевой интегративный экспрессирующий вектор», как использовано в данном описании, относится к вектору, который допускает встраивание в геном дрожжей. В конкретном варианте осуществления указанный дрожжевой интегративный экспрессирующий вектор содержит: (i) бактериальный селективный ген и (ii) экспрессирующую кассету, встроенную в дрожжевой селективный ген, причем указанная экспрессирующая кассета дополнительно содержит функционирующий в дрожжах промотор, дрожжевой сигнал терминации транскрипции и уникальный участок рестрикции для клонирования выбранного гена (белок ТФ или его фрагмент, обладающий прокоагулянтной активностью).

Практически любой бактериальный селективный ген, экспрессирующая кассета, встроенная в дрожжевой селективный ген, функционирующий в дрожжах промотор, дрожжевой сигнал терминации транскрипции и уникальный участок рестрикции для клонирования выбранного гена можно использовать в производстве указанного дрожжевого интегративного экспрессирующего вектора; тем не менее, в конкретном варианте осуществления ген устойчивости к ампициллину (Amp) используют в качестве бактериального селективного гена; в другом конкретном варианте осуществления экспрессирующая кассета pGPD-BamHI-PGKt, встроенная в центральную часть гена URA3, используется в качестве экспрессирующей кассеты, содержащей функционирующий в дрожжах промотор (pGDP), дрожжевой сигнал терминации транскрипции (PGKt) и уникальный участок рестрикции (BamHI) для клонирования выбранного гена в центральную часть гена URA3.

Фактически любую дрожжевую клетку, поддающуюся трансформации указанным дрожжевым экспрессирующим вектором, содержащим нуклеотидную последовательность, кодирующую белок ТФ или его фрагмент, обладающий прокоагулянтной активностью, функционально связанный с функционирующим в дрожжах промотором, можно использовать в настоящем изобретении. Трансформация дрожжевых клеток указанным дрожжевым экспрессирующим вектором может быть осуществлена с помощью общепринытых средств, известных специалистам в данной области (Sambrook et ah, 2001, Molecular Cloning: A Laboratory Manual).

В предпочтительном варианте осуществления указанные дрожжи представляют собой нефлоккулирующие (т.е. дрожжевые клетки, которые не флоккулируют (агрегируются), когда их диспергируют в ферментационном способе). Преимущественно, указанная дрожжевая клетка представляет собой GRAS дрожжевую клетку. Иллюстративные, неограничивающие примеры дрожжевых клеток, которые можно использовать в способе настоящего изобретения, представляют собой так называемые спиртовые виды дрожжей (дрожжи, используемые для производства алкогольных напитков), которые продуцируют спирт, углекислый газ, хлебопекарные дрожжи и т.п. посредством метаболизма жидкого материала брожения. Особенно предпочтительны дрожжи, выбранные из S. cerevisiae. Примеры таких спиртовых дрожжей включают пивные дрожжевые клетки, винные дрожжевые клетки и дрожжевые клетки для сакэ. В предпочтительном варианте осуществления изобретения дрожжевая клетка представляет собой винную дрожжевую клетку, например, S. cerevisae T73 ura3- (примеры 1-3).

После трансформации дрожжевой клетки, следующая стадия состоит в ферментации культуры рекомбинантных дрожжевых клеток, которые экспрессируют белок ТФ или его фрагмент, обладающий прокоагулянтной активностью, в условиях, которые делают возможной экспрессию указанного белка ТФ или его фрагмента, обладающего прокоагулянтной активностью. В конкретном варианте осуществления указанная дрожжевую клетку выращивают в достаточной среде, где указанная дрожжевая клетка может экспрессировать желаемый гетерологичный продукт (белок ТФ или его фрагмент, обладающий прокоагулянтной активностью). Подходящие культуральные среды для выращивания дрожжевых клеток хорошо известны специалистам в данной области и будут выбираться из подходящих сред, принимая во внимание подлежащие культивированию дрожжевые клетки. Для получения продукта ферментации можно использовать любой материал до тех пор, пока он подходит для ферментации, вызванной используемыми неагглютинирующими дрожжевыми клетками, и по желанию можно использовать известные материалы. Например, при производстве ликеров в качестве подходящих по отдельности или в комбинации используют, например, солоды, фруктовые соки, сахаристые жидкости, зерновые засахарившиеся жидкости и т.п. Также при необходимости туда могут быть добавлены подходящие питательные вещества и т.п.

По существу условия ферментации не отличаются от известных условий и могут быть определены специалистом в данной области. В конкретном варианте осуществления ферментация сопровождается контролем развития основных параметров на всем протяжении процесса ферментации и его останавливают, когда давление кислорода (PO2) достигает стационарного состояния.

Затем продукт ферментации, полученный на стадии ферментации a), осаждают общепринятыми способами, такими как центрифугирование, и перед гомогенизацией указанный продукт ресуспендируют в подходящем буфере для лизиса. Дрожжи могут быть гомогенизированы общепринятыми способами, например, с помощью высокого давления в гомогенизаторе для формирования ферментационного гомогената.

Затем ферментационный гомогенат подвергают разделению общепринятыми способами, такими как центрифугирование, для формирования осадка и очищенного дрожжевого экстракта (ОДЭ), содержащего указанные полученные из дрожжей микровезикулы, несущие ТФ, обладающие прокоагулянтной активностью (т.е. полученная из дрожжей микровезикула, несущая ТФ, настоящего изобретения), которые можно собрать по отдельности. Общая схема способа настоящего изобретения показана на фиг.11.

Наличие белка ТФ или его фрагмента, обладающего прокоагулянтной активностью, может быть определено с помощью общепринятых способов, таких как, Вестерн-блоттинг с использованием специфических моноклональных антител (mAb) против белка ТФ. Дополнительно, прокоагулянтная активность ОДЭ может быть определена с помощью любого общепринятого теста, например, с помощью любого коагуляционного теста, приведенного в примере 4, например, обычно с помощью коагуляционного теста в плазме или в цельной крови без добавления антикоагулянтов in vitro и т.д.

Дополнительное исследование образцов ОДЭ с помощью иммуноэлектронной микроскопии показало присутствие полученных из дрожжей микровезикул, меченых mAb против ТФ на поверхности указанных микровезикул. Указанные микровезикулы, содержащие белок ТФ или его фрагмент, обладающий прокоагулянтной активностью, также обладают прокоагулянтной активностью и соответствуют полученным из дрожжей микровезикулам, несущим ТФ, настоящего изобретения.

Необязательно, при желании, указанные полученные из дрожжей микровезикулы, несущие ТФ, обладающий прокоагулянтной активностью, предварительно полученные согласно способу настоящего изобретения, могут быть концентрированы, изолированы или очищены с помощью общепринятых способов, известных специалисту в данной области. Для иллюстративных целей, очистка аффинной хроматографией белков, содержащих пептидную метку (например, His-метку и т.д.) или на C-, или на N-конце, является хорошо стандартизованным способом, используемым для получения препаратов больших количеств белков с высокой степенью очистки. Как любой хроматографический способ, указанный способ может легко масштабироваться. Могут осуществляться альтернативные методы очистки, такие как иммуноаффинная хроматография, хотя это будет требовать наличия хорошо стандартизованного материала специфических моно- или поликлональных антител против ТФ, в особенности для крупномасштабного производства.

Таким образом, способ выделения и очистки будет зависеть, в частности, от природы белка ТФ или его фрагмента, обладающего прокоагулянтной активностью, т.е. если он является слитым белком, имеющим метку для связывания с одним или несколькими лигандами матрицы аффинности, например, хроматографическую подложку или гранулу с высокой аффинностью (например, His-метка и т.д.), или эпитоп, который может быть распознан антителом, таким как метка c-myc (распознается с помощью антител против c-myc), и т.д.

На фиг.23 схематически изображен способ очистки полученных из дрожжей микровезикул, несущих рекомбинантный белок ТФ (или его фрагмент, обладающий прокоагулянтной активностью) в виде слитого белка, слитого с His-меткой [т.е. полученные из дрожжей микровезикулы, несущие (белок ТФ-His-метка) или «готовое лекарственное средство 6HT-ТФ», как отмечено на фиг.23]. В кратком изложении, очищенный дрожжевой экстракт (ОДЭ), полученный согласно описанному выше способу, содержащий полученные из дрожжей микровезикулы, несущие (белок ТФ-His-метка), фильтруют (например, через фильтр с размером пор 0,2 мкм посредством тангенциального поточного фильтрования) перед загрузкой в подходящую колонку для аффинной хроматографии (например, колонка для аффинной хроматографии HiTrap®); затем, после использования образца, собирают элюат (несвязанный материал) и колонку несколько раз промывают, после последнего промывания, полученные из дрожжей микровезикулы, несущие (белок ТФ-His-метка) элюируют добавлением в колонку соответствующего буфера (например, буфера, содержащего имидазол) и элюированные фракции собирают и диализируют для формирования выделенных или очищенных полученных из дрожжей микровезикул, несущих (белок ТФ-His-метка).

Также, в другом варианте осуществления полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения могут быть очищены с помощью оборудования AKTA prime. AKTA prime представляет собой жидкостную автоматизированную хроматографическую систему от General Electric Healthcare, которую можно использовать для создания стандартных протоколов очистки, которые могут легко масштабироваться для крупного производства.

Способ очистки микровезикул, содержащих представляющий интерес мембранный белок от эукариотического хозяина

Также авторы настоящего изобретения обнаружили, что везикулы присутствуют в очищенном экстракте, полученном из клеток, экспрессирующих ТФ, можно дополнительно обогатить с использованием фракционирования по размеру. Не желая ограничиваться какой-либо теорией, полагают, что фракционирование по размеру с использованием мембраны, имеющей определенный размер пор, делает возможным удаление других компонентов клеточного экстракта, которые вредят прокоагулянтной активности белка. Полагают, что разработанный авторами способ, как правило, применим для очистки любых мембранных белков в эукариотическом хозяине в указанной мембране. Таким образом, в другом аспекте изобретение относится к способу производства препарата микровезикул, содержащих представляющий интерес мембранный белок, включающему стадии:

(a) выращивания культуры эукариотических клеток-хозяев в условиях, которые делают возможной экспрессию указанного представляющего интерес мембранного белка;

(b) гомогенизации клеток культуры со стадии (a),

(c) разделения гомогената со стадии (b) для формирования осадка и очищенного клеточного экстракта, содержащего указанные полученные из клетки микровезикулы, содержащие представляющий интерес мембранный белок;

(d) очистки указанных полученных из клетки микровезикул с помощью фракционирования по размеру.

Стадия (a): Выращивание культуры эукариотических клеток-хозяев

Эукариотические хозяева, которых можно использовать в контексте настоящего изобретения, включают любые клетки, которые можно культивировать в лаборатории или на промышленном предприятии, но, более предпочтительно, клетки, с которыми можно проводить генетические манипуляции, для того, чтобы в клетках сделать возможной экспрессию представляющего интерес мембранного белка. Хозяева, которых можно использовать в настоящем изобретении, включают дрожжи (например, Saccharomyces, Pichia), клетки насекомых, клетки растений или системы клеток млекопитающих (например, COS, CHO, BHK, 293,3T3).

Эукариотические хозяева могут быть использованы или для экспрессии их белка как части нормального протеома, или могут быть модифицированы введением экзогенной нуклеиновой кислоты, которая кодирует представляющий интерес мембранный белок. В обоих случаях клетки должны культивироваться в условиях, которые делают возможной экспрессию представляющего интерес мембранного белка. Если представляющий интерес мембранный белок кодируется нуклеиновой кислотой, нуклеиновая кислота может быть помещена в вектор под контролем промоторов. Примеры хорошо известных промоторов, пригодных для осуществления изобретения, включают конститутивные промоторы, такие как промоторы, обнаруженные в некоторых эукариотических вирусах (вирус полиомы, аденовирус, SV40, CMV, вирус птичьей саркомы, вирус гепатита B, промоторы гена металлотионина, промоторы тимидиновой киназы вируса простого герпеса, участки длинных концевых повторов ретровирусов, промоторы иммуноглобулинов, промоторы актина, промоторы EF-1 альфа, а также индуцибельные промоторы, где экспрессия нижележащего гена требует добавления в культуру субстанции экзогенного сигнала, например, тетрациклиновые промоторы, NFκB/УФ свет, Cre/lox, промоторы теплового шока, регулируемые промоторы РНК полимеразы II, описанные в WO/2006/135436, а также тканеспецифические промоторы, такие как PSA промоторы, описанные в WO2006012221.

Клетки культивируют с использованием подходящей среды для культивирования. Специалисту в данной области будет очевидно, что среды для культивирования должны выбираться в зависимости от типа используемой клетки-хозяина. Однако специалисту доступно широкое разнообразие сред для каждого типа клеток, как описано Sambrook, J. et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)) и Ausubel et al. (Current Protocols in Molecular Biology, eds. Ausubel et al, John Wiley & Sons (1992)).

Практически любой мембранный белок может быть экспрессирован и очищен согласно способу настоящего изобретения. Если представляющий интерес белок представляет собой мембранный белок, тогда белок может быть экспрессирован как таковой, так как он будет нацелен на мембранную систему клетки-хозяина, при условии, что он содержит сигнальную последовательность. Мембранные белки, которые могут быть экспрессированы с использованием способа настоящего изобретения, включают рецепторы, транспортеры, такие как рецепторы эстрогена, транспортеры аминокислот, рецепторы андрогенов, рецепторы гормонов гипофиза, рецепторы трансферрина, рецепторы прогестерона и транспортеры глюкозы. Также возможно экспрессировать растворимые белки с использованием способа настоящего изобретения, если эти растворимые белки слиты с сигнальной последовательностью на N-конце и с трансмембранным доменом на C-конце. Таким образом, слитый белок будет встроен в мембраны клетки-хозяина и очищен в микровезикулах. В предпочтительном варианте осуществления представляющий интерес мембранный белок представляет собой рТФ, его фрагмент или его N-гликозилированный мутант, как описано выше.

Стадия (b): Гомогенизация

На стадии (b) гомогенизируют клетки культуры для того, чтобы получить гомогенат. Клетки должны быть отделены от среды для культивирования с использованием любого способа, доступного специалисту (центрифугирование, осаждение, фильтрование и т.п.). Когда клетки выделены, их подвергают гомогенизации для того, чтобы разрушить клеточные стенки и плазматические мембраны и высвободить внутриклеточное содержимое в буфер, в котором выполняется гомогенизация. Разрушение клеток осуществляется с использованием любого пригодного известного в данной области способа, такого как высокое давление, кавитация азота, осмотический шок с применением гипотонического буфера, обработка ультразвуком, механическая гомогенизация, энзимолитические способы разрушения ткани, сонификация. Гомогенизацию проводят при отсутствии детергента. Предпочтительно, гомогенизацию проводят с помощью высокого давления.

Стадия (c): Разделение гомогената

Затем гомогенат фракционируют общепринятыми средствами для того, чтобы отделить неразрушенные клетки и большие агрегаты от содержимого, высвобожденного из клеток. Предпочтительно, фракционирование осуществляют центрифугированием при 13000×g. Полученный после центрифугирования супернатант представляет собой очищенный клеточный экстракт, который содержит растворимый материал, а также различные популяции микровезикул разных размеров, которые образуются при фрагментации мембранной системы клетки.

Стадия (d): Очистка фракционированием по размеру

Затем очищенный клеточный экстракт, полученный на стадии (c), фракционируют по размеру микровезикул, образующих указанный экстракт, для того, чтобы выбрать микровезикулы, которые имеют определенный диаметр. Авторы настоящего изобретения обнаружили, что способ очистки фракционированием по размеру можно использовать для предоставления препаратов микровезикул достаточной чистоты, которые можно терапевтически вводить без дополнительных стадий очистки, таких как хроматография и другие способы, ранее считавшихся необходимыми. Не намереваясь ограничиваться какой-любой отдельной теорией настоящего изобретения, полагают, что стадии обработки очищенных клеточных экстрактов через фракционирование по размеру в результате дают продукт со сниженной нагрузкой загрязнителями. Кроме того, загрязнители по своей природе и размеру могут быть быстро отделены от микровезикул с помощью простой стадии очистки фракционированием по размеру.

Ультрафильтрация через полупроницаемую мембрану является хорошо известным в данной области способом биотехнологии. Полупроницаемая мембрана определяется как структура, обладающая поперечными размерами, значительно превышающими ее толщину, массообмен через которую может происходить под действием множества движущих сил. Хотя многие фильтры можно признать мембранами, фильтры также включают материалы, поперечные размеры которых не всегда в 100 раз превышают их толщину и функция разделения которых главным образом состоит в захвате видов или частиц в их толще. Наиболее общие параметры, используемые для описания мембран, попадают в три основных категории. Это транспортные свойства, (геометрические) характеристики пор и поверхностные (или преимущественно химические) свойства. Тем не менее, транспортные свойства в значительной степени зависят от характеристик пор и поверхности. Хотя способ мембранного разделения может быть медленнее и с меньшим объемом, чем другие способы разделения, его эффективность делает его пригодным для получения малых количеств дорогостоящих продуктов.

Системы ультрафильтрации через полупроницаемую мембрану могут быть сконструированы множеством различных способов, чтобы обладать различными фильтрационными свойствами. Критерии конструкции включают: работа в конце (с или без помешивания) или режим поперечного потока; полный или частичный возврат поданной смеси; подача внешнего трансмембранного давления через насос, подушку с инертным газом или эвакуацию с выходной стороны устройства; и использование плоских листов (или отдельных или множественных), пучка полых волокон или трубчатых мембран. Способы разделения фракционированием по размеру используют мембраны для фракционирования по размеру, которые могут представлять собой диализные или другие похожие мембраны, как известно специалистам в данной области. Подходящие материалы для диализных мембран, пригодные для фракционирования по размеру ультрафильтрацией через полупроницаемую мембрану настоящего изобретения, включают коммерчески доступные мембраны, такие как мембраны, производимые из полиэфирсульфона, поликарбоната, нейлона, полипропилена и т.п. Поставщики таких материалов для диализных мембран в качестве примера включают Akzo-Nobel, Millipore, Inc., Poretics, Inc. и Pall Corp.

В предпочтительном варианте осуществления фракционирование по размеру с помощью мембран представляет собой тангенциальную поточную фильтрацию (ТПФ), также известную как «поперечная фильтрация». Тангенциальная поточная фильтрация представляет собой процесс разделения под давлением, в котором жидкость прокачивается вдоль по касательной к поверхности мембраны. Приложенное давление служит для проталкивания части жидкости, включая загрязнители, через мембрану для фильтрования по размеру. Твердые частицы и макромолекулы, которые слишком велики, чтобы пройти через поры мембраны, остаются с входной стороны. В отличие от методов обычной поточной фильтрации (ОПФ), в которых остающиеся компоненты забивают поверхность мембраны, тангенциальная поточная фильтрация смывает остающиеся компоненты в направлении тока жидкости.

ТПФ классифицируется, основываясь на размере компонентов, подлежащих разделению. Характеристика размера пор мембраны обычно дается в микронах и показывает, что частицы, которые по размеру больше, чем размер поры, будут удерживаться мембраной. С другой стороны, предел номинальной молекулярной массы (ПНММ), указывает на то, что большая часть растворенных макромолекул с молекулярной массой выше, чем ПНММ и некоторые с молекулярной массой ниже, чем ПНММ, будут задерживаться мембраной. Форма компонента, его способность к деформации и его взаимодействие с другими компонентами в растворе будет влиять на задерживание. Различные производители мембран используют различные критерии, чтобы задавать характеристики ПНММ семейству мембран, но специалисты в данной области смогут определить соответствующую характеристику эмпирически.

Ультрафильтрация является одной из наиболее широко используемых форм ТПФ и применяется для отделения белков от компонентов буфера буферным обменом, опреснением или концентрированием, а также может использоваться для фильтрования очищенных клеточных экстрактов настоящего изобретения. Обычный размер пор для фильтрования микровезикул варьирует от 0,2 до 0,1 микрон. В предпочтительном варианте осуществления ТПФ содержит первую мембрану с размером пор 0,2 микрона и вторую мембрану с размером пор 0,1 микрона, так что в пространстве между мембранами накапливаются микровезикулы с диаметром от 0,2 до 0,1 микрона.

В функциональном блоке ТПФ, для создания тока подаваемой жидкости через канал между поверхностями мембран используется насос. Во время каждого прохода жидкости через поверхность мембраны, приложенное давление проталкивает часть жидкости через мембрану и в поток фильтрата. Результатом является градиент концентрации исходного сырья от объема условий в центре канала до более концентрированного состояния у стенки у поверхности мембраны. Также имеет место градиент концентрации вдоль длины подводного канала от входа к выходу (концентрат) при постепенно увеличивающемся прохождении жидкости на сторону фильтрата. Ток исходного сырья вдоль длины мембраны вызывает падение давления от загрузочной стороны до удерживающего конца канала. Ток у поверхности мембраны со стороны фильтрата обычно ниже и там есть небольшое сужение, так что давление вдоль длины мембраны со стороны фильтрата приблизительно постоянное.

Мембраны могут быть изготовлены из различных материалов, предлагая выбор пропускных характеристик и химической совместимости. Подходящие материалы включают целлюлозу, полиэфирсульфон и другие материалы, известные специалистам в данной области. В определенных вариантах осуществления используется полиэфирсульфон. Обычные мембраны из полиэфирсульфона стремятся адсорбировать белок, а также другие биологические компоненты, приводя к загрязнению мембраны и сниженному потоку. Некоторые мембраны гидрофильно модифицированы, чтобы быть более устойчивыми к загрязнению, например, Biomax (Millipore).

Специалисты в данной области признают, что различные типы модулей ТПФ будут полезны при осуществлении изобретения. Полезные модули ТПФ включают в качестве неограничивающих примеров модули с плоской пластиной (также известной как кассеты), модули со спиральной навивкой и модули с полыми волокнами.

Затем для любого данного модуля ключевые параметры процесса могут быть быстро оптимизированы средним специалистом. Такие параметры включают скорость поперечного потока, трансмембранное давление (ТМД), контроль фильтрата, площадь мембраны и реализация диафильтрации. Скорость поперечного потока зависит от того, какой модуль выбран. В основном, более высокая скорость поперечного потока дает более высокий поток при одинаковом ТМД и увеличивает смывающее действие вдоль мембраны и уменьшает градиент концентрации по направлению к поверхности мембраны. Многие применения ТПФ используют поперечный поток и заданную точку давления, и фильтрат вытекает бесконтрольно и без ограничений из модуля. Это является самым простым типом функционирования, но в некоторых условиях может быть желательно использовать какой-либо тип контроля фильтрата сверх того, что достигается простой регулировкой давления с учетом объема концентрата. Площадь мембраны выбирают после определения последовательности технологических операций и общего объема, подлежащего переработке, а также в зависимости от времени переработки.

Обычно концентрирование может быть проведено центрифугированием при 2000-4500g, например, от 2500 до 4000g, или от 2750 до 3500g, или от 3000 до 3500g, например, при 3000, или 3100g, или 3200g, или 3300g, или 3400g, или 3500g.

Обычно центрифугирование может происходить в течение нескольких часов, например, более одного часа, например, 1-10 часов.

Для снижения отрицательного влияния на стабильность целевого полипептида, центрифугирование, в частности, можно проводить при температуре в диапазоне 2-20°C, например, в диапазоне 3-15°C, или в диапазоне 3-10°C, или в диапазоне 3-6°C.

Предпочтительными буферами для использования в ТПФ являются фосфатный буфер, HEPES буфер или трис буфер. Однако в определенных вариантах осуществления буфер имеет концентрацию от 5 мМ до 15 мМ, включая концентрации по меньшей мере 5 мМ, 6 мМ, 7 мМ, 8 мМ, 9 мМ, 10 мМ, 11 мМ, 12 мМ, 13 мМ, 14 мМ и 15 мМ, и дополнительно включает мМ концентрации между ними. В определенных вариантах осуществления буфер имеет pH примерно от 7,2 до 7,5. Таким образом, в одном из вариантов осуществления буфер имеет pH 7,2, 7,3, 7,4 или 7,5 или дробные значения pH между ними. В другом варианте осуществления буферообменный буфер дополнительно содержит от 0,10 M до 0,20 M NaCl и от 3,5% до 4,5% сахарозы.

В предпочтительном варианте осуществления препарат микровезикул, полученный после стадии фракционирования по размеру, дополнительно подвергается во второй стадии очистки, которая делает возможным выделение микровезикул, имеющих самое большое количество белка/активность, из всех других продуктов, присутствующих в образце.

В одном из вариантов осуществления указанную вторую стадию очистки осуществляют с помощью второй стадии фракционирования по размеру. В другом варианте осуществления вторая стадия очистки может быть выполнена посредством аффинной хроматографии. Если микровезикулы содержат ТФ, тогда аффинную хроматографию осуществляют с использованием соединения, которое проявляет аффинность в отношении ТФ (например, антитело). Если микровезикулы содержат слитый белок, содержащий ТФ и метку, аффинная хроматография может быть выполнена с использованием лиганда, который проявляет аффинность в отношении указанной метки. Предпочтительно, метка представляет собой гексагистидиновую метку, в случае которой аффинную хроматографию осуществляют с использованием металлической колонки для аффинной хроматографии.

Когда препарат микровезикул очищен, элюат со стадии фракционирования проверяют на наличие представляющего интерес белка и те фракции, которые содержат самое высокое количество белка или самую высокую активность, объединяют и используют непосредственно. Профиль элюирования колонки может быть проверен на наличие белка с применением любых доступных средств, известных в данной области, для обнаружения присутствия заданного белка (ELISA, Вестерн-блоттинг, радиоиммунный анализ и т.п.) или может быть проверен на наличие активности представляющего интерес белка. Специалисту в данной области будет очевидно, что тест на активность будет зависеть от белка, который подлежит очистке. В предпочтительном варианте осуществления представляющий интерес белок представляет собой ТФ и активность, которая может быть обнаружена для идентификации фракций, содержащих везикулы, содержащие указанный белок, представляет собой прокоагулянтную активность, как представлено в примере 5.

Терапевтическое применение полученных из дрожжей микровезикул, несущие ТФ, настоящего изобретения

Различные анализы показали, что полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения проявляют прокоагулянтную активность. Фактически, пример 4 включает:

a) in vitro анализы, показывающие, что полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения вызывают образование фибринового сгустка и свертывание крови как в патологическом, так и в здоровом состоянии; то есть, указанные анализы показывают, что указанные полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения, способны коагулировать:

плазму от здоровых субъектов (коагуляционные тесты в плазме);

плазму с дефицитом FVIII, FIX или FXI (коагуляционные тесты в плазме);

плазму при приобретенной тромбоцитопении (коагуляционные тесты в плазме при тромбоцитопении);

плазму при недостаточности FXI в плазме в присутствии антител против FVII (коагуляционные тесты в плазме);

кровь от здоровых субъектов (коагуляционные тесты в цельной крови без добавления антикоагулянтов); и

кровь от пациентов с гемофилией (коагуляционные тесты в цельной крови без добавления антикоагулянтов);

b) in vivo анализы показывают, что полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения являются средством, полезным для местного кровоостанавливающего лечения на моделях с тяжелой геморрагией (введением прямо в предварительно разрезанный кровеносный сосуд); то есть, указанные анализы показывают, что указанная полученная из дрожжей микровезикула, несущая ТФ, пригодна в качестве местного гемостатического средства как для обработанных, так и не обработанных гепарином экспериментальных животных;

c) in vivo анализы показывают, что полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения являются средством, пригодным для местной кровоостанавливающей терапии на моделях с летальной геморрагией (введением прямо в предварительно разрезанных кровеносный сосуд); то есть, указанные анализы показывают, что указанная полученная из дрожжей микровезикула, несущая ТФ, пригодна в качестве местного гемостатического средства на животных моделях с летальной геморрагией посредством проксимальных надрезов хвоста у мышей с дефицитом FVIII.

Приведенные результаты ясно показывают, что полученная из дрожжей микровезикула, несущая ТФ, настоящего изобретения представляет собой прокоагулянт или кровоостанавливающее средство, пригодное для местного лечения геморрагии у субъекта.

Таким образом, полученную из дрожжей микровезикулу, несущую ТФ, настоящего изобретения можно применять в качестве лекарственного средства, то есть, в качестве прокоагулянта или в качестве кровоостанавливающего средства, особенно, в качестве кровоостанавливающего средства для местного применения, при лечении геморрагий у субъекта.

Поэтому, в другом аспекте изобретение относится к полученной из дрожжей микровезикуле, несущей ТФ, настоящего изобретения в качестве лекарственного средства. В конкретном варианте осуществления изобретение относится к полученной из дрожжей микровезикуле, несущей ТФ, настоящего изобретения в качестве местного лекарственного средства с прокоагулянтной (антигеморрагической) активностью, пригодной для лечения геморрагий у субъекта.

Хотя полученная из дрожжей микровезикула, несущая ТФ, настоящего изобретения, может применяться местно для лечения геморрагии у субъекта, т.е. без смешивания с фармацевтически приемлемым носителем, так как компоненты очищенного дрожжевого экстракта (ОДЭ), содержащие указанные полученные из дрожжей микровезикулы, несущие ТФ, полученные согласно способу настоящего изобретения, по существу являются безвредными для субъекта, как правило, при введении субъекту, полученная из дрожжей микровезикула, несущая ТФ, настоящего изобретения, будет составлена в форме для фармацевтического введения, подходящей для ее введения, предпочтительно, для ее местного введения (локального) при лечении кровотечения.

Таким образом, в другом аспекте изобретение относится к фармацевтической композиции, далее обозначаемой как фармацевтическая композиция настоящего изобретения, содержащей полученную из дрожжей микровезикулу, несущую ТФ, настоящего изобретения и фармацевтически приемлемый наполнитель, носитель или эксципиент. Затем указанная фармацевтическая композиция составлена в форму для фармацевтического введения, пригодную для ее введения субъекту.

Затем для их введения субъекту, полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения будут составлены в форму для фармацевтического введения, предпочтительно, в форму для фармацевтического введения, пригодную для их местного введения, в которую с этой целью будут включены фармацевтически приемлемые носители и эксципиенты, пригодные для получения желаемой формы для фармацевтического введения. Информацию об указанных носителях и эксципиентах, а также об указанных формах введения, пригодных для введения указанного продукта настоящего изобретения, можно найти в галеновых фармацевтических справочниках. Обзор различных форм для фармацевтического введения лекарственных средств в общем и о способах их получения, можно найти в издании, называемом «Tratado de Farmacia Galenica» («Galenic Pharmacy Treatise»), by C. Fauli i Trillo, 1st Edition, 1993, Luzan 5, S.A. of Ediciones.

Хотя можно использовать различные формы для фармацевтического введения полученных из дрожжей микровезикул, несущих ТФ, настоящего изобретения, местное введение указанного продукта на практике является более полезным; поэтому указанные полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения будут составлены в фармацевтическую форму, пригодную для их местного введения. Иллюстративные, неограничивающие примеры указанных фармацевтических форм включают аэрозоли, растворы, суспензии, эмульсии, гели, целебные мази, кремы, перевязки, пластыри, притирания, полоскания для рта и т.д. С этой целю фармацевтическая композиция настоящего изобретения будет содержать фармацевтически приемлемые наполнители, носители и/или эксципиенты, требующиеся для получения формы для фармацевтического введения полученных из дрожжей микровезикул, несущих ТФ, настоящего изобретения для местного введения.

Поэтому, в конкретном варианте осуществления фармацевтическая композиция настоящего изобретения представляет собой фармацевтическую композицию для местного введения полученных из дрожжей микровезикул, несущих ТФ, настоящего изобретения, содержащих указанный продукт и фармацевтически приемлемый наполнитель, носитель или эксципиент, пригодный для местного введения указанных полученных из дрожжей микровезикул, несущих ТФ настоящего изобретения. Иллюстративные, неограничивающие примеры фармацевтически приемлемых наполнителей, носителей или эксципиентов, пригодных для местного введения указанных полученных из дрожжей микровезикул, несущих ТФ, можно найти в галеновских фармацевтических справочниках.

В конкретном варианте осуществления фармацевтическая композиция настоящего изобретения содержит дрожжевые микровезикулы, несущие ТФ, содержащий белок ТФ человека или его фрагмент, обладающий прокоагулянтной активностью, например, например, зрелый ТФ человека или усеченный ТФ человека (т.е. белок ТФ человека, где весь или часть домена, ответственного за связывание с FVIIa, отсутствует или мутантный белок ТФ человека, обладающий прокоагулянтной активностью, в котором домен, ответственный за связывание с FVIIa не функционален).

Полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения будут присутствовать в фармацевтической композиция настоящего изобретения в терапевтически эффективном количестве. Указанное количество может меняться в широких пределах, например, примерно от 1,0 пг активного белка/мл до 1,0 мг активного белка/мл, предпочтительно, от 0,05 мкг активного белка/мл до 10 мкг активного белка/мл и, наиболее предпочтительно, примерно от 0,1 мкг активного белка/мл до 2,0 мкг активного белка/мл.

Доза полученной из дрожжей микровезикулы, несущей ТФ, настоящего изобретения для введения субъекту может меняться в очень широких пределах, например, примерно от 1,0 пг активного белка/мл до 1,0 мг активного белка/мл, предпочтительно, от 0,05 мкг активного белка/мл до 10 мкг активного белка/мл и, наиболее предпочтительно, примерно от 0,1 мкг активного белка/мл до 2,0 мкг активного белка/мл. Доза полученной из дрожжей микровезикулы, несущей ТФ, настоящего изобретения для введения будет зависеть от нескольких факторов, включая среди них особенности используемого в композиции белка ТФ или его фрагмента, обладающего прокоагулянтной активностью, такие как, например, его активность и биологическое время полураспада, концентрация белка ТФ или его фрагмента, обладающего прокоагулянтной активностью, клиническое состояние субъекта или пациента, подлежащее лечению геморрагическое нарушение и т.д. По этой причине дозы, приведенные выше, должны рассматриваться только в качестве ориентировочных для специалиста в данной области, и специалист в данной области сможет подобрать дозы согласно приведенным выше переменным. Тем не менее, фармацевтическая композиция настоящего изобретения может вводиться один или несколько раз в день для превентивных или терапевтических целей.

Фармацевтическую композицию настоящего изобретения можно использовать вместе с другими дополнительными лекарственными средствами, пригодными для предупреждения и/или лечения геморрагического диатеза (например, факторы свертывания, человеческая плазма и т.д.) для предоставления комбинированного лечения. Указанные дополнительные лекарственные средства могут быть частью одной и той же фармацевтической композиции или, альтернативно, они могут предоставляться в виде отдельных композиций для их одновременного или последовательного (разделенного во времени) введения относительно введения фармацевтической композиции настоящего изобретения.

Фармацевтическая композиция настоящего изобретения также может быть помещена на подложку. Поэтому, в другом аспекте изобретение относится к продукту, содержащему фармацевтическую композицию настоящего изобретения и подложку. Термин «подложка», как использовано в данном описании, относится к субстрату из подходящего материала, позволяющего размещать на нем фармацевтическую композицию настоящего изобретения, она будет переноситься и высвобождаться в желаемом месте, например, в месте, где фармацевтическая композиция настоящего изобретения осуществляет свой терапевтический эффект. Указанная подложка может быть твердой основой или не твердой основой, например, жидкой основой или газообразной основой. Иллюстративные, неограничивающие примеры твердых основ включают повязки, бандажи, компрессы, пластыри и т.д. Иллюстративные, неограничивающие примеры жидких основ включают гели, спреи, полоскания для рта и т.д. Иллюстративные, неограничивающие примеры газообразных основ включают воздух, пропелленты и т.д.

В конкретном варианте осуществления фармацевтическая композиция настоящего изобретения содержит дрожжевые микровезикулы, несущие ТФ, содержащий белок ТФ человека или его фрагмент, обладающий прокоагулянтной активностью, например, например, зрелый ТФ человека или усеченный ТФ человека (т.е. белок ТФ человека, где весь или часть домена, отвечающего за связывание с FVIIa, отсутствует, или мутантный белок ТФ человека, обладающий прокоагулянтной активностью, в котором домен, отвечающий за связывание с FVIIa не функционален).

Этот продукт, включающий фармацевтическую композицию настоящего изобретения, расположенную на подложке, может быть получен с помощью общепринятых способов, например, смешиванием фармацевтической композиции настоящего изобретения и основы. Взаимодействие между фармацевтической композицией настоящего изобретения и основой может представлять собой физическое или химическое взаимодействие, в зависимости от природы компонентов фармацевтической композиции настоящего изобретения и используемой основы.

В другом аспекте изобретение относится к применению полученной из дрожжей микровезикулы, несущей ТФ, настоящего изобретения в получении лекарственного средства для лечения геморрагий у субъекта, в частности, для местного лечения геморрагий у здорового субъекта или у субъекта с геморрагическим диатезом.

Термин «местное лечение», как использовано в данном описании, относится к применению при лечении прямо в месте, где оно требуется, например, в прерывистых разрезах кожи (порезах и т.д.) и ткани сосудов (порванные сосуды и т.д.), при венозных и артериальных геморрагиях из-за открытых ран, хирургических операций и т.д. и при кожно-слизистых и капиллярных геморрагиях.

Согласно настоящему изобретению и как показано в примере 4, полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения могут действовать в качестве прокоагулянта или кровоостанавливающего средства, и, таким образом, указанный продукт можно применять при лечении или корректировке геморрагических заболеваний, особенно таких геморрагических заболеваний, которые связаны с геморрагическим диатезом.

Термин «геморрагический диатез» относится к процессу, вызванному гемостатическим нарушением и который в результате дает рост возникновения геморрагического синдрома, который может иногда проявляться с обширным и чрезмерным кровотечением. Геморрагический диатез может быть вызван врожденной или приобретенной коагулопатией и/или врожденным или приобретенным заболеванием тромбоцитов.

Термин «коагулопатия» относится к нарушению факторов свертывания. Это нарушение может происходить по причине недостатка или дефицита конкретного фактора свертывания, следствием которого будет проявление геморрагического синдрома, или из-за нарушения факторов свертывания. Как правило, коагулопатия может быть врожденной коагулопатией или приобретенной коагулопатией.

В качестве иллюстративных, неограничивающих примеров врожденных коагулопатий могут быть отмечены недостаточности факторов свертывания, выбранные из фактора свертывания V (FV), фактора свертывания VII (FVII), фактора свертывания VIII (FVIII), дефицит или недостаточность которого вызывает гемофилию A, фактора свертывания IX (FIX), дефицит или недостаточность которого вызывает гемофилию B, фактора свертывания X (FX), фактора свертывания XI (FXI), дефицит или недостаточность которого вызывает гемофилию C, фактора свертывания XII (FXII), фактора свертывания XIII (FXIII) и их комбинаций.

Приобретенные коагулопатии могут иметь различные источники. Иллюстративные примеры включают недостаточности синтеза факторов свертывания при тяжелой печеночной недостаточности, антикоагулянтную терапию (например, гепарин, низкомолекулярные гепарины, варфарин, производные кумарина, дикумарины и т.д.). Альтернативный механизм основан на чрезмерном потреблении факторов свертывания, таким образом, что они не доступны для образования сгустка в кровоточащем повреждении. Этот механизм проявляется при синдроме диссеминированного внутрисосудистого свертывания или коагулопатии из-за потребления, происходящего при множестве заболеваний, таких как тяжелое септическое повреждение, микроциркуляторная эндотелиальная активация тромбоцитов и факторов свертывания с образованием множественных микротромбов; при инвазии крови тканевым фактором, например, при плацентарном выбросе; при удержании мертвого плода; при множественных травмах с раздавлением тканей; при укусах ядовитых змей и т.д. При васкулите, париетальное и эндотелиальное повреждение высвобождает активаторы коагуляции. Потребление факторов свертывания ухудшается за счет лизиса фибрина множественных микротромбов из-за плазмина с высвобождением PDF, которые являются антитробоцитарными средствами и антикоагулянтами.

Термин «тромбоцитарное нарушение» относится к нарушению как количества, так и функциональных способностей тромбоцитов, результатом чего является проявление геморрагического синдрома. Указанное тромбоцитарное нарушение может быть врожденным или приобретенным.

В конкретном варианте осуществления указанное тромбоцитарное нарушение представляет собой врожденное тромбоцитарное нарушение. Иллюстративные, неограничивающие примеры врожденных тромбоцитарных нарушений включают тромбастению Гланцмана, болезнь Бернарда Солье, синдром Болин-Джеймсона, синдром Вискотта-Олдрича, синдром Пари-Труссо-Якобсона, тромбоцитопения, связанная с X хромосомой, тромбоцитарный синдром Грея, синдром Себастьяна и анемия Фанкони.

В другом конкретном варианте осуществления указанное тромбоцитарное нарушение представляет собой приобретенное тромбоцитарное нарушение. Иллюстративные, неограничивающие примеры приобретенных тромбоцитарных нарушений включают миелоприлиферативные заболевания, такие как тромбоцитемия, полицитемия, хроническая миелоцитарная лейкемия и т.д.; функциональные тромбоцитарные нарушения имеют место при миелоидной метаплазии с увеличенным временем кровотечения, дефиците задержки микрочастиц, дефиците агрегации тромбоцитов, ненормальном высвобождении и дефиците тромбоцитарного фактора III. Функциональные дефициты тромбоцитов были обнаружены при диспротеинемиях, при цинге и при врожденном пороке сердца и циррозе печени.

Термины «приобретенная коагулопатия» и «приобретенное тромбоцитарное нарушение» относятся к источнику нарушения, который может быть ятрогенным или вторичным по отношению к другому заболеванию.

Термин «субъект», как использовано в данном описании, включает любое количество животных видов, включая человеческий вид; в иллюстративных целях неограничивающего примера, указанный субъект может быть млекопитающим, например, приматом, домашним животным, грызуном и т.д., указанный субъект предпочтительно представляет собой мужчину или женщину любого возраста и любой расы. В конкретном варианте осуществления указанный субъект представляет собой без нарушений гемостаза в анамнезе, например, индивидуум без коагулопатии или тромбоцитарных нарушений. В другом конкретном варианте осуществления указанный субъектом является человек с нарушениями гемостаза в анамнезе, например, индивидуум с геморрагическим диатезом, например, коагулопатией, например, врожденной или приобретенной коагулопатией, или тромбоцитарным нарушением, таким как врожденное или приобретенное тромбоцитарное нарушение.

Поэтому в конкретном варианте осуществления изобретение относится к применению полученных из дрожжей микровезикул, несущих ТФ, настоящего изобретения при получении лекарственного средства для местного лечения геморрагий у человека без заболеваний гемостаза в анамнезе. В другом конкретном варианте осуществления изобретение относится к применению полученных из дрожжей микровезикул, несущих ТФ, настоящего изобретения при получении лекарственного средства для местного лечения геморрагии у человека с геморрагическим диатезом.

Как указано выше, для местного введения субъекту, полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения будут составлены в фармацевтической форме, пригодной для их местного применения (локального) при лечении геморрагий у субъекта. Иллюстративные, неограничивающие примеры указанных фармацевтических форм включают аэрозоли, растворы, суспензии, эмульсии, гели, целебные мази, кремы, повязки, пластыри, притирания, полоскания для рта и т.д. С этой целью фармацевтическая композиция, содержащая полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения будет включать фармацевтически приемлемые наполнители, носители и эксципиенты, требующиеся для получения выбранной формы для фармацевтического введения. Информация касательно фармацевтической композиции (формы для фармацевтического введения, дозы, количество активного компонента и т.д.) приведена выше в связи с фармацевтической композицией настоящего изобретения.

Также сообщалось о том, что ТФ индуцирует ангиогенез и увеличивает образование VEGF (Ollivier et al, 2000, Arterioscler. Thromb. Vase. Biol, 20:1374-1381; Chen et al, 2000, Thromb.Haemost., 86:334-345 y Watanabe et al., 1999, Thromb.Res., 96:183-189). Таким образом, в другом аспекте изобретение относится к полученным из дрожжей микровезикулам настоящего изобретения для лечения заболеваний, где требуется увеличенный ангиогенез или увеличенная клеточная миграция.

Заболевания, ассоциированные со сниженным ангиогенезом и для которых можно получить преимущество от лечения ангиогенез-стимулирующими композициями настоящего изобретения, включают заболевания коронарных артерий, например, ишемический миокардит, инфаркт миокарда, ишемическая кардиомиопатия или заболевания периферических артерий, такие как перемежающаяся хромота из-за хронической ишемии конечности (скелетных мышц) или боль в покое/ишемическое образование язвы/гангрена. Стимуляция ангиогенеза также требуется при ишемическом инсульте/нейропатии, например, мозговой/нервной ткани, например, ишемическая пневмония вокруг инсульта/инфаркта. Альтернативно, проангиогенное влияние композиций настоящего изобретения можно использовать для содействия выздоровления и/или эндотелизации внутрисосудистых люминальных поверхностей, например, для содействия эндотелизации нестабильных/изъязвленных атеросклеротических бляшек, например, в коронарных/сонных артериях, или на деэндотелизированных люминальных поверхностях, таких как поверхности, обнаруживаемые после эндартэктомии, например, внутри сонной артерии, тромбэктомии (или артериальной или венозной), пластики сосудов, например, баллонной, лазерной или криогенной пластики сосудов, артерэктомии или последующего тромболизиса, посредством введения композиции, которая включает соединение оксида азота. Проангиогенные композиции настоящего изобретения также могут быть полезны при рассасывании острого или хронического артериального и/или венозного тромбоза, например, реваскуляризации и/или неоваскуляризации, и/или реканализации. В другом варианте осуществления композиции настоящего изобретения способствуют развитию нового капиллярного русла для применения в генной терапии, применения в регенерации органов и для замены биосинтетическими гибридными органами (например, поджелудочной железы, почки, легкого, печени), а также стимулирование и/или усиление заживления ран, и/или для стимуляции грануляционной ткани, например, для хронических ран, таких как ишемические, диабетические, невропатические, вызванные венозным застоем раны.

Сообщалось, что ТФ способствует клеточной миграции (Ott et al., 2005, Circulation, 111:349-355 и WO 0105353). Таким образом, в другом аспекте изобретение относится к композиции, содержащей ТФ, настоящего изобретения для стимулирования клеточной миграции у пациентов, нуждающихся в этом. Следует принимать во внимание, что различные заболевания можно лечить композициями настоящего изобретения зависимости от того, миграцию клеток какого типа стимулируют. Например, пациенты, которые страдают от повреждения тела протока, такого как кровеносный сосуд, артерия, коронарная артерия, вена, просвет пищевода и уретра, нуждаются в стимуляции миграции эндотелиальных клеток; пациенты, страдающие от повреждений в центральной нервной системе в результате как ишемического, так и геморрагического инсульта, и от травматического повреждения будут нуждаться в стимуляции миграции нервных клеток к месту повреждения; пациенты, страдающие от язв, которые могут быть хроническими и устойчивыми к лечению, например, у диабетических и пожилых пациентов, например язвы ног и пролежни, раны роговицы, ожоги, истирания, хирургические разрезы, места донорской трансплантации и повреждения, вызванные инфекционными агентами). Другие медицинские состояния, которые можно лечить, представляющие собой хронические состояния (такие как хроническая венозная язва, диабетическая язва, язва от сдавливания, пролежни и язвы или раны слизистой поверхности), повреждения кожи и эпителиальных покровов, вызванные устойчивым воспалительным процессом или инфекцией, или генетическим дефектом (таким как келоидное образование и аномалии коагуляции), получат пользу от стимуляции миграции эпителиальных клеток, необходимых для репопуляции поврежденной ткани.

Композиция, содержащая полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения

В другом аспекте изобретение относится к композиции, далее обозначаемой как «композиция настоящего изобретения», содержащей полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения и наполнитель.

Практически любой наполнитель, который не влияет неблагоприятно на полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения можно использовать в указанной композиции настоящего изобретения.

В варианте осуществления указанный наполнитель представляет собой практически жидкую среду, например, среду, окружающую полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения, полученные способом настоящего изобретения. Поэтому, в конкретном варианте осуществления композиция настоящего изобретения содержит очищенный дрожжевой экстракт, полученный при выполнении способа настоящего изобретения.

Усеченный ТФ с частично или полностью отсутствующим доменом, отвечающим за связывание с FVIIa

Как указано выше, авторы с удивлением обнаружили, что усеченный белок ТФ, который не был способен связываться с FVIIa, обладает прокоагулянтной активностью. Как можно видеть в примере 4, авторы показали, что указанная усеченная форма белка ТФ обладает прокоагулянтной активностью в коагуляционном тесте в плазме.

Таким образом, в другом аспекте настоящее изобретение относится к усеченному ТФ с частично или полностью отсутствующим доменом, отвечающим за связывание с FVIIa, в дальнейшем обозначаемому как «усеченный ТФ с отсутствующим доменом, связывающим FVIIa, настоящего изобретения", где весь или часть домена, отвечающего за связывание с FVIIa, отсутствует, и, таким образом, он не способен связываться с FVIIa, но обладает прокоагулянтной активностью. Соответственно, указанный «усеченный ТФ с отсутствующим доменом, связывающим FVIIa, настоящего изобретения» включает мутантные белки ТФ, обладающие прокоагулянтной активностью, в которых домен, отвечающий за связывание с FVIIa, не функционален из-за мутаций.

Усеченный ТФ с отсутствующим доменом, связывающим FVIIa, настоящего изобретения, может быть получен с помощью общепринятых средств, например, средствами генной экспрессии нуклеотидной последовательности, кодирующей указанный белок в подходящей системе экспрессии (дрожжи, бактерии, эукариотические клетки, клетки насекомых и т.д.).

Для того чтобы определить, способен ли усеченный ТФ с отсутствующим доменом, связывающим FVIIa, настоящего изобретения, связываться с FVIIa, можно использовать тесты на связывание, один из которых описан в международной публикации WO00/04148. Кроме того, прокоагулянтная активность усеченного ТФ с отсутствующим доменом, связывающим FVIIa, настоящего изобретения может быть оценена как указано выше, например, с помощью любого из коагуляционных тестов, приведенных в примере 4, например, с помощью in vitro коагуляционного теста в плазме или с помощью in vitro коагуляционного теста в цельной крови без добавления антикоагулянтов, или с помощью in vivo исследования на животных моделях с тяжелой геморрагией, или с помощью in vivo исследования на животных моделях с летальной геморрагией, таких как приведено в примере 4.

В конкретном варианте осуществления указанный усеченный ТФ с отсутствующим доменом, связывающим FVIIa, настоящего изобретения содержит домен для взаимодействия с X фактором, трансмембранную область и цитоплазматический хвост и не имеет, частично или полностью, домен, отвечающий за связывание с FVIIa. Более того, в конкретном варианте осуществления указанный усеченный ТФ с отсутствующим доменом, связывающим FVIIa, настоящего изобретения представляет собой усеченную форму белка ТФ человека, содержащую домен для взаимодействия с фактором X (а.к. 174-251), трансмембранную область (а.к. 252-274) и цитоплазматический хвост (а.к. 275-295) и дополнительную гистидиновую метку (пример 3). Затем авторы с удивлением обнаружили, что указанная усеченная форма белка ТФ с отсутствующим доменом, отвечающим за связывание с FVIIa, обладает прокоагулянтной активностью (пример 4, таблица 3).

В другом конкретном варианте осуществления ТФ модифицировали с помощью одной или нескольких точечных мутаций в домене, связывающемся с FVIIa, так что указанный домен больше не был способен связываться с FVIIa. Точечные мутации домена, связывающегося с FVIIa, тканевого фактора, которые известны способностью нарушать связывание с указанным FVIIa, известны в данной области (например, описанные Kelley, R.F. et al, 1995, в Biochemistry, 34:10383-10392, содержание которой включено в данное описание посредством ссылки во всей своей полноте).

Было с удивлением обнаружено, что указанный фрагмент ТФ, с частично или полностью отсутствующим доменом, отвечающим за связывание с FVIIa, обладает прокоагулянтной активностью, так как, и это хорошо известно, во внешнем пути свертывания крови ТФ связывается с циркулирующим FVII/FVIIa с образованием комплекса ТФ::FVIIa и в присутствие кальция действует в качестве субстрата, так что происходит активация FX. Общепринято, что в случае геморрагии, вызванной повреждением сосуда, коагуляция запускается благодаря внешнему пути активации, включающему взаимодействие ТФ с его лигандом, FVII/FVIIa.

Усеченный ТФ с отсутствующим доменом, связывающим FVIIa, настоящего изобретения может быть гликозилирован или нет. Таким образом, в конкретном варианте осуществления усеченный ТФ с отсутствующим доменом, связывающим FVIIa, настоящего изобретения не гликозилирован, тогда как в другом конкретном варианте осуществления указанный усеченный ТФ с отсутствующим доменом, связывающим FVIIa, настоящего изобретения гликозилирован. Как указано выше, термин «гликозилирован» включает любую степень гликозилирования.

Мутантные ТФ, несущие один или несколько не функциональных сайтов гликозилирования

Как указано выше, авторы настоящего изобретения также обнаружили, что прокоагулянтная активность ТФ, а также его экспрессия в дрожжевых клетках-хозяевах увеличивается, когда указанный ТФ несет мутации в сайтах гликозилирования, которые предотвращают прикрепление по меньшей мере одной из трех N-связанных цепей гликозилов, найденных в ТФ дикого типа. Таким образом, в конкретном варианте осуществления полученные из дрожжей микровезикулы, несущие ТФ, настоящего изобретения содержат негликозилированный фрагмент белка ТФ, обладающий прокоагулянтной активностью. Как указано выше, термин «гликозилированный» включает любую степень гликозилирования. В предпочтительном варианте осуществления вариант ТФ представляет собой полипептид, где по меньшей мере один из сайтов N-гликозилирования ТФ был модифицирован для того, чтобы сделать его нефункциональным, т.е. неспособным служить в качестве акцепторного сайта для добавления гликозидных цепей. Сайты N- гликозилирования в последовательности ТФ, которые могут быть модифицированы, указаны выше, т.е. сайт Asn11-Leu12-Thr13, сайт Asn124-Val125-Thr126 и/или сайт Asn137-Asn138-Thr139. Любая модификация консенсусных участков N-гликозилирования подходит до тех пор, пока добавление N-связанной цепи гликозила нарушено или в значительной степени ингибировано. Предпочтительно, модификация вводится в остаток аспарагина, соответствующий положениям 11, 124 и/или 136 в зрелом ТФ человека, так как это остаток, который служит в качестве акцептора для присоединения цепи гликозила. Как используется в настоящем изобретении, «сайты, соответствующие сайтам 11, 124 и/или 136 в зрелом ТФ человека» относятся к сайтам N-гликозилирования в других ортологах ТФ, которые могут возникать в различных положениях в полипептидной цепи, но которые совпадают с сайтами N-гликозилирования в зрелом ТФ человека, когда человеческая и ортологичные последовательности выравнивают исходя из сходства последовательностей. Подходящим алгоритмом для выравнивания или множественных последовательностей ТФ и, таким образом, для идентификации сайтов N-гликозилирования в ортологе ТФ, соответствующих сайтам в зрелом ТФ человека, является программа PILEUP, составляющая часть пакета программного обеспечения GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wis.). PILEUP создает множественное выравнивание последовательностей из группы связанных последовательностей с использованием последовательных парных выравниваний для того, чтобы показать родство и процент идентичности последовательности. Также она строит дерево или дендрограмму, показывающую кластеры родства, использованные для создания выравнивания. PILEUP использует упрощение способа последовательного выравнивания Feng и Doolittle, J.Mol. EvoL, 35: 351-360 (1987). Предпочтительно, остатки Asn в положениях 11, 124 и/или 136 замещены Ala. Таким образом, в предпочтительном варианте осуществления вариант ТФ, который образует часть микровезикул, выбирают из группы N11A, N124A, N137A, N11A и N124A, N11A и N137A, N124A и N137A и N11A, N124A и N137A в зрелом ТФ человека. В любом другом ортологе ТФ, мутации будут иметь место в соответствующих остатках Asn, которые образуют консенсусные сайты N-гликозилирования.

Усеченный ТФ с отсутствующим доменом, связывающим FVIIa, мутантный ТФ, несущий нефункциональный домен, связывающий FVIIa, и мутантные ТФ, несущие один или несколько нефункциональных сайтов N-гликозилирования, настоящего изобретения могут быть частью слитого белка, причем указанный слитый белок содержит первый участок, содержащий указанный усеченный ТФ с отсутствующим доменом, связывающим FVIIa, указанный мутантный ТФ, несущий нефункциональный домен, связывающий FVIIa, и указанные мутантные ТФ, несущие один или несколько нефункциональных сайтов N-гликозилирования, настоящего изобретения, связанный со вторым участком, содержащим другой пептид или белок. Указанный второй участок может быть связан с амино-концевым участком указанного усеченного ТФ с отсутствующим доменом, связывающим FVIIa, указанного мутантного ТФ, несущего нефункциональный домен, связывающий FVIIa, и указанных мутантных ТФ, несущих один или несколько нефункциональных сайтов N-гликозилирования, настоящего изобретения, или, альтернативно, указанный второй участок может быть связан с карбокси-концевым участком указанного усеченного ТФ с отсутствующим доменом, связывающим FVIIa, указанного мутантного ТФ, несущего нефункциональный домен, связывающий FVIIa, и указанных мутантных ТФ, несущих один или несколько нефункциональных сайтов N-гликозилирования, настоящего изобретения. Как первый, так и второй участки могут быть связаны напрямую или связаны через линкерный полипептид между указанными первым и вторым участками.

В конкретном варианте осуществления указанный слитый белок содержит усеченный ТФ с отсутствующим доменом, связывающим FVIIa, мутантный ТФ, несущий нефункциональный домен, связывающий FVIIa, или мутантный ТФ, несущий один или несколько нефункциональных сайтов N-гликозилирования, и метку, обычно пептидную метку, связанную с C-концевым или N-концевым доменом указанного усеченного ТФ с отсутствующим доменом, связывающим FVIIa, настоящего изобретения. Как правило, указанная метка представляет собой пептид или аминокислотную последовательность, которую можно использовать при выделении или очистке указанного слитого белка. Иллюстративные, неограничивающие примеры указанных меток указаны выше. В конкретном варианте осуществления указанная метка представляет собой His-метку, связанную с C-концевым доменом указанного белка ТФ. В другом варианте осуществления указанная метка представляет собой His-метку, связанную с N-концевым доменом указанного белка ТФ.

Указанный слитый белок может быть получен с помощью общепринятых средств, например, средствами генной экспрессии нуклеотидной последовательности, кодирующей указанный слитый белок, в подходящей дрожжевой клетке. Возможную метку можно использовать, при желании, для выделения или очистки указанного слитого белка.

Усеченный ТФ с отсутствующим доменом, связывающим FVIIa, мутантный ТФ, несущий нефункциональный домен, связывающий FVIIa, и мутантные ТФ, несущие один или несколько нефункциональных сайтов N-гликозилирования, можно использовать в качестве лекарственного средства, например, в качестве прокоагулянта при лечении геморрагий у субъекта.

Поэтому, в другом аспекте изобретение относится к указанному усеченному ТФ с отсутствующим доменом, связывающим FVIIa, указанному мутантному ТФ, несущему нефункциональный домен, связывающий FVIIa, и указанным мутантным ТФ, несущим один или несколько нефункциональных сайтов N-гликозилирования, в качестве лекарственного средства. В конкретном варианте осуществления изобретение относится к указанному усеченному ТФ с отсутствующим доменом, связывающим FVIIa, указанному мутантному ТФ, несущему нефункциональный домен, связывающий FVIIa, и указанным мутантным ТФ, несущим один или несколько нефункциональных сайтов N-гликозилирования, в качестве лекарственного средства с прокоагулянтной активностью, пригодного для лечения геморрагий у субъекта.

Более того, в другом аспекте изобретение относится к фармацевтической композиции, содержащей усеченный ТФ с отсутствующим доменом, который связывает FVIIa, мутантный ТФ, несущий нефункциональный домен, связывающий FVIIa, или мутантный ТФ, несущий один или несколько нефункциональных сайтов N-гликозилирования, и фармацевтически приемлемый наполнитель. В конкретном варианте осуществления указанная фармацевтическая композиция представляет собой фармацевтическую композицию для местного введения усеченного ТФ с отсутствующим доменом, связывающим FVIIa, мутантного ТФ, несущего нефункциональный домен, связывающий FVIIa, или мутантного ТФ, несущего один или несколько нефункциональных сайтов N-гликозилирования, и фармацевтически приемлемого носителя, пригодного для местного введения указанного усеченного ТФ с отсутствующим доменом, связывающим FVIIa настоящего изобретения, или мутантного ТФ, несущего один или несколько нефункциональных сайтов N-гликозилирования.

В другом аспекте изобретение относится к усеченному ТФ с отсутствующим доменом, связывающим FVIIa, мутантному ТФ, несущему нефункциональный домен, связывающий FVIIa, и мутантным ТФ, несущим один или несколько нефункциональных сайтов N-гликозилирования, для лечения заболевания, которое требует стимуляции клеточной миграции и/или ангиогенеза у субъекта. В другом аспекте изобретение относится к усеченному ТФ с отсутствующим доменом, связывающим FVIIa, мутантному ТФ, несущему нефункциональный домен, связывающий FVIIa, или мутантному ТФ, несущему один или несколько нефункциональных сайтов N-гликозилирования, для стимуляции ангиогенеза или для стимуляции клеточной миграции у нуждающегося в этом субъекта.

Как правило, для введения субъекту, усеченный ТФ с отсутствующим доменом, связывающим FVIIa, мутантный ТФ, несущий нефункциональный домен, связывающий FVIIa, или мутантные ТФ, несущие один или несколько нефункциональных сайтов N-гликозилирования, будут составлены в фармацевтической форме, пригодной для ее местного введения (локального) при лечении геморрагии. Иллюстративные, неограничивающие примеры указанных фармацевтических форм включают аэрозоли, растворы, суспензии, эмульсии, гели, целебные мази, кремы, повязки, пластыри, притирания, полоскания для рта и т.д. С этой целью фармацевтическая композиция, содержащая усеченный ТФ с отсутствующим доменом, связывающим FVIIa, настоящего изобретения будет включать фармацевтически приемлемые носители и эксципиенты, необходимые для получения выбранной формы для фармацевтического введения. Поэтому, в конкретном варианте осуществления фармацевтическая композиция настоящего изобретения содержит, в дополнение к усеченному белку ТФ настоящего изобретения фармацевтически приемлемый наполнитель, что можно найти в галеновых фармацевтических справочниках.

Усеченный ТФ с отсутствующим доменом, связывающим FVIIa настоящего изобретения, мутантный ТФ, несущий нефункциональный домен, связывающий FVIIa, настоящего изобретения и указанные мутантные ТФ, несущие один или несколько нефункциональных сайтов N-гликозилирования настоящего изобретения, будут присутствовать в данной фармацевтической композиции в терапевтически эффективном количестве. Указанное количество может меняться в широких пределах, например, примерно от 1,0 пг активного белка/мл до 1,0 мг активного белка/мл, предпочтительно, от 0,05 мкг активного белка/мл до 10 мкг активного белка/мл и, наиболее предпочтительно, примерно от 0,1 мкг активного белка/мл до 2,0 мкг активного белка/мл.

В другом аспекте изобретение относится к полинуклеотидной последовательности (в дальнейшем обозначаемой как «полинуклеотид настоящего изобретения»), которая кодирует указанный усеченный ТФ с отсутствующим доменом, связывающим FVIIa, указанный мутантный ТФ, несущий нефункциональный домен, связывающий FVIIa, и указанные мутантные ТФ, несущие один или несколько нефункциональных сайтов N-гликозилирования. В другом аспекте изобретение относится к вектору (в дальнейшем обозначаемому как «вектор настоящего изобретения»), который содержит полинуклеотидную последовательность настоящего изобретения. Векторы, пригодные для использования в настоящем изобретении, включают прокариотические экспрессирующие векторы, такие как pUC18, pUC19, Bluescript и его производные mp18, mp19, pBR322, pMB9, CoIE1, pCR1, RP4, фаги и челночный вектор, например, pSA3 и pAT28, дрожжевые экспрессионные векторы, такие как 2 микроплазмиды, встраивающиеся плазмиды, YEP векторы, центромерные плазмиды и т.п., экспрессирующие векторы растений, такие как векторы pIBI, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE и т.п., экспрессирующие векторы клеток насекомых, такие как векторы pAC и pVL, эукариотические экспрессирующие векторы, основанные или на вирусных векторах (аденовирус, аденоассоциированные вирусы, ретровирусы и лентивирус), а также невирусные векторы, такие как pcDNA3, pHCMV/Zeo, pCR3,1, pEFl/His, pIND/GS, pRc/HCMV2, PSV40/Zeo2, pTRACER-HCMV, pUB6/V5-His, pVAXl, pZeoSV2, pCI, pSVL и pKSV-10, pBPV-1, pML2d и pTDTl.

В другом аспекте изобретение относится к клетке-хозяину (в дальнейшем обозначаемой как «клетка-хозяин настоящего изобретения»), которая содержит полинуклеотид настоящего изобретения или вектор настоящего изобретения. Клетки, которые можно использовать для целей настоящего изобретения, предпочтительно представляют собой эукариотические клетки, более предпочтительно, клетки позвоночных или беспозвоночных, клетки насекомых или клетки грибов, наиболее предпочтительно, клетка позвоночного животного представляет собой клетку Xenopus, клетку, выделенную из полосатой перцины, или клетку млекопитающего. Предпочтительно, клетка млекопитающего представляет собой клетку из постоянной клеточной линии, такой как CHO, VERO, BHK, HeLa, COS, MDCK 293, 3T3, WI38 и т.п., эмбриональную стволовую клетку, взрослую стволовую клетку или соматическую клетку.

В другом аспекте изобретение относится к антителу, которое специфически связывается с усеченным ТФ с отсутствующим доменом, связывающим FVIIa, с мутантным ТФ, несущим нефункциональный домен, связывающий FVIIa, или с мутантными ТФ, несущими один или несколько нефункциональных сайтов N-гликозилирования, настоящего изобретения. Подходящие антитела для использования в настоящем изобретении включают «интактные» антитела, которые содержат антигенсвязывающую вариабельную область, а также легкую цепь константного домена (CL) и тяжелые цепи константных доменов, CH1, CH2 и CH3, «Fab» фрагменты, полученные в результате расщепления интактного антитела папаином и которые содержат отдельный антигенсвязывающий сайт и области CL и CH1, «F(ab')2» фрагменты, полученные в результате расщепления интактного антитела пепсином и которые содержат два антигенсвязывающих сайта, причем «Fab'» фрагменты содержат константный домен легкой цепи и первый константный домен (CH1) тяжелой цепи и имеют только один антигенсвязывающий сайт. Фрагменты Fab' отличаются от Fab фрагментов добавкой в несколько остатков на карбоксильном конце CH1 домена тяжелой цепи, включающей один или несколько цистеинов из шарнирной области антитела, «Fv» представляет собой минимальный фрагмент антитела, который содержит полный антигенраспознающий и антигенсвязывающий сайт, одно-цепочечные FV или «scFv» фрагменты антител, которые содержат VL и VH домены антитела, где эти домены присутствуют в отдельной полипептидной цепи, «диатела» содержат вариабельный домен тяжелой цепи (VH), соединенный с вариабельным доменом легкой цепи (VL) на той же полипептидной цепи (VH-VL), соединенной пептидным линкером, который слишком короток, чтобы сделать возможным спаривание между двумя доменами одной и той же цепи, и «биспецифические антитела» (bAb) представляют собой отдельные, двухвалентные антитела (или их иммунотерапевтически эффективные фрагменты), которые имеют два антигенсвязывающих участка с различной специфичностью.

Следующие примеры иллюстрируют изобретение и не должны рассматриваться в качестве его ограничения.

ПРИМЕРЫ

Примеры 1-3 раскрывают синтез в дрожжах прокоагулянтного продукта, основанный на экспрессии (i) зрелого белка ТФ человека, необязательно в форме слитого белка, слитого с гистидиновой меткой (пример 3), (ii) усеченной формы белка ТФ человека, слитой с гистидиновой меткой (пример 4), и (iii) N-гликозилированных мутантов белка ТФ человека (пример 5). Указанные прокоагулянтные продукты, все вместе, для простоты в общем названые в примере 6, микровезикулированным тканевым фактором, микровезикулированным ТФ или мТФ. В примере 2 описана очистка микровезикулированного ТФ.

Пример 6 раскрывает некоторые in vitro анализы, выполненные с целью оценки способности указанного мТФ образовывать фибриновый сгусток у здоровых субъектов и субъектов с гемофилией при различных концентрациях, а также некоторые in vivo анализы, выполненные с целью оценки способности указанного мТФ лечить геморрагии на моделях с тяжелой и летальной геморрагией.

ПРИМЕР 1

Получение прокоагулянтного продукта, основанное на экспрессии полноразмерного белка ТФ в дрожжах (ОДЭ-ТФ)

1.1. Дрожжевой экспрессирующий вектор

Для экспрессии рекомбинантного ТФ из плазмид pG1 (ATCC № 37305) и Yep352 (ATCC № 37673) создавали дрожжевой эписомальный вектор (pTT-10301), следуя стратегии клонирования, изображенной на фиг.1. Плазмида pTT-10301 содержит следующие элементы:

i) ген URA3, который делает возможным отбор рекомбинантных дрожжей при отсутствии урацила в среде для роста,

ii) ген устойчивости к ампициллину (Amp) для отбора и размножения плазмидного вектора в E. coli,

iii) дрожжевой 2-микронный (2 мк) репликатор, который делает возможной эписомальную репликацию вектора в дрожжах,

iv) промотор глицеральдегид-3-фосфатдегидрогеназы (GPD), который контролируют транскрипцию нижерасположенных генов,

v) специфический дрожжевой сигнал терминации транскрипции фосфоглицераткиназы (PGK), и

vi) уникальный участок рестрикции BamHI, который делает возможным клонирование выбранных генов под контролем промотора GPD (pGPD), с идущим за ним стоп последовательностью PGK (PGKt).

На фиг.1A показана карта плазмидного вектора pTT10301. Рестрикционный анализ подтвердил правильное расположение всех элементов в плазмиде, показанной на фиг.1B.

Штамм E. coli DH5α (Stratagene) использовали для амплификации плазмиды. Бактериальные клетки, несущие плазмиду pTT10301, выращивали при 37°C в питательной среде Лурия с ампициллином (LBA) (1% триптон, 1% NaCl, 0,5% дрожжевой экстракт, 50 мг ампициллина на мл). Исходные рекомбинантные бактериальные культуры, содержащие плазмиду pTT-10301, хранили в глицерине при -80°C.

1.2. Рекомбинантный ген

Тканевой фактор (ТФ) представляет собой 295-аминокислотный (а.к.) белок с 32-а.к. лидерной последовательностью. Зрелый белок может быть разделен на три домена: внеклеточный домен (а.к. 33-251), трансмембранная область (а.к. 252-274) и цитоплазматический хвост (а.к. 275-295). На фиг.2 показан график гидрофобности/гидрофильности белка ТФ человека (чТФ).

кДНК, кодирующая зрелый белок чТФ (а.к. 33-295), амплифицировали в виде 816-п.о. фрагмент с помощью полимеразной цепной реакции (ПЦР). Для ПЦР реакции в качестве матрицы использовали библиотеку человеческой плацентарной кДНК (Marathon-Ready cDNA, Clontech Laboratories, Inc.), и олигонуклеотиды A (SEQ ID NO:1) и B (SEQ ID NO:2), отжигаемые, соответственно, на 5' или 3'-конце гена ТФ человека, использовали в качестве праймеров.

На фиг.3 показана отжигаемая последовательность праймеров A (SEQ ID NO:1) и B (SEQ ID NO:2) в последовательности ДНК чТФ (инвентарный номер GenBank BC011029). Праймер, идентифицируемый как SEQ ID NO:1, кодирует первые четыре аминокислоты зрелого чТФ с отсутствующим сигнальным пептидом и содержит инициирующий кодон ATG в рамке с чТФ ОРС.

Условия ПЦР были следующими: 35 циклов ПЦР (94°C, 30с; 45°C 30с; 72°C 1 минута) и конечная стадия элонгации 7 минут при 72°C. Затем ПЦР продукт очищали (Qiagen система очистки ДНК).

1.3. Создание рТФ плазмидного экспрессирующего вектора

ПЦР-амплифицированный фрагмент ДНК, полученный, как указано в разделе 1.2, расщепляли с помощью BamHI для удаления концов, осаждали этанолом и клонировали в вектор pTT10301, предварительно обработанный BamHI. После рестрикционного анализа некоторых клонов выбирали плазмиду, содержащую ген рекомбинантного зрелого чТФ (в дальнейшем обозначаемого как рТФ) в правильной ориентации относительно промотора GDP (pGDP), названную pTT10302 (фиг.4).

ДНК-последовательность рТФ, содержащаяся в плазмиде pTT10302, была на 100% идентична опубликованной последовательности (GenBank №BC011029). ДНК-последовательность ДНК, кодирующей рТФ, установили на автоматическом секвенаторе (ABI prism 370, Applied Biosystems) с использованием праймеров A (SEQ ID NO:1) и B (SEQ ID NO:2) и реактивов Big Dye Terminator. Клетки DH5α E. coli, несущие плазмиду pTT10302, выращивали в течение ночи при 37°C в среде LBA и использовали для получения глицериновых основных растворов, которые хранили при -80°C.

1.4. Экспрессия рТФ с помощью рекомбинантных дрожжей

Для создания рекомбинантных дрожжей, экспрессирующих рекомбинантных зрелый тканевой фактор (рТФ) человека, использовали экспрессирующий вектор pTT10302 для трансформации дрожжевых клеток T73 ura3-.

T73 ura3- являются производным очень хорошо описанного штамма T73 S. cerevisiae, который широко используется при производстве вина. T73 представляет собой диплоидный штамм, выведенный в области Аликант, Испания (Colecciόn Espanola de Cultivos Tipo, номер доступа № CECT1894), и в производстве продуктов питания он коммерциализирован по всему миру компанией Lallemand Inc. (Montreal, Quebec, Canada). Штамм T73 ura3- является производным от T73, в котором обе копии гена URA3 разрушены (J. Agric. Food Chem. 1998. 46, 1689-1693). T73 ura3- представляет собой фенотипически стабильный URA- и безопасный для применения в пище штамм дрожжей, который делает возможным создание T73 рекомбинантных дрожжей с использованием плазмидных векторов, несущих URA3 ген селективного маркера.

Для создания рабочих растворов, клетки T73 ura3- выращивали в чашках Петри и отдельные колонии изолировали и выращивали при 30°C в среде YPD (1% дрожжевой экстракт, 2% бактериологический пептон, 2% глюкоза) до достижения плотности в 107 клеток/мл. Затем дрожжевые клетки осаждали центрифугированием, ресуспендировали в 15% глицерине в минимальной селективной среде (дрожжевой экстракт азотистого основания и полная синтетическая среда без урацила; YNB CSM-URA) и замораживали в аликвотах при -80°C до их использования. Три случайно выбранных аликвоты размораживали и проверяли на отсутствие бактериального загрязнения. Первую, свежую аликвоту T73 ura3- оттаивали и клетки делали восприимчивыми к введению плазмидного вектора согласно протоколу LiAc/SS-ДНК/ПЭГ (Methods in Enzymology 1994. 350:87-96). Такой же стратегии следовали при создании контрольных рекомбинантных дрожжей, содержащих пустую плазмиду pTT10301.

Рекомбинантные клоны дрожжей отбирали по их способности расти в среде без урацила. Восемь независимых клонов трансформировали с помощью pTT10302, изолировали и культивировали в течение ночи в среде без урацила. Полученные культуры рекомбинантных дрожжей, названные yTT10301, осаждали и гомогенизировали с помощью стеклянных гранул. Подобным образом независимые клоны из дрожжей, трансформированных с помощью pTT10301 (названные yTT10300), также подвергали аналогичной процедуре.

Белки из различных клонов обоих типов рекомбинантных дрожжей разделяли электрофорезом в SDS-полиакриламидном геле и переносили на нитроцеллюлозную мембрану, которую подвергали Вестерн-блоттингу. Как показано на фиг.5, все выбранные клоны из культур yTT10301 (клоны 1-8) экспрессировали несколько полипептидов, которые распознавались специфическими моноклональными антителами (mAb) CD142 против ТФ человека (BD Biosciences Pharmingen). Однако ни один из клонов yTT10300 не проявил иммунореактивные полипептиды к специфическим mAb против ТФ человека (дорожка C на фиг.5 соответствует одному из указанных клонов).

Как показано на фиг.5, размер молекул основного иммунореактивного продукта в yTT10301 (дорожки 1-8) составил примерно 35 кДа (отмечено звездочкой). Также можно наблюдать другие продукты с молекулярными массами 44 и 46 кДа (отмечены стрелочками) и большие агрегаты с размером в диапазоне от 70 до 115 кДа (стрелка). Полипептиды с молекулярными массами ниже, чем 35 кДа вероятно соответствуют продуктам деградации рТФ.

Появление нескольких связанных с ТФ продуктов, проявляющих различные электрофоретические подвижности, может быть вызвано или агрегацией белков, или различными степенями гликозилирования, или обоими причинами. Для исследования таких возможностей, экстракты yTT10301 (клон №7) обрабатывали эндогликозилазами Endo H и PNGase F. Как показано на фиг.6, после инкубирования или с Endo H (дорожка 2), или с PNGase F (дорожка 3) самые крупные агрегаты (75-150 кДа) были неявными, хотя продукт в 75 кДа был ясно виден (сравни дорожку 1 с дорожками 2 и 3). Кроме того, белковые полосы 44 и 46 кДа также исчезали после обоих обработок. В образцах, обработанных Endo H (дорожка 2) продукты 44 и 46 кДа похоже дали прирост продукту примерно в 36 кДа. Обработка PNGase F привела к появлению двух полос 37 и 39 кДа (дорожка 3). С другой стороны, продукт 35 кДа оставался неизменным после обработки этими гликозилазами. Таким образом, похоже, что продукт 35 кДа соответствует негликозилированному белку рТФ, и продукт 75 кДа, который можно распознать после обработки эндогликозилазой, может представлять димер негликозилированного белка. Большой агрегат, который наблюдался в необработанных образцах, может соответствовать тому же димеру, но с различными степенями гликозилирования. Подобным образом, белки 44 и 46 кДа похоже соответствуют белку 35 кДа с отличающимися картинами гликозилирования.

Предсказанная молекулярная масса чТФ без сигнального пептида, определенная согласно аминокислотной последовательности, составляет 29,8 кДа. Разница между предсказанной и наблюденной молекулярной массой может быть из-за аномального движения белка в электрофорезе в SDS-полиакриламидном геле ввиду вытягивания гидрофобных аминокислот.

Дополнительно, экспрессию рТФ с помощью yTT10301 анализировали лазерной сканирующей конфокальной микроскопией. Для данных исследований сферопласты (т.е. дрожжи без клеточной стенки, полученные обработкой ферментами) из неэкспрессирующих (yTT10300) и рТФ-экспрессирующих (yTT10301, клон №7) рекомбинантных дрожжей фиксировали и инкубировали или с mAb против ТФ человека, или с mAb против АТФазы мембраны дрожжей. Как показано на фиг.7, mAb против АТФазы специфически метили только поверхность сферопластов (фиг.7A, изображения 1 и 3). Однако mAb против ТФ человека показали сигнал, распространенный по всей клетке, указывая на наличие рТФ не только в плазматической мембране, но также внутри клетки, вероятно ассоциированного с внутренними мембранными компартментами клетки (фиг.7B, изображения 5 и 7). С другой стороны, как показано на фиг.8, в дрожжевых клетках, несущих пустую плазмиду (yTT10300), mAb против АТФазы также давали специфический сигнал на поверхности клетки (фиг.8A, изображение 1), но, как ожидалось, мечение антителами против ТФ человека не определялось (фиг.8B, изображение 3).

Для подтверждения того, что рТФ был белком, ассоциированным с мембраной, дрожжевые клетки yTT10301 обрабатывали буфером для лизиса, содержащим детергент тритон X-114 (до конечной концентрации 1%). После 1 часа инкубации при 4°C лизат наносили на мягкий слой 6% сахарозы, нагретой до 30°C, на 3 мин и центрифугировали при 300×g в течение 3 мин для отделения верхней водной фазы от нижней фазы детергента. Водную фазу собирали и осадок детергента сохранили во льду. После отбора малой аликвоты для последующего анализа, водную фазу подвергали повторной экстракции тритоном X-114. После разделения новой фазы, вторую водную фазу собирали и новый осадок детергента добавляли к предыдущему. Смесь из двух осадков детергента и двух водных фаз анализировали с помощью электрофореза в SDS-полиакриламидном геле и окрашивания кумаси синим (фиг.9A), и с помощью Вестерн-блоттинга с mAb против ТФ человека (фиг.9B). Как показано на фиг.9B, характеристические, полученные из рТФ продукты наблюдались исключительно в фазе детергента (дорожка 4) и ни в одной из двух водных фаз (дорожки 2 и 3). В окрашенном кумаси геле можно видеть, что большинство белков из дрожжевых экстрактов остались в водной фазе (дорожки 2 и 3). Этот результат ясно указывает на то, что рТФ, экспрессированный в yTT10301, ассоциирован с мембраной.

1.5. Ферментация

Для проверки получения дрожжевых экстрактов yTT10301 на предпроизводственном уровне, осуществляли ферментацию в 2-литровом биореакторе (Biostat B-2L. BRAUN). Режим работы и среда для культивирования:

Режим работы: T: 30°C; скорость встряхивания: 250-300 об/мин; pH: 4,5; поток воздуха: 6 л/мин.

Среда для культивирования: CSM-URA: 0,78 г/л; YNB: 6,7 г/л; сахароза: 20 г/л.

На графике на фиг.10 показано изменение основных параметров на всем протяжении процесса ферментации. Изменения давления кислорода (PO2), которое было единственным неконтролируемым параметром, отражает изменения в потреблении кислорода клетками в ходе процесса. Ферментацию останавливали, когда PO2 достигало стационарного уровня (обозначено стрелкой) (18 ч).

Продукт, полученный в результате ферментации, осаждали центрифугированием при 3000 об/мин (1200×g) в течение 10 мин и ресуспендировали в 200 мл буфера для лизиса (25 мМ PIPES (pH 7,8), 50 мМ NaCl). Дрожжи гомогенизировали с помощью высокого давления (1000 бар (108 Па)) (гомогенизатор NIRO SOAVIS. Panda 2K), гомогенат центрифугировали при 13000 об/мин (13000×g) в течение 30 мин при 4°C и осадок (50 мл) и супернатант очищенного дрожжевого экстракта (ОДЭ) (150 мл) собирали раздельно. Общая схема способа представлена на фиг.11.

Концентрацию белка в обоих препаратах измеряли с помощью стандартного колориметрического BCA теста (Pierce), и присутствие рТФ определяли с помощью Вестерн-блоттинга. Результаты данных тестов показали, что концентрация общего белка была сходной в обоих образцах (осадок: 3,8 мг/мл и ОДЭ: 3,9 мг/мл), и, таким образом, количество обнаруженного с помощью Вестерн-блоттинга рТФ также было равным в ОДЭ и в осадке, как показано на фиг.12.

Прокоагулянтная активность, которую определяли, как описано в примере 4, в ОДЭ и в осадке также была сходной, когда оба образца анализировали в день их приготовления (1,400 нг/мл активного рТФ), но стабильность рТФ была значительно ниже в экстрактах из осадка (1,500 против 199 нг/мл) на четвертый день после приготовления, вероятно из-за присутствия протеазы в указанной фракции. Таким образом, фракция ОДЭ была выбрана для последующего получения готовых препаратов лекарственного средства.

1.6. Электронная микроскопия

Для лучшего описания ОДЭ продукта проводили иммуноэлектронное микроскопическое исследование. Изучение образцов ОДЭ с помощью электронного микроскопа (ЭМ) показало присутствие большого количества полученных из дрожжей везикул различных размеров (в диапазоне от 0,1 до 0,01 мкм). Примерно 5-10% везикул были мечены mAb против ТФ человека, что было заметно по наличию частиц золота по их периметру (обозначено стрелками) (фиг.13). С другой стороны, в контрольных сетках, которые инкубировали с неродственными mAb, наблюдалось очень мало частиц золота, и они не были связаны с везикулами (не показано).

Точно установлено, что оптимальная активность свертывания крови требует соединения ТФ с липидами (Thromb. Haemost. 2001; 86: 66-74), и так как дрожжевые экстракты без экспрессии ТФ из yTT10300 не проявляли какой-либо прокоагулянтной активности, полученные результаты указывали на то, что прокоагулянтная активность ОДЭ принадлежит липидированному рТФ, полученному в результате связывания рТФ с полученными из дрожжей мембранными микровезикулами, в дальнейшем обозначаемыми как ОДЭ-ТФ (т.е. фракция ОДЭ, обладающая прокоагулянтной активностью, содержащая рТФ в ассоциации с полученными из дрожжей мембранными микровезикулами).

ПРИМЕР 2

Получение прокоагулянтного продукта, обогащенного в микровезикулах, содержащих полноразмерный ТФ (мТФ)

2.1 Очистка

Очищенный дрожжевой экстракт, содержащий рТФ (в дальнейшем обозначаемый как ОДЭ-ТФ), полученный из yTT10301, получали, следуя описанной выше методике (пример 1, разделы 1.1-1.5). ОДЭ-ТФ подвергали следующим стадиям тангенциального поточного фильтрования в системе тангенциальной фильтрации (Sartorius sartoflow Slice 200 Benchtop) с использованием фильтров с постепенным снижением размера пор (0,45 мкм, 0,2 мкм и 0,1 мкм мембраны (Sartorius, полисульфон). Схема осуществляемой методики изображена на фиг.14A.

Для очистки микровезикул, содержащих рТФ (мТФ), 10 мл профильтрованного ОДЭ-ТФ экстракта, соответствующего микровезикулам с размером от 0,1 до 0,2 мкМ (0,1 мкМ концентрат), загружали на колонку для эксклюзионной хроматографии (Sephacryl S500column -HR (60 см-26 мм, 320 мл - General Electric), предварительно уравновешенную Фосфатным буфером и соединенную с системой AKTA-FPLC. Элюирование проводили при скорости потока 1 мл/мин с использованием того же буфера и собирали 42 фракции по 4 мл каждая. За картиной элюирования наблюдали с помощью измерения оптической плотности фракций при 280 нм.

Хроматографические профили, полученные в различных экспериментах с очисткой были сходными. График на фиг.15 показывает репрезентативный хроматографический профиль.

Аликвоты из каждой фракции анализировали с помощью Вестерн-блоттинга и с помощью теста на активность для определения тех фракций, которые обладают прокоагулянтной активностью. На фиг.16 показано, что фракции 5-25, которые аккумулировали мТФ, что наблюдалось при Вестерн-блоттинге, также были фракциями, где активность была повышена (таблица 1).

Таблица 1
Прокоагулянтная активность мТФ во фракциях 5-42, полученных после очистки исключением по размеру
Фракция Активность нгТФ/мл Фракция Активность нгТФ/мл
F.5 169 F.23 171
F.6 236 F.24 146
F.7 353 F.25 106
F.8 298 F.26 32
F.9 261 F.27 3
F.10 246 F.28 0
F.11 197 F.29 0
F.12 237 F.30 0
F.13 239 F.31 0
F.14 261 F.32 0
F.15 241 F.33 0
F.16 125 F.34 0
F.17 269 F.35 0
F.18 312 F.36 0
F.19 263 F.37 0
F.20 265 F.38 0
F.21 282 F.39 0
F.22 248 F.40 0
F.23 171 F.41 0
F.24 146 F.42 0
F.25 106 F.43 0

Наконец, для повышения активности фракции 5-43 из каждого процесса очистки объединяли и снова подвергали ТПФ через 0,1 мкм фильтр. С помощью такого приема можно получить воспроизводимые партии (14.31, 14.32, 15.32, 15.36) биологически активного мТФ, как показано в таблице 2, и все полученные партии показывают сходный белковый профиль (фиг.17).

Таблица 2
Сравнение содержания общего белка и прокоагулянтной активности среди партий
Общий белок, мкг/мл Активный белок, нг/мл
мТФ партия 14.31 346 709
мТФ партия 14.32 283 659
мТФ партия 15.32 271 745
мТФ партия 15.36 342 718

2.2. Биохимическая характеристика микровезикул, содержащих рТФ, очищенных с помощью исключающей по размеру хроматографии

2.2.1. Содержание белка

Микровезикулы, в которые встроен рТФ, в дополнение к рТФ содержат другие интегральные мембранные белки, полученные из дрожжевой клетки-хозяина. Содержание белка в различных партиях очищенного мТФ анализировали с помощью электрофореза в SDS-полиакриламидном геле и окрашивания кумаси синим (фиг.17A). Визуальное сравнение окрашенного геля показывает, что белковые профили различных партий были почти одинаковыми. Для выполнения более точного сравнительного анализа гель сканировали и каждую дорожку геля подвергали денситометрии, и график показывает пики, соответствующие различным белковым полосам, и относительную интенсивность каждого белка получали для каждой партии. Белковые профили четырех партий, изображенных на фиг.17 (панель B), были крайне похожими.

2.2.2. Содержание липидов

Содержание липидов в очищенном мТФ анализировали с помощью тонкослойной хроматографии, следуя методике, описанной Hara и Radin (Anal. Biochem. 1978, 90: 420-426), с некоторыми модификациями (Rodriguez-Sureda y Peinado-Onsurbe, 2005, Anal.Biochem. 343: 277-282). По существу, 120 мг лиофилизированного продукта в стеклянной трубке растворяли в 1 мл смеси гексана и изопропанола (3:2, об:об). Флакон, защищенный от света во избежание окисления липидов, выдерживали в орбитальном встряхивателе в течение 24 ч. В это время 0,3 мл добавляли сульфата натрия (0,47M). Для облегчения фазового разделения образец центрифугировали. Верхняя фаза (гексан) содержит неполярные липиды, тогда как полярные липиды, такие как фосфолипиды, обнаружены близко интерфазе. Верхнюю фазу переносили в другой флакон и выпаривали с использованием газообразного азота во избежание окисления липидов. Сухой экстракт, содержащий липиды, растворяли в хлороформе (0,2 мл). ТСХ проводили на пластине с силикагелем с использованием в качестве подвижной фазы смеси хлороформ:метанол и вода (Х:М:В, 345:133:21, об:об:об). Параллельно с образцами в тех же условиях анализировали липидные эталоны. После того, как образцы пропустили по пластинам, липиды визуализировали добавлением паров йода. Идентификацию различных липидных компонентов в образцах осуществляли, сравнивая их подвижность относительно эталонов.

Таким же способом можно определить, что как ОДЭ-ТФ (партия 91) при различных концентрациях 5, 10 и 20 мкг/мл), так и очищенный продукт содержат (партия 14.31 при 5, 10 и 20 мкг/мл) сложный набор липидов, включая триацилглицериды, эргостерол, фосфатидилэтаноламин, кардиолипин, фосфатидиновую кислоту, фосфатидилхолин, фосфатидилсерин/фосфатидилинозит (фиг.18). Липидный профиль микровезикулы, содержащей рТФ, отличается от профиля, полученного из релипидизированного рТФ, полученного встраиванием рТФ в синтетические липосомы, следуя методикам, описанным, среди прочих, Waters, E.K. и Morrisey, J.H. (Biochemistry, 2006, 45:3769-3774), Brucato, C. et al (Protein Expression and Purification, 1998, 26:386-393), WO9848283 и Guha, A. et al (Proc.Natl.Acad.Sic.USA, 1986, 83:299-302). Поскольку синтетические липосомы, описанные во всех приведенных ссылках, содержат в основном комбинацию фосфатидилхолина и фосфатидилсерина, или фосфатидилхолина, фосфатидилсерина и фосфатидилэтаноламина, полученные из дрожжей микровезикулы, очищенные по настоящему изобретению, содержат дополнительные компоненты, такие как эргостерол и кардиолипин, которые не были обнаружены в липосомах, содержащих рТФ.

ПРИМЕР 3

Получение прокоагулянтного продукта, основанный на экспрессии полноразмерного белка ТФ, модифицированного гистидиновой меткой, в дрожжах (6HT-ТФ)

3.1. Получение рТФ, содержащего 6×His-метку на карбокси-конце

Очистка аффинной хроматографией белков, содержащих гистидиновую метку (His-метка) или на C-, или на N-конце, является хорошо стандартизованным способом, который экстенсивно использовался для получения препаратов большого количества белков высокой степени очистки. Как любой хроматографический способ, данная методика может быть легко масштабирована. По этой причине синтезировали рТФ, содержащий 6×His-метку на карбокси-конце.

3.2. Создание плазмидного экспрессирующего вектора с рТФ-His-меткой

кДНК, кодирующая зрелый белок чТФ (а.к. 33-295) с 18 дополнительными нуклеотидами (кодирующими шесть гистидинов) на 3'-конце, амплифицировали в виде фрагмента в 842 п.о. с помощью ПЦР. Для данной реакции следовали стратегии, описанной в примере 1 (разделы 1.2 и 1.3). Таким образом, в качестве матрицы использовали библиотеку плацентарной кДНК человека (Marathon-Ready cDNA, Clontech Laboratories, Inc.) и в качестве праймеров использовали олигонуклеотиды A (SEQ ID NO:1) и E (SEQ ID NO:3). В олигонуклеотиде E (SEQ ID NO:3) концевой кодон (TAA) ДНК последовательности чТФ заменяли нуклеотидной последовательностью, кодирующей 6 остатков гистидина с последующим новым концевым кодоном (TAG). На фиг.19 показано расположение праймеров A (SEQ ID NO:1) и E (SEQ ID NO:3) в ДНК последовательности чТФ (GenBank инвентарный № BC011029).

После 35 циклов ПЦР (94°C, 30с, 45°C 30с, 72°C 1 мин) и конечной стадии элонгации 7 мин при 72°C ДНК продукт с ожидаемым размером очищали (Qiagen система очистки ДНК). Амплифицированный с помощью ПЦР фрагмент ДНК расщепляли с помощью BamHI для удаления концов, осаждали этанолом и клонировали в вектор pTT10301, предварительно расщепленный с помощью BamHI. После рестрикционного анализа нескольких клонов выбирали плазмиду pTT10303, содержащую рекомбинантный ген чТФ-His-метка в правильной ориентации относительно промотора GDP (pGDP) (фиг.20).

Авторы дополнительно подтвердили, что ДНК последовательность рекомбинантного чТФ-His-метка, клонированного в pTT10301, была на 100% идентична опубликованной ранее ДНК последовательности чТФ (GenBank №BC011029), и что она содержала 18 дополнительных нуклеотидов на 3'-конце. Анализ ДНК последовательности рекомбинантного чТФ-His-метка осуществляли в автоматическом секвенаторе (ABI prism 370, Applied Biosystems) с использованием праймеров A (SEQ ID NO:1) и E (SEQ ID NO:3) и реактивов Big Dye Terminator. Клетки DH5α, несущие плазмиду pTT10303, выращивали в течение ночи при 37°C в среде LBA и использовали для получения глицериновых основных растворов.

3.3. Экспрессия рТФ-His-метки

Для создания рекомбинантных дрожжей, экспрессирующих рекомбинантный зрелый чТФ-His-метка (рТФ-His-метка), экспрессирующий вектор pTT10303 использовали для трансформации дрожжевых клеток T73 ura3-, как описано в примере 1 (раздел 1.4). Рекомбинантные дрожжевые клоны (названные yTT10302) отбирали по их способности расти в среде без урацила. Пять независимых клонов yTT10302 изолировали и культивировали в течение ночи в среде без урацила. Вестерн-блоттинг показал, что все выбранные клоны экспрессировали полипептиды, распознанные mAb против ТФ человека (фиг.21). На фиг.22 показан профиль экспрессии рТФ-His-метка для выбранного клона (yTT10302 клон №5) в сравнении с экстрактами рекомбинантных дрожжей yTT10300 и yTT10301. Как показано, молекулярные размеры анти-ТФ иммунореактивных продуктов, экспрессируемых yTT10302, составляли примерно 36, 38, 45, 47 и 49 кДа (отмечены стрелками), хотя также можно наблюдать другие агрегаты с большой молекулярной массой (примерно 100-115 кДа) (стрелка). Как в случае с дрожжевыми экстрактами yTT10301, эти различия в подвижности соответствовали различным степеням гликозилирования рТФ, как это показано на фиг.20.

3.4. Очистка рТФ-His-метки с помощью хроматографии

3.4.1. Очистка

Очистку рТФ-His-метки начинали с очищенных экстрактов, содержащих рТФ-His-метку (в дальнейшем обозначаемый как ОДЭ-6HT-ТФ), полученную из yTT10302, следуя описанной выше методике (пример 1, раздел 1.5). Указанный ОДЭ-6HT-ТФ фильтровали через фильтр с размером пор 0,2 мкм посредством тангенциального поточного фильтрования перед загрузкой в 5 мл колонку для аффинной хроматографии HiTrap® (Pharmacia Biotech), которую предварительно промывали водой и уравновешивали стартовым буфером (20 мМ фосфатный буфер, 500 мМ NaCl, pH 7,4). После внесения образца собирали фильтрат (несвязанный материал), и колонку промывали три раза: первый раз 40 мл стартового буфера (20 мМ фосфатный буфер, 500 мМ NaCl, pH 7,4); второй раз 40 мл стартового буфера, содержащего 10 мМ имидазол; и третий раз 40 мл стартового буфера с добавлением 100 мМ имидазола. После последнего промывания микровезикулированный белок рТФ-His-метка, названный 6HT-ТФ, элюировали добавлением в колонку 25 мл стартового буфера, содержащего 1M имидазол, и собирали элюированные фракции (фракции №1, №2, №3 и №4) по 2,5 мл. Общая схема способа изображена на фиг.23.

Фракции диализировали в буфере для диализа (20 мМ фосфатный буфер, 50 мМ NaCl, pH 7,4), и исходный экстракт, несвязанный материал, последний смыв перед элюированием и четыре диализированные элюированные фракции анализировали с помощью электрофореза в SDS-полиакриламидном геле и окрашивания серебром или с помощью Вестерн-блоттинга. Как было показано в Вестерн-блоттинге на фиг.24A, после связывания 6HT-ТФ с колонкой, продукт может быть успешно собран в основном в первых трех элюированных фракциях (дорожки 4-6). Примечательно, что когда белки из одних и тех же образцов визуализировались окрашиванием серебром в геле (фиг.24B), белковые полосы можно было наблюдать только на дорожках, соответствующих стартовому дрожжевому экстракту (дорожка 1) и несвязанному материалу (дорожка 2), но не в элюированных фракциях (дорожки 4-7). Кроме того, количество общего белка в данных образцах было ниже предела обнаружения стандартного реактива BCA (20 мкг/мл).

Полученные результаты, вместе с результатами Вестерн-блоттинга, ясно показали, что высоко очищенный 6HT-ТФ продукт может быть получен данным методом аффинной хроматографии. Наиболее важно то, что диализированные элюированные фракции №1-3 сохраняли прокоагулянтную активность, которую определяли, как описано в примере 4, и поразительно, что фракция №1 показала практически такую же прокоагулянтную активность, как стартовый экстракт ОДЭ-6HT-ТФ. Как ожидалось, фракция, содержащая меньшее количество иммунореактивного белка рТФ (фракция №4, дорожка 7) не показала какой-либо прокоагулянтной активности.

Различия в концентрациях общего белка в сравнении с активностью в данных двух образцах могут быть суммированы следующим образом

Концентрация общего белка (мг/мл) Концентрация рТФ (нг/мл)
ОДЭ-6HT-ТФ 6,2 275
фракция №1 6HT-ТФ НО* 252
НО*: не определяется стандартным колориметрическим тестом (BCA) (предел обнаружения 20 мкг/мл)

3.4.2. Аналитические способы

Как показано в Вестерн-блоттинге на фиг.19, 6HT-ТФ продукт в элюированных фракциях состоял, подобно цельному дрожжевому экстракту, из нескольких белковых полос с переменным размером, что, вероятно, происходило из-за различного гликозилирования белка рТФ-His-метка. Для изучения такой возможности, элюированную фракцию №1 обрабатывали эндогликозилазой. В кратком изложении, экстракты дрожжей, экспрессирующих рТФ (yTT10301), обработанные 500 единицами (ЕД) эндогликозидазы H (Endo H) или N-гликозидазы F (PNGase F) в течение 1ч при 37°C дополнительно анализировали с помощью Вестерн-блоттинга с mAb против ТФ человека. На фиг.25 показано, что после обработки или PNGase F (дорожка 2), или Endo H (дорожка 3) белковые полосы 45, 47 и 49 кДа отсутствовали при обеих обработках. После инкубирования с PNGase F наблюдались только два полипептида, 36 и 38 кДа, которые были усилены, скорее всего, из-за дегликозилирования продуктов 45, 47 и 49 кДа (сравни дорожки 1 и 2). Обработка с помощью Endo H давала прирост единственному иммунореактивному продукту в 36 кДа (дорожка 3), который соответствовал негликозилированному белку рТФ-His-метка.

Кроме того, очищенный 6HT-ТФ анализировали с помощью ЭМ после того, как подвергали иммуноокрашиванию с помощью mAb против ТФ человека, как описано в примере 1 (раздел 1.6). Как показано на фиг.26, можно наблюдать большое количество частиц золота, большая часть которых была ассоциирована с малыми везикулами нормального размера. В сходном подвергнутом параллельному анализу образце из дрожжей, не экспрессирующих рТФ, количество частиц золота было сильно снижено (не показано). Этот результат указывает на то, что метод аффинной хроматографии, использованный для очистки 6HT-ТФ продукта, делает возможным выделение биологически активного 6HT-ТФ, который ассоциирован с полученными из дрожжей мембранными микровезикулами.

ПРИМЕР 4

Получение прокоагулянтного продукта, основанное на экспрессии усеченной формы белка чТФ в дрожжах (ОДЭ-УТФ)

4.1. Создание плазмидного экспрессирующего вектора с усеченным ТФ-His-метка (УТФ-His-метка)

кДНК, кодирующую усеченную форму белка чТФ (УТФ), содержащую домен для взаимодействия с фактором X (а.к. 174-251), трансмембранную область (а.к. 252-274) и цитоплазматический хвост (а.к. 275-295) с 18 дополнительными нуклеотидами (кодирующими шесть гистидинов) на 3'-конце, амплифицировали в виде фрагмента в 398 п.о. с помощью ПЦР. Следовали стратегии, сходной с описанной в примере 1 (разделы 1.2 и 1.3). Таким образом, библиотеку плацентарной кДНК человека (Marathon-Ready cDNA, Clontech Laboratories, Inc.) использовали в качестве матрицы, и олигонуклеотиды F и E использовали в качестве праймеров. В олигонуклеотиде E, концевой кодон (TAA) ДНК последовательности чТФ заменяли нуклеотидной последовательностью, кодирующей 6 остатков гистидина с последующим новым концевым кодоном (TAG). На фиг.28 показано расположение праймеров F и E в ДНК последовательности чТФ (GenBank инвентарный № BC011029).

После 35 циклов ПЦР (94°C, 30с, 45°C 30с, 72°C 1 мин) и конечной стадии элонгации 7 мин при 72°C, ДНК продукт с ожидаемым размером очищали (Qiagen система очистки ДНК).

Амплифицированный с помощью ПЦР фрагмент ДНК расщепляли с помощью BamHI для удаления концов, осаждали этанолом и клонировали в вектор pTT10301, предварительно расщепленный с помощью BamHI. После рестрикционного анализа нескольких клонов, выбирали плазмиду pTT10304, содержащую рекомбинантный ген УТФ-His-метка в правильной ориентации относительно промоторов GDP (pGDP) (фиг.29).

Авторы дополнительно подтвердили то, что ДНК последовательность рТФ-His-метка, клонированная в pTT10301, была на 100% идентична ранее опубликованной последовательности (GenBank №BC011029) и что она содержит ожидаемые 18 дополнительных нуклеотидов на 3'-конце (фиг.25). Клетки DH5α, несущие плазмиду pTT10304, выращивали в течение ночи при 37°C в среде LBA и использовали для получения глицериновых основных растворов.

4.2. Экспрессия рУТФ-His-метка рекомбинантными дрожжами

Для создания рекомбинантных дрожжей, экспрессирующих рекомбинантный усеченный ТФ-His-метка человека (рУТФ-His-метка), экспрессирующий вектор pTT10304 использовали для трансформации дрожжевых клеток T73 ura3-, как описано в примере 1 (раздел 1.4). Рекомбинантные дрожжевые клоны (названные yTT10304) отбирали по их способности расти в среде без урацила.

Для экспрессии рУТФ-His-метка, очищенные дрожжевые экстракты (ОДЭ), полученные из yTT10304, следуя методике, описанной в примере 1 (раздел 1.5), обладающие прокоагулянтной активностью, названные ОДЭ-УТФ (т.е. очищенный дрожжевой экстракт (ОДЭ), содержащий микровезикулированный усеченный тканевой фактор (УТФ)), готовили и анализировали на предмет активности, как описано в примере 1.

ПРИМЕР 5

Создание плазмидного экспрессирующего вектора с N-гликозилированным мутантным ТФ

ТФ проявляет три различных остатка, в которых имеет место N-гликозилирование, а именно N11, N124 и N137. Отдельные мутанты, затронувшие эти остатки (N11A, N124A и N 137A), и все возможные их сочетания, созданы с использованием стандартных методик (фиг.30).

Олигонуклеотид-направленный мутагенез

Стандартную ПЦР реакция с использованием олигонуклеотидов, перечисленных в таблице 3, использовали для создания различных мутантов (Current Protocols in Molecular Biology, chapter 15th). Плазмиду pTT10302 использовали в качестве ДНК матрицы, и Pfu использовали в качестве полимеразы, так как она показывает очень высокую точность и низкий уровень ошибок.

Таблица 3
Последовательность олигонуклеотидов, использованных для создания гликозилированных мутантов в ТФ. Ala обозначает аланин, и Asn обозначает аспарагин
Название Расположение аминокислоты-замена Направление Последовательность олигонуклеотида 5-3'
TT-7071 11-Asn на Ala прямой TGACACCGTCGTATACGTAATTGAACCTTTAGT
TT7075 11-Asn на Ala обратный ACTGTGGCAGCATATCGATTAACTTGGAAATCA
TT-7072 124-Asn на Ala прямой ATCTTCTACGGTCACTGCCACTTTTGTTCCCAC
TT-7076 124-Asn на Ala обратный GTGGGAACAAAAGTGGCAGTGACCGTAGAAGAT
TPM1 137-Asn на Ala прямой ACTTTAGTCAGTTGGGCAAACACTTTCCTAAGC
TPM2 137-Asn на Ala обратный GCTTAGGAAAGTGTTTGCCCTTCTGACTAAAGT

Результаты

Точечные мутации в ТФ, повреждающие сайты гликозилирования

На фиг.31 показано сравнение профиля различных мутантов по сайтам гликозилирования с диким типом с помощью Вестерн-блоттинга с mAb против ТФ. Как показано, у них всех различается профиль, и при обработке гликозилазами, все полосы превращаются в одну, что означает, что наблюденные профили возникают из-за различного состояния гликозилирования.

Определяли коагуляционную активность таких мутантов и данные суммированы в таблице 4. Все данные были нормализованы относительно дикого типа, чья активность и экспрессия были приняты за 100. Отдельные мутации как в 11 (ТМ1), так и в 124 (ТМ2) показали увеличение активности, хотя удивительно, что наиболее поразительный эффект наблюдался при мутации 124 остатка, так как его активность и экспрессия были значительно увеличены (в 6 и в 2 раза, соответственно). Активность таких двойных мутантов и тройных мутантов, включавших ТМ2, также увеличилась.

Таблица 4
Относительная активность и экспрессия различных мутантов в сайтах гликозилирования по сравнению с 6HT-ТФ дикого типа
Относительная активность Относительная экспрессия
ТМ/6H-ТФ*100 ТМ/6H-ТФ*100
WT 100 100
PM1 190 48
PM2 602 194
PM3 64 67
PM1 и 2 206 52
PM1 и 3 0 15
PM2 и 3 114 108
PM1 и 2 и 3 294 12
ТМ = точечная мутация

ПРИМЕР 6

Оценка прокоагулянтной активности микровезикулированного тканевого фактора (мТФ)

Для простоты, в данном примере «микровезикулированный тканевой фактор», «микровезикулированный ТФ» или «мТФ» указывают, в основном, на тканевой фактор, модифицированный тканевой фактор (посредством замены, удаления, добавления или подмены одной или нескольких аминокислот), слитый белок, содержащий тканевой фактор или усеченный тканевой фактор с отсутствующим частично или полностью доменом, связывающим с FVIIa, все они полностью или частично гликозилированы и ассоциированы с полученными из дрожжей микровезикулами (т.е. интегрированы в липидный слой микровезикул), если не указано иное.

С целью оценки прокоагулянтной активности микровезикулированного тканевого фактора, предоставленного настоящим изобретением, выполняли серию анализов in vitro и in vivo, а именно:

1. In vitro анализы, показывающие, что микровезикулированный ТФ вызывает образование фибринового сгустка и свертыванию крови как в здоровом, так и в патологическом состоянии

1.1 Коагуляционные тесты в плазме от здоровых субъектов.

1.2 Сравнение прокоагулянтного эффекта везикул, очищенных с помощью гель-фильтрации, и релипидированного ТФ.

1.3 Коагуляционные тесты в плазме с недостаточностью FVIII, FIX или FXI.

1.4 Коагуляционные тесты в плазме при тромбоцитопении.

1.5 Коагуляционные тесты в плазме из плазмы с дефицитом FVIII, FIX и FXI в присутствие антител против FVII.

1.6 Коагуляционные тесты в цельной крови без добавления антикоагулянтов от здоровых субъектов.

1.7 Коагуляционные тесты в цельной крови без добавления антикоагулянтов от пациентов с гемофилией (коагуляционные тесты в цельной крови без добавления антикоагулянтов).

2. In vivo тесты, демонстрирующие, что микровезикулированный ТФ является средством, полезным для местного антигеморрагического лечения на моделях с тяжелой геморрагией (посредством применения его прямо в предварительно разрезанном кровеносном сосуде)

2.1 Тест на животной модели с тяжелой геморрагией посредством проксимального надреза хвоста крысы.

2.2 Тест на животной модели с тяжелой геморрагией, предварительно обработанной гепарином.

3. In vivo тесты, показывающие что микровезикулированный ТФ является средством, полезным для местного антигеморрагического лечения на моделях с летальной геморрагией (посредством применения прямо на предварительно разрезанный кровеносный сосуд)

3.1 Тест на животной модели с летальной геморрагией посредством проксимального надреза хвоста мыши с дефицитом FVIII.

I. МАТЕРИАЛЫ И СПОСОБЫ

Материалы

В качестве источника микровезикулированного тканевого фактора (мТФ) использовали три различных соединения:

(i) очищенные дрожжевые экстракты, содержащие микровезикулированный ТФ (ОДЭ-ТФ), полученный согласно примеру 1;

(ii) очищенный микровезикулированный слитый белок ТФ-гексагистидиновая метка (6HT-ТФ), полученный согласно примеру 2; и

(iii) очищенный дрожжевой экстракт, содержащий микровезикулированный усеченный тканевой фактор (ОДЭ-УТФ), полученный согласно примеру 3;

Коммерческие образцы плазмы с недостаточностями факторов свертывания FVIII, FIX и FXI были приобретены у Dade Behring Marburg GmbH.

Коммерческие моноклональные антитела против FVII человека (клон HVII-1) были приобретены у Sigma Aldrich.

Коммерческие мыши с гемофилией (аллель: F8tmlKaz; общее название MFVIII-16; мутированные Haig H Kazazian; ссылка: Bi L; Lawler AM; Antonarakis SE; High KA; Gearhart JD; Kazazian HH Jr. 1995. Направленное разрушение мышиного гена фактора VIII дает модель гемофилии A, Nat. Genet. 10:119-21) были приобретены у Jackson Laboratory.

Коммерческий рТФ был от American Diagnostica.

Образцы плазмы от пяти здоровых доноров были получены из Blood Bank of Vall d'Hebrόn Hospital, Department «Banc de Sang i Teixits» (Pg,Vall d'Hebrόn, 119-129, 08035 Barcelona). Образцы плазмы проверяли на вирус гепатита B (HBV), вирус гепатита C (HCV), ВИЧ и тест гемаглютинации бледной трепонемы (TPHA), и все были отрицательными. Пять образцов плазмы объединяли и замораживали при -20°C в 1,5 мл флаконах до их использования.

Способы

Релипидирование рТФ

Коммерческий рТФ (American Diagnostica) релипидировали, следуя стандартной методике, описанной Morrissey (http://www.tf7.org/relipidation2.pdf), в которой рТФ встраивается в фосфолипидные липосомы. Количество рТФ, присутствующего в образцах, измеряли с помощью IMUBIND Tissue Factor ELISA Kit из American Diagnostica Inc. (No. 845) и следуя инструкции продавца.

In vitro анализы

Для того, чтобы определить, отсутствует в микровезикулированном усеченном тканевом факторе часть или целый домен, связывающийся с FVII, и чтобы узнать, является ли он все еще активным, во-первых, проводили тест на связывание микровезикулированного усеченного тканевого фактора с FVIIa для того, чтобы определить, может ли связывание микровезикулированного усеченного тканевого фактора с FVIIa быть определено или нет, и, во-вторых, можно использовать коагуляционный тест в плазме для определения, является ли микровезикулированный усеченный тканевой фактор все еще активным в качестве прокоагулянта.

Тест на связывание микровезикулированного усеченного тканевого фактора с FVIIa

Для определения взаимодействия между или очищенным микровезикулированным меченным гексагистидином слитым белком ТФ (6HT-ТФ), очищенными дрожжевыми экстрактами, содержащими микровезикулированный ТФ (ОДЭ-ТФ), или очищенными дрожжевыми экстрактами, содержащими микровезикулированный усеченный ТФ (ОДЭ-УТФ), и фактором свертывания VIIa (FVIIa), следовали модифицированной версии способа, описанного в международной публикации WO 00/04148. Подобным образом, связывание 6H-ТФ, ОДЭ-ТФ или ОДЭ-УТФ с биотинилированным FVIIa оценивали в тесте ELISA. Для этого биотинилированный FVIIa (BEGR-7a) готовили, как описано ранее (Kelley et ah, 1995 Biochem. 34:10383-10392). Затем 96 луночные микротитровальные планшеты покрывали BEGR-7a с использованием стрептавидина в качестве агента захвата. Лунки промывали дважды 0,05% Tween 20 в дистиллированной воде и блокировали PBS, содержащим 1% нежирное сухое молоко (блокирующий раствор), в течение 2 ч. После этого, десятикратные разведения 6HT-ТФ, ОДЭ-ТФ или ОДЭ-УТФ, начиная при концентрации 10 мкг/мл, готовили в буфере TNC (20 мМ Tris, pH 7,5, 100 мМ NaCl, 5 мМ CaCl2), содержащем фиксированное количество или стрептавидина, конъюгированного с BEGR-7a, или одного стрептавидина, добавляли в лунки. После 2 ч инкубации при комнатной температуре, лунки снова промывали 0,05% Tween 20 для удаления несвязанного материала. Для обнаружения комплекса ТФ-FVIIa в различных растворах, содержащих ТФ, использовали специфические поликлональные антисыворотки кролика против ТФ. Для этого, разведение 1:500 растворов сывороток против ТФ добавляли в лунки и инкубировали 2 ч при 37°C. Планшеты промывали пять раз, прежде чем добавляли антитела для детектирования. Конъюгированное с пероксидазой антитело козы против иммуноглобулина G (IgG) кролика (Southern Biotechnology Associated) разводили 1:1000 в блокирующем растворе и инкубировали в течение 1 ч при 37°C. Планшеты снова промывали пять раз и для развития реакции использовали пероксид водорода и ортофенилендиамин (OPD) 0,05%. После инкубации в течение 10-15 мин при комнатной температуре, реакцию останавливали добавлением H2SO4 (2н.) и оптическую плотность измеряли при 492 нм на планшет-ридере Multiskan Plus (Labsystem).

Коагуляционные тесты в плазме

Спонтанную прокоагулянтную активность (нестимулированную) в плазме измеряли посредством двухстадийного коагуляционного теста в 4-канальном коагулометре (Start 4, Diagnostica Stago). В кратком изложении, 50 мкл плазмы, бедной тромбоцитами, добавляли в уже подвергнутые температурному воздействию кюветы и добавляли 50 мкл образца (мТФ или дистиллированной воды в качестве контроля). Полученную смесь оставляли инкубироваться в течение 60 секунд при 37°C, незамедлительно добавляли 50 мкл 25 мМ хлорида кальция и в коагулометре определяли время свертывания в секундах, подтвержденное образованием сгустка. Образцы бедной тромбоцитами плазмы получали центрифугированием и количество тромбоцитов определяли с помощью Coulter.

Прокоагулянтное действие мТФ на образцы плазмы с дефицитом факторов свертывания (FVIII, FIX или FXI), соответствующих гемофилиям A, B или C, соответственно, исследовали с использованием коммерческих образцов плазмы (Dade Behring Marburg GmbH), обедненных средствами иммуноаффинных способов. В каждом случае конечное содержание указанных факторов свертывания было менее 1%.

Прокоагулянтное действие при состоянии, сходном с тромбоцитопенией, исследовали в плазме со сниженным содержанием тромбоцитов посредством процесса последовательного центрифугирования.

Коагуляционные тесты в цельной крови

Прокоагулянтная активность цельной крови без добавления антикоагулянтов определяли средствами коагуляционного способа. Различные средства (мТФ), подлежащие изучению, добавляли в 0,2 мл до конечного объема в 0,8 мл цельной крови без добавления антикоагулянтов и измеряли время свертывания с помощью часов от начала извлечения до возникновения стабильного и консолидированного кровяного сгустка. Действие различных средств оценивали по их укорочению или удлинению времени свертывания крови.

Все образцы цельной крови были получены от пациентов или здоровых добровольцев.

Анализы in vivo

Моделирование тяжелой геморрагии с помощью проксимального разреза хвоста крысы

Самцов крыс Sprage-Dawley массой 300-600 грамм случайным образом распределяли в 2 лечебные группы:

контрольная группа, состоящая по меньшей мере из 3 животных, которые получали местное лечение физиологическим раствором, и

вторая группа, также состоящая по меньшей мере из 3 животных, которые получали местное лечение с мТФ.

Все соединения приходили в местный контакт с проксимальным разрезом хвоста животного для гемостатического действия в объеме 1 мл/мин, который наносили непосредственно на поверхность раны, когда крыса находилась в положении мордой вверх. Образование стабильного и консолидированного сгустка определяли, основываясь на подтверждении отсутствия кровотечения.

Моделирование тяжелой геморрагии с помощью проксимального разреза крысиного хвоста у животных, которых лечили антикоагулянтными лекарственными средствами

a) животные, которых лечили с 6HT-ТФ

Самцов крыс Sprage-Dawley массой 300-600 грамм, случайным образом распределяли в 2 лечебные группы:

контрольная группа, состоящая из 14 животных, которые получали местное лечение физиологическим раствором, и

вторая группа, состоящая из 5 животных, которые получали 200 ЕД/кг гепарина внутривенно (в.в.) за 15 минут до начала процедуры рассечения хвоста. Через 15 минут эту группу лечили с помощью мТФ (6HT-ТФ) 1494 нг/мл. мТФ приходил в местный контакт с проксимальным разрезом хвоста животного для гемостатического действия, подаваемый по каплям с помощью пластиковой пипетки eppendorf.

Образование стабильного и консолидированного сгустка определяли, основываясь на подтверждении отсутствия кровотечения.

b) животные, которых лечили с помощью ОДЭ-ТФ

27 самцов крыс Sprage-Dawley весом 300-600 грамм случайным образом распределили в 5 лечебных групп:

контрольная группа, состоящая из 14 животных, которые получали местное лечение физиологическим раствором;

две группы получали 200 ЕД/кг гепарина в.в. за 15 минут до начала процедуры рассечения хвоста (для обработки с помощью ОДЭ-ТФ (n=3) и до обработки физиологическим раствором (n=5)), и

две другие группы, получавшие перорально 0,1 мг/кг/день варфарина в течение трех дней перед началом процедуры рассечения хвоста (для обработки с помощью ОДЭ-ТФ (n=3) и до обработки физиологическим раствором (n=2)).

Следовательно, для каждой обработки антикоагулянтом были контрольные обработанные группы. Распределенный с помощью пластиковой пипетки eppendorf ОДЭ-ТФ привели в местный контакт с проксимальным разрезом хвоста животного для гемостатического действия. Образование стабильного и консолидированного сгустка определяли, основываясь на подтверждении отсутствия кровотечения.

Моделирование летальной геморрагии с помощью проксимального разреза хвоста мыши с использованием мышей с недостаточностью фактора VIII

Целью данного теста была оценка эффектов местного введения мТФ на модели летальной геморрагии (рассечение хвостовой вены) с использованием мышей с недостаточностью фактора VIII (гемофилия A), полученных с помощью направленной мутации генов.

Мыши, которые были гомозиготными по целевому, связанному с X хромосомой, мутантному аллелю, были жизнеспособными и фертильными. Гомозиготные самки и самцы-носители имели менее чем 1% от нормальной активности фактора VIII и проявляли удлиненное время образования сгустка. Эти мыши повторяли ключевые особенности гемофилии A и предоставляли прекрасную модель для использования в исследовании альтернативных терапевтических стратегий.

Было 5 лечебных групп, по 3-5 мышей на группу, как изложено ниже:

Группа A: контрольные мыши наполнитель 0 нг/мл
Группа B: самцы мышей с гемофилией наполнитель 0 нг/мл
Группа C: самцы мышей с гемофилией мТФ 1,494 нг/мл
Группа D: самки мышей с гемофилией наполнитель 0 нг/мл
Группа E: самки мышей с гемофилией мТФ 1,494 нг/мл

Концентрация белка в основном растворе мТФ составляла 1,494 нг/мл биологически активного материала. Только одну дозу использовали прямо из сосуда с основным раствором и не выполняли разведений. Тестовые дозы вычисляли на основании концентрации биологически активного белка с использованием двухстадийного коагуляционного теста. мТФ и наполнитель вводили местно по каплям на кровоточащий участок хвоста мыши со скоростью 0,25 мл/минута в течение не более чем 20 минут (5 мл).

II. РЕЗУЛЬТАТЫ

1. In vitro анализы показывают, что микровезикулированный ТФ вызывает свертывание крови как в здоровом, так и в патологическом состоянии

Некоторые анализы in vitro были выполнены с целью оценки способности мТФ вызывать фибриновый сгусток у здоровых субъектов и субъектов с гемофилией в различных концентрациях. Как отмечалось выше, «время свертывания» относится ко времени, которое требуется сгустку для консолидации в образце крови, не обработанном антикоагулянтами.

1.1 Микровезикулированный ТФ способен коагулировать плазму от здоровых субъектов (коагуляционные тесты в плазме)

Непосредственная оценка прокоагулянтной активности мТФ в здоровой плазме при различных концентрациях показала, что мТФ способен весьма значительно снижать время свертывания в состояниях со здоровой плазмой в прямой зависимости доза-ответ. Даже при очень низкой концентрации мТФ (2 нг/мл) время свертывания здоровой плазмы снижалось почти в 3 раза. При более высоких концентрациях (100 нг/мл) оно снижалось более чем в 5 раз. В таблице 5 показаны результаты трех независимых экспериментов для очищенного микровезикулированного слитого белка ТФ-гексагистидиновая метка (6HT-ТФ), в таблице 6 для очищенных дрожжевых экстрактов, содержащих микровезикулированный ТФ (ОДЭ-ТФ), и в таблице 7 для очищенного дрожжевого экстракта, содержащего микровезикулированный усеченный ТФ (ОДЭ-УТФ).

Таблица 5
Очищенный микровезикулированный слитый белок ТФ-гексагистидиновая метка (6HT-ТФ) снижает время свертывания здоровой плазмы с зависимостью доза-ответ
6HT-ТФ (нг/мл) Время свертывания (секунды)
0,00 168,60±6,06
2,00 63,27±2,17
5,00 55,56±0,76
20,00 45,47±0,92
50,00 37,50±0,75
100,00 31,10±0,12
Среднее±SEM(стандартная ошибка средней) (n=3)
Таблица 6
Очищенные дрожжевые экстракты, содержащие микровезикулированный ТФ (ОДЭ-ТФ), снижают время свертывания здоровой плазмы с зависимостью доза-ответ
ОДЭ-ТФ (нг/мл) Время свертывания (секунды)
0,00 320,4±81,3
0,43 67,35±4,6
4,30 37,6±1,9
43,00 23,1±1,09
209 18,08±0,26
Среднее±SEM(стандартная ошибка средней) (n=4)
Таблица 7
Очищенные дрожжевые экстракты, содержащие микровезикулированный усеченный ТФ (ОДЭ-УТФ), снижают время свертывания здоровой плазмы
ОДЭ-УТФ (нг/мл) Время свертывания (секунды)
0,00 233,4±2,65
20,00 85,6±1,1
Среднее±SEM(стандартная ошибка средней) (n=2)

1.2 Микровезикулированный ТФ способен с улучшенной эффективностью коагулировать плазму по сравнению с рТФ, релипидированным следуя стандартным методикам.

1.2.1. Прокоагулянтная активность мТФ по сравнению с коммерческим рТФ, релипидированным по стандартным методикам

Коммерческий рТФ (American Diagnostica) релипидировали, следуя стандартным методикам, описанным Morrissey (http://www.tf7.org/relipidation2.pdf), в которых рТФ встраивается в фосфолипидые липосомы. Образцы плазмы от пяти здоровых доноров получали из Blood Bank of Vall d'Hebrόn Hospital, департамент «Banc de Sang i Teixits»(Pg,Vall d'Hebrόn, 119-129, 08035 Barcelona). Образцы плазмы проверяли на вирус гепатита B (HBV), вирус гепатита C (HCV), DBX и TPHA, и все были отрицательными. Пять образцов плазмы объединяли и замораживали при -20C в 1,5 мл пузырьках до их использования. Количество рТФ, присутствующего в образцах, измеряли с помощью IMUBIND Tissue Factor ELISA Kit из American Diagnostica Inc. (No. 845), следуя инструкциям производителя.

Сначала проанализировали возможные различия активности между рТФ, встроенным в дрожжевые микровезикулы или когда он встроен в синтетические липосомы. Для данных экспериментов на коагулянтную активность тестировали четыре различных партии мТФ (партии P4, P7, P8 и P) и одну партию релипидированного in vitro рТФ, все с известными концентрациями рТФ, определенными с помощью ELISA. Таким образом, серийные разведения или мТФ (из четырех различных партий) или релипидированного коммерческого рТФ тестировали на активность в стандартном коагуляционном тесте. Результат показал, что во всем протестированном диапазоне концентраций и независимо от тестируемого объединенного раствора, прокоагулянтная активность в образцах мТФ всегда была выше (между одним или двумя порядками величины), чем прокоагулянтная активность для соответствующего разведения релипидированного рТФ (фиг.32).

1.2.2. Прокоагулянтная активность рТФ, встроенного в полученные из дрожжей микровезикулы (мТФ), по сравнению с тем же рТФ, встроенным в синтетические липосомы

Попытки релипидировать рТФ, полученный из мТФ микровезикул, показали, что активность рТФ значительно снижена по сравнению с исходными дрожжевыми микровезикулами, содержащими рТФ (фиг.33). Похоже, что для оптимальной активности тканевого фактора имеют место конформационные условия.

1.2.3. Прокоагулянтная активность мТФ в гепаринизированной плазме

Дополнительно, активность, присутствующая в восстановленных препаратах, была незначительной в определенных in vivo моделях геморрагии (гепаринизированных животных) (фиг.34).

Собранные вместе, результаты, приведенные в 1.2, указывают на то, что уникальная комбинация тканевого фактора и мембран дрожжей, присутствующих в мТФ или 6H-ТФ микровезикулах настоящего изобретения, показывает массу гемостатических активностей, которые не могут быть достигнуты обыкновенным встраиванием рТФ в синтетические липосомы in vitro.

1.3. Микровезикулированный ТФ способен коагулировать плазму от пациентов с недостаточностью FVIII, FIX и FXI (коагуляционные тесты в плазме)

Прямая оценка прокоагулянтной активности мТФ в плазмах с недостаточностями факторов свертывания FVIII (гемофилия A), FIX (гемофилия B) и FXI (гемофилия C), полученных с помощью иммунодеплеции при различных концентрациях, показала, что мТФ способен весьма значительно снижать время свертывания в состояниях при гемофилии, с ясной зависимостью доза-ответ. Даже при очень низких концентрациях мТФ (2 нг/мл) успешно вызывал коагуляцию в плазмах с недостатком FVIII, FIX или FXI. При более высоких концентрациях (100 нг/мл) мТФ снижает время свертывания в плазмах с недостатком на таком же уровне, как в здоровых плазмах. В таблице 8 показаны результаты 3 независимых экспериментов для очищенного микровезикулированного слитого белка ТФ-гексагистидиновая метка (6HT-ТФ), и в таблице 9 показаны результаты для очищенных дрожжевых экстрактов, содержащих микровезикулированный ТФ (ОДЭ-ТФ).

Таблица 8
Очищенный микровезикулированный слитый белок ТФ-гексагистидиновая метка (6HT-ТФ) снижает время свертывания в плазмах с недостаточностью факторов свертывания FVIII (гемофилия A), FIX (гемофилия B), и FXI (гемофилия C) с зависимостью доза-ответ
6HT-ТФ (нг/мл) FVIII (гемофилия A). Время свертывания (секунды) FIX (гемофилия B). Время свертывания (секунды) FXI (гемофилия C). Время свертывания (секунды)
0,00 600±0,0 600±0,0 600±0,0
2,00 87,43±3,01 78,37±0,82 66,43±2,17
5,00 57,43±1,68 52,20±0,69 51,67±0,64
20,00 48,57±1,23 41,70±1,18 46,07±1,70
50,00 39,80±0,67 34,40±0,42 38,93±1,23
100,00 32,77±0,38 29,17±0,43 32,50±0,85
Среднее±SEM(стандартная ошибка средней) (n=3)
Таблица 9
Очищенные дрожжевые экстракты, содержащие микровезикулированный ТФ, снижают время свертывания в плазмах с недостаточностью факторов свертывания FVIII (гемофилия A), FIX (гемофилия B) и FXI (гемофилия C) с зависимостью доза-ответ
ОДЭ-ТФ (нг/мл) FVIII (гемофилия A). Время свертывания (секунды) FIX (гемофилия B). Время свертывания (секунды) FXI (гемофилия C). Время свертывания (секунды)
0,00 >600 >600 <600
0,043 127,9±0 126,7±1,2 -
0,43 63,25±5 64,15±5 130,2±0
4,3 34,65±2,65 35,47±2,57 36,9±4,0
43,0 20,15±1,05 20,6±1,4 20,85±1,15
Среднее±SEM(стандартная ошибка средней) (n=2)

1.4. Микровезикулированный ТФ способен коагулировать плазму от приобретенной тромбоцитопении (коагуляционные тесты в плазме при тромбоцитопении)

Прямая оценка прокоагулянтной активности мТФ в плазме от приобретенной тромбоцитопении показали, что мТФ способен весьма значительно снижать время свертывания в тромбоцитопенических плазмах с недостаточностью количества тромбоцитов. Даже при очень низком количестве тромбоцитов (<1000/мкл) время свертывания радикально уменьшалось с помощью очищенных дрожжевых экстрактов, содержащих микровезикулированный ТФ (ОДЭ-ТФ), как показано в таблице 10.

Таблица 10
Очищенные дрожжевые экстракты, содержащие микровезикулированный ТФ, (ОДЭ-ТФ) снижают время свертывания в тромбоцитопенических плазмах
Количество тромбоцитов Без мТФ. Время свертывания (секунды) С ОДЭ-ТФ (60 нг/мл). Время свертывания (секунды)
350000/мкл 226,3 21,9
150000/мкл 232,6 22,8
50000/мкл 253,9 22,4
9000/мкл 321,2 21,3
<1000/мкл >400 21,3
Среднее±SEM(стандартная ошибка средней) (n=1)

1.5. Микровезикулированный ТФ способен коагулировать плазму из плазмы с недостаточностью FVIII, FIX и FXI в присутствие антител против FVII (коагуляционные тесты в плазме)

Действие микровезикулированного ТФ на коагуляцию плазмы исследовали с помощью коагуляционных тестов с использованием плазмы с недостаточностью FVIII, FIX и FXI (FVIII DP, FIX DP и FXI DP) от здоровых добровольцев в присутствие моноклональных антител против FVII. Результаты ясно показывают, что очищенные дрожжевые экстракты, содержащие микровезикулированный ТФ, (ОДЭ-ТФ) способны производить коагуляцию плазмы, удивительно, снижая время свертывания даже при отсутствии FVIII, FIX или FXI и в присутствии моноклональных антител против FVII, как показано в таблице 11. Коагуляция в отсутствие FX и в присутствии FVII антител означает, что, неожиданно, мТФ не действует ни через внутренний, ни через внешний путь свертывания.

Таблица 11
Очищенные дрожжевые экстракты, содержащие микровезикулированный ТФ, (ОДЭ-ТФ) коагулируют плазмы с недостаточностью FVIII, FIX и FXI в присутствие антител против FVII
Без мТФ. Время свертывания (секунды) С ОДЭ-ТФ (70 нг/мл). Время свертывания (секунды)
FVIII DP 308,17±5,41 29,6±4,85
FIIIV DP+анти FVII >395 45,9±0,86
FIX DP 347,4±23,03 26,77±3,97
FIX DP+анти FVII >400 41,67±0,55
FXI DP 331±5,43 32,9±5,8
FXI DP+анти FVII >400 49,17±1,2
Нормальная плазма 126,28±85 28,15±0,05
Нормальная плазма+анти FVII 216,8±0 42,55±2,05
Среднее±SEM(стандартная ошибка средней) (n=4)

1.6 Микровезикулированный ТФ способен коагулировать кровь от здоровых субъектов (коагуляционные тесты в цельной крови без добавления антикоагулянтов)

Прямая оценка прокоагулянтной активности мТФ в цельной крови от здоровых субъектов при различных концентрациях показала, что мТФ способен весьма значительно снижать время свертывания с ясной зависимостью доза-ответ. Даже при очень низких концентрациях мТФ (1 нг/мл) успешно снижает время свертывания цельной крови от здоровых субъектов. При более высоких концентрациях (100 нг/мл), мТФ снижает время свертывания в плазмах с недостатком более чем в 8 раз. В таблице 12 показаны результаты трех независимых экспериментов для очищенного микровезикулированного слитого белка ТФ-гексагистидиновая метка (6HT-ТФ), и в таблице 13 показаны результаты для очищенных дрожжевых экстрактов, содержащих микровезикулированный ТФ (ОДЭ-ТФ).

Таблица 12
Очищенный микровезикулированный слитый белок ТФ-гексагистидиновая метка снижает время свертывания в цельной крови от здоровых пациентов с зависимостью доза-ответ
6HT-ТФ (нг/мл) Время свертывания (минуты)
0,00 4,23±0,54
1,00 2,03±0,14
10,00 1,17±0,12
100,00 0,33±0,03
Среднее±SEM(стандартная ошибка средней) (n=3)
Таблица 13
Очищенные дрожжевые экстракты, содержащие микровезикулированный ТФ, (ОДЭ-ТФ) снижают время свертывания в цельной крови от здоровых пациентов с зависимостью доза-ответ
ОДЭ-ТФ (нг/мл) Время свертывания (секунды)
0,00 264,7±33,4
0,043 235,0±37,5
0,43 168,3±14,2
4,30 76,6±12,1
43,0 43,3±8,8
208 23,0±3,0
Среднее±SEM(стандартная ошибка средней) (n=3)

1.7 Микровезикулированный ТФ способен коагулировать кровь от пациентов с гемофилией (коагуляционные тесты в цельной крови без добавления антикоагулянтов)

Прямая оценка прокоагулянтной активности мТФ в цельной крови от пациентов с гемофилией при различных концентрациях показала, что мТФ способен весьма значительно снижать время свертывания с ясной зависимостью доза-ответ. Даже при низких концентрациях мТФ (2-5 нг/мл) успешно нормализует время свертывания цельной крови от пациентов с гемофилией. При более высоких концентрациях (20 нг/мл) мТФ снижает время свертывания в гемофилической цельной крови менее чем до минуты. В таблице 14 показаны результаты трех независимых экспериментов для очищенного микровезикулированного слитого белка ТФ-гексагистидиновая метка (6HT-ТФ), и в таблице 15 показаны результаты для очищенных дрожжевых экстрактов, содержащих микровезикулированный ТФ (ОДЭ-ТФ).

Таблица 14
Очищенный микровезикулированный слитый белок ТФ-гексагистидиновая метка (6HT-ТФ) снижает время свертывания в цельной крови от пациентов с гемофилией A и B с зависимостью доза-ответ
6HT-ТФ (нг/мл) FVIII (гемофилия A)
Время свертывания (минуты)
FXI (гемофилия B)
Время свертывания (минуты)
0,00 17,17±1,56 19,27±0,84
1,00 8,50±0,47 11,23±0,65
10,00 3,93±0,30 6,40±0,32
100,00 0,80±0,12 0,77±0,15
Среднее±SEM(стандартная ошибка средней) (n=3)
Таблица 15
Очищенные дрожжевые экстракты, содержащие микровезикулированный ТФ, (ОДЭ-ТФ) снижают время свертывания в цельной крови от пациентов с гемофилией A и B с зависимостью доза-ответ
ОДЭ-ТФ (нг/мл) FVIII (гемофилия A)
Время свертывания (минуты)
FXI (гемофилия B)
Время свертывания (минуты)
0,00 15,3±1,2 18,4±2,1
1,00 9,8±1,3 11,2±0,1
10,00 5,7±0,7 5,8±0,3
100,00 1,4±0,2 1,5±0,1
Среднее±SEM(стандартная ошибка средней) (гемофилия A, n=3; гемофилия B, n=2)

2. In vivo анализы, демонстрирующие, что микровезикулированный ТФ представляет собой средство, пригодное для местного антигеморрагического лечения, на моделях с тяжелой геморрагией (посредством прямого применения на предварительно рассеченном кровеносном сосуде)

Некоторые анализы in vivo были выполнены с целью оценки способности мТФ вызывать фибриновый сгусток у здоровых субъектов и субъектов с гемофилией при различных концентрациях.

2.1 Микровезикулированный ТФ пригоден в качестве местного гемостатического средства на животных моделях с тяжелой геморрагией с помощью проксимального разреза хвоста крысы

Исследования in vivo с использованием модели тяжелой геморрагии у крыс с помощью полного рассечения показали значительное снижение времени кровотечения: от 18,16±1,61 до 8,36±0,82 минут, когда животных лечили с помощью 6HT-ТФ при 1494 нг/мл до 1,7 мкг концентрации общего белка; от 18,16±5,98 до 9,33±1,05 минут, когда животных лечили с помощью ОДЭ-ТФ при 200 нг/мл/мин.

2.2 Микровезикулированный ТФ пригоден в качестве местного гемостатического средства на животной модели тяжелой геморрагии, предварительно обработанной гепарином

Исследования in vivo с использованием модели тяжелой геморрагии на крысах, предварительно обработанных антикоагулянтом (т.е. гепарин 200 МЕ) с помощью полного рассечения хвоста, показали весьма значительный кровоостанавливающий эффект. Крысы, не обработанные 6HT-ТФ, истекали кровью до смерти после 90 минут, тогда как у крыс, обработанных 6HT-ТФ при 1494 нг/мл, кровотечение останавливалось за 15,46±1,20 минут, и была показана 100% выживаемость. С другой стороны, применение ОДЭ-ТФ также показало сходный кровоостанавливающий эффект. Крысы, предварительно обработанные гепарином, истекали кровью до смерти после 90 минут, тогда как у крыс, обработанных ОДЭ-ТФ, кровотечение прекращалось через 14,2±2,4 (n=5) минут и также показана 100% выживаемость. У крыс, предварительно обработанных варфарином, снизилось время свертывания от 41,6±16,45 до 5,8±0,64 (n=3) минут при обработке ОДЭ-ТФ (200 нг/мл).

3. Анализы in vivo показывают, что микровезикулированный ТФ является средством, пригодным для местного антигеморрагического лечения на моделях с летальной геморрагией (посредством применения непосредственно на предварительно рассеченный кровеносный сосуд)

3.1 Микровезикулированный ТФ является пригодным в качестве местного гемостатического средства на животных моделях летальной геморрагии с помощью проксимального разреза хвостов мышей с недостаточностью FVIII

В модели летальной геморрагии на мышах с гемофилией (мыши с недостаточностью FVIII) местное введение 6HT-ТФ приводило к существенному сокращению времени кровотечения (от 31,4±4,74 до 5,14±0,69 минут у самцов с гемофилией и от 43,33±13,48 до 5,0±2,0 минут у самок мышей), сравнимому с временем кровотечения, полученным для нормальных, не больных гемофилией мышей (5,0±0,65 минут). Это уменьшение времени кровотечения было связано с отсутствием смертности в группе, обработанной 6HT-ТФ, тогда как все обработанные наполнителем мыши с гемофилией истекали кровью до смерти. В таблице 16 показаны результаты пяти/трех независимых экспериментов для очищенного микровезикулированного слитого белка ТФ-гексагистидиновая метка (6HT-ТФ).

Таблица 16
Очищенный микровезикулированный слитый белок ТФ-гексагистидиновая метка (6HT-ТФ) снижает время кровотечения на моделях летальной геморрагии с помощью проксимальных разрезов хвостов мышей с недостаточностью FVIII
Обработка Масса животного (г) 6HT-ТФ (нг/мышь) Время кровотечения (мин) Смертность
Среднее±SEM Среднее±SEM Среднее±SEM N % Среднее (мин)
Контрольные самцы мыши Носитель 23,56±0,74 0±0 5±0,65 5 0 -
Самцы мыши с гемофилией Носитель 20,94±0,35 0±0 31,4±4,74 5 100 44,8±8,43
Самцы мыши с гемофилией 6HT-ТФ 21,04±0,49 1807±291 5,14±0,69 5 0 -
Самки мыши с гемофилией Носитель 19,7±1 0±0 43,3±13,48 5 100 50±16,04
Самки мыши с гемофилией 6HT-ТФ 19,43±0,29 1618±498 5±2 3 0 -
Среднее±SEM(стандартная ошибка средней) (контрольные самцы и самцы с гемофилией, n=5; самки с гемофилией, n=3)

Суммарные результаты показывают мощный гемостатический потенциал мТФ у здоровых субъектов и даже у пациентов с гемофилией, это продемонстрировано с помощью моделей in vitro (плазма и цельная кровь от пациентов с гемофилией), а также in vivo, с использованием модели гемофилии A на мышах с дефектным геном. Дополнительно, мТФ способен коагулировать плазмы с заблокированным как внутренним, так и внешним путями.

1. Полученная из дрожжей микровезикула, несущая тканевой фактор (ТФ), снижающая время коагуляции, содержащая (i) мембрану дрожжей и (ii) белок тканевого фактора (ТФ) человека или его вариант, обладающий прокоагулянтной активностью, где часть указанного белка ТФ человека, обладающего прокоагулянтной активностью, встроена в указанную мембрану, и где N-концевой домен указанного белка ТФ человека или его варианта, обладающего прокоагулянтной активностью, расположен на внешней стороне указанной мембраны, и где указанный его вариант, обладающий прокоагулянтной активностью, соответствует белку тканевого фактора человека, имеющему по меньшей мере одну модификацию, выбранную из группы, состоящей из: включения гетерологичной последовательности, которая пригодна для облегчения выделения или очистки варианта, причем указанная гетерологичная последовательность связана с C-концевым или N-концевым доменом;
удаления сигнального пептида, приводящего к зрелому белку ТФ человека;
модификации сайта N-гликозилирования, соответствующего остаткам в положениях 11-13 зрелого белка ТФ человека, причем указанная модификация делает указанный сайт нефункциональным; модификации сайта N-гликозилирования, соответствующего остаткам в положениях 124-126 в зрелом белке ТФ человека, причем указанная модификация делает указанный сайт нефункциональным; модификации сайта N-гликозилирования, соответствующего остаткам в положениях 137-139 в зрелом белке ТФ человека, причем указанная модификация делает указанный сайт нефункциональным; модификации сайтов N-гликозилирования, соответствующих остаткам 124-126 и 11-13 в зрелом белке ТФ человека, причем указанная модификация делает указанный сайт нефункциональным; модификации сайтов N-гликозилирования, соответствующих остаткам 124-126 и 137-139 в зрелом белке ТФ человека, причем указанная модификация делает указанный сайт нефункциональным; модификации сайтов N-гликозилирования, соответствующих остаткам 124-126, и 11-13, и 137-139 в зрелом белке ТФ человека, причем указанная модификация делает указанный сайт нефункциональным; удаления всего домена или его части, ответственных за связывание с FVIIa; и введения мутации в домен, ответственный за связывание с FVIIa, которая приводит к существенно сниженной аффинности к FVIIa.

2. Полученная из дрожжей микровезикула по п.1, где указанный белок ТФ или его вариант, обладающий прокоагулянтной активностью, гликозилирован.

3. Полученная из дрожжей микровезикула по п.1, где указанную гетерологичную последовательность, пригодную для облегчения выделения или очистки, выбирают из группы, состоящей из гексагистидина, полиаргинина, октапептида FLAG, эпитопа, способного распознаваться антителом, такого как с-mус-тег (распознаваемый анти-с-mус-антителом), SBP-тег, S-тег, кальмодулин-связывающий белок, целлюлозу-связывающий домен, хитин-связывающий домен, глутатион S-трансфераза-тег, мальтозу-связывающий белок, NusA, TrxA, DsbA, Avi-тег, Ala-His-Gly-His-Arg-Pro, Pro-Ile-His-Asp-His-Asp-His-Pro-His-Leu-Val-Ile-His-Ser, Trp-Ser-His-Pro-Gln-Phe-Glu-Lys, Gly-Met-Thr-Cys-X-X-Cys и β-галактозидаза.

4. Полученная из дрожжей микровезикула по п.3, где указанная гетерологичная последовательность, пригодная для облегчения выделения или очистки, представляет собой гексагистидиновую последовательность на C-конце.

5. Полученная из дрожжей микровезикула по п.1, где указанный вариант ТФ, обладающий прокоагулянтной активностью, представляет собой зрелый белок ТФ человека, который соответствует белку ТФ человека без сигнального пептида.

6. Полученная из дрожжей микровезикула по п.1, где, если вариант ТФ человека соответствует тканевому фактору человека, где весь домен или его часть, ответственные за связывание с FVIIa (а.к. 32-174), отсутствуют, тогда указанный вариант содержит домен для взаимодействия с фактором X, трансмембранную область и цитоплазматический хвост при частичном или полном отсутствии домена, отвечающего за связывание с FVIIa.

7. Полученная из дрожжей микровезикула по п.6, где указанный вариант, имеющий прокоагулянтную активность, содержит домен для взаимодействия с фактором Х (а.к. 174-251), трансмембранную область (а.к. 252-274) и цитоплазматический хвост (а.к. 275-295) белка ТФ человека и гексагистидиновую последовательность на С-конце.

8. Полученная из дрожжей микровезикула по п.1, где, если указанный вариант ТФ, имеющий прокоагулянтную активность, соответствует тканевому фактору человека, имеющему модифицированный(е) сайт(ы) N-гликозилирования, как определено выше, тогда указанный вариант несет по меньшей мере одну мутацию Asn на Ala в остатке Asn в положении 124 в зрелом белке ТФ человека.

9. Полученная из дрожжей микровезикула по п.1, где указанный вариант ТФ, обладающий прокоагулятной активностью, представляет собой зрелый белок ТФ человека, содержащий гексагистидиновую последовательность на С-конце и несущий мутацию Asn на Аlа в остатке Asn в положении 124 в зрелом белке ТФ человека.

10. Применение полученной из дрожжей микровезикулы, несущей ТФ, по любому из пп.1-9 в качестве лекарственного средства с прокоагулянтной активностью.

11. Применение полученной из дрожжей микровезикулы, несущей ТФ, по любому из пп.1-9, для лечения геморрагии у субъекта.

12. Применение полученной из дрожжей микровезикулы, несущей ТФ, по любому из пп.1-9, для местного лечения геморрагии у субъекта.

13. Способ производства полученной из дрожжей микровезикулы, несущей ТФ, обладающий прокоагулянтной активностью, по п.1, который включает:
a) ферментацию культуры рекомбинантных дрожжевых клеток, которые экспрессируют белок ТФ или его фрагмент, обладающий прокоагулянтной активностью, в условиях, которые делают возможным синтез указанного белка ТФ или его фрагмента, обладающего прокоагулянтной активностью;
b) осаждение центрифугированием продукта, полученного на стадии ферментации а), для формирования продукта ферментации;
c) гомогенизацию указанного продукта ферментации со стадии b) для формирования ферментационного гомогената; и
d) разделение указанного ферментационного гомогената со стадии с) для формирования осадка и очищенного дрожжевого экстракта (ОДЭ), содержащего указанную полученную из дрожжей микровезикулу, несущую ТФ, обладающий прокоагулянтной активностью;
e) сбор указанного очищенного дрожжевого экстракта (ОДЭ), содержащего указанную полученную из дрожжей микровезикулу, несущую ТФ, обладающий прокоагулянтной активностью; и, необязательно,
f) при желании, выделение или очистку указанных полученных из дрожжей микровезикул, несущих ТФ, обладающий прокоагулянтной активностью.

14. Способ по п.13, где указанную очистку осуществляют очисткой с помощью метки или иммуноаффинной хроматографией.

15. Способ получения микровезикул по п.1, содержащих представляющий интерес мембранный белок, где представляющим интерес белком является рТФ, его фрагмент или его мутант N-гликозилирования, из дрожжевой клетки-хозяина, включающий стадии:
a) выращивания культуры указанной эукариотической клетки-хозяина в условиях, которые делают возможным синтез указанного представляющего интерес мембранного белка;
b) гомогенизации клеточной фракции культуры со стадии a);
c) разделения гомогената, полученного на стадии b), для формирования осадка и очищенного клеточного экстракта, содержащего указанные полученные из клетки микровезикулы, содержащие представляющий интерес мембранный белок;
d) очистки указанных полученных из клетки микровезикул посредством фракционирования по размеру с использованием тангенциального поточного фильтрования и/или с использованием мембранных фильтров, которые удерживают микровезикулы, имеющие диаметр 0,1-0,2 мкм.

16. Способ по п.15, который включает дополнительную стадию концентрирования с помощью эксклюзионной хроматографии или дополнительную стадию очистки с помощью аффинной хроматографии с использованием лиганда, проявляющего аффинность в отношении представляющего интерес мембранного белка.



 

Похожие патенты:

Изобретение относится к области биотехнологии и вирусологии. .

Изобретение относится к области биотехнологии, конкретно к получению высокоочищенных композиций рекомбинантных витамин К-зависимых белков, и может быть использовано для снижения примесей белка S в этих композициях.

Изобретение относится к области медицины. .

Изобретение относится к способам получения терапевтически эффективного средства для лечения и/или улучшения состояния при диссеминированном внутрисосудистом свертывании крови (ДВС), и касается способов лечения и/или улучшения состояния при ДВС у пациентов, активность антитромбина в плазме которых составляет 40% или менее.

Изобретение относится к области биотехнологии, конкретно к получению вариантов домена Gla фактора VII человека и фактора VIIa человека, и может быть использовано в медицине.

Изобретение относится к области биотехнологии, конкретно к выделению сериновых протеаз, содержащих GLA-остаток, и может быть использовано в медицине. .

Изобретение относится к области биотехнологии, конкретно к получению полипептидов фактора VII, и может быть использовано в медицине. .

Изобретение относится к области биотехнологии и может быть использовано для получения фактора VII свертывания крови человека. .

Изобретение относится к области белковой и генной инженерии и может быть использовано в фармацевтической промышленности. .

Изобретение относится к области биотехнологии, конкретно к модифицированному фактору Виллебранда (VWF), и может быть использовано в медицине. Рекомбинантным путем получают модифицированный VWF, слитый в С-концевой части своего первичного продукта трансляции с N-концевой частью альбумина посредством линкера SSGGSGGSGGSGGSGGSGGSGGSGGSGGSGS. Полученный модифицированный VWF используют в составе фармацевтической композиции для лечения или профилактики нарушения свертываемости крови. Изобретение позволяет получить модифицированный VWF, который сохраняет способность к N-концевой димеризации и С-концевой мультимеризации, имея при этом удлиненный полупериод функционального существования в плазме крови по сравнению с полупериодом функционального существования VWF. 8 н. и 9 з.п. ф-лы, 5 ил., 4 табл., 11 пр.

Изобретение относится к биотехнологии и представляет собой способ контроля аутоактивации фактора VII или его аналога и способ предотвращения расщепления активированного фактора VII или его аналога. Способы включают измерение начальной концентрации фактора VII/VIIa или его аналога. Измеряют начальную долю активированного фактора VII или его аналога. Рассчитывают время реакции активации фактора VII или его аналога путем корреляции значений, измеренных на вышеуказанных стадиях, со значением необходимой доли активированного фактора VII или его аналога. Выполняют реакцию активации фактора VII при pH от 6,0 до 8,0. Завершают реакцию путем снижения pH до значения ниже приблизительно 6,0. Предложенное изобретение позволяет определить оптимальное время реакции для достижения желательных уровней модифицированного фактора VII или его аналога, получить более чистый протеазный продукт, а также снизить расходы на производственную базу. 2 н. и 13 з.п. ф-лы, 5 ил., 1 табл., 2 пр.

Изобретение относится к очистке различных гамма-карбоксилированных форм полипептида с использованием ионообменной хроматографии. В частности, согласно изобретению предложен способ очистки полипептида, имеющего желаемое содержание гамма-карбоксиглутаминовой кислоты, из образца, содержащего смесь вариантов указанного полипептида, имеющих различные содержания гамма-карбоксиглутаминовой кислоты, при этом указанный способ включает стадии: (а) загрузки указанного образца на анионообменный хроматографический материал; (b) элюирования указанного полипептида с использованием раствора при рН менее чем 9,0, содержащего по меньшей мере одну соль, выбранную из ацетата аммония, хлорида аммония и ацетата натрия; и (с) отбора фракции, полученной после указанного элюирования, при этом полипептиды в данной фракции имеют желаемое содержание гамма-карбоксиглутаминовых кислот. 7 з.п. ф-лы, 13 ил., 6 табл., 7 пр.

Экспрессионная плазмида, содержащая фрагмент днк, кодирующий мутеин [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, бактерия e. coli - продуцент белка-предшественника мутеина [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, способ получения рекомбинантного мутеина [c245s] тканевого фактора человека с неотделяемым с-концевым тагом, рекомбинантный мутеин [c245s] тканевого фактора человека с неотделяемым с-концевым тагом // 2550027
Изобретение относится к области биотехнологии и может быть использовано для рекомбинантного получения тканевого фактора человека (чТФ). Конструируют плазмиду pHYP-10ETFCS6 длиной 5912 п.о. с физической картой, представленной на Фиг. 2, для экспрессии в бактерии рода Escherichia предшественника мутеина [C245S] чТФ, содержащего отщепляемый N-концевой лидерный пептид, содержащий декагистидиновый кластер и последовательность узнавания энтерокиназы, слитую в рамке с последовательностью, кодирующей указанный мутеин, слитый в рамке с последовательностью, кодирующей дополнительный неотщепляемый C-концевой пептид, содержащий гексагистидиновый кластер. Способ получения предшественника мутеина [C245S] чТФ включает культивирование бактерии-продуцента в питательной среде, выделение телец включения, солюбилизацию белка-предшественника, металлохелатную хроматографию в денатурирующих условиях, рефолдинг и диафильтрацию раствора белка. Способ получения зрелого мутеина [C245S] чТФ, включает отделение N-концевого лидерного пептида от указанного предшественника мутеина с использованием энтерокиназы и выделение целевого белка. Изобретение позволяет повысить уровень биосинтеза и выход прокоагуляционно активного чТФ. 6 н. и 3 з.п.ф-лы, 5 ил., 1 табл., 7 пр.

Группа изобретений относится к медицине, а именно к гематологии и может быть использована при лечении расстройств, ассоциированных с кровотечением. Способ по изобретению включает введение субъекту химерного полипептида фактора VIIa, где указанный химерный полипептид фактора VIIa включает домен EGF-2 и каталитический домен фактора VII; домен GLA, выбранный из группы, состоящей из домена GLA фактора VII, домена GLA фактора IX и домена GLA белка S; и домен EGF-1, выбранный из группы, состоящей из домена EGF-1 фактора IX и домена EGF-1 белка S. Химерный полипептид фактора VIIa по изобретению включает домен EGF-2 и каталитический домен фактора VII; домен GLA белка S;и домен EGF-1, выбранный из группы, состоящей из домена EGF-1 белка S и домена EGF-1 фактора IX. Молекула нуклеиновой кислоты по изобретению кодирует химерный полипептид фактора VIIa. Также изобретения касаются вектора, включающего молекулу нуклеиновой кислоты, клетки, включающей химерный полипептид фактора VIIa и клетки, включающей вектор. Использование изобретений позволяет снизить дозы вводимого белка и ослабить нежелательные побочные эффекты. 6 н.з. и 5 з.п. ф-лы, 7 ил., 5 пр.

Изобретение относится к области биохимии, в частности к увеличивающим гемостаз вариантам фактора Ха, кодирующим их нуклеиновым кислотам, получению и применению фактора Xa для лечения расстройств, связанных с гемостазом. Заявленный фактор Xa включает аминокислотную замену в последовательности фактора X дикого типа в положении 16, 17 или 194 в системе нумерации химотрипсина. Изобретение позволяет эффективно увеличивать гемостаз. 7 н. и 14 з.п. ф-лы, 11 ил., 5 табл., 1 пр.

Изобретение относится к области биотехнологии, конкретно к получению модифицированного фактора FVII, и может быть использовано в медицине. Полипептид FVII модифицируют путем замены аминокислотного остатка, выбранной из D196L, D196I, D196Y, К197Е, K197D, K197L, К197М, K197I, K197V, K197F, K197W, K197Y, K199D и K199E, в аминокислотной последовательности FVII, представленной в виде SEQ ID NO: 3, или в соответствующих остатках его предшественника с SEQ ID NO: 1 или SEQ ID NO: 2. Полипептид может содержать дополнительные модификации аминокислот, улучшающие его функциональные свойства. Изобретение позволяет получить модифицированный полипептид FVII, который при активации обладает увеличенной коагулянтной активностью и/или повышенной устойчивостью к ингибиторам по сравнению с немодифицированным полипептидом FVII с последовательностью, приведенной в SEQ ID NO: 3. 9 н. и 39 з.п. ф-лы, 7 ил., 23 табл., 17 пр.

Изобретение относится к фармацевтической промышленности, а именно к способу выделения очищенного концентрата тромбина. Способ получения концентрата тромбин, свободного от вирусов, заключающийся в криофракционировании свежезамороженной плазмы донорской крови человека, выделении протромбинового комплекса на анионообменном сорбенте DEAE Sepharose Fast Flow, активации протромбина раствором СаСl2 в составе протромбинового комплекса с получением тромбина, вирусной инактивации сольвент-детергентным методом и очистке полученного тромбина на катионообменном сорбенте Fractogel EMD-SO3 с последующей стерильной фильтрацией и лиофилизацией. Вышеописанный способ позволяет повысить чистоту и выход конечного продукта 1 табл., 1 пр.
Наверх