Способ дифференциации штаммов возбудителя чумы основного подвида средневекового и античного биоваров методом полимеразной цепной реакции



Способ дифференциации штаммов возбудителя чумы основного подвида средневекового и античного биоваров методом полимеразной цепной реакции
Способ дифференциации штаммов возбудителя чумы основного подвида средневекового и античного биоваров методом полимеразной цепной реакции

 


Владельцы патента RU 2496882:

Российская Федерация, от имени которой выступает Федеральная служба по надзору в сфере защиты прав потребителей и благополучия человека (RU)

Изобретение раскрывает дифференциацию штаммов возбудителя чумы основного подвида античного и средневекового биоваров. Определение проводят методом полимеразной цепной реакции (ПЦР). Способ предусматривает выделение ДНК, проведение ПЦР с применением синтезированных праймеров Med(24) и Med(19) для амплификации фрагментов хромосомных генов исследуемого штамма. Дифференциацию осуществляют путем сравнения размеров полученных амплифицированных фрагментов исследуемого штамма с размерами фрагментов генов, характерных для штаммов средневекового биовара 198 и 82 п.н. и для штаммов античного биовара 222 и 101 п.н. Способ позволяет эффективно и надежно проводить дифференциацию штаммов Y.pestis основного подвида античного и средневекового биоваров. 2 пр.

 

Изобретение относится к области медицинской микробиологии, в частности к внутривидовой дифференциации и молекулярному типированию штаммов возбудителя чумы, и может быть использовано в научно-исследовательских учреждениях медицинского профиля и службах Роспотребнадзора.

Изобретение выполнено в рамках реализации федеральной целевой программы «Национальная система химической и биологической безопасности Российской Федерации (2009-2013 гг.)» и в соответствии с Государственным контрактом №53-Д от 04.06.2012 г.

Чума - особо опасная инфекционная болезнь, которая и в настоящее время требует к себе пристального внимания и координированного контроля со стороны служб здравоохранения. В Российской Федерации и ближнем зарубежье существуют 45 природных очагов чумы, 11 из которых расположены на территории России. В большинстве этих природных очагов циркулируют штаммы Yersinia pestis средневекового биовара, которые относятся к основному высоковирулентному и эпидемически - значимому подвиду возбудителя чумы. Штаммы другого - античного - биовара, также относящегося к основному подвиду возбудителя чумы, имеют гораздо меньшее распространение и циркулируют в Российской Федерации лишь в одном из природных очагов Сибири, а также в ограниченном числе очагов в Киргизии, Казахстане и Монголии. Штаммы античного и средневекового биовара отличаются по биохимической активности и имеют отличия в вирулентности. Разделение штаммов этих биоваров представляет собой важную в практическом отношении задачу, поскольку выявление принадлежности исследуемых штаммов к определенному биовару позволяет проводить идентификацию штаммов по происхождению, оценивать возможные пути заноса инфекции и проводить молекулярно-эпидемиологический мониторинг штаммов Y. pestis.

В диагностических исследованиях дифференциацию штаммов Y. pestis основного подвида античного и средневекового биовара проводят по биохимическому признаку - редукции нитратов. Штаммы античного биовара активны по этому признаку, в то время как штаммы средневекового биовара неспособны к редукции нитратов. Однако проявление этого фенотипического признака может варьировать в зависимости от качества используемых сред и условий культивирования культур возбудителя. Более надежными по сравнению с фенотипическими методами анализа являются методы дифференциации, основанные на генетических свойствах, которые отличаются большей консервативностью и поэтому их применение дает более стабильные и хорошо воспроизводимые результаты. В связи с этим, важное значение имеет разработка простого и надежного способа генетической дифференциации биоваров возбудителя чумы. Применение такого метода обеспечит быстрое и эффективное разделение средневекового и античного биоваров возбудителя чумы и повысит эффективность проводимого мониторинга штаммов этого опасного возбудителя.

В настоящее время для детекции возбудителя чумы и проведения его внутривидовой дифференциации разработан ряд способов, основанных на полимеразной цепной реакции (ПЦР) и мультилокусном секвенировании.

Зарегистрирована тест-система, предназначенная для экспресс-диагностики возбудителя чумы методом ПЦР с набором праймеров на гены cqfl и pla, расположенные на плазмидах чумного микроба («Ген Пест» ТУ8895-005-0189). Однако эта система предназначена для детекции возбудителя чумы, но не для проведения его внутривидовой дифференциации.

Разработана другая ПЦР тест-система, использующая в качестве ДНК мишеней гены irp2, IcrV и локус "3а", которая позволяет определять видовую принадлежность штаммов Y. pestis с одновременной дифференциацией вирулентных и авирулентных штаммов, но не позволяет проводить разделения штаммов Y. pestis разных биоваров (Куклев В.Е. с соавт. Применение мультилокусной ПЦР для ускоренной идентификации Y. pestis. Сб. VI Всероссийской науч. - практ. конф. с международным участием «Генодиагностика инфекционных болезней». Москва, 2007; 1: 376-77).

Известен способ детекции бактерий рода Yersinia и дифференциации патогенных для человека видов иерсиний методом мультиплексной полимеразной цепной реакции по патенту RU 2385941, при котором идентификацию и дифференциацию патогенных видов иерсиний осуществляют путем амплификации участка гена OmpF порина Y. pestis с помощью подобранных трех пар праймеров с последующим гель-электрофорезным анализом длин амплифицированных фрагментов. Способ обеспечивает надежное разделение штаммов родственных патогенных иерсиний (Y. pestis, Y. pseudotuberculosis, Y. enterocolitica), однако, он не предназначен для проведения внутривидовой дифференциации штаммов Y. pestis.

Известен способ дифференциации штаммов возбудителя чумы основного и неосновных подвидов и возбудителя псевдотуберкулеза методом полимеразной цепной реакции по патенту RU 2425891, включающий выделение ДНК из исследуемого штамма, проведение ПЦР с амплификацией фрагментов генов terC, ilvN и inv с использзованием нуклеотидных праймеров на эти гены. Способ применяют для дифференциации штаммов Y. pestis основного подвида от штаммов неосновных подвидов и штаммов Y. pseudotuberculosis.

По патенту RU 2332464 известен способ дифференциации чумного и псевдотуберкулезного микробов с одновременной внутривидовой дифференциацией штаммов чумного микроба, включающий выделение тотальной ДНК исследуемого штамма, проведение полимеразной цепной реакции с использованием синтезированных праймеров TAN1 и TAN2 комплементарные hutG-YP01967 области возбудителя чумы с последующим анализом специфичных ампликонов. Использование этого метода требует применения набора референтных штаммов Y. pestis, что усложняет проведение анализа и стандартизации получаемых результатов, а также способ не предусматривает разделения штаммов основного подвида по их биоварной принадлежности.

Известен способ подвидовой дифференциации штаммов возбудителя чумы методом секвенирования по патенту RU 2404256, включающий выделение хромосомной ДНК исследуемого штамма, проведение полимеразной цепной реакции с использованием праймеров на гены жизнеобеспечения rhaS и araC, амплификацию фрагментов генов, установление их нуклеотидной последовательности и определение генотипа штамма и дифференциация штаммов путем сравнения полученного генотипа с генотипами основного и неосновных подвидов. Применение этих ДНК мишеней является достаточным для определения подвидовой (основной, алтайский, гиссарский, кавказский и улегейский подвиды) принадлежности штаммов возбудителя чумы, но не для установления их принадлежности к определенному биовару.

По патенту RU 2415948 известен «Способ подвидовой дифференциации штаммов Yersinia pestis методом мультилокусного сиквенс - типирования», предусматривающий определение нуклеотидных последовательностей фрагментов генов rhaS, araC, metB, aspA и thiH, с последующей подвидовой дифференциацией путем сравнения их с последовательностями этих генов у штаммов возбудителя чумы основного и неосновных подвидов. Данный способ также не дает возможности определять принадлежность штаммов Y. pestis к конкретному биовару.

Описанные способы предназначены для детекции штаммов Y. pestis, их отделения от штаммов других родственных патогенных иерсиний, а также для установления их принадлежности к определенному подвиду - основному, кавказскому, алтайскому, гиссарскому, улегейскому. Однако ни один из вышеперечисленных способов не позволяет проводить внутривидовую дифференциацию штаммов Y. pestis основного подвида по их биоварной принадлежности, что сужает их диагностические возможности и значимость для их применения в молекулярно-эпидемиологическом мониторинге возбудителя чумы. В связи с этим существует необходимость создания способа дифференциации штаммов возбудителя чумы, относящихся к различным биоварам.

Задачей изобретения является разработка простого и надежного способа дифференциации штаммов возбудителя чумы основного подвида средневекового и античного биоваров методом полимеразной цепной реакции.

Технический результат заключается в возможности эффективной и надежной дифференциации штаммов возбудителя чумы основного подвида средневекового и античного биоваров.

Технический результат достигается способом дифференциации штаммов возбудителя чумы основного подвида средневекового и античного биоваров методом полимеразной цепной реакции, включающий выделение ДНК исследуемого штамма, проведение полимеразной цепной реакции с амплификацией фрагментов хромосомной ДНК с помощью двух пар синтезированных праймеров Med (24) и Med (19), имеющих следующие последовательности:

с последующей дифференциацией штаммов, которую проводят путем сравнения размеров полученных амплифицированных фрагментов исследуемого штамма с размерами фрагментов генов, характерных для штаммов средневекового биовара 198 и 82 п.н. и для штаммов античного биовара 222 и 101 п.н.

Способ осуществляют следующим образом.

Выделение ДНК исследуемого штамма чумного микроба проводят по стандартной методике в соответствии с МУ 1.3.1794-03 «Организация работы при исследованиях методом ПЦР материала, инфицированного микроорганизмами I-II групп патогенности».

Полимеразную цепную реакцию осуществляют по стандартной методике (МУ 1.3.1794-03) с применением вышеуказанных праймеров Med (24) и Med (19), рассчитанных на основе последовательностей штаммов чумного микроба Y. pestis KIM, Antiqua, Nepali 6, представленных в базе данных NCBI GenBank. С помощью рассчитанных праймеров проводят в ПЦР амплификацию участков хромосомы исследуемого штамма Y. pestis и определяют размеры амплифицированных фрагментов. Используемые праймеры имеют следующий состав:

Амплификацию ДНК осуществляют по следующей программе: 1 цикл 94°С в течение 5 мин, затем 35 циклов при 94°С 45 сек, 56°С 1 мин, 72°С 45 сек и 1 цикл 3 мин при 72°С.

Определение размеров образованных в ПЦР фрагментов у исследуемых штаммов проводят методом электрофореза в 2% агарозном геле относительно стандарта маркеров молекулярных масс с размером от 100 до 1000 п.н.

Штаммы основного подвида возбудителя чумы средневекового биовара имеют размеры образуемых в ПЦР с помощью праймеров Med (24) и Med (19) фрагментов соответственно 198 п.н. и 82 п.н., а античного биовара - 222 и 101 п.н.

В примерах на исследуемых штаммах с неустановленной биоварной принадлежностью показана сущность изобретения.

Пример 1. Выделение ДНК исследуемого штамма проводят стандартным методом с помощью лизирующего раствора на основе 6М гуанидинизотиоцианата с предварительным обеззараживанием культуры путем добавления мертиолята натрия до концентрации 1:10000 с последующим прогреванием при температуре 56°С в течение 30 мин. (Организация работы при исследованиях методом ПЦР материала, инфицированного микроорганизмами I-II групп патогенности. МУ 1.3.1794-03).

Полимеразную цепную реакцию проводят в объеме 25 мкл; реакционная смесь содержит: 1х буфер (10х ПЦР-буфер - 2,5 мкл), MgCl2 - 2,0 мМ, смесь dNTP - 0,3 мМ, оли-гонуклеотидные праймеры- 2 пмол, Taq DNA полимераза - 0,1 ед., исследуемой ДНК - 10 мкл. Продукты амплификации анализируют в 2% агарозном геле с добавлением этидиум бромида и просматривают в УФ свете.

Определяют размеры амплифицированных с помощью праймеров Med (24) и Med (19) фрагментов ДНК Они составляют 198 и 82 п.н., что соответствует размерам фрагментов генов у штаммов средневекового биовара. Исследуемый штамм №1 относят к средневековому биовару Y. pestis.

Пример 2. Выделение ДНК и условия полимеразной цепной реакции осуществляют аналогично примеру 1. Размеры образуемых в ПЦР фрагментов ДНК составляют 222 и 101 п.н., что соответствует размерам фрагментов, образуемых у штаммов античного биовара. Штамм №2 относят к античному биовару Y. pestis.

Таким образом, заявленный способ дифференциации штаммов возбудителя чумы основного подвида средневекового и античного биоваров методом ПЦР позволяет быстро, эффективно и надежно проводить дифференциацию штаммов Y. pestis основного подвида античного и средневекового биоваров. Использование двух ДНК мишеней, расположенных в разных участках генома возбудителя чумы повышает надежность разделения этих биоваров возбудителя чумы.

Способ дифференциации штаммов возбудителя чумы основного подвида античного и средневекового биоваров, включающий выделение ДНК, проведение ПЦР с амплификацией фрагментов хромосомных участков исследуемого штамма, отличающийся тем, что при проведении ПЦР используют две пары синтезированных праймеров Med(24) и Med(19), имеющих следующие последовательности:
Med(24)-S GTATTTTGTGTCACCCC
Med(24)-As AATGAGACACCGCCAGT;
Med(19)-S GACTCAACACGATTAATTTGGTTC
Med(19)-As CCAGGTTGGTGAGAAGGAACAGAG,
с последующей дифференциацией штаммов, которую проводят путем сравнения размеров полученных амплифицированных фрагментов исследуемого штамма с размерами фрагментов генов, характерных для штаммов средневекового биовара 198 и 82 п.н. и для штаммов античного биовара 222 и 101 п.н.



 

Похожие патенты:

Изобретение относится к области медицины. Предложен набор для многопрофильного иммунологического анализа антител в препаратах крови.
Изобретение относится к области медицинской микробиологии, а именно к способу молекулярно-генетического типирования штаммов Bordetella pertussis. Способ включает выделение ДНК из штаммов B.pertussis, проведение полимеразной цепной реакции с одновременным введением специфических праймеров PF-PR для получения ампликонов фрагмента промотора коклюшного токсина ptxP, рестрикции полученных ампликонов эндонуклеазами KpnI и MluI и электрофорезу продуктов рестрикции в агарозном геле.

Изобретение относится к области биотехнологии, а именно к реагенту для предотвращения по меньшей мере одного ошибочного старта в амплификации полимеразной цепной реакции (ПЦР), способу предотвращения по меньшей мере одного ошибочного старта в амплификации полимеразной цепной реакции (ПЦР-амплификация) и наборам, которые включают данный реагент.

Изобретение относится к области молекулярной биологии и химии. Предложена выделенная нуклеиновая кислота, кодирующая флуоресцентный биосенсор для детекции пероксида водорода, а также соответствующая кассета экспрессии, клетка-продуцент биосенсора и выделенный флуоресцентный биосенсор.

Изобретение относится к области биотехнологии и вирусологии. Описаны нуклеиновые кислоты, кодирующие геномы двух новых штаммов свиного цирковируса типа 2В.

Изобретение относится к области биотехнологии, а именно к способу оценки степени пролиферации лимфоцитов с помощью маркерных генов методом полимеразной цепной реакции в реальном времени (ПЦР РВ).

Изобретение относится к области генной инженерии, конкретно к способу анализа онкологических заболеваний молочной железы, и может быть использовано в медицине. .

Изобретение относится к области биохимии и молекулярной биологии. .

Изобретение относится к генной диагностике офтальмологических расстройств и предназначено для диагностики аутосомно-доминантной оптической нейропатии. .

Изобретение относится к области биотехнологии, а именно к способу и набору для определения наличия или отсутствия мутации в гене PIK3CA. .
Изобретение относится к биотехнологии и представляет собой способ мультиплексного ПЦР-анализа и набор для его осуществления. Способ включает использование неблокированных прямых и обратных праймеров и гомологичных им блокированных прямых и обратных праймеров. Выделяют ДНК из биологического или клинического материала. Проводят мультиплексную ПЦР с первыми 5-10 циклами амплификации в виде трехшаговой ПЦР и с последующими 25-35 циклами амплификации в виде двухшаговой ПЦР в буфере для постановки реакции, содержащем катионы калия (I) и катионы магния (II), на основе буферной системы с pH 7,0-7,5 при 40-85°C, включающей соль глутаминовой кислоты, трис(гидроксиметил)аминометан и ортофосфорную кислоту. Выбирают соотношение количества молекул неблокированных праймеров и количества молекул гомологичных им блокированных праймеров с некомплементарным участком из 1-8 нуклеотидов на 3'-конце, выбранных из ряда: некомплементарный первый нуклеотид, некомплементарный второй нуклеотид, некомплементарный третий нуклеотид, некомплементарный четвертый нуклеотид, некомплементарный пятый нуклеотид, некомплементарный шестой нуклеотид, некомплементарный седьмой нуклеотид, некомплементарный восьмой нуклеотид или их сочетания, составляющее от 2:1 до 4:1, при отсчете номера нуклеотида блокированного праймера с 3'-конца. Предложенное изобретение позволяет уменьшить продолжительность мультиплексной ПЦР без повышения концентрации Taq-полимеразы, при предотвращении получения ложных результатов, связанных с различиями концентраций нуклеотидных последовательностей-мишеней. 2 н. и 1 з.п. ф-лы, 3 пр.

Изобретение относится к способу скрининга веществ, способных влиять на процесс старения клетки путем использования нуклеосомных матриц. Способ включает в себя сборку нуклеосом из донорного хроматина с использованием очищенных препаратов гистонов Н2А, Н2В, Н3, Н4 натурального происхождения на ДНК-матрицах, где ДНК несет определенные мутации, ассоциированные с различными заболеваниями или со старением, активацию элонгации, внесение различных тестируемых агентов, способных стабилизировать или дестабилизировать компоненты матрицы, проведение транскрипции, оценку продуктов транскрипции. Для оценки продуктов или интермедиатов транскрипции возможно использование различных методов электрофоретического анализа, а также методы кристаллографии. Способность изменять активность транскрипции позволяет соответственно маркировать тестируемые вещества как влияющие на процесс старения. 12 з.п.ф-лы, 1 ил.
Изобретение относится к области биотехнологии. Тест-система для обнаружения РНК вируса блютанга 14-го серотипа путем проведения полимеразной цепной реакции в реальном времени включает олигонуклеотидные праймеры и ДНК-зонд, комплементарные участкам вариабельного 2-го сегмента, имеющие следующий нуклеотидный состав (5'-3'): 14/2/qf GCT GTC GGG TAT AGG TAG GA; 14/2/z FAM - GTG AAC GTG GGG TCA TCT TCA С - BHQ1; 14/2/qr ACG TGT CCG ATG CTG СТА TC. Данная тест-система обладает повышенной специфичностью и чувствительностью при сокращении времени проведения работы по определению серотипа вируса блютанга. 2 табл., 1 пр.

Изобретение относится к области биотехнологии, а именно к способу получения терапевтического агента для лечения клещевого энцефалита людей. Способ включает получение аптамеров, которые способны образовывать комплекс с третичной структурой поверхностного белка вируса. Используют фрагмент поверхностного белка Е вируса клещевого энцефалита, с 50 по 250 аминокислоту от N-конца белка, ген которого амплифицируют и клонируют в плазмидном векторе. Клонированный рекомбинантный белок экспрессируют. Полученный белок очищают и иммобилизуют на планшете. Из первоначального пула вырожденных олигонуклеотидов состава 5'-CTCCTCTGACTGTAACCACG-(N40)-GGCTTCTGGCTACCTATGC-3', где N - любой из нуклеотидов (G, A, T, C), взятых в эквивалентном количестве при синтезе 40-звенных олигонуклеотидов, содержащих на 5'- конце флуоресцентный краситель FAM с помощью 15 циклов экспоненциального обогащения, SELEX, проводят отбор специфично связывающихся с вирусным белком аптамеров. На каждом этапе сорбции проводят денатурацию 25 рМ одноцепочечного олигонуклеотида. Наносят денатурированный пул аптамеров в лунку с иммобилизованным белком, инкубируют и отмывают от несвязавшихся олигонуклеотидов. Связанные с белком аптамеры снимают с поверхности буфером с низкой ионной силой и высоким pH. Пул аптамеров, после каждого этапа сорбции, амплифицируют. Полученные ампликоны двуцепочечной библиотеки аптамеров очищают и проводят реакцию ассиметричной полимеразной цепной реакции (ПЦР). Продукт очищают с помощью сорбции с получением целевого продукта в виде аптамеров. Предложенное изобретение позволяет получить аптамеры, которые используют для предотвращения заболевания клещевым энцефалитом. 4 з.п. ф-лы, 1 пр.

Изобретение относится к области молекулярной биологии и генной инженерии. Предложен способ выявления воспалительного заболевания кишечника млекопитающего посредством детекции повышенной экспрессии генов LY6 в желудочно-кишечных тканях или клетках по сравнению с контролем. Изобретение может быть использовано в медицине для диагностики воспалительных заболеваний кишечника. 3 н. и 52 з.п. ф-лы, 36 ил., 9 табл.

Изобретение относится к области медицины, в частности к применению молекулярных маркеров ВПЧ ВКР и их качественных и количественных характеристик для прогнозирования течения гиперпролиферативных заболеваний ШМ. Способ осуществляется поэтапно: 1) из соскобов из цервикального канала и биоптатов ШМ выделяют ДНК ВПЧ; 2) определяют генотип вируса; 3) отбирают пациенток с ВПЧ16-позитивной CIN; 4) методом ПНР в реальном времени определяют число копий ДНК вируса и степень интеграции ее в хозяйский геном (физический статус); 5) устанавливают пороговый уровень вирусной нагрузки с учетом физического статуса вируса (6,5 lg копий ДНК ВПЧ 16 на клетку); 6) классифицируют пациенток в зависимости от установленного порогового уровня вирусной нагрузки и физического статуса вируса (эписомальная или интегрированная форма); 7) выявляют пациенток с неблагоприятным прогнозом, имеющих высокую вирусную нагрузку (>6.5 lg копий ДНК на клетку) при эписомальной форме вируса или низкую нагрузку (<6.5 lg копий ДНК на клетку) при интегрированной форме вируса. Способ позволяет провести раннее прогнозирование неблагоприятного течения цервикальных интраэпителиальных неоплазий и возможного перехода их в рак ШМ. 2 з.п. ф-лы, 2 ил., 1 табл., 4 пр.

Изобретение относится к биотехнологии, в частности к генетической инженерии, и может быть использовано для выявления генетического материала (РНК) коронавируса человека, ассоциированного с тяжелым острым респираторным синдромом (ТОРС). Набор олигодезоксирибонуклеотидных праймеров и флуоресцентно-меченного ДНК-зонда для идентификации коронавируса человека, ассоциированного с тяжелым острым респираторным синдромом, содержит пару внутренних и один внешний олигонуклеотиды, обладающие активностью прямого и обратного праймеров в полимеразной цепной реакции, а также флуоресцентно-меченный ДНК-зонд, имеющие следующую структуру: внешний обратный праймер NR: 5`-CTTTTGGCAATGTTGTK(G/T)CCTT-3`; внутренние прямой (F) и обратный (R) праймеры 5`→3` F: 5`-AAAATGTCTGATAATGGACCCC-3` и R: 5`-ACCACCACGAR(A/G)CTCGTCG-3`; флуоресцентно-меченный ДНК-зонд Z: 5`-TY(C/T)CACCAAATGTAATGCGGGG-3`. Набор праймеров и зонд позволяют идентифицировать коронавирус человека, ассоциированный с ТОРС, а также коронавирусы, подобные ТОРС-коронавирусу человека, выделенные от пальмовых циветт, енотовых собак и плодоядных летучих мышей методом ПЦР в реальном времени с получением более продолжительного амплифицированного фрагмента NP-гена коронавируса (513 п.н.). 2 ил., 5 табл., 2 пр.

Изобретение относится к области биотехнологии. Раскрыты способы, композиции и наборы для диагностики остеоартрита у животных семейства кошачьих. Способы по изобретению включают детектирование дифференциальной экспрессии, по меньшей мере, одного маркера в образце из организма, предпочтительно в образце крови, где биомаркер дифференциально экспрессируется при остеоартрите. 6 н. и 17 з.п. ф-лы, 4 ил., 7 табл., 3 пр.

Изобретение относится к биотехнологии и представляет собой способ выявления мутации c.-53-2A>G в гене SLC26A5, сопровождающийся развитием несиндромальной аутосомно-рецессивной глухоты. Способ включает выделение ДНК из лимфоцитов периферической крови методом фенольно-хлороформной экстракции. Проводят полимеразную цепную реакцию с возможностью проведения анализа флуоресценции по конечной точке. Амплифицируют одновременно два участка гена SLC26A5 в смеси двух пар последовательностей олигонуклеотидов с флуоресцентной меткой: CACCACAAAGAAGAGATG, TCAGCATGATCCATAGTAC, FAM-agtgtCacTagGggaaaa-BHQ-1, VIC-agtgtCacCagGggaaaa-BHQ-2, фланкирующих область с возможным содержанием мутации c.-53-2A>G в гене SLC26A5. Предложенное изобретение позволяет получить точный, объективный клинический диагноз наследственной аутосомно-рецессивной потери слуха. 1 ил., 2 табл., 2 пр.

Изобретение относится к области молекулярной биологии. Предложены способ, композиция и применение полярного апротонного растворителя с циклической основной структурой для гибридизации последовательностей нуклеиновых кислот. Изобретение может быть использовано в гибридизационных анализах. 3 н. и 16 з.п. ф-лы, 25 табл., 2 ил., 22 пр.
Наверх