Способ определения чувствительности опухоли легкого к терапии ингибиторами тирозинкиназ



Способ определения чувствительности опухоли легкого к терапии ингибиторами тирозинкиназ
Способ определения чувствительности опухоли легкого к терапии ингибиторами тирозинкиназ

 

G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2499994:

федеральное государственное бюджетное учреждение "Научно-исследовательский институт онкологии имени Н.Н. Петрова" Министерства здравоохранения Российской Федерации (ФГБУ "НИИ онкологии им. Н.Н. Петрова" Минздрава России) (RU)

Изобретение относится к области медицины, в частности к молекулярной диагностике. Предложен способ определения чувствительности опухоли легкого к терапии ингибиторами тирозинкиназ у пациентов с раком легкого в цитологическом опухолевом материале методом полимеразной цепной реакции в режиме реального времени при помощи праймеров для выявления 8 делеций в 19 экзоне гена EGFR и замены L858R гена EGFR в 21 экзоне. При выявлении любой из этих мутаций определяют чувствительность опухоли легкого к терапии ингибиторами тирозинкиназ как положительную и назначают терапию гефитинибом или эрлотинибом. Способ обладает высокой информативностью и чувствительностью, прост в исполнении и интерпретации результата. 2 ил., 2 табл., 1 пр.

 

Изобретение относится к области медицины, в частности к молекулярной онкологии, молекулярной диагностике, и может быть использовано для определения чувствительности опухоли легкого к терапии ингибиторами тирозинкиназ гефитинибом (Иресса) и эрлотинибом (Тарцева).

Позитивный эффект терапии ингибитрами тирозинкиназ гефитинибом и эрлотинибом определяется присутствием в опухолевой ткани активирующих мутаций в гене EGFR. Общепринятым стандартом в настоящее время является тестирование на предмет наличия генетических повреждений EGFR свежезамороженного или архивного операционного патоморфологического (гистологического) материала. Гистологический материал, однако, доступен не у всех пациентов с раком легкого: в большинстве случаев заболевание выявляется на поздних стадиях, большей части пациентов с впервые выявленным раком легкого (РЛ) (до 70%) не показано оперативное лечение. Альтернативой в таких случаях может служить цитологический материал, полученный с помощью тонкоигольной или щеточной биопсии, путем смывов с бронхов или другими малоинвазивными методами.

Использование цитологических образцов для анализа сопряжено с рядом трудностей: во-первых, они могут содержать чрезвычайно малое количество клеток, а следовательно, и генетического материала, пригодного для тестирования. Во-вторых, доля опухолевых клеток по отношению к нормальным в таких образцах может быть невысока. С учетом этих особенностей был разработан высокочувствительный тест для детекции двух наиболее частых вариантов мутаций EGFR - делеций в 19 экзоне и точечной замены L858R - в цитологическом материале.

На сегодняшний день описан и используется целый ряд способов тестирования мутаций EGFR, большинство из которых рассчитано на использование гистологического материала. Наиболее распространенный вариант - это прямое секвенирование 18-21 экзонов гена. Данная методика позволяет выявить весь спектр известных генетических повреждений EGFR, однако обладает сравнительно низкой чувствительностью. Для надежной детекции мутаций необходимо, чтобы доля опухолевых клеток в образце составляла около 50% [Smouse JH et al. EGFR mutations are detected comparably in cytologic and surgical pathology specimens of nonsmall cell lung cancer. Cancer. 2009 Feb 25; 117(1):67-72]. В связи с этим прямое секвенирование не может быть рекомендовано для рутинного анализа цитологического материала.

Другая группа способов нацелена на поиск отдельных часто встречающихся генетических дефектов EGFR и основывается на различных модификациях полимеразной цепной реакции (ПЦР): ПЦР с включением олигонуклеотидов с модифицированными основаниями (PNA-LNA PCR clamp) [Таnака Т et al. Reliability of the peptide nucleic acid-locked nucleic acid polymerase chain reaction clamp-based test for epidermal growth factor receptor mutations integrated into the clinical practice for non-small cell lung cancers. Cancer Sci. 2007 Feb; 98(2):246-52; Yamada N et al. The Peptide nucleic Acid-locked nucleic Acid polymerase chain reaction clamp-based test for epidermal growth factor receptor mutations in bronchoscopic cytological specimens of non-small cell lung cancer. Oncology. 2012; 82(6):341-6]; ПЦР с флюоресцентными метками типа TaqMan [Molina-Vila MA et al. A sensitive method for detecting EGFR mutations in non-small cell lung cancer samples with few tumor cells. J Thorac Oncol. 2008 Nov;3(ll):1224-35; van Eijk R et al. Rapid KRAS, EGFR, BRAF and PIK3CA mutation analysis of fine needle aspirates from non-small-cell lung cancer using allele-specific qPCR. PLoS One. 2011 Mar 8; 6(3):el7791] или Scorpion [Horiike A et al. Detection of epidermal growth factor receptor mutation in transbronchial needle aspirates of non-small cell lung cancer. Chest. 2007 Jun; 131(6):1628-34]; ПЦР с обогащением мутантного варианта ДНК (mutant-enriched PCR) [Asano et al. Detection of EGFR gene mutation in lung cancer by mutant-enriched polymerase chain reaction assay. Clin Cancer Res. 2006 Jan 1; 12(1): 43-8]; ПЦР с последующим гетеродуплексным анализом (loop-hybrid mobility shift assay) [Oshita F et al. Novel heteroduplex method using small cytology specimens with a remarkably high success rate for analysing EGFR gene mutations with a significant correlation to gefitinib efficacy in non-small-cell lung cancer. Br J Cancer. 2006 Oct 23; 95(8): 1070-5]; ПЦР с последующим высокоточным анализом кривых плавления (high resolution melting - HRM) [Nomoto К et al. Detection of EGFR mutations in archived cytologic specimens of non-small cell lung cancer using high-resolution melting analysis. Am J Clin Pathol. 2006 Oct; 126(4):608-15]. Чувствительность этой группы методик значительно превосходит секвенирование и позволяет обнаруживать мутации при содержании опухолевых клеток 1-5%, что делает эти методы пригодными для тестирования цитологических образцов. К их недостаткам относятся необходимость использования комбинаций дорогих флюоресцентно-меченых или модифицированных олигонуклеотидов или флюоресцентных красителей, дополнительных процедур анализа (рестрикционный анализ при mutant-enriched PCR, электрофорез при гетеродуплексном анализе), дорогого оборудования (приборы для HRM-анализа).

Еще одним вариантом поиска мутаций EGFR является иммуногистохимия с использованием специфических к мутантному белку антител [Hasanovic A et al. Use of mutation specific antibodies to detect EGFR status in small biopsy and cytology specimens of lung adenocarcinoma. Lung Cancer. 2012 Aug;77(2):299-305]. В отличие от вышеперечисленных методов, эта методика способна выявлять только один из возможных вариантов делеций в 19 экзоне EGFR (del Е746-А750). Кроме того, для иммуногистохимического исследования характерно сравнительно большое количество ложнопозитивных результатов.

Известен способ определения чувствительности опухоли легкого к терапии ингибитрами тирозинкиназ, основанный на обычной ПЦР в сочетании с электрофорезом и аллель-специфической ПЦР, позволяющий детектировать до 90% встречающихся мутаций EGFR [Того А. В. и соавт. Молекулярно-генетический способ определения чувствительности опухоли у пациентов с раком легкого к терапии гефитинибом. Патент на изобретение №2454464]. Способ обладает большой информативностью и надежностью, однако можно говорить о повышении его чувствительности.

Известен способ определения чувствительности опухоли легкого к терапии ингибиторами тирозинкиназ, основанный на аллель-специфическом дизайне ПЦР, предложенный Ohnishi с соавт.[Ohnishi Н. et al. A simple and sensitive method for detecting major mutations within the tyrosine kinase domain of the epidermal growth factor receptor gene in non-small-cell lung carcinoma. Diagn Mol Pathol. 2006 Jun;15(2): 101-8]. При высокой чувствительности способ позволяет выявить только 2 варианта делеций в 19 экзоне и точечную мутацию L858R в 21 экзоне. Этот способ принят за прототип предлагаемого изобретения.

Техническим результатом заявленного изобретения является повышение информативности и чувствительности способа при использовании цитологических образцов для анализа известных мутаций в гене EGFR у больных РЛ.

Указанный технический результат достигается тем, что Способ определения чувствительности опухоли легкого к терапии ингибиторами тирозинкиназ у пациентов с раком легкого, включающий молекулярно-генетический анализ мутаций гена EGFR в цитологическом опухолевом материале, отличающийся тем, что осуществляют аллель-специфическую полимеразную цепную реакцию в режиме реального времени при помощи праймеров для выявления делеций в 19 экзоне гена EGFR:

прямого праймера 5' - CGTCGCTATCAAGGCАТСТС-3',

прямого праймера 5' - CGTCGCTATCAAGGTACCGAA-3',

прямого праймера 5' - CGTCGCTATCAAGGAACCATC-3'

и обратного праймера 5' - GCCAGACATGAGAAAAGGTG-3,'

а для выявления замены L858R гена EGFR в 21 экзоне:

праймера, специфичного к нормальному аллелю 5' - TCCGCACCCAGCAGTTTGGCTA-3',

праймера, специфичного к мутантному аллелю 5' - TCCGCACCCAGCAGTTTGGCTC-3, общего праймера 5' - GCATGAACTACTTGGAGGAC- 3'

и при выявлении любой из перечисленных мутаций определяют чувствительность опухоли легкого к терапии ингибиторами тирозинкиназ как положительную и назначают терапию гефитинибом или эрлотинибом.

В таблицах 1, 2 представлены типы детектируемых делеций (табл.1) и последовательности праймеров для детекции делеций в 19 экзоне гена EGFR (табл.2).

Таблица 1
Тип мутации Изменения на уровне ДНК Изменения на уровне белка
Microdeletion (1) c.2235_2249del p.Glu746_Ala750del
Microdeletion (2) c.2236_2250del p.Glu746_Ala750del
Microdeletion (3) c.2240_2257del p.Leu747_Pro753delinsSer
Microindel (4) c.2237_2255delinsT p.Glu746_Ser752delinsVal
Microindel (5) c.2239_2251 delinsC p.Leu747_Thr751 delinsPro
Microindel (6) c.2239_2248 delinsC p.Leu747_Ala750 delinsPro
Microdeletion (7) c.2239_2256del p.Leu747_Ser752del
Microdeletion (8) c.2237_2251del p.Glu746_Thr751 delinsAla
Таблица 2
Праймер 5' - 3' последовательность Типы детектируемых делеций
Прямой праймер 1 CGTCGCTATCAAGGCATCTC 1, 2, 7, 8
Прямой праймер 2 CGTCGCTATCAAGGTACCGAA 3, 4, 6
Прямой праймер 3 CGTCGCTATCAAGGAACCATC 5
Обратный праймер GCCAGACATGAGAAAAGGTG

Изобретательский уровень предлагаемого способа подтверждается спектром детектируемых повреждений EGFR, представленных на фиг.1 ,2.

На фиг.1 представлен пример детекции делеций в экзоне 19 гена EGFR при помощи аллель-специфических праймеров в режиме реального времени. А, В, Д - Кривые, полученные при амплификации образцов с делениями и без с использованием трех пар праймеров (А-пара 3, В - пара 2, Д - пара 1). Б, Г, Е - Кривые плавления, полученные для тех же образцов.

На фиг.2 представлен пример детекции замены L858R в 21 экзоне гена EGFR (wt -кривая амплификации с праймерами, специфичными последовательности дикого типа, mt - кривая амплификации с праймерами, специфичными последовательности с мутацией).

Способ осуществляют, например, следующим образом.

Тестирование рекомендовано всем пациентам с аденокарциномой легкого, а также может быть использовано у больных с другими гистологическими вариантами опухолей легкого. Материалом для исследования может служить ДНК, выделенная из цитологических образцов.

Детекция 8 наиболее частых делеций в 19 экзоне EGFR (табл.1) осуществляется методом аллель-специфической ПЦР (АС-ПЦР) в режиме реального времени при помощи трех пар праймеров (табл.2). Реакционная смесь (суммарный объем 20 мкл) содержит 1 мкл раствора ДНК (10-100 нг ДНК), 1,0 ед. «hot-start» ДНК-полимеразы, 1-кратный ПЦР-буфер (рН 8.3), 2.5 мМ MgCl2, 200 мкМ каждого из нуклеотидтрифосфатов, 0,3 мкМ одного из трех прямых и обратного праймеров. К ПЦР-смеси добавляется интеркалирующий краситель SYBR-Green I (20х раствор, добавляется из расчета 1/100 объема реакции), ПЦР-реакция начинается с 10-минутной активации Taq-полимеразы при 95°С; для накопления ПЦР-продукта проводится 45 циклов амплификации (денатурация: 15 сек при 95°С; отжиг: 30 сек при 60°С; синтез: 30 сек при 72°С). Результат оценивается но наличию/отсутствию амплификации (прироста флюоресценции) после прохождения реакции. Для контроля специфичности фрагментов используется анализ кривых плавления. Примеры детекции делеций различных типов представлены на фиг.1. Амплификация может производиться на оборудовании для ПЦР разных производителей.

Тестирование миссенс-мутации EGFR L858R в 21 экзоне проводится методом АС-ПЦР в режиме реального времени с использованием праймеров, содержащих нуклеотиды, некомплементарные матрице (mismatch-нуклеотиды) во 2 позиции от 3'-конца праймера: 5'-TCCGCACCCAGCAGTTTGGCTA-3' (праймер, специфичный для последовательности дикого типа), 5'-TCCGCACCCAGCAGTTTGGCTC-3' (праймер, специфичный для последовательности с мутацией) и 5'-GCATGAACTACTTGGAGGAC-3' (общий праймер). ПЦР может проводиться на приборах различных производителей (BioRad, ДНК-технология, Corbett Research) и состоит из 50 циклов амплификации (денатурация: 15 сек при 95°С; отжиг: 30 сек при 63°С; синтез: 30 сек при 72°С). Смесь для ПЦР (суммарный объем 20 мкл) содержит 1 мкл раствора ДНК (10-100 нг ДНК), 1,0 ед. ДНК-полимеразы, 1-кратный ПЦР-буфер (рН 8.3), 2.5 мМ MgCl2, 200 мкМ каждого из нуклеотидтрифосфатов, 0,3 мкМ каждого праймера, SYBR green I в концентрации 0,2х (исходный раствор 10 000х; Molecular Probes). Каждый сет амплификации должен включать контрольный образец (гетерозигота по исследуемой мутации), а также негативный контроль. Для оценки специфичности амплификации используется анализ кривых плавления. Генотипирование каждого образца требует постановки двух ПЦР-реакций одновременно. Первая реакция включает общий праймер и праймер, специфичный к нормальному аллелю (wt), вторая - общий праймер и праймер, специфичный к мутантному аллелю (mut). Определение генотипа основывается на разнице пороговых циклов Ct (цикл, во время которого уровень флуоресценции в пробирке начинает достоверно превышать базовый, что визуально отображается как пересечение кривой амплификации пороговой линии) в этих двух реакциях, так называемом показателе ΔCt(ΔCt=Ct(mt)-Ct(wt)). В случае гетерозиготы эффективность амплификации с обеими парами праймеров одинакова, и ΔCt составляет не более 1-2 циклов. В случае гомозиготы дикого типа реакция значительно более эффективно проходит в пробирке, содержащей пару праймеров, специфичных нормальной последовательности, и ΔCt составляет не менее 6-10 циклов.

Несомненным преимуществом предлагаемого способа является высокая чувствительность (способность выявлять генетические повреждения EGFR при содержании ДНК с мутацией в образце менее 1%) и, соответственно, возможность использования цитологического материала для проведения анализа. Предложенный способ позволяет обнаруживать оба распространенных варианта мутаций EGFR (8 делеций в 19 экзоне и замену L858R гена EGFR в 21 экзоне) при помощи оборудования для ПЦР в режиме реального времени любого производителя с использованием недорого флюоресцентного красителя SYBR Green, не требует дополнительного этапа визуализации, прост в исполнении и интерпретации результата.

Способ определения чувствительности опухоли легкого к терапии ингибиторами тирозинкиназ у пациентов с раком легкого, включающий молекулярно-генетический анализ мутаций гена EGFR в цитологическом опухолевом материале, отличающийся тем, что осуществляют аллель-специфическую полимеразную цепную реакцию в режиме реального времени при помощи праймеров для выявления делеций в 19 экзоне гена EGFR: прямого праймера 5'-CGTCGCTATCAAGGCАТСТС-3' - для делеций c.2235_2249del, c.2236_2250del, c.2239_2256del, c.2237_2251del,
прямого праймера 5'-CGTCGCTATCAAGGTACCGAА-3' - для делеций c.2240_2257del, c.2237_2255delinsT, c.2239_2248delinsC,
прямого праймера 5'-CGTCGCTATCAAGGAACCATC-3' - для делеции c.2239_2251delinsC и обратного праймера 5'-GCCAGACATGAGAAAAGGTG-3' и для выявления замены L858R гена EGFR в 21 экзоне:
праймера, специфичного к нормальному аллелю 5'-TCCGCАСССAGCAGTTTGGCTA-3', праймера, специфичного к мутантному аллелю 5'-TCCGCACCCAGCAGTTTGGCTC-3', общего праймера 5'-GCATGAACTACTTGGAGGAC-3'
и при выявлении любой из перечисленных мутаций определяют чувствительность опухоли легкого к терапии ингибиторами тирозинкиназ как положительную и назначают терапию гефитинибом или эрлотинибом.



 

Похожие патенты:

Изобретение относится к медицине и касается способа персонифицированного подбора антиагрегантых препаратов больным, нуждающимся в подобном лечении, включающего забор крови больного, получение богатой тромбоцитами плазмы с помощью центрифугирования крови, разделение ее на пробы и введение в них антиагрегантных препаратов, имеющих различные механизмы антиагрегационного действия на тромбоциты с последующей инкубацией проб плазмы с препаратами при температуре 36,5-37,5°C и с индуктором агрегации тромбоцитов.

Изобретение применяют для оценки влияния цитомегаловирусной инфекции на содержание метгемоглобина в эритроцитах периферической крови беременной на третьем триместре гестации.
Изобретение относится к медицине, а именно к кардиологии, и может быть использовано для выявления высокого риска развития нарушения толерантности к глюкозе на фоне приема метопролола у больных стабильной стенокардией напряжения.

Изобретение относится к области медицины, конкретно к онкологии, и касается способа прогнозирования возникновения рецидивов при немелкоклеточном раке легкого (НМРЛ).
Настоящее изобретение относится к медицине и описывает способ определения содержания в тканях сердечно-сосудистой системы Ti, Al, включающий помещение образца ткани в емкость с добавлением азотной кислоты и выдержкой в течение 3 час при 75°С, последующее приливание перекиси водорода с выдержкой в течение 2 часов при той же температуре, добавление новой порции азотной кислоты с выдержкой 2 часа при температуре 110°С, добавление плавиковой кислоты и выдерживание в течение 18 часов при 20°С с последующим нагревом в течение 6 часов при 75°С и помещением в микроволновую печь, выпариванием и выполнением измерений методикой масс-спектроскопии с индуктивно связанной плазмой, при следующем соотношении компонентов, мас.%: НNО3 35, Н2О2 5, HF 13,3, деионизированная вода - остальное.
Изобретение относится к медицине и касается способа лабораторной диагностики развития инфекции у больных острым лимфобластным лейкозом (ОЛЛ) в состоянии индуцированной нейтропении.

Изобретение относится к области медицины. Предложен способ прогнозирования популяционных нарушений биотрансформации чужеродных веществ, обусловленных воздействием техногенных химических факторов среды обитания.
Изобретение относится к медицине и может быть использовано для выбора тактики лечения деструктивной формы острого панкреатита. В сыворотке крови определяют концентрацию прокальцитонина (ПКТ) с помощью количественного иммуноферментного анализа.

Изобретение относится к медицине и предназначено для повышения проницаемости мембран гладкомышечных клеток тонкого кишечника. Проводят обработку клеток в одной пробе пороформирующим гемолизином HlyII из Bacillus cereus в концентрации 3-5 мкг/мл.

Изобретение относится к области медицины. Предложен способ дифференциальной диагностики тяжелой бронхиальной астмы, включающий определение вентиляционной функции легких и исследование мононуклеаров, выделенных из венозной крови больного, с последующим расчетом индекса, характеризующего воспалительный процесс.

Изобретение относится к медицине, в частности к педиатрии, а именно к способу дифференциальной диагностики гнойных и серозных менингитов у детей. Способ состоит в определении показателей микробицидной активности нейтрофильных лейкоцитов: ферментов миелопероксидазы, цитохромоксидазы, кислой фосфатазы в ликворе больных гнойным и серозным менингитами с помощью спектрофотометрического анализа. При значениях миелопероксидазы в пределах 0,18-0,2 усл.ед. диагностируют гнойный менингит, а при значениях 0,059-0,061 усл.ед. - серозный менингит. Показатель активности цитохромоксидазы в пределах 0,49-0,57 усл.ед. свидетельствует о гнойном менингите, в пределах 0,186-0,174 усл.ед. - о серозном менингите. Показатель активности кислой фосфатазы в ликворе в пределах 0,14-0,18 усл.ед. следует расценивать как гнойный менингит, а в пределах 0,069-0,071 усл.ед. - как серозный менингит. Использование заявленного способа позволяет повысить точность диагностики гнойных и серозных менингитов у детей. 1 табл., 2 пр.
Изобретение относится к области биохимии и микробиологии и может быть использовано для определения липолитической активности в субклеточных фракциях бактерий. Сущность способа состоит в том, что среда, содержит агарозу или агар (500 мг), неионный детергент (50 мкл), хлористый кальций (12,5 мг), 0,05 М Трис-HCl буфер pH 8,3 (до 100 мл), причем после застывания среды в ней делают лунки, в которые вносят исследуемый образец в объеме 10-50 мкл на одну лунку, затем среду с исследуемым образцом инкубируют при 37°C в течение 12 часов и визуально определяют наличие или отсутствие липолитической активности в исследуемом образце. При наличии липолитической активности наблюдают матовые ореолы вокруг лунки, при отсутствии липолитической активности среда вокруг лунки остается прозрачной. Использование заявленного способа позволяет просто, доступно и экономично определить липолитическую активность субклеточных фракций бактерий. 3 з.п. ф-лы, 6 пр.

Изобретение относится к области медицины. Предложен способ оценки индивидуальной чувствительности генома человека к воздействию повышенных доз излучений радона и продуктов его распада. В буккальных эпителиоцитах определяют предрасполагающие и протективные генотипы: маркер Arg399Gln гена XRCC1 - предрасполагающий генотип Arg/Gln, протективный генотип Arg/Arg; маркер Arg194Trp гена XRCC1 - предрасполагающий генотип Arg/Trp; маркер Glu185Gln гена NBS1 - предрасполагающий генотип Glu/Gln, протективный генотип Glu/Glu; маркер Ser326Cys гена hOGG1 - предрасполагающий генотип Ser/Cys; маркер Asp1853Asn гена ATM - предрасполагающий генотип Asp/Asp, протективный генотип Asp/Asn; маркер Asp1104His гена XPG - протективный генотип His/His. При преобладании предрасполагающих генотипов или равном количестве предрасполагающих и протективных генотипов делают заключение о высокой индивидуальной чувствительности к действию повышенных доз радона и о прогнозировании накопления микроядер и протрузий. При количественном преобладании протективных генотипов делают заключение о высокой индивидуальной устойчивости к воздействию радона и о прогнозировании устойчивости к накоплению микроядер и протрузий. Предложенный способ позволяет проводить оценку генетически детерминированной предрасположенности к формированию повышенного уровня микроядер и протрузий еще до воздействия радиационного фактора. 1 з.п. ф-лы, 5 табл., 2 пр.

Настоящее изобретение относится к медицине, а именно к определению ферментов в костной и хрящевой тканях при изучении регенераторных процессов, и описывает способ определения щелочной фосфатазы в костной и хрящевой тканях, включающий подготовку образцов исследуемых тканей и гистохимическое исследование срезов полученного материала, где образцы исследуемых костной и хрящевой тканей выдерживают в забуференном растворе нейтрального 10% формалина в течение 1 суток при температуре +4°C, затем обрабатывают в 0,1 М растворе фосфатного буфера сначала в 4 смены по 2 часа каждая, а после в 9 смен по часу с добавлением сахарозы постепенно возрастающей концентрации, после чего исследуемый материал погружают в реагент Tissue-Tek O.C.T. Compound, замораживают при -35°C, готовят срезы и визуально определяют наличие щелочной фосфатазы. Способ прост в исполнении, его возможно использовать для определении щелочной фосфатазы в образцах ткани в каждом учреждении медицинского профиля и научной лаборатории без использования специального оборудования. 5 ил., 1 пр.
Изобретение относится к педиатрии и онкогематологии и может быть использовано для прогнозирования развития нарушений функции миокарда у детей с острым лимфобластным лейкозом (ОЛЛ) на разных этапах полихимиотерапии (ПХТ). Для чего проводят исследование в крови N-концевого фрагмента предшественника мозгового натрийуретического пептида (NT-pro-BNP), прогормона предсердного натрийуретического пептида (pro-ANP), белка, связывающего жирные кислоты (БСЖК), ферритина, гепсидина, гомоцистеин, неоптерина до начала ПХТ и уровня ферритина 2 после проведения индукции ремиссии. Выявленные значения показателей вышеперечисленных параметров подставляют в уравнения для расчета изменения показателей ЭКГ, ИЖМ, В(Е-Еа), NT-pro-BNP, ФВ после окончания интенсивной ПХТ. Рассчитывают общий коэффициент К по следующей формуле: К=ЭКГ3×ИЖМ3×В(Е-Еа)3×NT-pro-BNP3×ФВ3. При значениях коэффициента К>0,17 прогнозируют развитие кардиальных осложнений. Изобретение позволяет выбрать тактику сопроводительной терапии для коррекции и предупреждения нарушений функции миокарда у детей острым лимфобластным лейкозом. 6 табл.
Предлагаются модели на насекомых, предназначенные отображать проницаемость гематоэнцефалического барьера (ГЭБ) у млекопитающего, в частности, человека. Изобретение касается способа оценки транспорта химического соединения через ГЭБ, а также применения насекомых в скрининге веществ, обладающих биологическим действием на мозг или центральную нервную систему и/или действующих на заболевание или нарушение, затрагивающее мозг или центральную нервную систему. Способ включает: введение химического соединения насекомому, имеющему ГЭБ; выдерживание насекомых; препарирование мозга насекомых и измерение концентрации химического соединения в мозге. 2 н. и 8 з.п. ф-лы, 2 табл., 12 пр.

Изобретение относится к медицине, в частности к способу оценки функционального состояния эндотелия (ФСЭ) экспериментальных животных после реконструктивных операций на брюшной аорте. Сущность способа состоит в том, что для оценки ФСЭ осуществляют исходный анализ биохимических показателей крови, таких как оксид азота (II), супероксиддисмутаза (СОД), малоновый диальдегид (МДА), проводят аллопластику брюшной аорты, затем осуществляют биохимический контроль через 6 месяцев, выводят животных из эксперимента, далее проводят гистологическое исследование зоны аллопластики аорты с помощью компьютерной морфометрии и осуществляют расчет корреляции. При увеличении уровня метаболитов NO считают развитие утолщения интимы менее выражено, что не превышает физиологических значений восстановления стенки артерии после операционного воздействия, при уменьшении уровня метаболитов N0 развивается гиперплазия интимы, а при увеличении активности СОД и уровня МДА определяют активное развитие утолщение интимы артерии. Использование заявленного способа позволяет повысить эффективность оценки ФСЭ у животных после реконструктивных операций на брюшной аорте. 3 табл., 5 ил., 1 пр.

Изобретение относится к области биотехнологии и медицины. Предложен способ диагностики предрасположенности пациента к наследственной макулодистрофии Штаргардта. Фибробласты кожи, взятые у пациента, культивируют и обрабатывают вирусными конструкциями, несущими гены Oct4, Sox2 и Klf4 под контролем CMV промотера. Осуществляют направленную дифференцировку фибробластов в клетки ретины. Из клеток ретины выделяют кодирующую РНК гена АВСА4. По наличию делеции в экзоне 39-41 гена АВСА4 диагностируют предрасположенность пациента к наследственной макулодистрофии Штаргардта. Изобретение позволяет эффективно диагностировать предрасположенность пациента к наследственной макулодистрофии Штаргардта по наличию делеции в экзоне 39-41 гена АВСА4. 3 ил., 1 табл., 1 пр.
Изобретение относится к области медицины, в частности к прогнозированию риска раннего развития атеросклероза у больных хроническим простатитом. Сущность способа состоит в том, что в сыворотке крови больных хроническим простатитом молодой возрастной группы определяют уровень общего тестостерона, секссвязывающего глобулина с последующим расчетом индекса свободного тестостерона, а также определяют содержание липопротеидов высокой плотности, триацилглицеридов и рассчитывают коэффициент атерогенного риска по формуле. При значении коэффициента атерогенного риска <3,7 прогнозируют высокий риск раннего развития атеросклероза. Использование заявленного способа позволяет повысить точность прогнозирования риска раннего развития атеросклероза у больных хроническим простатитом. 1 табл., 2 пр.

Изобретение относится к биотехнологии и представляет собой способ выявления мутации c.-53-2A>G в гене SLC26A5, сопровождающийся развитием несиндромальной аутосомно-рецессивной глухоты. Способ включает выделение ДНК из лимфоцитов периферической крови методом фенольно-хлороформной экстракции. Проводят полимеразную цепную реакцию с возможностью проведения анализа флуоресценции по конечной точке. Амплифицируют одновременно два участка гена SLC26A5 в смеси двух пар последовательностей олигонуклеотидов с флуоресцентной меткой: CACCACAAAGAAGAGATG, TCAGCATGATCCATAGTAC, FAM-agtgtCacTagGggaaaa-BHQ-1, VIC-agtgtCacCagGggaaaa-BHQ-2, фланкирующих область с возможным содержанием мутации c.-53-2A>G в гене SLC26A5. Предложенное изобретение позволяет получить точный, объективный клинический диагноз наследственной аутосомно-рецессивной потери слуха. 1 ил., 2 табл., 2 пр.
Наверх