Штамм lactobacillus paracasei subspecies paracasei, обладающий антимикробными и иммуномодулирующими свойствами, и пищевой продукт на его основе

Изобретение относится к штамму Lactobacillus paracasei subspecies paracasei, обладающему антимикробными и иммуномодулирующими свойствами, и к продукту, содержащему указанный штамм. Штамм депонирован в CNCM под номером I-3689. Штамм обладает способностью ингибировать рост патогенных микроорганизмов в культуре, в частности Escherichia coli, Salmonella enteritidis и Listeria monocytogenes. Штамм обладает противовоспалительными свойствами при соотношении IL-10/IL-12 равном 11,8. Пищевой продукт, содержащий живой указанный штамм в количестве по меньшей мере 105 КОЕ на грамм, обладает антимикробными и/или иммуномодулирующими свойствами. 2 н. и 4 з.п. ф-лы, 3 ил., 4 табл., 3 пр.

 

Настоящее изобретение относится к новому штамму Lactobacillus paracasei subsp. Paracasei, обладающему антимикробными и иммуномодулирующими свойствами.

В множестве научных исследований сообщается о положительном воздействии на здоровье определенных микроорганизмов, присутствующих в ферментированных пищевых продуктах, а именно в молочных продуктах. Обычно эти микроорганизмы называют «пробиотиками». В соответствии с общепринятым в настоящее время определением, пробиотики представляют собой «живые микроорганизмы, которые при потреблении в соответствующих количествах оказывают благоприятное воздействие на здоровье хозяина» (доклад ФАО/ВОЗ по оценке оказывающих на здоровье свойств и питательных свойств пробиотиков в пищевых продуктах, включая сухое молоко, содержащее живые молочнокислые бактерии; Кордова, Аргентина; Октябрь 1-4, 2001 (FAO/WHO report on evaluation of health and nutritional properties of probiotics in food, including powder milk containing live lactic acid bacteria; Cordoba, Argentina; October 1-4, 2001)).

Было установлено, что потребление пищевых продуктов, содержащих пробиотические бактерии, может оказать благоприятное воздействие на здоровье, в частности, приведением в равновесие кишечной флоры, повышением резистентности к инфекциям и модулированием иммунного ответа.

Пробиотические микроорганизмы, используемые в пищевых продуктах, как правило, представляют собой молочнокислые кислые бактерии, главным образом, принадлежащие к роду Lactobacillus и Bifidobacterium и, в частности, к видам Lactobacillus paracasei subsp. paracasei (штамм, описанный в патентной заявке EP 0794707).

Однако оказание положительного воздействия на здоровье человека не является общим не только для всех бактерий одного и того же рода, но даже и для бактерий одного и того же вида. Как правило, это свойство встречается только у некоторых видов; дополнительно наблюдаемое воздействие может качественно меняться и/или количественно от одного штамма пробиотиков к другому, в пределах одного и того же вида.

Для того чтобы микроорганизм мог рассматриваться в качестве потенциально используемого как пробиотик, он должен отвечать, по меньшей мере, одному и, в идеале, нескольким из следующих критериев:

- наличие ингибирующей активности в отношении патогенных микроорганизмов, которые могут присутствовать в кишечной флоре, проявление этой активности возможно, как результат способности адгезироваться на клетках желудочно-кишечного тракта, следовательно, исключая или снижая адгезию патогенов или благодаря., способности продуцировать вещества, ингибирующие патогены, или же благодаря комбинации этих двух характеристик;

- наличие иммуномодулирующих свойств и, в частности, иммуностимулирующих и/или противовоспалительных свойств.

Дополнительно, если этот микроорганизм предназначен для добавления в молочный продукт, предпочтительным был бы его удовлетворительный рост в молоке.

Наконец, он должен сохранять хорошую жизнеспособность во время получения и хранения пищевого продукта, в который он добавлен, и также после потребления пищевого продукта потребителем для того, чтобы он был способен достичь кишечника и выжить в среде желудочно-кишечного тракта.

Однако следует отметить, что хотя жизнеспособность является важной для соответствия данному в настоящее время определению «пробиотик», было установлено, что некоторое положительное воздействие, связанное с пробиотическими штаммами может быть достигнуто/получено даже в отсутствие живых бактерий и связано с определенными фракциями бактерий или активными фракциями супернатантов их культур. Например, в заявке PCT WO 2004093898 описывается иммуномодулирующее лекарственное средство, полученное фракционированием супернатанта культуры штамма CNCM 10 I-2219.

Авторам настоящего изобретения удалось выделить новый штамм Lactobacillus paracasei subsp. paracasei, отвечающий указанным выше критериям.

Объект настоящего изобретения представляет собой штамм, депонированный согласно условиям Будапештского договора о признании депонирования микроорганизмов для целей патентной процедуры, в CNCM (Collection Nationale de Cultures de Microorganismes [National collection of microorganism cultures] (Национальная коллекция культур микроорганизмов), 25 rue du Docteur Roux, Paris), 9 ноября 2006, под номером I-3689.

Штамм CNCM I-3689 имеет следующие характеристики.

Морфологические признаки: Грамположительный микроорганизм, маленькие тонкие бациллы, изолированные или в виде маленьких цепочек.

Ферментирует следующие сахара (результаты получены на стрипе api 50 CH со средой API MRS при температуре 37°C в течение 48 часов): рибоза, галактоза, D-глюкоза, D-фруктоза, D-манноза, маннит, N-ацетилглюкозамин, арбутин, целлобиоза, мальтоза, лактоза, трегалоза, мелицитоза, D-тураноза, D-тагатоза, глюконат.

Присутствует единичный локус CRISPR последовательности SEQ ID NO:1, содержащий повторяющуюся последовательность, представленную нуклеозидной последовательностью SEQ ID NO:2.

Дополнительно его антимикробные свойства, являются результатом сильной способности ингибировать рост патогенных микроорганизмов в культуре, в частности Escherichia coli, Salmonella enteritidis и Listeria monocytogenes.

CNCM штамм I-3689 также обладает иммуномодулирующими и, в частности, противовоспалительными свойствами.

Также объектом настоящего изобретения являются штаммы Lactobacillus paracasei subsp. paracasei, которые могут быть получены мутагенезом или генетической трансформацией штамма CNCM I-3689. Предпочтительно эти штаммы сохраняют антимикробные или иммуномодулирующие свойства штамма CNCM I-3689. Они могут представлять собой штаммы, в которых один или несколько эндогенных генов штамма CNCM I-3689 подвергаются мутации, например, таким образом, чтобы модифицировать некоторые метаболические свойства (например, способность этого штамма стабилизировать сахара, его устойчивость при прохождении через желудочно-кишечный тракт, его устойчивость к кислоте, его постокисление или продуцирование метаболита). Также они могут представлять собой штаммы, полученные в результате генетической трансформации штамма CNCM I-3689 одного или нескольких интересующих генов, делая возможным, например, придание дополнительных физиологических характеристик указанному штамму или экспрессию интересующих терапевтических белков или белков для вакцины, являющиеся желательными для введения посредством указанного штамма.

Эти штаммы могут быть получены из штамма CNCM I-3689 при использовании традиционных технологий случайного или сайт-направленного мутагенеза и генетической трансформации молочнокислых бактерий, таких как описанные, например, Gury et al. (Arch Microbiol., 182, 337-45, 2004) или Velez et al. (Appl Environ Microbiol., 73, 3595-3604, 2007), или при использовании технологии, известной как «перетасовка генома» (Patnaik et al. Nat Biotechnol, 20, 707-12, 2002; Wang Y. et al., J Biotechnol., 129, 510-15, 2007). Эти штаммы, в частности, имеют локус CRISPR последовательности SEQ ID NO:1.

Также объектом настоящего изобретения является способ получения штамма Lactobacillus paracasei subsp. paracasei, обладающего антимикробными и/или иммуномодулирующими свойствами, включающий стадию мутагенеза или генетической трансформации штамма CNCM I-3689.

Также объектом настоящего изобретения является способ получения клеточной фракции, обладающей антимикробными и/или иммуномодулирующими свойствами из штамма Lactobacillus paracasei subsp. paracasei по настоящему изобретению. Указанные клеточные фракции представляют собой, в частности, препараты ДНК или препараты бактериальных клеток, полученные из культур указанных штаммов. Также они могут представлять собой супернатанты культур или фракции этих супернатантов.

Также объектом настоящего изобретения являются композиции, содержащие штамм Lactobacillus paracasei subsp. paracasei по настоящему изобретению или клеточную фракцию, полученную из указанного штамма.

Эти композиции, в частности, могут представлять собой ферменты молочнокислых бактерий, комбинации штамма Lactobacillus paracasei subsp. paracasei по настоящему изобретению с одним или несколькими другими, необязательно пробиотическими штаммами молочнокислых бактерий. В качестве примера штамма молочнокислых бактерий могут быть указаны штаммы Lactobacillus bulgaricus и Streptococcus thermophilus.

Также они могут представлять собой пищевые продукты и, в частности, молочные продукты или фармацевтические или косметические продукты, включающие штамм Lactobacillus paracasei subsp. paracasei по настоящему изобретению или клеточную фракцию, полученную из указанного штамма.

В случае, когда указанный штамм присутствует в форме живых бактерий, предпочтительно они присутствуют в количестве, по меньшей мере, 105 КОЕ на грамм, предпочтительно, по меньшей мере, 106 КОЕ на грамм продукта, более предпочтительно, по меньшей мере, 107 КОЕ на грамм и еще более предпочтительно, по меньшей мере, 108 КОЕ на грамм.

Настоящее изобретение будет более понятно из последующего описания со ссылкой на примеры, иллюстрирующие антимикробные, иммунномоделирующие и противоинфекционные свойства штамма CNCM I-3689 и также молекулярного типирования этого штамма.

ПРИМЕР 1: СРАВНЕНИЕ СВОЙСТВ ШТАММА CNCM I-3689 СО СВОЙСТВАМИ ИЗВЕСТНЫХ ПРОБИОТИЧЕСКИХ ШТАММОВ

Свойства штамма CNCM I-3689 сравнивают со свойствами различных штаммов предшествующего уровня техники, известных своими пробиотическими свойствами.

Список этих штаммов приведен в Таблице I, ниже.

Таблица I
Род Вид Название(я) Номер публикации патентной заявки
Lactobacillus johnsonii NCC533=La1=
CNCM I-1225
EP 0577903
Lactobacillus acidophilus NCFM WO2004032639
Lactobacillus acidophilus La-5
Lactobacillus casei Shirota
Lactobacillus paracasei CRL431=ATCC 55544
Lactobacillus rhamnosus LGG=ATCC 53103 США 4839281
Lactobacillus rhamnosus HN001=NM97/09514 WO 9910476
Lactobacillus plantarum ATCC 14917=
DSMZ 20174=WCFS1
Lactobacillus plantarum Probi 299v=DSM 9843 WO 9391823
Lactobacillus reuteri DSMZ 20016
Lactobacillus reuteri Biogaia SD 2112=
ATCC 55730
WO2004034808
Bifidobacterium breve ATCC 15700
Bifidobacterium breve BBC50=CNCM I-2219 EP 1189517
Bifidobacterium infantis ATCC 15697
Bifidobacterium longum BB536
Bifidobacterium longum NCC2705=
CNCM I-2618
Bifidobacterium animalis subsp. lactis BB12=ATCC 27536
Bifidobacterium animalis subsp. lactis HN019=NM97/01925 WO 9910476

1 - Антимикробная активность

Исследование антимикробной активности против патогенных бактерий: Escherichia coli E1392-75-2A, Salmonella enteritidis NIZO B1241 и Listeria monocytogenes 4B. Молочнокислые бактерии культивируют в чашках Петри в двух различных средах: среде Elliker и (Elliker et al., J. Dairy Sci.f 39, 1611-1612, 1956) и среде TGE (триптон-глюкоза-мясной экстракт).

Чашки инкубируют при температуре 37°C до появления колоний бактерий. Бифидобактерии культивируют в анаэробных условиях. Затем на поверхность чашек выливают слой агара, содержащий среду BHI (бульон с сердечно-мозговым экстрактом) и патоген.

Чашки снова инкубируют при температуре 37°C в течение 24 часов. Затем измеряют диаметры областей ингибирования патогенов вокруг каждой колонии молочнокислых бактерий. Оценка 1 соответствует диаметру в пределах от 1 до 3 мм. Оценка 2 соответствует диаметру в пределах от 4 до 6 мм. Оценка 3 соответствует диаметру более, чем 6 мм. Для каждого штамма каждый эксперимент проводят трижды независимо.

Оценки, полученные на целевых патогенах в каждом эксперименте, суммируют, получая, таким образом, для каждой молочнокислой бактерии общую оценку антимикробной активности.

Результаты приведены в Таблице II ниже.

Эти результаты, показывают, что среди тестируемых штаммов, штамм CNCM I-3689, штамм ATCC 55544 имеют наивысшую антимикробную активность.

2 - Иммуномодуляция

Оценивают иммуномодулирующие свойства различных молочнокислых бактерий измерением соотношения IL-10/IL-12.

Образцы человеческой крови, полученные от здоровых индивидуумов разводят в соотношении 1:2 с PBS-CA (Gibco) и очищают с использованием градиента Ficoll (Gibco). После центрифугирования при 400×g в течение 30 минут при температуре 20°C, собирают PBMC (монуклеарные клетки периферической крови человека). Затем проводят трехстадийное промывание и ресуспендируют PBMC в культуральной среде RPMI (Gibco) с добавлением 1% фетальной телячьей сыворотки, 1% L-глютамина (Gibco) и 150 μг/мг гентамицина (Gibco).

Под микроскопом подсчитывают PBMC и регулируют до концентрации 2×106 клетки/мл и затем разливают аликвоты по 1 мл в 24-луночную пластину для культивирования клеток (Corning, Inc.).

Штаммы молочнокислых бактерий культивируют в среде MRS (de Man et al.f J. Appl. Bacteriol. 23, 130-135, 1960) и штаммы бифидобактерий культивируют в среде MRS с добавлением 0,03% L-цистеина (Sigma) в анаэробных условиях. Все штаммы инкубируют при температуре 37°C. Рост бактерий останавливают в стационарной фазе и затем бактерии промывают и ресуспендируют в концентрации 3, измеряемой в единицах MacFarlan в PBS, содержащей 20% глицерина.

В каждую лунку пластины добавляют объем 10 μл бактериального препарата, содержащего PBMC (соотношение бактерии:клетки 10:1). Пластины инкубируют в течение 4 часов при температуре 37°C в атмосфере, содержащей 5% CO2. Затем супернатант, полученный в результате центрифугирования при 2000 оборотах в минуту, удаляют и хранят при температуре -20°C.

В тесте используют контрольные бактериальные штаммы с известными иммуномодулирующими свойствами, также в качестве отрицательного контроля используют PBS-20% глицерина, без бактерий. Эксперимент проводят для каждого штамма на PBMC, полученном от трех различных доноров.

Экспрессию цитокинов измеряют при использовании метода ELISA с использованием коммерческих наборов (Pharmingen, BD 10 Biosciences). Исследуют два цитокина: IL-10 и IL-12.

Для каждого тестируемого штамма рассчитывают среднее соотношение IL-10/IL-12. Результаты приведены в Таблице III ниже.

Таблица III
Род Вид Контроль Соотношение
IL-10/IL-12
Lactobacillus paracasei subsp, paracasei DN 114121=
CNCM I-3689
11,8
Lactobacillus plantarum Probi 299v=
DSM 9843
12,7
Lactobacillus acidophilus La-5 23,5
Lactobacillus acidophilus NCFM 23,6
Lactobacillus johnsonii NCC533=
La1=I-1225
23,7
Lactobacillus plantarum АТСС 14917=
DSMZ 20174=WCFS1
25,0
Lactobacillus reuteri Biogaia SD 2112 ATCC 55730 25,4
Bifidobacterium longum BB536 26,4
Bifidobacterium animalis subsp. lactis HN019=
NM97/01925
28,7
Bifidobacterium animalis subsp. lactis BB12=
ATCC 27536
32,4
Lactobacillus rhamnosus LGG=АТСС 53013 34,5
Lactobacillus reuteri DSMZ 20016 42,0
Bifidobacterium infantis ATCC 15697 51,4
Bifidobacterium breve BBC50=I-2219 58,6
Lactobacillus casei Shirota 67,6
Bifidobacterium breve ATCC 15700 68,5
Bifidobacterium longum NCC2705=
CNCM I-2618
72,6
Lactobacillus rhamnosus HN001=NM97/09514 92,1
Lactobacillus paracasei CRL431=ATCC 55544 164,0

Эти результаты показывают, что штамм CNCM I-3689 демонстрирует значительные противовоспалительные свойства на этой модели. Ни один из контрольных тестируемых штаммов не продемонстрировал таких хороших свойств.

На Фиг.1 представлено соотношение IL-10/IL-12 каждого бактериального штамма как функция его антипатогенной оценки (относительная единица), как указанно выше. Эта Фигура показывает насколько штамм CNCM I-3689 отличается от других тестируемых штаммов.

3 - Выживание при кишечном стрессе

Используют in vitro модель, отражающую условия кишечного стресса.

Культуры молочнокислых бактерий получают в молоке добавлением дрожжевого экстракта. Культуры инкубируют в течение от 24 до 48 часов в зависимости от вида (до момента наступления стационарной фазы культуры).

Получают искусственный желудочный сок, включающий соли желчной кислоты свиньи (3,3 г/л) и NaHCO3 карбонатный буфер (16,5 г/л). pH регулируют до 6,3. 1 мл этого желудочного сока добавляют в 100 μл бактериальной культуры. Затем культуры инкубируют в течение 5 часов.

Показатели выражают как следующее:

Кишечный стресс=log (КОЕ5ч/КОЕ0ч).

КОЕXмин является концентрацией бактерий, выраженной как колониеобразующие единицы (КОЕ) после X минут инкубации.

Для кишечного стресса является хорошей при показателе более чем -0,5, средней при показателе в пределах от -0,5 до -1,5, и плохой при показателе менее, чем -1,5.

Таблица IV
Род Вид Контроль Кишечный стресс
Lactobacillus paracasei subsp. paracasei DN 114121=
CNCM I-3689
-0,40
Bifidobacterium animalis subsp. lactis HN019=
NM97/01925
3,40
Bifidobacterium infantis ATCC 15697 2,79
Lactobacillus reuteri Biogaia SD 2112
ATCC 55730
1,00
Lactobacillus johnsonii NCC533=La1=
I-1225
0,69
Bifidobacterium animalis subsp. lactis BB12=ATCC
27536
0,07
Lactobacillus paracasei CRL431=ATCC 55544 0,04
Lactobacillus rhamnosus HN001=
NM97/09514
0,00
Lactobacillus rhamnosus LGG=АТСС 53103 -0,07
Bifidobacterium breve ATCC 15700 -0,14
Bifidobacterium longum NCC2705=
CNCM I-2618
-0,22
Lactobacillus acidophilus La-5 -0,23
Lactobacillus plantarum АТСС 14917=
DSMZ 20174=WCFS1
-0,79
Bifidobacterium breve BBC50=I-2219 -0,91
Lactobacillus plantarum Probi 299v=
DSM 9843
-1,04
Bifidobacterium longum BB536 -1,12
Lactobacillus acidophilus NCFM -1,45
Lactobacillus casei Shirota -1,50
Lactobacillus reuteri DSMZ 20016 -1,91

4 - Заключение

Результаты, приведенные выше в Таблицах II, III и IV, показывают, что среди различных тестируемых штаммов только один штамм CNCM I-3689 обладает как значительными антимикробными свойствами, так и значительными противовоспалительными свойствами, сопровождающимися дополнительно очень хорошей устойчивостью к кишечному стрессу.

ПРИМЕР 2: РОСТ ШТАММА CNCM I-3689 НА МОЛОКЕ

Рост на молоке штамма CNCM I-3689 тестируют с использованием следующего протокола:

- среду, полученную из обезжиренного восстановленного водой сухого молока, инокулируют штаммом CNCM I-3689 (5,6×106 КОЕ/г или 1,1×107 КОЕ/г);

- ферментативную активность этого штамма, которую связывают с его ростом, измеряют непрерывным мониторингом pH среды для роста.

Результаты приведены на графике на Фиг.2.

Эти результаты показывают, что штамм CNCM I-3689 способен к эффективному росту на молоке и что, следовательно, он может быть использован при производстве ферментированных молочных продуктов.

ПРИМЕР 3: МОЛЕКУЛЯРНОЕ ТИПИРОВАНИЕ ШТАММА CNCM I-3689

Многие прокариотические организмы, имеющие один или несколько локусов CRISPR - аббревиатура «Расположенные группами короткие палиндромные повторы» (Jansen et al., 2002, OMICS, Vol. 6, No, 1, 23-33), локус CRISPR характеризуется неконтигуальными повторяющимися последовательностями (или DR), как правило, в пределах от 21 до 37 пар оснований (п.о.), отделенные уникальными последовательностями, как правило, в пределах от 20 до 40 пар оснований, называемые вариабельными последовательностями («спейсеры»). От одного бактериального штамма к другому могут наблюдаться отличия по:

- числу локусов CRISPR,

- позиции локусов CRISPR в геноме,

- числу повторяющихся последовательностей и/или

- природе и/или размеру вариабельных последовательностей.

1 - Идентификация локуса CRISPR в штамме CNCM I-3689.

Штамм CNCM I-3689 секвинируют. Анализ его генома проводят с использованием программного обеспечения ERGO™, позволяющего идентифицировать единичный локус CRISPR в этом штамме. Этот локус представляет собой 3323 п.о. в длину, расположенный на 20 пар оснований ниже ORF RDBK00370. Последовательность геномной ДНК представлена последовательностью SEQ ID NO:1. Она состоит из повторяющихся единиц (GTTTTCCCCGCACATGCGGGGGTGATCC; SEQ ID NO:2), которые идентичны таковым локуса CRISPR штамма ATCC 334 (Lactobacillus casei) и 54 вариабельных последовательностей (спейсеров).

2 - Конструирование праймеров для PCR амплификации, специфичных к штамму CNCM I-3689.

Некоторые пары олигонуклеотидных праймеров определяют на базе вариабельных последовательностей локуса CRISPR штамма CNCM I-3689. Эти праймеры тестируют с использованием PCR амплификации на некоторых бактериальных штаммах для определения их специфичности к штамму CNCM I-3689.

Одна пара праймеров состоит из:

- праймера OFF2486 (CTCAACAGGATAAGTGCCAC; SEQ ID NO:3), расположенного в 33-й вариабельной последовательности локуса CRISPR, в позициях 2049-2068; TM=60°C;

- праймера OFF2488 (GGTTGGCTGGGTTTAACGC; SEQ ID NO:4), расположенного в 37-й вариабельной последовательности локуса CRISPR, в позициях 2093-2110; TM=60°C.

Фиксированые условия PCR представляют собой следующее:

Реакционная смесь:

ДНК: 1 μм
дНТФ: 4 μм
10X буфер: 5 μм
праймер OFF2486: 0,3 μм
праймер OFF2488: 0,3 μм
ДНК полимераза Ex taq™: 0,2 μм
Вода: 39,2 μм

Циклы:

95°C 5' × 30
95°C 30”
61°C 30”
72°C 45”
72°C 10'
10°C

Предполагаемый размер PCR продукта из штамма CNCM I-3689 составляет 263 п.о.

Пару праймеров OFF2486/OFF2488 тестируют на штамме CNCM I-3689 и 18 других отличающихся штаммах Lactobacillus casei, включая штаммы CNCM 1-1518 и ATCC 334. Штаммы CNCM 1-1518 и ATCC 334 являются негативным контролем, поскольку указанные праймеры не могут гибридизоваться с геномной последовательностью ДНК этих штаммов при указанных выше условиях PCR.

Результаты, проиллюстрированные при использовании электрофореза в агарозном геле продуктов PCR амплификации, представлены на Фиг.3, где «121» представляет штамм CNCM 15 I-3689, «001» представляет штамм CNCM I-1518, «S3» - «S18» представляют, соответственно, 16 различных штаммов Lactobacillus casei, и «SL» представляет маркер молекулярной массы (SmartLadder; Eurogentec).

Эти результаты показывают, что пара праймеров OFF2486/OFF2488 безусловно специфична к штамму CNCM I-3689, поскольку продукты PCR амплификации предполагаемого размера (то есть, около 260 п.о.) получают только для этого штамма.

1. Штамм Lactobacillus paracasei subsp. paracasei, обладающий антимикробными и иммуномодулирующими свойствами, депонированный в CNCM под номером I-3689.

2. Штамм Lactobacillus paracasei subsp. paracasei по п.1 для применения в качестве лекарственного средства.

3. Штамм Lactobacillus paracasei subsp. paracasei по п.2, отличающийся тем, что указанное лекарственное средство предназначено для применения при лечении микробных инфекций.

4. Штамм Lactobacillus paracasei subsp. paracasei по п.2, отличающийся тем, что указанное лекарственное средство представляет собой противовоспалительное средство.

5. Пищевой продукт, имеющий антимикробные и/или иммуномодулирующие свойства, содержащий живой штамм Lactobacillus paracasei subsp. paracasei по п. 1 в количестве по меньшей мере 105 КОЕ на грамм.

6. Пищевой продукт по п. 5, отличающийся тем, что представляет собой молочный продукт.



 

Похожие патенты:
Изобретение относится к области биотехнологии и может быть использовано в ветеринарии. Штамм Bacillus licheniformis BKM B-2713D обладает выраженным антагонизмом по отношению к Salmonella typhi, Staphylococcus aureus, Listeria monocytogenes.

Изобретение относится к биотехнологии, а именно генной инженерии. Предложены способ получения рекомбинантного капсидного белка вируса гепатита E (rtHEV-ORF2) и рекомбинантная вакцина для профилактики вирусного гепатита E.

Изобретение относится к биотехнологии и представляет собой штамм бактерий Bacillus licheniformis ВКПМ В-11302 - продуцент термостабильной липазы. При ферментации полученного штамма в 3 л лабораторном ферментере активность фермента в культуральной жидкости достигает уровня 500 ЕД/мл.

Изобретение относится к области биотехнологии и представляет собой штамм бактерий Bacillus subtilis ВКПМ В-11270 - продуцент фермента фосфолипазы C. При ферментации полученного штамма в 3 л лабораторном ферментере в минимальной среде при температуре 30°C, активность фермента в культуральной жидкости достигает уровня 210 ЕД/мл.
Изобретение относится к биотехнологии, в частности к получению препаратов кератиназы, и может быть использовано для получения препаратов кератиназ, применяемых в медицине, косметологии, легкой промышленности и сельском хозяйстве.
Изобретение относится к биотехнологии, в частности к способам приготовления биологически активных кормовых добавок для животных, птицы, рыбы. Готовят жидкую культуру штамма Corynebacterium glutamicum ВКПМ В-1959 - продуцента лизина глубинным способом и жидкие культуры штаммов Bacillus subtilis ВКПМ В-8130, Bacillus subtilis ВКПМ В-2984, Bacillus subtilis ВКПМ В-4099 и Bacillus licheniformis ВКПМ В-4162.

Изобретение относится к биотехнологии. Штамм Aspergillus oryzae RCAM01135 - продуцент протеолитических и амилолитических ферментов - обладает способностью продуцировать протеолитические и амилолитические ферменты.
Изобретение относится к биотехнологии. Штамм одноклеточных водорослей Dunaliella salina IPPAS 295 - продуцент биологически активных веществ, обладающих антиоксидантной активностью, депонирован в коллекции культур микроводорослей Института физиологии растений им.

Изобретение относится к области медицинской микробиологии и касается штамма бактериофага Escherichia coli ECD4. Штамм бактериофага Escherichia coli ECD4 выделен из фекалий бройлерных кур на культуре бактерий штамма Escherichia coli О104:Н4 RKI№112027 и депонирован в Государственной коллекции патогенных микроорганизмов и клеточных культур «ГКПМ-Оболенск» под номером Рh63.

Изобретение относится к биотехнологии, в частности биодеградации органических соединений с помощью микроорганизмов. Предложен способ биодеградации дротаверина гидрохлорида (спазмолитик НОШПА).
Изобретение относится к области биотехнологии и может быть использовано в ветеринарии. Штамм Bacillus licheniformis BKM B-2713D обладает выраженным антагонизмом по отношению к Salmonella typhi, Staphylococcus aureus, Listeria monocytogenes.
Изобретение относится к биотехнологии. Предложен способ очистки водного раствора, содержащего соль меди, от ионов меди.
Изобретение относится к области фармацевтики и представляет собой питательную композицию для младенца или ребенка, содержащую липид или жир; источник белка; источник полиненасыщенных жирных кислот с длинной цепью, который содержит докозагексаеновую кислоту; до 2,5 вес.% источника дополнительного кальция, причем по меньшей мере 20% источника дополнительного кальция представляет собой глюконат кальция, и от 0,015 до 0,1 миллионных долей (пг/мкг) ТРФ-β.

Изобретение относится к фармацевтической промышленности, а именно к экстракту одного или более бактериальных штаммов Lactobacillus. Экстракт одного или более бактериальных штаммов Lactobacillus, представляющий собой растворимый экстракт, где экстракт содержит химически модифицированные бактериальные молекулы, полученные в результате воздействия щелочной среды на один или более бактериальных штаммов Lactobacillus, экстракт полезен в лечении заболеваний, связанных с дисбалансом продукции противовоспалительных цитокинов.
Изобретение относится к биотехнологии, в частности к способам приготовления биологически активных кормовых добавок для животных, птицы, рыбы. Готовят жидкую культуру штамма Corynebacterium glutamicum ВКПМ В-1959 - продуцента лизина глубинным способом и жидкие культуры штаммов Bacillus subtilis ВКПМ В-8130, Bacillus subtilis ВКПМ В-2984, Bacillus subtilis ВКПМ В-4099 и Bacillus licheniformis ВКПМ В-4162.
Изобретение относится к микробиологии и может быть использовано для получения изотопно-меченых клеток микроорганизмов. Способ обогащения клеток E.coli изотопами магния предусматривает культивирование клеток E.coli в течение 10-16 ч при температуре 37°C в водном растворе, обогащенном изотопом магния 24Mg или 25Mg, или 26Mg.

Изобретение относится к получению ферментированного молочного продукта. Способ получения ферментированного продукта включает инокулирование молока бактериями, ферментацию молока и упаковывание готового продукта.
Изобретение относится к биотехнологии и может быть использовано при производстве пищевых и кормовых добавок для профилактики и лечения желудочно-кишечных заболеваний.

Изобретение относится к биотехнологии, в частности биодеградации органических соединений с помощью микроорганизмов. Предложен способ биодеградации дротаверина гидрохлорида (спазмолитик НОШПА).
Изобретение относится к биотехнологии, в частности к способу приготовления бактериального препарата ацидофильных культур, и может быть использовано при получении молочнокислых микроорганизмов при производстве биологически активной пищевой добавки для профилактики дисбактериозов, дисфункции кишечника у детей и взрослых, а также у сельскохозяйственных животных.

Настоящее изобретение относится к области иммунологии. Предложено антитело, специфично связывающее сегмент M1' IgE и которое индуцирует апоптоз в экспрессирующих IgE В-клетках, и его антигенсвязывающий фрагмент.

Изобретение относится к штамму Lactobacillus paracasei subspecies paracasei, обладающему антимикробными и иммуномодулирующими свойствами, и к продукту, содержащему указанный штамм. Штамм депонирован в CNCM под номером I-3689. Штамм обладает способностью ингибировать рост патогенных микроорганизмов в культуре, в частности Escherichia coli, Salmonella enteritidis и Listeria monocytogenes. Штамм обладает противовоспалительными свойствами при соотношении IL-10IL-12 равном 11,8. Пищевой продукт, содержащий живой указанный штамм в количестве по меньшей мере 105 КОЕ на грамм, обладает антимикробными иили иммуномодулирующими свойствами. 2 н. и 4 з.п. ф-лы, 3 ил., 4 табл., 3 пр.

Наверх