Способ получения валидной молекулярно-генетической модели для доклинических испытаний новых антиэпилептических лекарственных препаратов


 

C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2502257:

Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Башкирский государственный университет" (RU)

Изобретение относится к области медицины, нейробиологии и фармакогенетике и касается способа получения валидной молекулярно-генетической модели абсансной эпилепсии человека. Представленный способ заключается в том, что с помощью генотипирования локуса Taq 1А DRD2 среди крыс линии WAG/Rij выявляются родительские особи Р с генотипом А11 гена DRD2, скрещиваются между собой, получают потомство F1, которое выращивают до половозрелого возраста, затем среди потомства F1 выделяют неаудиогенных особей, после чего неаудиогенных особей потомства F1 скрещивают между собой для получения потомства F2, которое затем также доращивается до половозрелого возраста, среди них также производится отбор неаудиогенных особей, при этом скрещивание и отбор производится неоднократно для получения однородной популяции неаудиогенных крыс линии WAG/Rij с генотипом А11 гена DRD2, контроль типа ПВР у отобранных особей потомства F1 для последующего скрещивания производится посредством электроэнцефалографического анализа, включающего морфологический контроль. Представленное изобретение может быть использовано для доклинических испытаний антиэпилептических препаратов. 1 ил., 1 табл.

 

Эпилепсия как самое распространенное неврологическое заболевание, характеризующееся пожизненным течением и высокой инвалидизацией населения, относится к социально значимым. Разработка технологий снижения потерь от социально значимых заболеваний путем создания новых методов их диагностики и лечения включена в новый перечень приоритетных критических технологий, утвержденных указом Президента РФ от 7 июля 2011 года.

Около 70% всех форм эпилепсии начинается в детском возрасте и самой распространенной среди них является детская абсансная эпилепсия (ДАЭ). Правильная диагностика и грамотно разработанное медикаментозное лечение ДАЭ определяют прогноз заболевания, возможность купирования ее приступов, а в благоприятных случаях избавление больного ребенка от этого тяжкого недуга.

Разработка оптимальных схем медикаментозного лечения - одна из главных проблем в эпилептологии, т.к. сложность этиопатогенеза заболевания, в котором принимают участие как генетические, так и средовые факторы, предопределяет большое разнообразие ее форм. Большие надежды эпилептологов связаны с развитием фармакогенетики, нового направления, которое стремится построить подбор антиэпилептических препаратов (АЭП) на знаниях молекулярно-генетических маркеров генома больного человека. Успех фармакогенетики прогнозируется, прежде всего, в отношении идиопатической эпилепсии, т.е. таких ее форм, при которых нет другой причины эпилепсии, кроме наследственной предрасположенности. Именно к такой эпилепсии относится ДАЭ, в возникновении которой большую роль играют генетические факторы.

Создание новых АЭП предполагает их доклиническое испытание, которое должно проводиться на валидных моделях. В качестве таких моделей используются животные, болеющие эпилепсией, механизм формирования которой идентичен человеку [Погодаев К.И. Эпилептология и патохимия мозга. - М.: Медицина, 1986. - 288 с., Авакян Г.Н., Бадалян О.Л., Бурд С.Г., Авакян Г.Г., Чуканова А.С., Стойко М.И., Савенков А.А., Вальдман Е.А., Воронина Т.Д., Неробкова Л.Н., Крикова Е.В. Экспериментальная и клиническая эпилептология. Эпилепсия. 2010. 4: 41-54].

Широко используемой моделью для изучения механизмов абсансной эпилепсии человека и испытания АЭП являются крысы линии WAG/Rij [van Luijtelaar E.L., Coenen A.M. Two types of electrocortical paroxysms in an inbred strain of rats. Neurosci. Lett. 1986. 70 (3): 393-397; Coenen A.M., van Luijtelaar E.L. Genetic animal models for absence epilepsy: a review of the WAG/Rij strain of rats // Behavior Genetics. 2003. 33: 633-655]. Эти животные имеют до сотни спонтанно возникающих в коре пик-волновых разрядов (ПВР) в день. Однако регистрируемые у этой линии крыс ПВР, как показали исследования, неоднородны. Показано, что у 50% крыс линии WAG/Rij, наряду с типичными для абсансной эпилепсии ПВР первого типа, регистрируются и ПВР второго типа [van Luijtelaar E.L., Coenen A.M. Two types of electrocortical paroxysms in an inbred strain of rats. Neurosci. Lett. 1986. 70 (3): 393-397. Midzyanovskaya I.S. Absence and mixed forms of epilepsy in WAGRij rats: characteristics and brain aminergic modulations. Nijmegen: Nijmegen University Press. 2006. P.230]. ПВР первого и второго типа имеют различную локализацию в коре больших полушарий и характеризуются особенностями электрографических показателей. Существенно важно то, что они по-разному реагируют на введение агонистов и антагонистов рецептора дофамина второго типа (DRD2). Выявлено, что галоперидол увеличивает количество ПВР первого типа, сокращая интервал между их возникновением, вследствие чего эпиактивность возрастает в несколько раз. Апоморфин, наоборот, полностью подавляя ПВР разряды первого типа, увеличивает число ПВР второго типа [Kuznetsova G.D., Petrova F.V., Coenen A.M., van Luijtelaar E.L. Generalized absence epilepsy and catalepsy in rats. Physiol Behav. 1996. 60 (4): 1165-1169; Bruin de N.M., van Luijtelaar E.L., Cools A.R., Ellenbroek B.A. Dopamine characteristics in rat genotypes with distinct susceptibility to epileptic activity: apomorphine-induced stereotyped gnawing and novelty/amphetamine-induced locomotor stimulation. Behav. Pharmacol. 2001. 12 (6-7): 517-525; Deransart С.V., Riban. B. Le. C. Marescaux. A. Depaulis Dopamine in the striatum modulates seizures in a genetic model of absence epilepsy in the rat. // Neuroscience. 2000. 100: 335-344: Midzianovskaia I.S., Kuznetsova G.D., Coenen A.M.,. Spiridonov A.M., van Luijtelaar E.L. Electrophysiological and pharmacological characteristics of two types of spike-wave discharges in WAG/Rij rats. Brain Res. 2001. 911(1): 62-70: Birioukova L.M., I.S. Midzyanovskaya. S. Lensu. L. Tuomisto. E. L. van Luijtelaar Distribution of D (1)-like and D (2)-like dopamine receptors in the brain of genetic epileptic WAG/Rij rats // Epilepsv Research. 2005, 63: 89-96]. Наличие ПВР разного типа у крыс линии WAG/Rij, несомненно, ставит под сомнение валидность этой модели. Для получения достоверных результатов крысы этой линии до проведения фармакологических экспериментов с АЭП должны тщательно отбираться, т.е. в работу могут быть взяты крысы только с ПВР первого типа. а крысы, у которых регистрируются ПВР второго типа, должны отбраковываться. Это повышает трудоемкость проведения экспериментов, значительно повышает их стоимость.

Целью предлагаемого изобретения является разработка способа получения популяции крыс линии WAG/Rij с генотипом А1/А1 локуса Taq 1А DRD2, имеющих ПВР только первого типа, которые типичны для абсансной эпилепсии - валидной молекулярно-генетической модели абсансной эпилепсии человека для доклинических испытаний антиэпилептических препаратов.

Поставленная цель в предложенном способе получения валидной молекулярно-генетической модели для доклинических испытаний новых антиэпилептических лекарственных препаратов достигается тем, что с помощью генотипирования локуса Taq 1А DRD2 среди крыс линии WAG/Rij выявляются особи с генотипом А11 гена DRD2 (родители Р) и скрещиваются между собой с целью получения потомства F1, которое выращивают до половозрелого возраста (6 месяцев), затем среди потомства F1 выделяют неаудиогенных особей, после чего неаудиогенных особей потомства F1 скрещивают между собой для получения потомства F2, которое затем также доращивается до половозрелого возраста, среди них также производится отбор неаудиогенных особей. Таким образом, скрещивание и отбор производится неоднократно для получения однородной популяции неаудиогенных крыс линии WAG/Rij с генотипом А11 гена DRD2, служащих моделями абсансной эпилепсии человека для доклинических испытаний антиэпилептических препаратов.

Контроль типа ПВР у отобранных особей потомства F1 для последующего скрещивания производится посредством электроэнцефалографического (ЭЭГ) анализа, включающего морфологический контроль.

Селекция крыс линии WAG/Rij с генотипом А11 гена DRD2 (с отбором для получения потомства только неаудиогенных особей в ряде поколений) обеспечивает получение субпопуляции крыс этой линии, малые эпилептические припадки которых имеют мономорфный электроэнцефалографический паттерн в виде пик-волновых разрядов первого типа, типичных для абсансной эпилепсии в отличие от полиморфных спайк-волновых разрядов, имеющих место в исходной популяции крыс этой линии. Наличие в ЭЭГ неаудиогенных крыс линии WAG/Rij с генотипом А11 по локусу Taq 1А DRD2 только типичных для абсансной эпилепсии показателей эпиактивности и оптимизирует и обеспечивает достоверность результатов доклинических испытаний новых антиабсансных лекарственных препаратов.

Способ реализуется следующим образом.

Провели генотипирование локуса Taq 1А DRD2 крыс линии WAG/Rij. Для этого из хвостовой вены крыс в пробирку с консервантом, в качестве которого использовали глюгицир, набирали кровь в объеме 4-5 мл. Для выделения ДНК к 5 мл крови добавляли 30 мл лидирующего буфера (320 мМ сахарозы, 1% тритон Х-100, 5 мМ МgСl2, 10 мM трис-HCl, рH 7,6) и центрифугировали при 4ºС и 4000 об/мин в течение 20 минут. Надосадочную жидкость сливали, к осадку добавляли 20 мл лидирующего буфера и центрифугировали при тех же условиях в течение 10 минут. К полученному осадку добавляли 800 мкл буфера Soline ЭДТА (25 мМ ЭДТА, рН 8.0, 75 мМ NaCl). Затем ресуспендировали полученный раствор и переносили его в двухмиллилитровые стерильные пластиковые пробирки, добавляли 80 мкл 10% SDS (содиумдодецилсульфат), 20 мкл протеиназы К (10 мг/мл) и инкубировали при 37°С в течение 16 часов.

Экстракцию ДНК проводили в три этапа: 1) раствором забуференного фенола (200 мкл меркаптоэтанола на 50 мл фенола Трис-HCl, рН 7.8); 2) смесью фенола хлороформа (1:1) и хлороформом (2 мл изоамилового спирта на 48 мл хлороформа) в равных объемах (1000 мкл) с плавным перемешиванием на ротаторе в течение 10 мин; 3) центрифугированием при 6000 об/мин в течение 10 минут и отбором водной фазы после каждого этапа.

ДНК осаждали из раствора в стеклянных плоскодонных конических колбах объемом 50 мл 96% раствором охлажденного этанола в соотношении 1:3. Сформированную ДНК промывали 70% раствором этилового спирта, подсушивали на воздухе, растворяли в деионизированной воде и хранили при -20°С. Выделенную ДПК использовали для проведения полимеразной цепной реакции синтеза ДНК.

Амплификацию локуса проводили с помощью метода полимеразной цепной реакции (ПЦР) синтеза ДИК на амплификаторе "Терцик" производства г. Пущино. Использовали реакционную смесь для амплификации объемом 12.5 мкл, которая состояла 50 мМ трис-HСl-буфера (рН 8.8, 5 мМ MgCl2, 15 мМ (NH4)2SO4), 0,1 мкг геномной ДНК, смесь dNTP (dATP, dGTP, dCTP dTTP пo 200 мкл каждого), ДНК-полимеразу Termus aquaticus (производства фирмы "Биотекс", г. Москва) и локусспецифичные олигонуклеотидные праймеры (0.25 мкМ). Для определения нуклеотидных замен использовали метод анализа ПЦР-ПДРФ (полиморфизм длины рестрикционных фрагментов).

Для локуса Taq 1A DRD2 был использован праймер

5′ CTGGGTATCGTCCACCTTCT 3′

5′ AACACTGCTACACCTAATCATCCA 3′, который был подобран с помощью программы Primer3 (httр://frodо.wi.edu/primer3).

После денатурации (3 мин при 94°С) выполняли 35 циклов амплификации по схеме: отжиг праймеров - 1 мин при 58°C, синтез ДНК 1 мин при 72°С, денатурация 1 мин при 94°С. Затем пробы выдерживали 10 мин при 72°С, охлаждали. Для выявления полиморфизма 10 мкл реакционной смеси обрабатывали 5 единицами рестриктазы TAG 1А. В результате реакции аллель А1, локуса TAG 1А, длиной 295 пар оснований оставался интактным, а А2 подвергался ферментативному гидролизу. Длины фрагментов А2 были равны 119 и 176 пар оснований.

Разделение фрагментов ДНК после амплификации и рестрикции проводили при помощи электрофореза в 7% полиакриламидном геле (исходное соотношение акриламида и метиленбисакриламида - 29:1). Электрофорез проводили в 1×TBE буфере (0,089 М трис-НCl : 0,089 М борная кислота : 0,002 М ЭДТА, рН-8,0) при напряжении 300 В. Перед нанесением на гель пробы смешивали в соотношении 5:1 с буфером, содержащим 0,25% бромфенолового синего, 0,25% ксиленцианола и 15% фикола. В качестве маркера молекулярного веса использовали 2-Log Ladder (0,1 - 10,0 кб. New England Biolabs. США). После окончания электрофореза гель окрашивали раствором бромистого этидия и визуализировали в проходящем ультрафиолетовом свете. Документирование результатов электрофореза проводили с использованием видеосистемы «Geldokulant» (Франция).

Таким образом, среди крыс линии WAG/Rij были выявлены особи-родители Р с генотипом А11 гена DRD2.

Далее выявленных родительских особей Р с генотипом А11 скрестили между собой и получили потомство F1. Полученное потомство дорастили до половозрелого возраста - 6 месяцев. После чего половозрелые крысы с генотипом A1/A1 были подвергнуты воздействию звукового раздражителя с целью определения предрасположенности к аудиогенному судорожному припадку в соответствии с методикой, описанной в работе Г.Д. Кузнецовой [Kuznetsova G., Midzianovskaia I., Соеnеn A., van Luijlelaar L., Mixed forms of epilepsy in a sub-population of WAG/Rij rats. I he WAG/Rij rat model of absence epilepsy: ten years of research. Nijmegen: Nijmegen Univ. Press. 2000]. Аудиогенную чувствительность крыс определяли в специальной камере (60×60×60 см), используя «звон ключей» («keys ringing»). Звуковой сигнал имел диапазон 13-85 кГц (максимум спектра 20-40 кГц) и среднюю интенсивность 50-60 дБ с величиной пиков до 80-90 дБ. Стимульный раздражитель включал в себя ультразвуковую часть и был более эффективным для вызова большого судорожного припадка, чем звук звонка или гудка. Он предъявлялся в течение 1,5 минут.

В результате проведения звуковой стимуляции были выявлены неаудиогенные особи и аудиогенные особи. Для последующего скрещивания были отобраны только неаудиогенные особи.

Среди выявленных неаудиогенных особей потомства F был проведен контроль типа ПВР посредством электроэнцефалографического (ЭЭГ) анализа.

Для электроэнцефалографического (ЭЭГ) анализа использовали стереотаксический метод вживления хронических электродов. Координаты структур рассчитывали по атласу мозга крысы Paxinos. Watson (1998). Проводили вживление трех активных электродов с координатами: во фронтальную кору - поле 6 (АР- +3; L-3); в теменную кору - поле 2 (АР-0; L-5); в затылочную кору - поле 17 (АР- -6; L-3).

На восьмой день после операции проводили регистрацию фоновой ЭЭГ. Для этого животное помещали в экранированную затемненную камеру, где животное могло свободно двигаться. Подготовительный период до регистрации длился в среднем около получаса. По истечении этого времени к разъемам электродов, расположенным на голове животного, подсоединяли провода, идущие к усилителю. В предварительно открытом окне программы вводили номер крысы, номер файла. Запись осуществляли в программе EEGView на электроэнцефалографе Bioskript BST-2000 (Германия). Частотный состав ЭЭГ определялся в диапазоне от 1 до 25 Гц, частота опроса (дискретизации) составляла 128 мс, постоянная времени 0,3 с, фильтр высокой частоты 70 Гц. Для каждой крысы было записано от 4 до 12 файлов. Регистрация ЭЭГ во всех случаях осуществлялась в одно и то же время суток и при одинаковых условиях для всех экспериментальных животных.

Морфологический контроль проводили после окончания всех предусмотренных экспериментальных воздействий для определения местоположения кончика электрода. После наркоза извлекали головной мозг и фиксировали его в нейтральном 10% формалине. С помощью замораживающего столика готовили фронтальные срезы толщиной 20-30 мкм. Срез на предметном стекле помещали в фотоувеличитель и проецировали изображение на лист фотобумаги. Полученные фотографии проявляли, фиксировали и глянцевали. При этом использовали стандартные приборы, реактивы и материалы для черно-белой фотографии. Для анализа ЭЭГ использовали только тех крыс, у которых электроды находились в первичной соматосенсорной коре (фронтальная кора, основной фокус инициации ПВР), париетальной и затылочной областях неокортекса.

Данные ЭЭГ обрабатывали с помощью визуального анализа и вейвлет-анализа. Визуальный анализ позволил подсчитать количество одиночных пиков в одном пик-волновом разряде (ПВР), продолжительность ПВР (длительность разряда в секундах oт первой пик-волны до последней), пик-волновой индекс, выраженный в % (процент времени, занятый всеми пик-волновыми разрядами в файле регистрации, продолжительность которого принимали за 100%). Количество пик-волновых разрядов определяли в каждом анализируемом файле.

Для анализа частотно-временных характеристик ПВР. необходимых для определения типа разрядов, использовали вейвлет-преобразование но Морле в связи с его высокой информативностью и его модифицированный вариант, предложенный Босняковой и Обуховым [Bosnyakova D., Obukhov Yu. V. Extraction of Dominant Features in Biomedical Signals // Pattern Recognition and Image Analysis. 2005, 15 (2): 513] и Габовой и др. [Габова А.В., Гнездицкий В.В., Боснякова Д.Ю., Жарикова А.В., Самотаева И.С., Обухов Ю.В., Кузнецова Г.Д. Частотно-временная динамика разрядов «пик-волна» у пациентов с абсансной эпилепсией. Технологии живых систем. 2008. 5: 72-8], позволяющий выделить динамику частоты разряда.

Статистическую обработку данных проводили с помощью программы Statistica 6.0. Достоверность различий осуществляли с помощью параметрического критерия Стьюдента. Различия считали статистически значимыми при р<0,05.

У крыс с генотипом А11 спонтанно возникающие пик-волновые разряды имеют максимальную амплитуду во фронтальной коре (рис.1).

Они широко генерализованы по коре и их длительность колеблется от четырех до десяти секунд.

Полученные результаты показали, что: 1) у крыс с генотипом А11 пик-волновые разряды (ПВР) носят характер разрядов первого типа; 2) у крыс с генотипом А11 пик-волновые разряды широко генерализованы по коре, что является типичным для ДАЭ. Численные характеристики ПВР у крыс с генотипами А11 и А22 (контроль, крысы с ПВР второго тина) представлены в таблице 1. Они показывают, что у крыс с генотипом А11 ПВР формируются вдвое чаще (р<0,001), имеют достоверно большую продолжительность (р<0,001), что предопределяет наличие у них больших значений пик-волнового индекса(р<0,01).

Таблица 1
Количественные характеристики пик-волновых разрядов первого типа у крыс с генотипами А11 и А22
Параметр Длительность ПВР, с Количество ПВР, шт. Пик-волновой индекс, %
Генотип А11 А22 А11 А22 А11 А22
М±m 5,6 3,72 8,6 4,21 9,5 2,71
±0,34 ±0,14 ±0,66 ±0,41 ±0,82 ±0,25
t 4,29 5,08 6,71
p p<0,001 p<0,001 p<0,01

Количественные различия, проявляющиеся в выраженности ПВР первого типа у крыс с генотипами А11 и А22, есть следствие изменения модулирующего влияния дофамина на активность глутаматергической и ГАМКергической систем мозга, связанного с особенностями экспрессии короткой и длинной изоформ DRD2, обусловленного полиморфизмом локуса Taq 1А DRD2 [Zhang Y., Bertolino A., Fazio L., Blasi G., Rampino A., Romano R., Mei-Ling T. Lee. Tao Xiao. Papp A., Wang D., Sadѐe W. Polymorphisms in human dopamine D2 receptor gene affect gene expression, splicing, and neuronal activity during working memory. Proc Natl Acad Sci USA. 2007. 104 (51). 20052-20057; Jocham G., Klein T.A., Neumann J., von Cramon D.Y., Reuter M., Ullsperger M. Dopamine DRD2 polymorphism alters reversal learning and associated neural activity. J Neurosci. 2009. 29 (12): 3695-3704].

Характерным признаком типичных разрядов абсансной эпилепсии является возникновение в лобной области коры в самом начале разряда короткой вспышки активности с более высокой частотой, чем остальной разряд. Только после этого другие участки коры вовлекаются в ритмическую активность. Эти данные хорошо согласуются с современным представлением о ведущей роли лобных отделов коры в формировании ПВР при абсансной эпилепсии.

Таким образом, выявленные ПВР первого типа у крыс с генотипом А1/A1 характерны для абсансной эпилепсии, они формируются в структурах кортикоталамического круга.

Далее выявленные неаудиогенные крысы скрещиваются между собой для получения однородной популяции.

Т.о. техническим результатом изобретения является создание валидной модели - однородной популяции крыс линии WAG/Rij с генотипом А11 локуса Taq 1А DRD2, имеющих ПВР только первого типа, типичных для абсансной эпилепсии, позволяющей получить достоверные результаты при испытании антиэпилептических препаратов. Наличие у созданной популяции крыс с генотипом А1/А1 локуса Taq 1А DRD2 ПВР только первого типа (при отсутствии ПВР второго типа), определяя основную мишень действия испытываемых препаратов, позволит объективизировать оценку их эффективности путем анализа частоты, длительности и пик-волнового индекса ПВР первого типа, типичных для абсансной эпилепсии человека. Подобный подход обеспечит повышение качества создаваемых антиэпилептических препаратов, т.к. их оценка будет отражать способность воздействовать на основные патогенетические звенья заболевания.

Внедрение полученной валидной модели в практику доклинических испытаний даст большой экономический эффект с выраженным социальным эффектом, в частности:

1) потребуется меньшее число крыс для эксперимента,

2) сократятся затраты времени экспериментатора,

3) значительно повысится достоверность результатов, а следовательно, и эффективность проходящих испытание препаратов и последующего лечения,

4) повышение эффективности лечения приведет к уменьшению частоты приступов у больных и обеспечит их трудоспособность,

5) будет способствовать большей сохранности трофики нервной ткани,

6) уменьшит риск формирования психопатических осложнений эпилепсии и т.д.

Поскольку на сегодняшний день в мире нет равноценной валидной молекулярно-генетической модели абсансной эпилепсии человека, а частота заболеваний велика, есть все основания предполагать, что в случае получения патента в дальнейшем он может получить международный статус.

Способ получения валидной молекулярно-генетической модели для доклинических испытаний новых антиэпилептических лекарственных препаратов, заключающийся в том, что с помощью генотипирования локуса Taq 1А DRD2 среди крыс линии WAG/Rij выявляются родительские особи Р с генотипом А11 гена DRD2, скрещиваются между собой, получают потомство F1, которое выращивают до половозрелого возраста, затем среди потомства F1 выделяют неаудиогенных особей, после чего неаудиогенных особей потомства F1 скрещивают между собой для получения потомства F2, которое затем также доращивается до половозрелого возраста, среди них также производится отбор неаудиогенных особей, при этом скрещивание и отбор производится неоднократно для получения однородной популяции неаудиогенных крыс линии WAG/Rij с генотипом А11 гена DRD2, кроме того, контроль типа ПВР у отобранных особей потомства F1 для последующего скрещивания производится посредством электроэнцефалографического анализа, включающего морфологический контроль.



 

Похожие патенты:

Изобретение относится к биотехнологии и представляет собой бактерию рода Escherichia, которая продуцирует L-аминокислоту, выбранную из группы, состоящей из L-глутамина, L-глутаминовой кислоты, L-пролина, L-аргинина, L-цитруллина и L-орнитина.
Изобретение относится к биотехнологии и представляет собой способ получения L-аминокислоты, выбранной из группы, включающей L-глутамин, L-глутаминовую кислоту, L-пролин, L-аргинин, L-цитруллин, L-орнитин.
Изобретение относится к биотехнологии и представляет собой способ получения L-аминокислоты, выбранной из группы, состоящей из L-глутамина, L-глутаминовой кислоты, L-пролина, L-аргинина, L-цитруллина и L-орнитина.

Изобретение относится к области биохимии, молекулярной биологии и медицины. Предложен способ получения наноразмерной системы доставки фрагментов нуклеиновых кислот (ФНК) и их аналогов в клетки млекопитающих.

Изобретение относится к области генной инженерии и может быть использовано в биотехнологических процессах в качестве средства для объединения фрагментов ДНК и получения сложных ДНК-конструкций.

Изобретение относится к области биотехнологии и генетической инженерии и представляет собой вектор для получения вектора для экспрессии в бактериальной клетке предшественника целевого рекомбинантного белка, слитого с N-концевым пептидом, содержащим декагистидиновый кластер и сайт узнавания протеиназой, по существу состоящий из участка инициации репликации pBR322 ori; гена репрессора лактозного оперона; бактериального промотора; области, кодирующей N-концевой лидерный пептид, содержащий декагистидиновый кластер и, необязательно, сайт узнавания протеиназой; участка клонирования (полилинкера); участка терминации транскрипции, функционирующего в бактериальной клетке; фрагмента, кодирующего негеномную пару токсин-антитоксин, при этом ген антитоксина ориентирован таким образом, что направление его транскрипции совпадает с направлением транскрипции целевого гена; гена, кодирующего бактериальный маркер селекции.

Изобретение относится к биотехнологии и представляет собой рекомбинантную плазмидную ДНК pMALTEV-legumain, молекулярной массой 4,78 мегадальтон и размером 7839 п.н., кодирующую полипептид, обладающий антигенными свойствами белка легумаин Opisthorchis felineus, и содержащую фрагмент векторной плазмиды pMALTEV, включающий Ptac промотор; lac-операторную последовательность; последовательность гена malE, кодирующего мальтоза-связывающий белок; сочетание терминаторов транскрипции rrnB Т1Т2 E.coli; ген β-лактамазы и участок ori (pBR322) инициации репликации; кДНК гена легумаин O.felineus без сигнального пептида, фланкированную сайтами рестрикции BamHI и HindIII; промотор гибридный Ptac; lac-операторную последовательность для усиления связывания lac-репрессора; терминаторы транскрипции гена rrnB E.coli (t1 и t2); в качестве генетического маркера ген β-лактамазы (ampR), детерминирующий устойчивость трансформированных плазмидой pMALTEV-legumain клеток E.coli к ампициллиновым антибиотикам; нуклеотидную последовательность, кодирующую MBP (мальтоза-связывающий белок), являющийся частью гибридной последовательности рекомбинантного белка MBP-legumain и позволяющий выделять рекомбинантный полипептид методами аффинной хроматографии; уникальные сайты эндонуклеаз рестрикции, имеющие следующие координаты: BamHI (2668), EcoRI (2675), StuI (2685), SalI (2691), SpeI (2704), NotI (2711), XbaI (2725), PstI (2737), XhoI (2740), SphI (2750), KpnI (2756), HindIII (2758).

Изобретение относится к области биотехнологии, а именно к способам слияния эмбриональных клеток, конкретно к лазерному слиянию бластомеров внутри ранних доимплантационных эмбрионов млекопитающих без нарушения их целостности.

Изобретение относится к области генной инженерии, молекулярной и клеточной биологии. Предложена плазмидная генетическая конструкция pOL-DsRed2, построенная на основе плазмидного вектора pIRES (Clontech), в который помещены фрагменты кДНК генов ОСТ4 и LIN28 человека, соединенные нуклеотидной последовательностью, кодирующей F2А-пептид, и кДНК гена, кодирующая флуоресцентный белок DsRed2.

Изобретение относится к области генной инженерии, молекулярной и клеточной биологии, биотехнологии. Получена плазмидная генетическая конструкция pOK-DsRed2, построенная на основе плазмидного вектора pIRES (Clontech), в который помещены фрагменты кДНК генов ОСТ4 и KLF4 человека, соединенные нуклеотидной последовательностью, кодирующей F2А-пептид и кДНК гена, кодирующего флуоресцентный белок DsRed2.
Изобретение относится к области генетики и селекции животных. Способ отбора крупного рогатого скота калмыцкой породы заключается в том, что в 6-месячном возрасте выявляют в крови наличие эритроцитарных антигенов-маркеров высокорослого типа: G2 Е′3 R2.

Изобретение относится к области пушного звероводства, в частности к повышению продуктивности молодняка норок. Способ выращивания пушных зверей предусматривает введение в рацион молодняка норок, предназначенного для получения шкурки, биологически активных веществ (физиологических стимуляторов).

Изобретение относится к области сельского хозяйства, а именно к селекции, и может найти применение в селекционной работе в племенных птицеводческих хозяйствах. Оценку цыплят-бройлеров проводят по разработанной шкале для быстро- и медленнооперяющихся линий мясных пород, суточных цыплят распределяют на три группы: 6-18 часов - поздние; 19-32 часа - средние; 33 - и выше - ранние.

Изобретение относится к пантовому оленеводству и может быть использовано для выявления продуктивных качеств маралов-рогачей. .

Изобретение относится к области биохимии. .
Изобретение относится к ветеринарной медицине и свиноводству. .

Изобретение относится к генетике и разведению сельскохозяйственных животных. .

Изобретение относится к биохимии растений. .

Изобретение относится к сельскому хозяйству, к животноводству, в частности, для выявления охоты коров на преддоильной площадке. .
Изобретение относится к области ветеринарии и сельского хозяйства. Способ предусматривает определение в крови свиней следующих показателей: содержание малонового диальдегида МДА, антиокислительную активность АОА, общую окислительную активность плазмы крови ООА, активность каталазы КТ, супероксиддисмутазы СОД. Свиней двухмесячного возраста при показателях МДА 6,02±0,13ЕА/мл и ниже, АОА 60,86±0,31% и выше, ООА 71,64±0,16% и ниже, КТ 57,30±1,05 ЕА/мл мин и выше, СОД 14,57±0,44 ЕА/мл и выше относят к стрессустойчивым PSS «-», при показателях МДА 7,63±0,07 ЕА/мл и выше, АОА 50,22±0,42% и ниже, ООА 79,21±0,83% и выше, КТ 47,16±1,08 ЕА/мл мин и ниже, СОД 10,49±0,49 ЕА/мл и ниже относят к стрессчувствительным PSS «+». Свиней шестимесячного возраста при показателях МДА 7,37±0,17 ЕА/мл и ниже, АОА 61,93±0,25% и выше, ООА 41,86±0,19% и ниже, КТ 76,68±0,74 ЕА/мл мин и выше, СОД 22,80±0,68 ЕА/мл и выше относят к стрессустойчивым PSS «-», а при показателях МДА 8,05±0,09 ЕА/мл и выше, АОА 59,72±0,17% и ниже, ООА 46,21±0,09% и выше, КТ 71,76±0,51 ЕА/мл мин и ниже, СОД 19,91±0,59 ЕА/мл и ниже относят к стрессчувствительным PSS «+». Способ позволяет с высокой точностью оценивать поросят двух- и шестимесячного возраста на стрессустойчивость. 6 табл., 4 пр.
Наверх