Способ диагностики предрасположенности пациента к наследственной макулодистрофии штаргардта



Способ диагностики предрасположенности пациента к наследственной макулодистрофии штаргардта
Способ диагностики предрасположенности пациента к наследственной макулодистрофии штаргардта
Способ диагностики предрасположенности пациента к наследственной макулодистрофии штаргардта

 

G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2504781:

Федеральное государственное бюджетное учреждение "Национальный исследовательский центр "Курчатовский институт" (RU)

Изобретение относится к области биотехнологии и медицины. Предложен способ диагностики предрасположенности пациента к наследственной макулодистрофии Штаргардта. Фибробласты кожи, взятые у пациента, культивируют и обрабатывают вирусными конструкциями, несущими гены Oct4, Sox2 и Klf4 под контролем CMV промотера. Осуществляют направленную дифференцировку фибробластов в клетки ретины. Из клеток ретины выделяют кодирующую РНК гена АВСА4. По наличию делеции в экзоне 39-41 гена АВСА4 диагностируют предрасположенность пациента к наследственной макулодистрофии Штаргардта. Изобретение позволяет эффективно диагностировать предрасположенность пациента к наследственной макулодистрофии Штаргардта по наличию делеции в экзоне 39-41 гена АВСА4. 3 ил., 1 табл., 1 пр.

 

Настоящее изобретение относится к области биотехнологии и медицины. Из существующего уровня техники известно, что генетические мутации могут существенным образом влиять на проявление генов и приводить к заболеваниям, связанным с потерей зрения. Основными типами тканей, которые подвержены патологиям систем зрения, является эпителий ретины и фоторецепторы сетчатки глаза. Определить структуру генов, проявляющихся в патологических тканях, не представляется возможным в связи с инвазивностью процесса взятия материала глаза и возможно чрезвычайно низким уровнем проявлением генов. Настоящее техническое решение позволяет существенно снизить инвазивность и травматичность диагностических процедур по определению генетических особенностей заболеваний глаза.

Наиболее близким к заявленному техническому решению является US 2010299765, опубл. 2010-11-25. В патенте приведен способ получения клеток сетчатки глаза, из эмбриональных стволовых клеток человека. В результате использования определенных условий культивирования методами направленной дифференцировки заявленным способом получаются клетки пигментированного эпителия ретины и фоторецепторные предшественники сетчатки глаза пригодные для трансплантации. Однако, первичным источником клеток являются аллогенные эмбриональные стволовые клетки. В связи с этим, основным недостатком данного технического решения, который не позволяет использовать полученную культуру сетчатки глаза для диагностики, является использование эмбриональных стволовых клеток, которые затруднительно получать для живущих людей, страдающих наследственными дефектами зрения. Задачей, на решение которой направлено заявляемое изобретение является разработка способа диагностики генетических мутаций клеток глаза человека, получаемых из фибробластов кожи.

Новым техническим результатом, обеспечиваемым приведенной совокупностью признаков, является возможность проведения диагностики мутаций генов, характерных для пигментированных клеток ретины и фоторецепторов, не прибегая к инвазивному взятию материала клеток глаза живого человека.

Для этого предложен способ диагностики предрасположенности пациента к наследственной макулодистрофии Штаргардта, включающий взятие фибробластов кожи у этого пациента, их культивирование и обработку вирусными конструкциями, несущими гены Oct4, Sox2 и Klf4 под контролем CMV промотера, последующее культивирование для направленной дифференцировки фибробластов в клетки ретины и дальнейшее исследование клеток ретины на наличие мутации в экзоне 39-41 гена АВСА4, и по наличию делеции в этом экзоне диагностируют предрасположенность пациента к наследственной макулодистрофии Штаргардта.

Т.е., в заявленном способе фибробласты кожи репрограммируются генетическими факторами, позволяющими дифференцировать клеточную популяцию в клетки эпителия ретины и фоторецепторы глаза, экспрессирующие нормальные и мутантные гены, специфические для проведения генетических тестов с помощью полимеразной цепной реакции.

Описание способа диагностики

В качестве модельной системы были использованы фибробласты кожи людей с проявлением заболевания Штаргардта. В процессе индивидуального развития у этих людей происходит постепенная потеря зрения вплоть до полной слепоты. В основном, заболевание связано с мутациями в гене АВСА4, однако известно ограниченное количество генетических мутаций (http://www.med-gen.ru/science/staff/dnklab/). Поиск новых мутаций, которые могут не затрагивать структурную часть гена может быть затруднен или невозможен в связи с недоступностью эпителия ретины и фоторецепторов для анализа. ДНК фибробластов кожи пациентов носителей Штаргардта была проанализирована на наличие известных мутаций с негативным результатом. Для обнаружения мутаций необходимо исследовать кодирующую РНК известных генов, например АВСА4, на долю которого приходится до 70% известных мутаций. Однако эта РНК обнаруживается только в специализированных клетках ретины. Для получения специализированных клеток ретины фибробласты кожи культивировали в DMEM (ПанЭко, РФ), 15% фетальная бычья сыворотка (FBS) (Hyclone, США), 2 мМ глутамин (Hyclone, США), 50 ед./мл пенициллин-стрептомицин (ПанЭко, РФ). Через 2 недели после культивирования 4×104 клеток обработываются вирусными конструкциями, несущими гены Oct4, Sox2 и Klf4 под контролем CMV промотера (1). Клетки далее культивируются в среде DMEM/F12 (Hyclone, США), 20% Serum replacement (Invitrogen, США), 2 мМ L-глутамин (Hyclone, США), 0.1 мМ β-меркаптоэтанол (Sigma-Aldrich, США), 1% смесь аминокислот (Hyclone, США), bFGF 4 нг/мл (PeproTech, США), пенициллин-стрептомицин (50 ЕД/мл; 50 мкг/мл) (ПанЭко, РФ) до образования колоний (Фиг.1) Через 10 дней образовавшиеся колонии переносятся в дифференцировочную среду: DMEM/F12 с добавлением N2 саплемента, 20 ng/ml BDNF, 20 ng/ml GDNF, 150 mM аскорбиновой кислоты, 3% фетальная бычья сыворотка (FBS) (Hyclone, США) (2) и культивирование продолжается еще 3 недели. Через 3 недели на чашках формируется характерный слой окрашенных клеток (Фиг.2). Тотальная РНК из клеточных культур выделяется с помощью MiniRNA kit (Qiagen, США) согласно прилагающимся инструкциям. Обработку ДНКазой осуществляется непосредственно на колонках, с использованием прилагающихся к набору MiniRNA kit ДНКазы и буфера. Реакцию обратной транскрипции проводится с использованием случайных шестинуклеотидных праймеров (Amersham Biosciences, США), M-MLV Reverse Transcriptase (Promega, США), Ribonuclease Inhibitor (Promega, США), dNTPs (Fermentas, США) согласно прилагающимся инструкциям. На одну реакцию берется 0.5-1 мкг тотальной РНК. Для проведения ПЦР-амплификации продуктов реакции обратной транскрипции берется 0.05-0.1 часть реакционной смеси. ПЦР-амплификацию проводят с помощью ScreenMix (Евроген, РФ) согласно инструкциям производителя. Список использованных в работе праймеров приведен в таблице.

Таблица
название последовательность 3′-5′
ABCA4-Pr1-Dir ctcttaacggcgtttatgtc
ABCA4-Pr1-Rev tggatcaatgcattacaaaa
ABCA4-Pr1-Seq1 ttggcatacagagtgtcttcta
ABCA4-Pr1-Seq2 gggtatatcgagattttcaaga
ABCA4-Pr1-1-IN-1 cctcagctctgaccaatct
ABCA4-Pr1-1-IN-2 gtagggtgccctgggagag
ABCA4-Pr1-2-IN-1 ctcatgaatgcaccagaga
ABCA4-Pr1-2-IN-2 gataggatccttccttgtgg
ABCA4-Pr2-Dir agagacctttacaaagctgatg
ABCA4-Pr2-Rev gtcgctgtaatgtaggattctt
ABCA4-Pr2-Seq1 gtctatgtccattcggatctta
ABCA4-Pr2-Seq2 acacagatgaacatgatcagag
ABCA4-Pr2-1-IN-1 ctgtctgacctcctgtgtg
ABCA4-Pr2-1-IN-2 gggtggtagagagctggt
ABCA4-Pr2-2-IN-1 ggaacccaacagtaaaagact
ABCA4-Pr2-2-IN-2 catgatgaatatcgtcagga
ABCA4-Pr3-Dir ggatctactctgtctccatgac
ABCA4-Pr3-Rev gataggtcctgagcctcttc
ABCA4-Pr3-Seq1 ctctttcttctctggttgaaca
ABCA4-Pr3-Seq2 gttcgctttgaagagcaag
ABCA4-Pr3-1-IN-1 aagagcatcgtcttggaga
ABCA4-Pr3-1-IN-2 caagccaatacgactcttgt
ABCA4-Pr3-2-IN-1 ctgcagtggagcaacatc
ABCA4-Pr3-2-IN-2 attccgcttgtggtggag
ABCA4-Pr4-Dir gaagggacattgaaaccag
ABCA4-Pr4-Rev caaaaggagggataacaataga
ABCA4-Pr4-Seq1 ttcttatttggaagaaggaaga
ABCA4-Pr4-Seq2 gaaggctctactgctcagg
ABCA4-Pr4-1-IN-1 cagagccttggcatgtgtc
ABCA4-Pr4-1-IN-2 aagttcttgaccaatgcactcc
ABCA4-Pr4-2-IN-1 ccactcttcctgaagaactgct
ABCA4-Pr4-2-IN-2 agaaagcatcagagccaaaaac
ABCA4-Pr5-Dir aagagattccaacacaccatc
ABCA4-Pr5-Rev gaaggttttctggagaagtgta
ABCA4-Pr5-Seq1 cacaccttaatgttgtcttcag
ABCA4-Pr5-Seq2 cacggaaattctacaagacct
ABCA4-Pr5-1-IN-1 cggctacctttgtgttttt
ABCA4-Pr5-1-IN-2 ttgtcttcagtttctagatgttta
ABCA4-Pr5-2-IN-1 acaagacctgacggacaggaac
ABCA4-Pr5-2-IN-2 tttcttctgaaacccgatgaag
ABCA4-Pr6-Dir aggtgtggtttaataacaaagg
ABCA4-Pr6-Rev ggcataaaggtaaagatgttct
ABCA4-Pr6-Seq1 agggtcaggaggaagtacac
ABCA4-Pr6-Seq2 tacacttctccagaaaaccttc
ABCA4-Pr6-1-IN-1 cctggtcagctttctcaat
ABCA4-Pr6-1-IN-2 accatggcaaacaggttc
ABCA4-Pr6-2-IN-1 actgctcctgctgtatggatg
ABCA4-Pr6-2-IN-2 aagatgttctcgtcctgtgagc
ABCA4-Pr7-Dir caaaacaaccacattcaagat
ABCA4-Pr7-Rev tatttttccatgaaaatcacac
ABCA4-Pr7-Seq1 ctggagcatgttgtagtgc
ABCA4-Pr7-Seq2 atgctgtggaacgtcatc
ABCA4-Pr7-1-IN-1 aagatgctcactggggacac
ABCA4-Pr7-1-IN-2 gtagtgcctctccctctgcac
ABCA4-Pr7-2-IN-1 gctgtggtcctcacatcc
ABCA4-Pr7-2-IN-2 acacagacaaacatgcagaa
ABCA4-RT-Ex3-AS-Dir tgtggcctttatctttatttct
ABCA4-RT-Ex3-AS-Rev gatgtgtagctctgtccaaata

Амплификацию соответствующих фрагментов проводят в режиме 95°C - 3 мин, затем в течение 35 циклов: 94°C - 1 мин, 55°C - 1 мин, 72°C - 1 мин. После этого определяется полная нуклеотидная последовательность, полученного набора фрагментов и сравнивается с известной последовательностью гена АВСА4 (Фиг.3). Отсутствие комплементарных нуклеотидов свидетельствует о мутации гена.

При клинических испытаниях предлагаемого способа диагностики были обследованы 8 здоровых человека и 3 пациентов с клиническими признаками макулодистрофии Штаргардта. В результате этого среди пациентов с макулодистрофии Штаргардта был обнаружен носитель мутации в гетерозиготе с делецией 39-41 экзонов, среди здоровых ни одного носителя таких генотипов выявлено не было.

Определяющим существенным отличием заявляемого способа по сравнению с прототипом является использование индивидуальных клеток ретины, полученных после обработки фибробластов кожи вирусными векторами и применение дифференцировочной среды для получения клеток ретины.

Список литературы.

1. Shutova M, Chestkov I, Bogomazova A, Lagarkova M, Kiselev S.L., Generation ofiPS cells from human umbilical vein endothelial cells by lentiviral transduction, and their differentiation to neuronal lineage. In: Kaiming Ye and Sha Jin (eds.). Human Embryonic and Induced Pluripotent Stem Cells: Lineage-Specific Differentiation Protocols, Springer Protocols Handbooks, DOI 10.1007/978-1 -61779-267-OJ 1, © Springer Science+Business Media, LLC 2011

2. M.A. Lagarkova, M.V. Shutova, A.N. Bogomazova, E.M. Vassina, E.A. Glazov, P Zang., A.A Rizvanov., I.V. Chestkov., S.L. Kiselev. Induction ofpluripotency in human endothelial cells resets epigenetic profile on genome scale // Cell Cycle. 2010 Mar; 9(5):937-46.

Способ диагностики предрасположенности пациента к наследственной макулодистрофии Штаргардта, включающий взятие фибробластов кожи у этого пациента, их культивирование и обработку вирусными конструкциями, несущими гены Oct4, Sox2 и Klf4 под контролем CMV промотера, последующее культивирование для направленной дифференцировки фибробластов в клетки ретины и дальнейшее исследование клеток ретины на наличие мутации в экзоне 39-41 гена АВСА4, и по наличию делеции в этом экзоне диагностируют предрасположенность пациента к наследственной макулодистрофии Штаргардта.



 

Похожие патенты:

Изобретение относится к медицине, в частности к способу оценки функционального состояния эндотелия (ФСЭ) экспериментальных животных после реконструктивных операций на брюшной аорте.
Предлагаются модели на насекомых, предназначенные отображать проницаемость гематоэнцефалического барьера (ГЭБ) у млекопитающего, в частности, человека. Изобретение касается способа оценки транспорта химического соединения через ГЭБ, а также применения насекомых в скрининге веществ, обладающих биологическим действием на мозг или центральную нервную систему и/или действующих на заболевание или нарушение, затрагивающее мозг или центральную нервную систему.
Изобретение относится к педиатрии и онкогематологии и может быть использовано для прогнозирования развития нарушений функции миокарда у детей с острым лимфобластным лейкозом (ОЛЛ) на разных этапах полихимиотерапии (ПХТ).

Настоящее изобретение относится к медицине, а именно к определению ферментов в костной и хрящевой тканях при изучении регенераторных процессов, и описывает способ определения щелочной фосфатазы в костной и хрящевой тканях, включающий подготовку образцов исследуемых тканей и гистохимическое исследование срезов полученного материала, где образцы исследуемых костной и хрящевой тканей выдерживают в забуференном растворе нейтрального 10% формалина в течение 1 суток при температуре +4°C, затем обрабатывают в 0,1 М растворе фосфатного буфера сначала в 4 смены по 2 часа каждая, а после в 9 смен по часу с добавлением сахарозы постепенно возрастающей концентрации, после чего исследуемый материал погружают в реагент Tissue-Tek O.C.T.

Изобретение относится к области медицины. Предложен способ оценки индивидуальной чувствительности генома человека к воздействию повышенных доз излучений радона и продуктов его распада.
Изобретение относится к области биохимии и микробиологии и может быть использовано для определения липолитической активности в субклеточных фракциях бактерий. Сущность способа состоит в том, что среда, содержит агарозу или агар (500 мг), неионный детергент (50 мкл), хлористый кальций (12,5 мг), 0,05 М Трис-HCl буфер pH 8,3 (до 100 мл), причем после застывания среды в ней делают лунки, в которые вносят исследуемый образец в объеме 10-50 мкл на одну лунку, затем среду с исследуемым образцом инкубируют при 37°C в течение 12 часов и визуально определяют наличие или отсутствие липолитической активности в исследуемом образце.

Изобретение относится к медицине, в частности к педиатрии, а именно к способу дифференциальной диагностики гнойных и серозных менингитов у детей. Способ состоит в определении показателей микробицидной активности нейтрофильных лейкоцитов: ферментов миелопероксидазы, цитохромоксидазы, кислой фосфатазы в ликворе больных гнойным и серозным менингитами с помощью спектрофотометрического анализа.

Изобретение относится к области медицины, в частности к молекулярной диагностике. Предложен способ определения чувствительности опухоли легкого к терапии ингибиторами тирозинкиназ у пациентов с раком легкого в цитологическом опухолевом материале методом полимеразной цепной реакции в режиме реального времени при помощи праймеров для выявления 8 делеций в 19 экзоне гена EGFR и замены L858R гена EGFR в 21 экзоне.

Изобретение относится к медицине и касается способа персонифицированного подбора антиагрегантых препаратов больным, нуждающимся в подобном лечении, включающего забор крови больного, получение богатой тромбоцитами плазмы с помощью центрифугирования крови, разделение ее на пробы и введение в них антиагрегантных препаратов, имеющих различные механизмы антиагрегационного действия на тромбоциты с последующей инкубацией проб плазмы с препаратами при температуре 36,5-37,5°C и с индуктором агрегации тромбоцитов.

Изобретение применяют для оценки влияния цитомегаловирусной инфекции на содержание метгемоглобина в эритроцитах периферической крови беременной на третьем триместре гестации.
Изобретение относится к области медицины, в частности к прогнозированию риска раннего развития атеросклероза у больных хроническим простатитом. Сущность способа состоит в том, что в сыворотке крови больных хроническим простатитом молодой возрастной группы определяют уровень общего тестостерона, секссвязывающего глобулина с последующим расчетом индекса свободного тестостерона, а также определяют содержание липопротеидов высокой плотности, триацилглицеридов и рассчитывают коэффициент атерогенного риска по формуле. При значении коэффициента атерогенного риска <3,7 прогнозируют высокий риск раннего развития атеросклероза. Использование заявленного способа позволяет повысить точность прогнозирования риска раннего развития атеросклероза у больных хроническим простатитом. 1 табл., 2 пр.

Изобретение относится к биотехнологии и представляет собой способ выявления мутации c.-53-2A>G в гене SLC26A5, сопровождающийся развитием несиндромальной аутосомно-рецессивной глухоты. Способ включает выделение ДНК из лимфоцитов периферической крови методом фенольно-хлороформной экстракции. Проводят полимеразную цепную реакцию с возможностью проведения анализа флуоресценции по конечной точке. Амплифицируют одновременно два участка гена SLC26A5 в смеси двух пар последовательностей олигонуклеотидов с флуоресцентной меткой: CACCACAAAGAAGAGATG, TCAGCATGATCCATAGTAC, FAM-agtgtCacTagGggaaaa-BHQ-1, VIC-agtgtCacCagGggaaaa-BHQ-2, фланкирующих область с возможным содержанием мутации c.-53-2A>G в гене SLC26A5. Предложенное изобретение позволяет получить точный, объективный клинический диагноз наследственной аутосомно-рецессивной потери слуха. 1 ил., 2 табл., 2 пр.
Изобретение относится к области косметики и представляет собой способ определения водостойкости антиперспиранта, включающий: a) отбор участников исследования; b) выполнение требований участниками исследования о не использовании каких-либо продуктов или использовании продуктов, не содержащих антиперспирант, в подмышечных областях в течение требуемого периода; c) очистку подмышечных областей каждого участника исследования; d) нанесение необходимого количества антиперспирантного продукта на одну подмышечную область и плацебо на другую подмышечную область каждого участника исследования; e) выполнение стадии d) до достижения необходимого числа нанесений, если выбирается более одного нанесения; f) после выполнения последнего нанесения проводят водное испытание, включающее круговое движение участников исследования в бассейне и/или плавание в течение периода времени активности в бассейне с глубиной воды, достаточной для смачивания подмышечных областей; g) проведение оценки потоотделения; и h) определение того, проявляет ли антиперспирантный продукт по меньшей мере стандартную антиперспирантную эффективность. 8 з.п. ф-лы.

Изобретение относится к области медицины и предназначено для прогнозирования сроков наступления реактивной фазы острого панкреатита. Осуществляют выделение ДНК из периферической венозной крови, проводят анализ полиморфизма гена фактора некроза опухоли α и при выявлении генотипов -308 АА или -308 GA TNFα прогнозируют риск позднего наступления реактивной фазы острого панкреатита. Изобретение обеспечивает получение новых критериев оценки сроков наступления реактивной фазы острого панкреатита. 2 ил., 1 табл., 1 пр.

Изобретение относится к области медицины и предназначено для прогнозирования риска развития ангиопатии нижних конечностей у больных сахарным диабетом 2-го типа. Осуществляют выделение ДНК из периферической венозной крови, проводят анализ полиморфизма -308G/A гена фактора некроза опухоли α и при выявлении аллеля -308A TNFα прогнозируют повышенный риск развития ангиопатии нижних конечностей у больных сахарным диабетом 2-го типа. Изобретение обеспечивает получение новых критериев оценки риска развития диабетической ангиопатии у больных сахарным диабетом 2-го типа. 1 ил., 1 табл., 1 пр.

Изобретение относится к области молекулярной биологии и ветеринарии и предназначено для диагностики вируса инфекционного некроза поджелудочной железы лососевых. Осуществляют два раунда полимеразной цепной реакции с праймерами B37-B853r и B123-B320r для выявления фрагмента сегмента В, кодирующего РНК-зависимую РНК-полимеразу вируса инфекционного некроза поджелудочной железы с последующим электрофоретическим определением размера амплифицируемого фрагмента нуклеотидной последовательности. По наличию на электрофореграмме фрагментов длиной 860 и/или 240 пн в исследуемом образце диагностируют вирус инфекционного некроза поджелудочной железы лососевых. Предлагаемое изобретение применимо в диагностических исследованиях в научно-исследовательских институтах, ветеринарных лабораториях, рыбоводческих хозяйствах. 2 ил., 3 табл., 3 пр.

Изобретение относится к области медицины и предназначено для прогнозирования in vitro способности популяции клеток, полученных из сустава, продуцировать стабильный гиалиновый хрящ in vivo. В популяции клеток определяют экспрессию ряда маркерных генов, включающих позитивный маркер FRZB (Frizzled-Подобный Белок 1). негативный маркер ALK1 (Рецептор Активина А, Типу II-Подобная Киназа) и один или более маркеров, выбранных из группы, состоящей из негативного маркера PEDF (Фактор, Выделенный из Пигментного Эпителия), позитивного маркера COL11 (Коллаген, Тип XI А1), позитивного маркера COL2 (Коллаген, Тип II, Альфа 1) и позитивного маркера FGFR3 (Рецептор Фактора Роста Фибробластов 3). Уровни экспрессии каждого индивидуального маркера представляют с помощью числового значения. Числовые значения комбинируют в кумулятивный показатель, где значение кумулятивного показателя указывает на способность к продукции стабильного хряща. Предлагаемое изобретение обеспечивает эффективное прогнозирование способности популяции клеток, полученных из сустава, продуцировать стабильный гиалиновый хрящ in vivo. 5 з.п. ф-лы, 4 ил., 11 табл., 5 пр.

Изобретение относится к области медицинской диагностики и может быть использовано для прогнозирования сроков формирования абсцесса в фазу секвестрации острого панкреатита и, как следствие, неблагоприятного течения заболевания. Способ прогнозирования сроков формирования абсцесса в фазу секвестрации острого панкреатита включает выделение ДНК из периферической венозной крови, анализ полиморфизма +250 A/G Ltα и при выявлении генотипов +250 GG или +250 AG Ltα прогнозируют риск раннего формирования абсцесса в фазу секвестрации острого панкреатита. 1 табл., 2 ил.

Изобретение относится к области биотехнологии и касается способа выявления O-гликозилированных белков в составе клеточных гомогенатов, подготавливаемых к протеомному и фосфопротеомному анализу. Предложенное изобретение может быть использовано для проведения протеомного и фосфопротеомного анализа. Способ включает проведение двумерного электрофореза с последующей идентификацией пятен методами спектроскопии MALDI-TOF или фосфопротеомики. Проводят обессоливание клеточных гомогенатов методом гель-хроматографии или диализа клеточных гомогенатов. Подвергают клеточные гомогенаты дегликозилированию по принципу β-элиминирования в растворе 0,05 М NaOH, который содержит 38 мг/мл NaBH4, в течение 16 часов при +45°C с последующим добавлением цианинового красителя JC-1 в концентрации 10-6 М. Инкубируют клеточные гомогенаты в течение 15 мин при комнатной температуре. Концентрируют гомогенаты осаждением 50% ацетоном, подвергают двумерному электрофорезу с образованием электрофореграмм, анализируемых на флуоресценцию при облучении на трансиллюминаторе синего цвета со светофильтром янтарного цвета, визуально проявляющуюся в виде светящихся в темноте полос. Данные полосы экстрагируют из геля и используют для проведения протеомного или фосфопротеомного анализа. Дополнительный анализ интенсивности и расположения экстрагируемых полос выполняют за счет сравнения окрашенных азотнокислым серебром электрофореграмм гомогенатов до и после процедуры дегликозилирования. Предложенное изобретение позволяет идентифицировать белки, меняющие состав или степень своего O-гликозилирования в результате какого-либо физиологического воздействия на клетку. 5 ил.
Изобретение относится к медицине, а именно к микробиологии, и может быть использовано для определения адгезии золотистого стафилококка. Для этого исследуют чистую культуру золотистого стафилококка в концентрации 1 млрд/мл. Определяют среднее количество микробов, адгезированных на одном эритроците при подсчете не менее 25 эритроцитов. При этом в качестве субстрата адгезии используют эритроциты барана в концентрации 100 млн/мл, которые предварительно отмывают 50-ти % формалина. Изобретение обеспечивает качественную и количественную экспресс-диагностику определения степени выраженности адгезивных свойств стафилококков.
Наверх