Система маркеров на основе группы генов микрорнк для диагностики немелкоклеточного рака легкого, включая плоскоклеточный рак и аденокарциному

Изобретение относится к области медицины, в частности молекулярной биологии и онкологии, и касается системы маркеров, представляющую собой группу генов микроРНК: miR-129-2, miR-125b1, miR-137 и miR-375, для диагностики немелкоклеточного рака легкого, включая плоскоклеточный рак и аденокарциному. Выявление метилирования по крайней мере одного маркера из этой системы служит диагностическим признаком. Система маркеров позволяет выявить немелкоклеточный рак легкого на ранних клинических стадиях заболевания с высокой клинической чувствительностью и специфичностью. 4 табл., 3 пр.

 

Система маркеров на основе группы генов микроРНК для диагностики немелкоклеточного рака легкого, включая плоскоклеточный рак и аденокарциному.

Настоящее изобретение относится к области биомедицины, в частности молекулярной и клинической онкологии и молекулярной биологии, и касается системы маркеров для диагностики немелкоклеточного рака легкого (НМРЛ), путем оценки статуса метилирования генов микроРНК: miR-129-2, miR-125bl, miR-137 и miR-375. Выявление метилирования, по крайней мере, одного гена из заявленной системы маркеров в предположительно пораженной раком ткани человека, по сравнению со здоровой тканью легкого служит диагностическим признаком НМРЛ. Заявленная система маркеров на основе генов микроРНК позволяет с высокой частотой и специфичностью диагностировать НМРЛ, а именно плоскоклеточный рак легкого (ПРЛ) и аденокарциному легкого (АК), в том числе на ранних стадиях.

Немелкоклеточный рак легкого (НМРЛ) - самый распространенный вид рака среди онкопатологий человека. Тяжесть заболевания и низкая выживаемость при раке легкого связаны, прежде всего, с поздним выявлением заболевания. При обнаружении опухолей легкого на 1-ой клинической стадии, уровень 5-летней выживаемости пациентов поднимается от 15% до 70%.

Отбор системы генов микроРНК, связанных с развитием опухолей и ассоциированных с CpG-островками, проводили с привлечением следующих баз данных: UCSC Genome Browser (hg 18 (http://genome.ucsc.edu/)), miRBase (http://www.mirbase.org/), MicroRNAdb (http://bioinfo.au.tsinghua.edu.cn/micrornadb/), miRDB (http://mirdb.org/cgi-bin/search.cgi), miRGen (http://www.diana.pcbi.upenn.edu/miRGen.html), TargetScan (http://www.targetscan.org/), miR2Disease Base (http://www.mir2disease.org/), miRWalk (http://www.ma.uni-heidelberg.de/apps/zmf/mirwalk/), CpGcluster (http://bioinfo2.ugr.es/CpGcluster/). Отобранные микроРНК находятся на участках хромосом, часто вовлеченных в онкогенез, или связанных с генами, вовлеченными в онкогенез. Оценка статуса метилирования генов miR-129-2, miR-125b, miR-137 и miR-375 при НМРЛ позволила на их основе составить систему маркеров для диагностики этого заболевания. Сведений о выявлении метилирования этих генов при НМРЛ в источниках информации не обнаружено.

В качестве ближайшего аналога заявляемой системы маркеров рассмотрим систему маркеров на основе группы генов микроРНК: miR-34, miR-148 и miR-9 (WO 2010020787). Диагностика рака легкого осуществляется путем выявления метилирования или снижения экспрессии хотя бы в одном маркере этой системы. Значения клинической чувствительности и специфичности для данной системы не приведены.

Известные значения клинической чувствительности и специфичности для диагностики НМРЛ составляют 82% и 77% соответственно (WO 2011146937), которые достигаются путем анализа уровней экспрессии системы маркеров на основе группы генов микроРНК: miR-1254 и miR-574-5p.

Задача заявляемого изобретения - расширить арсенал маркеров на основе генов микроРНК для диагностики немелкоклеточного рака легкого, включая плоскоклеточный рак и аденокарциному. Задача решена путем:

- разработки системы маркеров на основе группы генов микроРНК: miR-129-2, miR-125b1, miR-137 и miR-375 - для диагностики немелкоклеточного рака легкого, включая плоскоклеточный рак и аденокарциному, путем выявления метилирования, по крайней мере, у одного гена из этой группы.

Диагностику НМРЛ осуществляют по следующему методу.

Берут образцы ткани легкого у лиц, обследуемых для выявления онкологического заболевания или с установленным диагнозом. Выделение и очистку ДНК из образцов ткани легкого проводят методом фенол-хлороформенной экстракции. Качество и точную концентрацию ДНК определяют спектрофотометрически по соотношению оптической плотности при длинах волн 260 и 280 нм. Далее проводят бисульфитную конверсию ДНК с последующей метилспецифичной ПЦР (МС-ПЦР) [4]. Для анализа метилирования каждой микроРНК методом МС-ПЦР используют две пары праймеров, специфичных как к метилированному, так и к неметилированному аллелю (Таблица 1). Продукты МС-ПЦР разделяют электрофорезом в 2% агарозном геле либо в 10% полиакриламидном геле (при длине продукта ПЦР менее 160 н.п.). Далее анализируют на наличие или отсутствие продуктов МС-ПЦР для праймеров, специфичных к метилированному и неметилированному аллелю. В качестве контролей для неметилированных аллелей используют образцы ДНК из лейкоцитов крови здоровых доноров. В качестве позитивного контроля 100%-ого метилирования используют препараты ДНК из лейкоцитов, обработанные метилтрансферазой SssI («СибЭнзим», Новосибирск). Соответствие фрагментов МС-ПЦР исследуемым генам проверяют прямым секвенированием обеих цепей продуктов МС-ПЦР. Диагностику НМРЛ осуществляют по наличию метилирования, по крайней мере, у одного маркера системы.

Пример 1. Определение набора праймеров для гена микроРНК miR-375.

Подбор праймеров для МС-ПЦР гена микроРНК miR-375 осуществляют с помощью программы Methyl Primer Express v.1.0 (Applied Biosystems, USA) со следующими параметрами: размер ампликонов 100-200 пар оснований, от 4 до 7 CpG-динуклеотидов на пару праймеров, от 4 до 10 цитозиновых остатков, не входящих в CpG-динуклеотиды, разница в температурах плавления праймеров в паре не более 5 градусов. Первоначальные варианты пар праймеров проверены на образование димеров и вторичных структур с помощью программы Vector NTI v.10.0 (Invitrogen, USA). В результате получен заявляемый набор праймеров для гена микроРНК miR-375, который приведен в таблице 1.

Пример 2. Диагностика НМРЛ, включая ПРЛ и АК.

Для 39 пациентов с морфологически установленным диагнозом - НМРЛ, включая 26 пациентов с ПРЛ и 13 с АК, и 20-ти доноров, онкологически здоровых в анамнезе, проведен анализ метилирования заявляемой системы маркеров (таблица 2, 3). В случае ПРЛ диагноз подтвержден у 24 из 26 пациентов, что соответствует 92% случаев. В случае АК диагноз подтверждается для 11 из 13 пациентов, что соответствует 85% случаев (таблица 4). Причем заявляемая система маркеров позволяет диагностировать АК и ПРЛ на самых ранних клинических стадиях. Так, на I и II клинических стадиях АК выявляют в 78% случаев, а ПРЛ - в 89% случаев. На поздних клинических стадиях (III и IV) использование заявляемой системы маркеров позволяет выявить АК и ПРЛ в 100% случаев (таблица 4). Для 20 доноров заявляемая система выявляет метилирование в двух образцах хотя бы по одному маркеру, что соответствует 10% (таблица 3). На основании этих данных можно утверждать о возможности использовать заявляемую систему маркеров для диагностики НМРЛ, включая ПРЛ и АК.

Пример 3. Оценка чувствительности и специфичности заявляемой системы маркеров.

Важным свойством заявляемой системы маркеров является высокая клиническая чувствительность и специфичность при диагностике НМРЛ. Наличие метилирования, по крайней мере, у одного маркера системы генов микроРНК выявлена у 35 из 39 пациентов с НМРЛ (90% случаев) и у двух из 20 доноров, онкологически здоровых в анамнезе (10% случаев). На основании этих данных клиническая чувствительность и специфичность заявляемой системы маркеров, рассчитанная методом ROC-анализа, составляют 90% и 90% соответственно. Таким образом, заявляемая система маркеров позволяет диагностировать НМРЛ у пациентов истинно больных данным онкозаболеванием с высокой (в 90% случаев) клинической чувствительностью.

Заявляемая система маркеров для диагностики НМРЛ характеризуется следующим.

1. Обладает клинической чувствительностью 90% и специфичностью 90%, что превосходит известные значения: 82% и 77% (WO 2011146937).

2. Позволяет диагностировать два наиболее распространенных вида НМРЛ - плоскоклеточный рак и аденокарциному на самых ранних клинических стадиях с высокой клинической чувствительностью (до 90%) и специфичностью (до 90%).

3. Позволяет осуществить диагностику в стандартизованных условиях (таблица 1) с использованием недорогих приборов отечественного производства.

Таблица 1.
Характеристика праймеров, условий5 и продуктов МС-ПЦР
Название гена и источник праймеров Структура праймеров Продукт ПЦР, п.н.
miR-129-21 MF1:GATTTTAGTTCGTATTAATGAGTTGGCGGTTTC
MR1:AACCCCGACTACAAAATCGCG
210
UF1:TGATTTTAGTTTGTATTAATGAGTTGGTGGTTTTG UR1:АССААССССААСТАСААААТСАСА 210
miR-125b12 MF2:TGGTGTATCGTTTTTTGTTTTC MR2:ACCCATTCGAAACGAAAC 190
UF2:ATTTGGTGTATTGTTTTTTGTTTTT
UR2:СТСАСССАТТСААААСААААС
190
miR-1373 MF3:TTTTGATTTTTTTCGGTGAC MR3:TACCGCTAATACTCTCCTCG 98
UF3:TTTTTTGATTTTTTTTGGTGAT UR3:CTACCACTAATACTCTCCTCAA 98
miR-3754 MF4:TCGTTATCGTTATTTTAATCGTACG
MR4:AAAAATTTCTATTCTAAACCACGAC
200
UF4:TGTTATTGTTATTTTAATTGTATGG
UR4:AAAAATTTCTATTCTAAACCACAAC
199
Примечания:
1[1]
2[2]
3[3]
4Подобраны авторами с использованием известных программ (Methyl Primer Express v.1.0, Vector NTI v.10.0 и т.п.)
Таблица 2.
Сопоставление данных по метилированию генов, входящих в заявляемую систему маркеров, с клинико-гистологическими характеристиками образцов от 39 пациентов с НМРЛ
№ образца Ген микроРНК Клиническая стадия Степень анаплазии Возраст/Пол Стадия по классификации TNM
miR-129-2 miR-125b1 miR-137 miR-375
Аденокарцинома легкого
842 + + - + IV md 72/M T2N2M1
882 + - - - III Id 36/M T4N2M0
791 + + + + III Id 54/Ж T3N1M0
850 + + + + III md 61/Ж T2N2M0
895 - - - + II md 50/Ж T2N0M0
848 + + + - I md 54/М T2N0M0
835 + - - - I md 55/М T2N0M0
806 - - - - I md 59/М T2N0M0
854 - + + + I md 61/Ж T2N0M0
776 + - + + I md 58/Ж T1N0M0
804 - + - + I md 68/Ж T1N0M0
883 - + - - I hd 47/Ж T1N0M0
838 - - - - I hd 70/Ж T1N0M0
Таблица 2.
(продолжение)
№ образца Ген микроРНК Клиническая стадия Степень анаплазии Возраст/Пол Стадия по классификации TNM
miR-129-2 miR-125b1 miR-137 miR-375
Плоскоклеточный рак легкого
852 + + + + III Id 77/M T4N2M0
384 - - + + III Id 67/M T3N0M0
815 - + - - III md 56/М T3N2M0
831 + + + + III md 65/М T3N2M0
851 - + - + III md 59/М T2N2M0
391 + + + + III md 67/М T3N0M0
534 + + - + III md 40/М T3N1M0
833 + + + - III md 59/М T1N2M0
844 - + + + II Id 62/М T3N0M0
817 + + - + II Id 58/М T3N0M0
709 - + - + II Id 39/М T2N1M0
808 + - - + II Id 63/М T2N1M0
816 - + - + II md 71/М T2N1M0
830 - + + + II md 47/Ж T2N1M0
832 - - - + II md 58/М T2N1M0
378 + + - + II md 64/М T1N1M0
№ образца Ген микроРНК Клиническая стадия Степень анаплазии Возраст/Пол Стадия по классификации TNM
miR-129-2 miR-125b1 miR-137 miR-375
Плоскоклеточный рак легкого
587 - - - - II md 45/Ж T2N1M0
840 - + - - II md 51/Ж T3N0M0
847 + - - - I md-Id 51/М T2N0M0
856 - + - + I Id 69/М T2N0M0
819 - - + + I md 67/Ж T2N0M0
843 + + + - I md 807М T2N0M0
934 - - + - I md 57/М T2N0M0
855 - + + - I md 69/М T2N0M0
778 - - - - I hd 67/М T2N0M0
513 + + - + I hd 62/М T2N0M0
Таблица 3.
Данные по метилированию генов, входящих в заявляемую систему маркеров в образцах, выделенных из ткани легкого 20-ти доноров, онкологически здоровых в анамнезе
№ образца Ген микроРНК
miR-129-2 miR-125b1 miR-137 miR-375
Онкологически здоровые в анамнезе доноры (нормальная ткань легкого)
1 - - - -
2 - - - -
3 - - - -
4 - - - -
5 - - - -
6 - - - -
7 - - - -
8 - - - -
9 - - - -
10 - - - -
11 - - - -
12 - - - -
13 - - - -
14 - - - -
15 - - - -
16 - - - -
17 - - - -
18 - - - -
19 - + - +
20 - - - +
Таблица 4.
Частота метилирования, чувствительность и специфичность заявляемой системы маркеров на разных клинических стадиях НМРЛ.
Пациенты с НМРЛ Аденокарцинома легкого (АК) Плоскоклеточный рак легкого (ПРЛ) НМРЛ (АК + ПРЛ)
Тотально (I, II, III, IV клинические стадии) 85% (11/13) 92% (24/26) 90% (35/39)
Только ранние клинические стадии (I, II) 78% (7/9) 89% (16/18) 85% (23/27)
Только поздние клинические стадии (III, IV) 100% (4/4) 100% (8/8) 100% (12/12)
Чувствительность 85% 92% 90%
Специфичность 90% 90% 90%

Цитированные источники научно-технической информации

1. Bandres Е., Agirre X., Bitarte N., Ramirez N., Zarate R., Roman-Gomez J., Prosper F., Garcia-Foncillas J. 2009. Epigenetic regulation of microRNA expression in colorectal cancer. Int J Cancer. 125, 2737-2743.

2. Ernesto Soto-Reyes, Rodrigo Gonzblez-Barrios, Fernanda Cisneros-Soberanis, Roberto Herrera-Goepfert, Vyctor Perez, David Cant, Diddier Prada, Clementina Castro, Felix Recillas-Targa and Luis A Herrera. Disruption of CTCF at the miR-125b1 locus in gynecological cancers. BMC Cancer. 2012-12:40.

3. Balaguer F., Link A., Lozano J.J., Cuatrecasas M., Nagasaka T., Boland R.C. and Goel A. Epigenetic silencing of miR-137 is an early event in colorectal carcinogenesis. Cancer Res. 2010 August 15; 70(16)-6609-6618.

4. Ходырев Д.С., Пронина И.В., Рыков С.В., Береснева Е.В., Фридман М.В., Казубская Т.П., Логинов В.И., Брага Э.А. 2012. Метилирование группы генов микроРНК вовлечено в регуляцию экспрессии генов-мишеней RAR-beta2 и NKIRAS1 при раке легкого. Молекулярная биология 46, 773-785.

Система маркеров на основе группы генов микроРНК для диагностики немелкоклеточного рака легкого, включая плоскоклеточный рак и аденокарциному, путем выявления метилирования, по крайней мере, одного маркера из этой группы, отличающаяся тем, что маркерами являются гены: miR-129-2, miR-125b1, miR-137 и miR-375.



 

Похожие патенты:

Изобретение относится к области лабораторной диагностики, медицинской вирусологии, молекулярной биологии и эпидемиологии. Изобретение предназначено для выявления и идентификации в клинических образцах и элюатах, полученных в результате концентрирования из воды, одиннадцати групп кишечных вирусов (энтеровирусов (ЭВ), полиовирусов (ПВ), ротавирусов А и С (РВА и РВС соответственно), аденовирусов (АДВ), норовирусов (НВ), саповирусов (СВ), вирусов гепатита А и Е (ВГА и ВГЕ соответственно), астровирусов (АВ), ортореовирусов (ОРВ) в присутствии внутреннего положительного контроля (ВПК) посредством мультиплексной ПЦР с детекцией в режиме реального времени.

Изобретение относится к области биотехнологии, а именно к способу и диагностическому набору для диагностики коклюша и определения авирулентных мутантов возбудителя коклюша.

Изобретение относится к способу получения новых соединений-диад (I) с двумя разными, не сопряженными друг с другом, хромофорными фрагментами, содержащими азогруппы и остатки ферроцена, и их использованию для тушения флуоресценции флуорофоров. где Fc - ферроценил; R1 - Н или Fc; R2 - H или орто- или пара-гидрокси-; R3 - орто- или мета-, или пара-нитро-, или орто- или мета-, или пара-нитрофенилазо-, или пара-N,N-диметиламино-, или пара-карбокси-; L - группа пара-карбамоилвинилиденацетофенона или пара-карбоксамидовинилиденацетофенона, или пара-N-(2-карбамоилэтил)-карбоксамидовинилиденацетофенона, или пара-(4-[метиламино]бутокси)-винилиденацетофенона, или N,N-ди[4{1-(пара-винилиденацетофениламино)-метил-1,2,3-триазолил}бутил]аминогруппа.

Изобретение относится к области молекулярной биологии. Предложены способ, композиция и применение полярного апротонного растворителя с циклической основной структурой для гибридизации последовательностей нуклеиновых кислот.

Изобретение относится к биотехнологии и представляет собой способ выявления мутации c.-53-2A>G в гене SLC26A5, сопровождающийся развитием несиндромальной аутосомно-рецессивной глухоты.

Изобретение относится к области биотехнологии. Раскрыты способы, композиции и наборы для диагностики остеоартрита у животных семейства кошачьих.

Изобретение относится к биотехнологии, в частности к генетической инженерии, и может быть использовано для выявления генетического материала (РНК) коронавируса человека, ассоциированного с тяжелым острым респираторным синдромом (ТОРС).

Изобретение относится к области медицины, в частности к применению молекулярных маркеров ВПЧ ВКР и их качественных и количественных характеристик для прогнозирования течения гиперпролиферативных заболеваний ШМ.

Изобретение относится к области молекулярной биологии и генной инженерии. Предложен способ выявления воспалительного заболевания кишечника млекопитающего посредством детекции повышенной экспрессии генов LY6 в желудочно-кишечных тканях или клетках по сравнению с контролем.

Изобретение относится к области биотехнологии, а именно к способу получения терапевтического агента для лечения клещевого энцефалита людей. Способ включает получение аптамеров, которые способны образовывать комплекс с третичной структурой поверхностного белка вируса.

Изобретение относится к области биотехнологии, конкретно к созданию рекомбинантных плазмид, обеспечивающих экспрессию полиэпитопных опухоль-ассоциированных антигенов в дендритных клетках, способных стимулировать специфические цитотоксические клетки, и может быть использовано в медицине.

Изобретение относится к области биотехнологии, а именно к способу получения терапевтического агента для лечения клещевого энцефалита людей. Способ включает получение аптамеров, которые способны образовывать комплекс с третичной структурой поверхностного белка вируса.

Изобретение относится к области биотехнологии и генной инженерии. Предложен способ получения вектора экспрессии, кодирующего адаптированную рекомбиназу.

Изобретение относится к области биотехнологии и может быть использовано для получения тканевого активатора плазминогена человека. Рекомбинантной плазмидной ДНК рВК415, кодирующей полипептид с последовательностью тканевого активатора плазминогена человека, включающей также MAR - область прикрепления к ядерному матриксу гена лизоцима птиц, усилитель транскрипции вируса CMV, внутренний сайт инициации трансляции IRES вируса энцефаломиокардита, ген DHFR мыши, сигнал полиаденилирования вируса SV40, ген аминогликозид-3'-фосфотрансферазы, обеспечивающей устойчивость к генетицину (Neo) и кассету для экспрессии в клетках бактерий гена β-лактамазы, обеспечивающей устойчивость к ампицилину, трансформируют клетки линии Cricetulus griseus CHO DHFR(-) с получением линии клеток Cricetulus griseus CHO 1F8, продуцирующей рекомбинантный белок тканевого активатора плазминогена со стабильно высоким выходом на уровне до 190 мг/л.

Изобретение относится к области биотехнологии и может быть использовано для получения рекомбинантного фактора свертываемости крови IX человека (hFIX). Рекомбинантная плазмидная ДНК рАК380, содержащая ген белка rhFIX, MAR - область прикрепления к ядерному матриксу гена лизоцима птиц, усилитель транскрипции вируса CMV, внутренний сайт инициации трансляции IRES вируса энцефаломиокардита, ген DHFR мыши, сигнал полиаденилирования вируса SV40, ген аминогликозид-3'-фосфотрансферазы для устойчивости к генетицину (Neo), кассету для экспрессии в клетках бактерий гена β-лактамазы для устойчивости к ампицилину, используется для получения рекомбинантного фактора hFIX в клетках линии Cricetulus griseus CHO 1E6.

Изобретение относится к области биотехнологии, конкретно к апоптотическим факторам, и может быть использовано в медицине. Получают композицию, включающую ингибитор TNF-подавляющей активности Core 1 митохондриального дыхательного комплекса III в опухолевой клетке на основе нуклеиновой кислоты; член суперсемейства фактора некроза опухоли (TNF) и носитель.

Изобретение относится к области молекулярной биологии, биоорганической химии и медицины. Заявляемые нанокомпозиты предназначены для направленного воздействия на генетический материал внутри клетки и подавления его дальнейшего функционирования.

Промотор // 2491344
Изобретение относится к области биотехнологии, конкретно к промоторам, и может быть использовано в продукции гетерологичных белков клетками-хозяевами. .

Изобретение относится к области молекулярной биологии и может быть использовано в диагностических исследованиях, направленных на выявление возбудителей острых кишечных инфекций (ОКИ). Предложен набор дифференцирующих олигонуклеотидов (зондов), обеспечивающий возможность определения в биологическом образце ДНК патогенных микроорганизмов, вызывающих ОКИ, и их видовой идентификации, где указанные микроорганизмы относятся к группе, включающей Shigella spp. и Enteroinvasive E.coli (EIEC), Salmonella spp., Campylobacter jejuni, Proteus mirabilis, Klebsiella pneumoniae. Описано конструирование биочипа с иммобилизованным на нем набором зондов по изобретению, предназначенного для проведения экспресс-анализа возбудителей ОКИ в клинических образцах и материале, полученном из объектов окружающей среды. 2 н.п. ф-лы, 4 табл., 2 ил., 5 пр.

Изобретение относится к области медицины, в частности молекулярной биологии и онкологии, и касается системы маркеров, представляющую собой группу генов микроРНК: miR-129-2, miR-125b1, miR-137 и miR-375, для диагностики немелкоклеточного рака легкого, включая плоскоклеточный рак и аденокарциному. Выявление метилирования по крайней мере одного маркера из этой системы служит диагностическим признаком. Система маркеров позволяет выявить немелкоклеточный рак легкого на ранних клинических стадиях заболевания с высокой клинической чувствительностью и специфичностью. 4 табл., 3 пр.

Наверх