Способ диагностики вируса инфекционного некроза поджелудочной железы лососевых методом полимеразной цепной реакции



Способ диагностики вируса инфекционного некроза поджелудочной железы лососевых методом полимеразной цепной реакции
Способ диагностики вируса инфекционного некроза поджелудочной железы лососевых методом полимеразной цепной реакции
Способ диагностики вируса инфекционного некроза поджелудочной железы лососевых методом полимеразной цепной реакции

 

G01N33/50 - химический анализ биологических материалов, например крови, мочи; испытания, основанные на способах связывания биоспецифических лигандов; иммунологические испытания (способы измерения или испытания с использованием ферментов или микроорганизмов иные, чем иммунологические, составы или индикаторная бумага для них, способы образования подобных составов, управление режимами микробиологических и ферментативных процессов C12Q)

Владельцы патента RU 2508547:

Государственное научное учреждение Всероссийский научно-исследовательский институт экспериментальной ветеринарии им. Я.Р. Коваленко (ВИЭВ) (RU)

Изобретение относится к области молекулярной биологии и ветеринарии и предназначено для диагностики вируса инфекционного некроза поджелудочной железы лососевых. Осуществляют два раунда полимеразной цепной реакции с праймерами B37-B853r и B123-B320r для выявления фрагмента сегмента В, кодирующего РНК-зависимую РНК-полимеразу вируса инфекционного некроза поджелудочной железы с последующим электрофоретическим определением размера амплифицируемого фрагмента нуклеотидной последовательности. По наличию на электрофореграмме фрагментов длиной 860 и/или 240 пн в исследуемом образце диагностируют вирус инфекционного некроза поджелудочной железы лососевых. Предлагаемое изобретение применимо в диагностических исследованиях в научно-исследовательских институтах, ветеринарных лабораториях, рыбоводческих хозяйствах. 2 ил., 3 табл., 3 пр.

 

Предлагаемое изобретение относится к области биотехнологии, молекулярно-генетической диагностики вирусных болезней животных, научных исследований в ветеринарии и молекулярной биологии.

Инфекционный некроз поджелудочной железы (Infectious pancreatic necrosis virus, IPNV) - высококонтагиозная вирусная болезнь, поражающая молодь культивируемых лососевых и некоторых видов рыб других семейств, обитающих как в пресной, так и в морской воде. Вирус инфекционного некроза поджелудочной железы наносит существенный экономический ущерб рыбоводческим хозяйствам РФ.

В комплексе мероприятий по оздоровлению хозяйств от вируса инфекционного некроза поджелудочной железы ведущее место принадлежит диагностике. Отсутствие коммерчески доступных диагностикумов на отечественном рынке вызвало необходимость создания тест - системы для идентификации IPNV методом полимеразной цепной реакции.

В настоящее время совершенствование методов диагностики IPNV крайне необходимо поскольку традиционные методы выделения вируса в культурах клеток не всегда позволяют идентифицировать вирус и занимают длительное время.

Принцип ПЦР заключается в многократном увеличении (амплификации) определенного участка ДНК выявляемого объекта путем его копирования с помощью фермента ДНК-полимеразы и специфических праймеров. Поскольку геном IPNV представлен двухцепочечной молекулой РНК в виде двух сегментов А и В, предварительно - перед постановкой ПЦР-РНК переводят в кДНК благодаря ферменту обратной транскриптазе. Специфические праймеры (прямой и обратный) ограничивают определенный фрагмент нуклеотидной последовательности таким образом, что элонгация новой цепи кДНК при обратной транскрипции и последующей амплификации в ПЦР происходит только между ними. Основными параметрами эффективного прохождения реакции амплификации, обеспечивающими специфичность и чувствительность, являются правильный выбор области генома идентифицируемого агента, структура и температурный режим отжига олигонуклеотидных праймеров.

Известны способы выявления фрагмента генома вируса инфекционного некроза поджелудочной железы лососевых методом ПЦР с использованием праймеров к сегменту А [1].

Также описан способ выявления РНК вируса инфекционного некроза поджелудочной железы методом «гнездовой» ПЦР (nested-PCR) с праймерами к сегменту А, которые имеют следующую структуру:

1 5'-CCAAACCAACAGGTCCTATCCTAC-3' (внешний прямой)

2 5'-TGATGCCGTTGTTCTCATCAGCTG-3' (внешний обратный)

3 5'-GAAGGAGATGACATGTGCTACACC-3' (внутренний прямой праймер с биотинилированной меткой на 5'-конце)

4 5'-GAGAGATGTGTTTGCCACCATCTC-3' (внутренний обратный)

Фрагмент, полученный в первом раунде ПЦР, служит матрицей во втором раунде ПЦР. Во втором раунде используется два меченых праймера: один имеет биотинилированную метку на 5'-конце, другой содержит радиоактивную метку 32P. Разделение ампликонов проходит с использованием магнитных частиц с последующей детекцией уровня радиоактивного излучения [2].

Известные способы выявления фрагментов генома вируса инфекционного некроза поджелудочной железы не лишены недостатков: использование радиоактивной метки требует соблюдения специальных мер безопасности и лицензирования лаборатории, в способе, предложенном K. Williams et al., амплифицируется фрагмент гена VP2, характерный для всех бирнавирусов, что не исключает возможность ложноположительных результатов. Описанные в литературе праймеры подобраны к генам сегмента А. В то же время установлено, что изоляты IPNV, выделенные из разных географических мест, отличаются высоким генетическим разнообразием, главным образом, обусловленным вариабельностью генов, кодируемых именно сегментом А. В этой связи высока вероятность того, что праймеры к сегменту А могут не подойти к вновь изолированным вирусам с измененным генотипом. В первую очередь это касается изолятов из водоемов тех регионов, где исследование на присутствие IPNV ранее не проводилось.

Для идентификации возбудителя методом ПЦР целесообразно использовать праймеры к наиболее консервативной области генома. В случае IPNV это может быть сегмент В, кодирующий ключевой фермент репликации вирусного генома РНК-зависимую РНК-полимеразу.

В задачу исследований входило - разработка эффективного способа обнаружения фрагменов генома вируса инфекционного некроза поджелудочной железы лососевых методом гнездовой ПЦР с использованием 4 специфических олигонуклеотидных праймеров.

Первоочередной задачей было конструирование четырех специфических праймеров к IPNV, которые являются главным компонентом ПЦР и обеспечивают ее специфичность и чувствительность.

Для выбора праймеров был использован сегмент В - в то время как в публикациях преимущественно описаны праймеры к сегменту А. При конструировании праймеров и оценке их специфичности использовали нуклеотидные последовательности и программу BLAST, доступные в Интернете на сайте NCBI Предложенный способ заключается в следующем: с помощью компьютерной программы DNASTAR (Lasergene Co., США) на основании программы, предоставленной в базах данных Интернет ресурсов GenBank(CLUA), по генотипам вируса инфекционного некроза поджелудочной железы выбирают рефернс - последовательность NC_001916 штамма Jasper. Праймеры проверяют на отсутствие гомологии с последовательностями других вирусов и генома человека программой BLAST с помощью веб-ресурса Национального центра биотехнологической информации (http://www.ncbi.nlm.nih.gov/). На основании проведенного компьютерного анализа была подобрано 2 пары праймеров: внешние B37 и B853r и внутренние B123 и B320r.

Название 5'--3' длина
B37 ACG TTG GTG GCA CCC GAC АТА С 22
B123 TGT CGG АСА ТСТ ТСА ACT CAC С 22
B320r CAG TCG AGGCAG AGCGGC АТС 21
B853r GTG ТСТ ССТ TTGGTT TTGCCT ATG 24

Синтез разработанных олигонуклеотидных праймеров заказывается в коммерческом сервисном центре.

Четыре праймера к сегменту В были подобраны таким образом, что позволяют применить технику гнездовой и полугнездовой ПЦР, а также могут быть использованы для секвенирования.

Праймеры имеют следующую характеристику: комлементарность выбранной области гена сегмента В, отсутствие самокомлементарных участков внутри каждого праймера и между прямым и обратным, фланкируют область фрагментов гена В размером 860 пн и ≈240 пн, соответственно. Синтез разработанных олигонуклеотидных праймеров заказывается в коммерческом сервисном центре.

Пример 1

Амплификация специфических фрагментов кДНК вируса инфекционного некроза поджелудочной железы лососевых с помощью разработанных праймеров для диагностики болезни.

В процессе проведения практических экспериментов подбирают оптимальные условия прохождения полимеразной цепной реакции с разработанными праймерами.

Предварительно проводят реакцию обратной транскрипции с парой внешних праймеров. Реакция обратной транскрипции проходит при 42° в течение 45 минут, затем полученную кДНК прогревают при 95° в течение 3 минут и используют для постановки ПЦР. Состав реакционной смеси указан в таблице 1. В качестве положительного контроля на стадии обратной транскрипции и ПЦР используют эталонные штаммы IPN (предоставлен доктором E. Neuvonen, Ветеринарный институт, Хельсинки, Финляндия. Предварительно штамм был испытан методом ИФА), в качестве отрицательного - воду или среду для культур клеток (например, Игла MEM).

Полимеразную цепную реакцию проводят в объеме реакционной смеси 25 мкл на 1 пробу ДНК.

Состав реакционной смеси представлен в таблице 2. Температурно-временной режим проведения реакции для амплификатора «Терцик» («ДНК-технология», Россия) представлен в таблице 3. Условия амплификации и реакционной смеси для первого и второго раунда одинаковые.

После проведения реакции амплификации продукты ПЦР анализируют методом электрофоретического разделения в 2% агарозном геле с добавлением бромистого этидия.

В процессе ПЦР были получены продукты амплификации кДНК вируса инфекционного некроза поджелудочной железы размером около 860 пн в первом раунде ПЦР и 240 пн во втором раунде ПЦР, что подтверждалось во всех экспериментах. Электрофореграмма результатов ПЦР представлена на рис.1. При учете результатов ПЦР в первую очередь оценивали контрольные образцы. В электрофоретической дорожке с положительным контрольным образцом (K+) присутствовала светящаяся полоса на уровне соответствующем фрагменту длиной 860 или 240 пн (в первом и втором раунде, соответственно; оценивали по маркеру М).

Опытные пробы оценивали по наличию в соответствующей дорожке специфической полосы, которая в положительных образцах располагалась на том же уровне, что и полоса в положительной контрольной пробе. В отрицательных пробах полоса отсутствовала (рис.2).

Пример 2

Определение чувствительности реакции амплификации с использованием разработанных специфических олигонуклеотидных праймеров.

Анализировали десятикратные разведения инфицированной IPNV суспензии клеток с исходным титром 7,5 lg ТЦД50/мл. (107,5 ТЦД50/мл).

При проведении «гнездовой» ПЦР последним разведением, в котором обнаруживалась специфическая полоса, было разведение 10-7, что соответствует 0,5 lg ТЦД50/мл или ~3 ТЦД50/мл. Электрофореграмма результатов ПЦР представлена на Рисунке 2.

Пример 3

Определение специфичности реакции амплификации с использованием разработанных специфических олигонуклеотидных праймеров.

Специфичность праймеров проверяли на образцах вируса инфекционного некроза гемопоэтической ткани, вируса инфекционного некроза поджелудочной железы и вируса геморрагической септицемии лососевых. Специфическая полоса была выявлена только в случае наличия в пробе вируса инфекционного некроза поджелудочной железы.

Предложенный вариант апробирован с положительным результатом и регулярной воспроизводимостью в 2010-2011 годах на 500 пробах, полученных из гомогената внутренних органов рыб, поступивших из хозяйств Московской, Рязанской областей и республики Карелия, а также инфицированных клеточных культур.

Предлагаемое изобретение найдет применение в диагностических исследованиях в научно- исследовательских институтах, ветеринарных лабораториях, рыбоводческих хозяйствах.

Литература

1. Wiliams K., Blake S., Sweeney A., Singer J.T., Nicholson B.L. // Multiplex Reverse transcriptase PCR assay for simultaneous detection of three fish viruses // J of clinical microbiology. - 1999. - V.37 (№12). - Р.4139-4141.

2. Rimstad E., Homes E., Olsvik O., Hyllseth B. // Identification of a double-stranded RNA virus by using polymerase chain reaction and magnetic separation of the synthesized DNA segments // J of clinical microbiology - 1990 -. V.28 (№10). - Р.2275-2278.

Сущность изобретения поясняется таблицами и рисунками, в которых отображается следующая информация:

Таблица 2
Состав реакционной смеси для проведения ПЦР для 1 реакции объемом 25 мкл
Компоненты ПЦР Исходная концентрация Конечная концентрация Объем на 1 реакцию
ПЦР-смесь 2 red 2,5 х 10 мкл
дНТФ 10 µМ 0,2 µМ 0,5 мкл
«Прямой» праймер B37(B123)* 10 µМ 0,2 µМ 0,5 мкл
«Обратный» праймер B853 (B320)* 10 µМ 0,2 µМ 0,5 мкл
Вода 8,5 мкл
кДНК (матрица) 5 мкл
* в скобках указаны праймеры для второго раунда ПЦР
Таблица 3
Температурно-временной режим проведения ПЦР (прибор «Терцик», Россия)
Описание стадии Температура, °С Длительность, сек. Кол-во циклов
1 Предварительное нагревание прибора «пауза» 94 - -
2 Черничная денатурация ДНК 95 120 1
3 Денатурация ДНК 95 20 3
4 Гибридизация праймеров со специфическими участками 50 20
5 Синтез комплементарных цепей 72 50
6 Денатурация ДНК 95 20 30
7 Гибридизация праймеров со специфическими участками 58 20
8 Синтез комплементарных цепей 72 50
9 Конечный синтез комп-х цепей 72 120 1
10 Хранение 10 - -

Способ диагностики вируса инфекционного некроза поджелудочной железы лососевых методом полимеразной цепной реакции, при котором используют два прямых и два обратных олигонуклеотидных праймера для выявления фрагмента сегмента B, кодирующего РНК-зависимую РНК-полимеразу вируса инфекционного некроза поджелудочной железы следующей структуры - B37: ACGTTGGTGGCACCCGACATAC, B123: TGTCGGACATCTTCAACTCACC, B320r: CAGTCGAGGCAGAGCGGCATC, B853r: GTGTCTCCTTTGGTTTTGCCTATG, с электрофоретическим определением размера амплифицируемого фрагмента нуклеотидной последовательности, где по наличию на электрофореграмме фрагментов длиной 860 и/или 240 пн в исследуемом образце диагностируют вирус инфекционного некроза поджелудочной железы лососевых.



 

Похожие патенты:

Изобретение относится к области медицины и предназначено для прогнозирования риска развития ангиопатии нижних конечностей у больных сахарным диабетом 2-го типа. Осуществляют выделение ДНК из периферической венозной крови, проводят анализ полиморфизма -308G/A гена фактора некроза опухоли α и при выявлении аллеля -308A TNFα прогнозируют повышенный риск развития ангиопатии нижних конечностей у больных сахарным диабетом 2-го типа.

Изобретение относится к области медицины и предназначено для прогнозирования сроков наступления реактивной фазы острого панкреатита. Осуществляют выделение ДНК из периферической венозной крови, проводят анализ полиморфизма гена фактора некроза опухоли α и при выявлении генотипов -308 АА или -308 GA TNFα прогнозируют риск позднего наступления реактивной фазы острого панкреатита.
Изобретение относится к области косметики и представляет собой способ определения водостойкости антиперспиранта, включающий: a) отбор участников исследования; b) выполнение требований участниками исследования о не использовании каких-либо продуктов или использовании продуктов, не содержащих антиперспирант, в подмышечных областях в течение требуемого периода; c) очистку подмышечных областей каждого участника исследования; d) нанесение необходимого количества антиперспирантного продукта на одну подмышечную область и плацебо на другую подмышечную область каждого участника исследования; e) выполнение стадии d) до достижения необходимого числа нанесений, если выбирается более одного нанесения; f) после выполнения последнего нанесения проводят водное испытание, включающее круговое движение участников исследования в бассейне и/или плавание в течение периода времени активности в бассейне с глубиной воды, достаточной для смачивания подмышечных областей; g) проведение оценки потоотделения; и h) определение того, проявляет ли антиперспирантный продукт по меньшей мере стандартную антиперспирантную эффективность.

Изобретение относится к биотехнологии и представляет собой способ выявления мутации c.-53-2A>G в гене SLC26A5, сопровождающийся развитием несиндромальной аутосомно-рецессивной глухоты.
Изобретение относится к области медицины, в частности к прогнозированию риска раннего развития атеросклероза у больных хроническим простатитом. Сущность способа состоит в том, что в сыворотке крови больных хроническим простатитом молодой возрастной группы определяют уровень общего тестостерона, секссвязывающего глобулина с последующим расчетом индекса свободного тестостерона, а также определяют содержание липопротеидов высокой плотности, триацилглицеридов и рассчитывают коэффициент атерогенного риска по формуле.

Изобретение относится к области биотехнологии и медицины. Предложен способ диагностики предрасположенности пациента к наследственной макулодистрофии Штаргардта.

Изобретение относится к медицине, в частности к способу оценки функционального состояния эндотелия (ФСЭ) экспериментальных животных после реконструктивных операций на брюшной аорте.
Предлагаются модели на насекомых, предназначенные отображать проницаемость гематоэнцефалического барьера (ГЭБ) у млекопитающего, в частности, человека. Изобретение касается способа оценки транспорта химического соединения через ГЭБ, а также применения насекомых в скрининге веществ, обладающих биологическим действием на мозг или центральную нервную систему и/или действующих на заболевание или нарушение, затрагивающее мозг или центральную нервную систему.
Изобретение относится к педиатрии и онкогематологии и может быть использовано для прогнозирования развития нарушений функции миокарда у детей с острым лимфобластным лейкозом (ОЛЛ) на разных этапах полихимиотерапии (ПХТ).

Настоящее изобретение относится к медицине, а именно к определению ферментов в костной и хрящевой тканях при изучении регенераторных процессов, и описывает способ определения щелочной фосфатазы в костной и хрящевой тканях, включающий подготовку образцов исследуемых тканей и гистохимическое исследование срезов полученного материала, где образцы исследуемых костной и хрящевой тканей выдерживают в забуференном растворе нейтрального 10% формалина в течение 1 суток при температуре +4°C, затем обрабатывают в 0,1 М растворе фосфатного буфера сначала в 4 смены по 2 часа каждая, а после в 9 смен по часу с добавлением сахарозы постепенно возрастающей концентрации, после чего исследуемый материал погружают в реагент Tissue-Tek O.C.T.

Изобретение относится к области медицины и предназначено для прогнозирования in vitro способности популяции клеток, полученных из сустава, продуцировать стабильный гиалиновый хрящ in vivo. В популяции клеток определяют экспрессию ряда маркерных генов, включающих позитивный маркер FRZB (Frizzled-Подобный Белок 1). негативный маркер ALK1 (Рецептор Активина А, Типу II-Подобная Киназа) и один или более маркеров, выбранных из группы, состоящей из негативного маркера PEDF (Фактор, Выделенный из Пигментного Эпителия), позитивного маркера COL11 (Коллаген, Тип XI А1), позитивного маркера COL2 (Коллаген, Тип II, Альфа 1) и позитивного маркера FGFR3 (Рецептор Фактора Роста Фибробластов 3). Уровни экспрессии каждого индивидуального маркера представляют с помощью числового значения. Числовые значения комбинируют в кумулятивный показатель, где значение кумулятивного показателя указывает на способность к продукции стабильного хряща. Предлагаемое изобретение обеспечивает эффективное прогнозирование способности популяции клеток, полученных из сустава, продуцировать стабильный гиалиновый хрящ in vivo. 5 з.п. ф-лы, 4 ил., 11 табл., 5 пр.

Изобретение относится к области медицинской диагностики и может быть использовано для прогнозирования сроков формирования абсцесса в фазу секвестрации острого панкреатита и, как следствие, неблагоприятного течения заболевания. Способ прогнозирования сроков формирования абсцесса в фазу секвестрации острого панкреатита включает выделение ДНК из периферической венозной крови, анализ полиморфизма +250 A/G Ltα и при выявлении генотипов +250 GG или +250 AG Ltα прогнозируют риск раннего формирования абсцесса в фазу секвестрации острого панкреатита. 1 табл., 2 ил.

Изобретение относится к области биотехнологии и касается способа выявления O-гликозилированных белков в составе клеточных гомогенатов, подготавливаемых к протеомному и фосфопротеомному анализу. Предложенное изобретение может быть использовано для проведения протеомного и фосфопротеомного анализа. Способ включает проведение двумерного электрофореза с последующей идентификацией пятен методами спектроскопии MALDI-TOF или фосфопротеомики. Проводят обессоливание клеточных гомогенатов методом гель-хроматографии или диализа клеточных гомогенатов. Подвергают клеточные гомогенаты дегликозилированию по принципу β-элиминирования в растворе 0,05 М NaOH, который содержит 38 мг/мл NaBH4, в течение 16 часов при +45°C с последующим добавлением цианинового красителя JC-1 в концентрации 10-6 М. Инкубируют клеточные гомогенаты в течение 15 мин при комнатной температуре. Концентрируют гомогенаты осаждением 50% ацетоном, подвергают двумерному электрофорезу с образованием электрофореграмм, анализируемых на флуоресценцию при облучении на трансиллюминаторе синего цвета со светофильтром янтарного цвета, визуально проявляющуюся в виде светящихся в темноте полос. Данные полосы экстрагируют из геля и используют для проведения протеомного или фосфопротеомного анализа. Дополнительный анализ интенсивности и расположения экстрагируемых полос выполняют за счет сравнения окрашенных азотнокислым серебром электрофореграмм гомогенатов до и после процедуры дегликозилирования. Предложенное изобретение позволяет идентифицировать белки, меняющие состав или степень своего O-гликозилирования в результате какого-либо физиологического воздействия на клетку. 5 ил.
Изобретение относится к медицине, а именно к микробиологии, и может быть использовано для определения адгезии золотистого стафилококка. Для этого исследуют чистую культуру золотистого стафилококка в концентрации 1 млрд/мл. Определяют среднее количество микробов, адгезированных на одном эритроците при подсчете не менее 25 эритроцитов. При этом в качестве субстрата адгезии используют эритроциты барана в концентрации 100 млн/мл, которые предварительно отмывают 50-ти % формалина. Изобретение обеспечивает качественную и количественную экспресс-диагностику определения степени выраженности адгезивных свойств стафилококков.
Изобретение относится к медицине, а именно к кардиологии, и может быть использовано для дифференциальной диагностики вариантов поражения проводящей системы миокарда при инфекционной кардиомиопатии у детей. Для этого пациенту проводят клинический осмотр и лабораторные исследования. Выполняют электрокардиографическое исследование. Проводят исследование крови, определяют антикардиальные антитела - АКАТ к антигенам отдельных структур сердца, по превышению титров которых относительно нормы определяют наличие воспалительного процесса в соответствующих структурах миокарда. При выявлении на ЭКГ нарушения ритма на фоне повышения значения титра АКАТ к проводящей системе миокарда диагностируют вариант поражения проводящей системы миокарда в виде нарушения ритма. При выявлении на ЭКГ нарушения проводимости на фоне повышения значения титров АКАТ к проводящей системе миокарда к кардиомиоцитам диагностируют вариант поражения проводящей системы миокарда в виде нарушения проводимости. При выявлении на ЭКГ изменения положения ST-T линии выше или ниже изолинии и повышении значения титров АКАТ к кардиомиоцитам диагностируют вариант поражения проводящей системы миокарда в виде нарушения реполяризации желудочков сердца. Изобретение позволяет на ранних стадиях заболевания провести адекватную терапию и предупредить развитие жизнеугрожающих осложнений. 3 пр.
Изобретение относится к области медицины и предназначено для прогнозирования риска развития бронхиальной астмы. Осуществляют выделение ДНК из лимфоцитов периферической венозной крови больного. Проводят генотипирование полиморфных вариантов rs7216389 гена гасдермина В (GSDMB), rs12342831 гена бета 1,4-галактозилтрансферазы 1 (B4GALT1) и rsl496499 гена белка 3, связывающего инсулиноподобные факторы роста (IGFBP3). При выявлении одного из сочетаний генотипов по трем полиморфным локусам генов: GSDMB*rs7216389C/T-B4GALT1*rs12342831T/Т-IGFBP3*rs1496499T/G; GSDMB*rs7216389T/T-B4GALT1*rs12342831T/Т-IGFBP3*rs1496499T/G; GSDMB*rs7216389T/Т-B4GALT1*rs12342831T/Т-IGFBP3*rs1496499T/T, прогнозируют риск развития бронхиальной астмы у индивидов различной этнической принадлежности. Изобретение обеспечивает эффективный способ прогнозирования риска развития бронхиальной астмы и способствует разработке профилактических мероприятий с учетом индивидуальных особенностей каждого больного. 1 табл., 2 пр.

Изобретение относится к области биотехнологии и медицины. Представлен способ, основанный на измерении в вагинальных соскобах уровня экспрессии мРНК генов интерлейкинов IL1B, IL8, IL10 и IL18 относительно представленности мРНК референсных генов B2M, GUS, TBP или HPRT; на основании полученных уровней экспрессии вычисляется значение канонической линейной дискриминантной функции (КЛДФ) следующим образом: Y=1,09*IL1B-0,61*IL8+0,21*IL10-0,11*IL18-0,91 (формула 1), где IL1B - относительный уровень экспрессии IL1B, IL8 - относительный уровень экспрессии IL8, IL10 - относительный уровень экспрессии IL10, IL18 - относительный уровень экспрессии IL18; IL=2^(Cpmin-Cpil)/NF (формула 2), где IL - относительный уровень экспрессии гена интерлейкина, Cpmin - коэффициент минимального значения уровня экспрессии, для IL1B Cpmin=17,9; IL8 Cpmin=16,6; IL10 Cpmin=28,8; IL18 Cpmin=23,3; Cpil - значение порогового цикла соответствующего IL в образце, определяемого автоматически; NF - фактор нормировки, вычисляется по формуле 3: (формула 3), где NF - фактор нормировки, вычисляемый как среднее геометрическое 4 факторов нормировки для референсных генов (см. формулу 4); NFref=2^(Cpmin-Cpref) (формула 4), где NFref - фактор нормировки для референсного гена, Cpmin - коэффициент минимального значения уровня экспрессии референсного гена, Cpref - показания прибора порогового значения в образце; значения Cpmin для референсных генов следующие: GUS Cpmin=26,5; HPRT Cpmin=26,8; B2M Cpmin=18,9; ТВР Cpmin=28,4; при этом, если значение КЛДФ≤0,1, делается заключение об отсутствии вагинита, значения КЛДФ>0,1 соответствуют вагиниту. Изобретение позволяет объективно выявить наличие вагинита у беременной женщины. 1 з.п. ф-лы, 1 ил., 3 табл., 3 пр.
Изобретение относится к медицине. Сущность способа определения липидов заключается в том, что к 10 мл хлороформного экстракта липидов добавляют 25 мкл 10% раствора тезита при одновременном перемешивании смеси с помощью шейкера при 20°C и частоте колебаний платформы 120 в минуту в течение 30 минут получают прозрачный раствор липидов для ферментативного определения триацилглицеридов. Способ позволяет повысить эффективность и точность определения липидов тканей. 1 табл.
Изобретение относится к области медицины, в частности к неврологии, и может быть использовано для выявления развития гиперплазии неоинтимы и рестеноза сонных артерий после ангиореконструктивных операций на них у больных с прогрессирующим церебральным атеросклерозом без использования ангиовизуализации. Больному с прогрессирующим церебральным атеросклерозом после проведения ангиореконструктивных операций на сонных артериях не более чем через 6 месяцев иммуноферментным методом определяют в сыворотке крови содержание биомаркера липопротеин-ассоциированной фосфолипазы A2 (Lp-PLA2) и при значении его уровня 360 нг/мл и более выявляют развитие гиперплазии неоинтимы и рестеноза в оперированной сонной артерии. Способ обеспечивает высокую точность выявления развития гиперплазии неоинтимы и рестеноза у больных с прогрессирующим церебральным атеросклерозом после ангиореконструктивных операций на сонных артериях.

Изобретение относится к области медицины, в частности к способам лабораторной диагностики негативного воздействия формальдегида на нарушение конъюгационной и элиминационной функций глутатионовой системы у детей, проживающих на территории, характеризующейся повышенным содержанием данного соединения в атмосферном воздухе. Способ заключается в следующем: производят отбор пробы крови у детей, определяют в цельной крови содержание формальдегида, а также определяют в сыворотке крови активность следующих лабораторных показателей: глутатионпероксидазы, глутатион-S-трансферазы и глюкозо-6-фосфатдегидрогеназы. Затем устанавливают корреляционную зависимость между содержанием формальдегида в крови и указанными лабораторными показателями. При одновременном установлении достоверных зависимостей: повышенное содержание формальдегида - пониженная активность глутатионпероксидазы, глюкозо-6-фосфатдегидрогеназы и повышенная активность глутатион-S-трансферазы - судят о негативном воздействии формальдегида на осуществление конъюгационной и элиминационной функции глутатионовой системы детского организма. Способ обеспечивает возможность на ранней стадии прогнозировать нарушение конъюгационной и элиминационной функции глутатионовой системы. 1 табл., 1 пр.
Наверх